DOCSLIB.ORG

Participation of Autophagy in the Cytotoxicity Against Breast Cancer Cells by Cisplatin

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Participation of Autophagy in the Cytotoxicity Against Breast Cancer Cells by Cisplatin ONCOLOGY REPORTS 34: 359-367, 2015 Participation of autophagy in the cytotoxicity against breast cancer cells by cisplatin MENG SHEN1*, WEI-MING DUAN1*, MENG-YAO WU1, WEN-JIE WANG1, LU LIU1, MENG-DAN XU1, JIE ZHU1, DAO-MING LI1, QI GUI1, LIAN LIAN1,2, FEI-RAN GONG3, KAI CHEN1, WEI LI1 and MIN TAO1,4 1Department of Oncology, The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu 215006; 2Department of Oncology, Suzhou Xiangcheng People's Hospital, Suzhou, Jiangsu 215131; 3Department of Hematology, The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu 215006; 4Jiangsu Institute of Clinical Immunology, Suzhou, Jiangsu 215006, P.R. China Received February 11, 2015; Accepted April 30, 2015 DOI: 10.3892/or.2015.4005 Abstract. Breast cancer is one of the most common cancers and ULK1, indicating that cisplatin induced autophagy affecting women worldwide. Conventional chemotherapy is through a multiple mechanism involved manner. still one of the major approaches to the treatment of breast cancer. Autophagy, also termed as type II programmed cell Introduction death (PCD), exhibits either a protumorigenic or antitumori- genic function. In the present study, we investigated whether Breast cancer is one of the most common cancers affecting autophagy could be involved in the effect of chemotherapy women worldwide, accounting for almost 23% of all cancers against breast cancer. Epirubicin, docetaxel, methotrexate, diagnosed in women (1-2). Although early detection, precise cyclophosphamide, fluorouracil (5-FU) and cisplatin were resection using wide margins and systematic adjuvant therapy applied in the present investigation. All of these chemo- have improved survival, breast cancer remains one of the therapeutics presented cytotoxicity against breast cancer cells. leading causes of death among women (3). Conventional DsRed-LC3 reporter assay revealed that only docetaxel and chemotherapy is still one of the major approaches to the cisplatin induced autophagy. Autophagy inhibitor 3-methylad- treatment of breast cancer, particularly for cases of breast enine (3-MA) strengthened the cytotoxicity of docetaxel, yet cancer in stages 2-4, and is particularly beneficial in estrogen impaired the cytotoxicity of cisplatin, suggesting that docetaxel receptor-negative (ER-) disease (4). Most chemotherapy medi- stimulates protumorigenic autophagy, while cisplatin-induced cations work by destroying fast-growing and/or fast-replicating autophagy could be antitumorigenic. Real-time PCR revealed cancer cells, either by causing DNA damage upon replication that cisplatin upregulated multiple autophagy-related genes, or by other mechanisms. including AMBRA1, ATG3, ATG4C, ATG4D, ATG5, ATG7, Autophagy, also termed as type II programmed cell death ATG13, ATG14, ATG16L2, Beclin1, DRAM1, GABARAP, (PCD), is a genetically programmed, evolutionarily conserved GABARAPL1, GABARAPL2, HDAC6, IRGM, MAP1LC3B process that degrades long-living cellular proteins and organ- elles, including the endoplasmic reticulum, Golgi apparatus and mitochondria (5). Autophagy is important in the normal development and cellular response to environmental stimuli. Correspondence to: Dr Wei Li or Dr Kai Chen, Department of In addition, autophagy participates in numerous diseases, Oncology, The First Affiliated Hospital of Soochow University, including bacterial and viral infections, neurodegenerative Suzhou, Jiangsu 215006, P.R. China disorders, cardiovascular diseases and cancers (5). Autophagy E-mail: [email protected] exhibits either a protumorigenic or antitumorigenic function, E-mail: [email protected] depending on the cell type, developmental stage of cancer and stimulator. Mechanistically, autophagy begins with seques- * Contributed equally tering cytoplasmic proteins or organelles in a membrane vacuole to form an autophagosome. Autophagosome Abbreviations: PCD, programmed cell death; DOC, docetaxel; formation is mediated by a set of evolutionarily conserved MTX, methotrexate; CTX, cyclophosphamide; 5-FU, fluorouracil; DDP, cisplatin; ER, estrogen receptor; ATG protein, autophagy- autophagy-related proteins (ATG proteins) (6). Previously, we related protein; 3-MA, 3-methyladenine; MTT, methyl thiazolyl demonstrated that stimulation of autophagy could be a poten- tetrazolium; DMSO, dimethyl sulfoxide; PI, propidium iodide; SD, tial strategy for the treatment of breast cancer (5). standard deviation; PI3P, phosphatidylinositol-3-phosphate; PE, In the present study, we investigated whether autophagy phosphatidylethanolamine could be involved in chemotherapy against breast cancer and whether this participation could be protumorigenic or antitu- Key words: autophagy, chemotherapy, cisplatin, breast cancer morigenic. Moreover, mechanisms involved in this autophagic cell death by chemotherapeutics were also investigated. 360 shen et al: Cisplatin induces autophagic cell death Table I. Primers. Product size Genes Sense (5'-3') Antisense (3'-5') (bp) AMBRA1 TCGGCAACAACATCATCGTC CTGGGAAGGGAAACAGGAAT 253 ATG3 ACTGATGCTGGCGGTGAAG GTGGCAGATGAGGGTGATTTT 208 ATG4A GGGATGTATGCTACGCTGTGG CACCCATTTGTGCCATTTGAT 182 ATG4B TAGGCCGAGATTGGAGGTG GCGCTATCTGGTGAATGGAGT 114 ATG4C TTTCCCTCTTGAGACATTCCAC GGTGATTTCTTCAGAAGCTCGTTT 130 ATG4D AGCCGAGTGGAAGTCTGTGGT AGCAGGAAGTCATCTTGGTAGCC 177 ATG5 ATCAGGTTTGGTGGAGGCA GGTTTAATGATGGCAGTGGAGG 140 ATG7 CCAAGGTCAAAGGACGAAGAT GTACGGTCACGGAAGCAAAC 156 ATG9A CCTTACCTCACCCGCAGTTC GGCAGCAAAGTATTTCCATCC 241 ATG9B CAGCCGAACACCAAAGTCAT GCTTCCCTTCCCTCTGTAAATC 239 ATG10 ACACTATTACGCAACAGGAACATC CTCAGAGGTAGATTCAGCCCAAC 184 ATG12 ACCCATTGCTCCTACTTGTTACTAT TTTCTGCCTGGTGGACTGC 256 ATG13 TGTCATTGCTGCTGAAGTCCC CCCACTGTCCCAACACGAACT 169 ATG14 GTGAGCCGAGATTGTGCCAT GGTAATAATGCCTGTTAGGACTCTTTC 267 ATG16L1 GGGATTTCTGAAGATTTGACTGAG ACCGACTTTGGAAGGACGAG 248 ATG16L2 ACCGGACAGTGAAGGAGTGG GGATCTTCTGGTCATTGTGGC 129 Beclin1 GCTGGATGATGAGCTGAAGAGT GTGCCAGATGTGGAAGGTTG 109 DRAM1 TCGTCAGCCGCCTTCATTAT CGAAACATCCCACCAATCC 262 GABARAP TCAAACACCACCTCCCTTATTC TGCCAACTCCACCATTACCC 94 GABARAPL1 GCCTGATCTGGACAAGAGGAAGT ATGGTAGCACTGGTGGGAGG 150 GABARAPL2 GTTGACATTGACAAACGGAAGTAC CATAGTTAGGCTGGACTGTGGG 150 HDAC6 CATCCGAACTCATACTCCTGTGC TAAGACTGTGCTGGGCGTGAT 136 IRGM CTTGCTGCTGCTCATTCTTTG CGAGTCTGGAGTTGTTCGTTTC 133 LAMP1 ACAACACGACGGTGACAAGG TTCATCCCGAACTGGAAGAGC 136 MAP1LC3B CGCATTTGCCATCACAGTTG TAGGAGTCAGGGACCTTCAGC 94 RAB24 CAGAAAGTGGCAGAGGATTACG TGACTACCCAAGCCCAGAAAG 199 RGS19 ATCTACACGCTCATGCACCG GACAACAACACCTGAAGGGAAC 175 ULK1 CAGCAAAGGCATCATCCACC GAAGCCGAAGTCAGCGATC 115 WIPI1 CTACCAACTACCTCCCTACCCAG TGTCCACTGGATGACGCAAC 154 Materials and methods Nanjing Pharmaceutical Factory Co., Ltd. (Nanjing, Jiangsu, China). Cell line and cultures. The human breast cancer cell lines MDA-MB-231 and MDA-MB-453 were purchased from the MTT assay. Cellular growth was evaluated by methyl thiazolyl American Type Culture Collection (ATCC; Manassas, VA, tetrazolium (MTT) assay (7). Cells were seeded into 24-well USA). Cells were maintained in RPMI-1640 medium, supple- tissue culture plates at 5x104 cells/well. After treatment, MTT mented with 10% fetal calf serum (both from Gibco, Grand (Sigma, St. Louis, MO, USA) was added to each well to a Island, NY, USA), 100 U/ml penicillin and 100 mg/ml strep- final concentration of 0.5 mg/ml, followed by incubation at tomycin. The cultures were incubated at 37˚C in a humidified 37˚C for 4 h. The medium was then removed, and 800 µl of atmosphere with 5% CO2. Cells were passaged every 2-3 days dimethylsulfoxide (DMSO) was added/well. The absorbance to obtain exponential growth. in each well was measured at 490 nm using a microplate ELISA reader (Bio-Rad Laboratories, Hercules, CA, USA). Reagents. 3-Methyladenine (3-MA) was purchased from The inhibition rate was calculated as follows: Inhibition Sigma (St. Louis, MO, USA). Epirubicin was purchased rate = [(mean control absorbance - mean experimental absor- from Pfizer (Shanghai, China). Docetaxel and methotrexate bance)/mean control absorbance] x 100 (%). The concentration (MTX) were purchased from Jiangsu Hengrui Medicine Co., that caused 50% growth inhibition (IC50) was calculated by Ltd. (Liangyungang, Jiangsu, China). Cyclophosphamide the modified Kärber's method (7) according to the formula: -1 (CTX) was purchased from Baxter Oncology GmbH IC50 = lg [Xk-i (Σp - 0.5)], in which Xk represents the loga- (Kantstrasse, Halle, Germany). Fluorouracil (5-FU) was rithm of the highest drug concentration; i, is that of the ratio of purchased from Shanghai Xudong Haipu Pharmaceutical the adjacent concentration; and Σp, is the sum of the percentage Co., Ltd. (Shanghai, China). Cisplatin was purchased from of growth inhibition at various concentrations. ONCOLOGY REPORTS 34: 359-367, 2015 361 Figure 1. Cytotoxicity of epirubicin (EPI), docetaxel (DOC), methotrexate (MTX), cyclophosphamide (CTX), fluorouracil (5-FU) and cisplatin (DDP) on (A) MDA-MB-231 and (B) MDA-MB-453 breast cancer cells. *P<0.05, **P<0.01 indicate significant difference from the respective control group. Autophagy assay using the DsRed-LC3 reporter. Autophagy manufacturer's protocol. After spectrophotometric quantifica- is dependent on the presence of autophagosomes and autoly- tion, 1 µg total RNA in a final volume of 20 µl was used for sosomes (8). LC3, the mammalian ontology of ATG8, is a reverse transcription with PrimeScript RT reagent kit (Takara, credible marker for autophagosomes (9). During the formation Otsu, Shiga, Japan) according to the manufacturer's protocol. of autophagosomes, LC3 will form punctate structures within Aliquots
Load more

Recommended publications
  • Combination of Cabazitaxel and Plicamycin Induces Cell Death in Drug Resistant B-Cell Acute Lymphoblastic Leukemia
    Clinical and Translational Science Institute Centers 9-1-2018 Combination of cabazitaxel and plicamycin induces cell death in drug resistant B-cell acute lymphoblastic leukemia Rajesh R. Nair West Virginia University Debbie Piktel West Virginia University Werner J. Geldenhuys West Virginia University Laura F. Gibson West Virginia University Follow this and additional works at: https://researchrepository.wvu.edu/ctsi Part of the Medicine and Health Sciences Commons Digital Commons Citation Nair, Rajesh R.; Piktel, Debbie; Geldenhuys, Werner J.; and Gibson, Laura F., "Combination of cabazitaxel and plicamycin induces cell death in drug resistant B-cell acute lymphoblastic leukemia" (2018). Clinical and Translational Science Institute. 34. https://researchrepository.wvu.edu/ctsi/34 This Article is brought to you for free and open access by the Centers at The Research Repository @ WVU. It has been accepted for inclusion in Clinical and Translational Science Institute by an authorized administrator of The Research Repository @ WVU. For more information, please contact [email protected]. HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Leuk Res Manuscript Author . Author manuscript; Manuscript Author available in PMC 2019 September 01. Published in final edited form as: Leuk Res. 2018 September ; 72: 59–66. doi:10.1016/j.leukres.2018.08.002. Combination of cabazitaxel and plicamycin induces cell death in drug resistant B-cell acute lymphoblastic leukemia Rajesh R. Naira, Debbie Piktelb, Werner J. Geldenhuysc,
    [Show full text]
  • Sensing and Relayaing of the Autophagic Signal by the ULK1
    SENSING AND RELAYING THE AUTOPHAGIC SIGNAL BY THE ULK1 KINASE COMPLEX by Cindy Puente A Dissertation Presented to the Faculty of the Louis V. Gerstner, Jr. Graduate School of Biomedical Sciences, Memorial Sloan-Kettering Cancer Center in Partial Fulfillment of the Requirement for the Degree of Doctor of Philosophy New York, NY May, 2016 __________________________ __________________________ Xuejun Jiang, PhD Date Dissertation Mentor Copyright © 2016 by Cindy Puente To my husband, son, family and friends for their indefinite love and support iii ABSTRACT Autophagy is a conserved catabolic process that utilizes a defined series of membrane trafficking events to generate a double-membrane vesicle termed the autophagosome, which matures by fusing to the lysosome. Subsequently, the lysosome facilitates the degradation and recycling of the cytoplasmic cargo. Autophagy plays a vital role in maintaining cellular homeostasis, especially under stressful conditions, such as nutrient starvation. As such, it is implicated in a plethora of human diseases, particularly age-related conditions such as neurodegenerative disorders. The long-term goals of this proposal were to understand the upstream molecular mechanisms that regulate the induction of mammalian autophagy and understand how this signal is transduced to the downstream, core machinery of the pathway. In yeast, the upstream signals that modulate the induction of starvation- induced autophagy are clearly defined. The nutrient-sensing kinase Tor inhibits the activation of autophagy by regulating the formation of the Atg1-Atg13-Atg17 complex, through hyper-phosphorylation of Atg13. However, in mammals, the homologous complex ULK1-ATG13-FIP200 is constitutively formed. As such, the molecular mechanism by which mTOR regulates mammalian autophagy is unknown.
    [Show full text]
  • Consumer Medicine Information
    DBL™ Docetaxel Concentrated Injection docetaxel Consumer Medicine Information What is in this leaflet It works by stopping cells from • wheezing or difficulty breathing growing and multiplying. or a tight feeling in your chest This leaflet answers some common Ask your doctor if you have any • swelling of the face, lips, tongue questions about DBL Docetaxel, questions about why this medicine or other parts of the body Concentrated Injection. has been prescribed for you. • rash, itching, hives or flushed, red It does not contain all the available Your doctor may have prescribed it skin information. It does not take the for another reason. • dizziness or light-headedness place of talking to your doctor or This medicine is not addictive. • back pain pharmacist. This medicine is available only with Do not use DBL Docetaxel, All medicines have risks and a doctor’s prescription. benefits. Your doctor has weighed Concentrated Injection if you have, You may have taken another the risks of you taking DBL or have had, any of the following Docetaxel, Concentrated Injection medicine to treat your breast, non medical conditions: small cell lung cancer, ovarian, against the benefits they expect it • severe liver problems prostate or head and neck cancer. will have for you. • blood disorder with a reduced However, your doctor has now number of white blood cells If you have any concerns about decided to treat you with docetaxel. taking this medicine, ask your There is not enough information to Do not use this medicine if you are doctor or pharmacist. recommend the use of this medicine pregnant or intend to become Keep this leaflet with the medicine.
    [Show full text]
  • Coxsackievirus Infection Induces a Non-Canonical Autophagy Independent of the ULK and PI3K Complexes
    www.nature.com/scientificreports OPEN Coxsackievirus infection induces a non‑canonical autophagy independent of the ULK and PI3K complexes Yasir Mohamud1,2, Junyan Shi1,2, Hui Tang1,3, Pinhao Xiang1,2, Yuan Chao Xue1,2, Huitao Liu1,2, Chen Seng Ng1,2 & Honglin Luo1,2* Coxsackievirus B3 (CVB3) is a single‑stranded positive RNA virus that usurps cellular machinery, including the evolutionarily anti‑viral autophagy pathway, for productive infections. Despite the emergence of double‑membraned autophagosome‑like vesicles during CVB3 infection, very little is known about the mechanism of autophagy initiation. In this study, we investigated the role of established autophagy factors in the initiation of CVB3‑induced autophagy. Using siRNA‑mediated gene‑silencing and CRISPR‑Cas9‑based gene‑editing in culture cells, we discovered that CVB3 bypasses the ULK1/2 and PI3K complexes to trigger autophagy. Moreover, we found that CVB3‑ induced LC3 lipidation occurred independent of WIPI2 and the transmembrane protein ATG9 but required components of the late‑stage ubiquitin‑like ATG conjugation system including ATG5 and ATG16L1. Remarkably, we showed the canonical autophagy factor ULK1 was cleaved through the catalytic activity of the viral proteinase 3C. Mutagenesis experiments identifed the cleavage site of ULK1 after Q524, which separates its N‑terminal kinase domain from C‑terminal substrate binding domain. Finally, we uncovered PI4KIIIβ (a PI4P kinase), but not PI3P or PI5P kinases as requisites for CVB3‑induced LC3 lipidation. Taken together, our studies reveal that CVB3 initiates a non‑canonical form of autophagy that bypasses ULK1/2 and PI3K signaling pathways to ultimately converge on PI4KIIIβ‑ and ATG5–ATG12–ATG16L1 machinery.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Functional Characterization of Epilepsy Associated GABRG2 Mutations
    Functional Characterization of Epilepsy Associated GABRG2 Mutations By Mengnan Tian Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in Partial Fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Pharmacology August, 2012 Nashville, Tennessee Approved: Robert L. Macdonald, M.D., Ph.D. Ronald Emeson, Ph.D. Kevin Ess, M.D., Ph.D. Katherine T. Murray, M.D. Douglas P. Mortlock, Ph.D. To my grandparents, Yunbo Tian and Zhenhua Cao. ii Acknowledgements Throughout my years pursuing Ph.D. degree, I have always been grateful for the opportunity working with an amazing complement of scientists. I would like to express my sincerest gratitude to my thesis advisor Dr. Robert Macdonald. He is by far the best mentor that I could have ever wished. He has provided me with excellent guidance and support, and given me the confidence to develop into an independent scientist. He granted me unprecedented freedom to explore new scientific fields and implement novel research strategies and techniques. I greatly appreciate all his trust in me, and it has fostered my confidence in performing researches. He has shown me, by his example, what a good scientist and mentor should be. I would like to thank my colleagues and collaborators in Macdonald lab. I have been collaborating with Xuan Huang since her rotation and after she joined our lab in 2009. We have also become good friends. She has made important contributions to many parts of my thesis studies, and provided brilliant critiques to help me improve the research plan. I am also deeply indebted to Dr.
    [Show full text]
  • 12Q Deletions FTNW
    12q deletions rarechromo.org What is a 12q deletion? A deletion from chromosome 12q is a rare genetic condition in which a part of one of the body’s 46 chromosomes is missing. When material is missing from a chromosome, it is called a deletion. What are chromosomes? Chromosomes are the structures in each of the body’s cells that carry genetic information telling the body how to develop and function. They come in pairs, one from each parent, and are numbered 1 to 22 approximately from largest to smallest. Additionally there is a pair of sex chromosomes, two named X in females, and one X and another named Y in males. Each chromosome has a short (p) arm and a long (q) arm. Looking at chromosome 12 Chromosome analysis You can’t see chromosomes with the naked eye, but if you stain and magnify them many hundreds of times under a microscope, you can see that each one has a distinctive pattern of light and dark bands. In the diagram of the long arm of chromosome 12 on page 3 you can see the bands are numbered outwards starting from the point at the top of the diagram where the short and long arms meet (the centromere). Molecular techniques If you magnify chromosome 12 about 850 times, a small piece may be visibly missing. But sometimes the missing piece is so tiny that the chromosome looks normal through a microscope. The missing section can then only be found using more sensitive molecular techniques such as FISH (fluorescence in situ hybridisation, a technique that reveals the chromosomes in fluorescent colour), MLPA (multiplex ligation-dependent probe amplification) and/or array-CGH (microarrays), a technique that shows gains and losses of tiny amounts of DNA throughout all the chromosomes.
    [Show full text]
  • Exploring Autophagy with Gene Ontology
    Autophagy ISSN: 1554-8627 (Print) 1554-8635 (Online) Journal homepage: https://www.tandfonline.com/loi/kaup20 Exploring autophagy with Gene Ontology Paul Denny, Marc Feuermann, David P. Hill, Ruth C. Lovering, Helene Plun- Favreau & Paola Roncaglia To cite this article: Paul Denny, Marc Feuermann, David P. Hill, Ruth C. Lovering, Helene Plun- Favreau & Paola Roncaglia (2018) Exploring autophagy with Gene Ontology, Autophagy, 14:3, 419-436, DOI: 10.1080/15548627.2017.1415189 To link to this article: https://doi.org/10.1080/15548627.2017.1415189 © 2018 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. View supplementary material Published online: 17 Feb 2018. Submit your article to this journal Article views: 1097 View Crossmark data Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=kaup20 AUTOPHAGY, 2018 VOL. 14, NO. 3, 419–436 https://doi.org/10.1080/15548627.2017.1415189 RESEARCH PAPER - BASIC SCIENCE Exploring autophagy with Gene Ontology Paul Denny a,†,§, Marc Feuermann b,§, David P. Hill c,f,§, Ruth C. Lovering a,§, Helene Plun-Favreau d and Paola Roncaglia e,f,§ aFunctional Gene Annotation, Institute of Cardiovascular Science, University College London, London, UK; bSIB Swiss Institute of Bioinformatics, Geneva, Switzerland; cThe Jackson Laboratory, Bar Harbor, ME, USA; dDepartment of Molecular Neuroscience, UCL Institute of Neurology, London, UK; eEuropean Bioinformatics Institute (EMBL-EBI), European Molecular Biology Laboratory, Wellcome Genome Campus, Hinxton, Cambridge, UK; fThe Gene Ontology Consortium ABSTRACT ARTICLE HISTORY Autophagy is a fundamental cellular process that is well conserved among eukaryotes. It is one of the Received 18 May 2017 strategies that cells use to catabolize substances in a controlled way.
    [Show full text]
  • On ATG4B As Drug Target for Treatment of Solid Tumours—The Knowns and the Unknowns
    cells Review On ATG4B as Drug Target for Treatment of Solid Tumours—The Knowns and the Unknowns Alexander Agrotis and Robin Ketteler * MRC Laboratory for Molecular Cell Biology, University College London, London WC1E 6BT, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-(0)20-7679-4063 Received: 3 December 2019; Accepted: 19 December 2019; Published: 24 December 2019 Abstract: Autophagy is an evolutionary conserved stress survival pathway that has been shown to play an important role in the initiation, progression, and metastasis of multiple cancers; however, little progress has been made to date in translation of basic research to clinical application. This is partially due to an incomplete understanding of the role of autophagy in the different stages of cancer, and also to an incomplete assessment of potential drug targets in the autophagy pathway. While drug discovery efforts are on-going to target enzymes involved in the initiation phase of the autophagosome, e.g., unc51-like autophagy activating kinase (ULK)1/2, vacuolar protein sorting 34 (Vps34), and autophagy-related (ATG)7, we propose that the cysteine protease ATG4B is a bona fide drug target for the development of anti-cancer treatments. In this review, we highlight some of the recent advances in our understanding of the role of ATG4B in autophagy and its relevance to cancer, and perform a critical evaluation of ATG4B as a druggable cancer target. Keywords: autophagy; ATG4; pancreatic ductal adenocarcinoma (PDAC); drug screening; small molecule compound; screening assay; biomarker 1. Introduction Autophagy is a cellular stress response that has been identified as a target pathway for intervention in various diseases such as neuro-degenerative disorders, pathogen infection, and various types of cancer [1].
    [Show full text]
  • Regulation of ULK1 in Autophagy 2012 Stefan Ludwik Loska
    Regulation of ULK1 in autophagy A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Life Sciences 2012 Stefan Ludwik Loska Table of Contents List of Figures...................................................................................................................6 Abstract.............................................................................................................................8 Declaration........................................................................................................................9 Copyright statement........................................................................................................10 Acknowledgements.........................................................................................................11 Autobiographical statement............................................................................................12 Abbreviations..................................................................................................................13 1. Introduction................................................................................................................19 1.1. Autophagy...........................................................................................................19 1.1.1. Role.............................................................................................................19 1.1.2. Mechanism..................................................................................................23
    [Show full text]
  • Network Organization of the Human Autophagy System
    Vol 466 | 1 July 2010 | doi:10.1038/nature09204 ARTICLES Network organization of the human autophagy system Christian Behrends1, Mathew E. Sowa1, Steven P. Gygi2 & J. Wade Harper1 Autophagy, the process by which proteins and organelles are sequestered in autophagosomal vesicles and delivered to the lysosome/vacuole for degradation, provides a primary route for turnover of stable and defective cellular proteins. Defects in this system are linked with numerous human diseases. Although conserved protein kinase, lipid kinase and ubiquitin-like protein conjugation subnetworks controlling autophagosome formation and cargo recruitment have been defined, our understanding of the global organization of this system is limited. Here we report a proteomic analysis of the autophagy interaction network in human cells under conditions of ongoing (basal) autophagy, revealing a network of 751 interactions among 409 candidate interacting proteins with extensive connectivity among subnetworks. Many new autophagy interaction network components have roles in vesicle trafficking, protein or lipid phosphorylation and protein ubiquitination, and affect autophagosome number or flux when depleted by RNA interference. The six ATG8 orthologues in humans (MAP1LC3/GABARAP proteins) interact with a cohort of 67 proteins, with extensive binding partner overlap between family members, and frequent involvement of a conserved surface on ATG8 proteins known to interact with LC3-interacting regions in partner proteins. These studies provide a global view of the mammalian autophagy interaction landscape and a resource for mechanistic analysis of this critical protein homeostasis pathway. Protein homeostasis in eukaryotes is controlled by proteasomal turn- promote incorporation of Atg8p--PE into autophagosomes, allowing over of unstable proteins via the ubiquitin system and lysosomal turn- Atg8p to promote autophagosome closure and cargo recruitment.
    [Show full text]
  • ER-Targeted Beclin 1 Supports Autophagosome Biogenesis in the Absence of ULK1 and ULK2 Kinases
    cells Article ER-Targeted Beclin 1 Supports Autophagosome Biogenesis in the Absence of ULK1 and ULK2 Kinases Tahira Anwar 1, Xiaonan Liu 2 , Taina Suntio 3, Annika Marjamäki 1, Joanna Biazik 1, Edmond Y. W. Chan 4,5, Markku Varjosalo 2 and Eeva-Liisa Eskelinen 1,6,* 1 Molecular and Integrative Biosciences Research Programme, University of Helsinki, 00014 Helsinki, Finland; tahira.anwar@helsinki.fi (T.A.); [email protected] (A.M.); [email protected] (J.B.) 2 Institute of Biotechnology & HiLIFE, University of Helsinki, 00014 Helsinki, Finland; xiaonan.liu@helsinki.fi (X.L.); markku.varjosalo@helsinki.fi (M.V.) 3 Institute of Biotechnology, University of Helsinki, 00014 Helsinki, Finland; taina.suntio@helsinki.fi 4 Department of Biomedical and Molecular Sciences and Department of Pathology and Molecular Medicine, Queen’s University, Kingston, ON K7L 3N6, Canada; [email protected] 5 Strathclyde Institute of Pharmacy and Biomedical Sciences, University of Strathclyde, Glasgow G4 0RE, UK 6 Institute of Biomedicine, University of Turku, 20520 Turku, Finland * Correspondence: eeva-liisa.eskelinen@utu.fi; Tel.: +358-505115631 Received: 24 April 2019; Accepted: 15 May 2019; Published: 17 May 2019 Abstract: Autophagy transports cytoplasmic material and organelles to lysosomes for degradation and recycling. Beclin 1 forms a complex with several other autophagy proteins and functions in the initiation phase of autophagy, but the exact role of Beclin 1 subcellular localization in autophagy initiation is still unclear. In order to elucidate the role of Beclin 1 localization in autophagosome biogenesis, we generated constructs that target Beclin 1 to the endoplasmic reticulum (ER) or mitochondria. Our results confirmed the proper organelle-specific targeting of the engineered Beclin 1 constructs, and the proper formation of autophagy-regulatory Beclin 1 complexes.
    [Show full text]