Regulation of ULK1 in Autophagy 2012 Stefan Ludwik Loska

Regulation of ULK1 in autophagy

A thesis submitted to the University of Manchester for the degree of

Doctor of Philosophy

in the Faculty of Life Sciences

2012

Stefan Ludwik Loska

Table of Contents

List of Figures...... 6 Abstract...... 8 Declaration...... 9 Copyright statement...... 10 Acknowledgements...... 11 Autobiographical statement...... 12 Abbreviations...... 13 1. Introduction...... 19 1.1. Autophagy...... 19 1.1.1. Role...... 19 1.1.2. Mechanism...... 23 1.1.3. Molecular machinery of autophagy...... 25 1.1.4. Initiation...... 27 1.1.5. Nucleation...... 28 1.1.6. Expansion and closure...... 30 1.1.7. Maturation...... 33 1.2. ULK1...... 35 1.2.1. Domain architecture of ULK1...... 35 1.2.2. Function of ULK1 in axon formation...... 38 1.2.3. Function of ULK1 in autophagy...... 41 1.2.4. ULK1 complex...... 47 1.2.5. Upstream regulation of ULK1...... 50 1.2.5.1. mTOR signalling...... 50 1.2.5.2. Role of mTOR and AMPK in regulation of ULK1...... 54 1.3. Conclusions and aims of the project...... 61 2. Materials and Methods...... 65 2.1. DNA Constructs...... 65 2.1.1. Introducing TEV site into pAc5.1/V5-HisB...... 65 2.1.2. pAc5.1/V5-TEV-HisB-ULK1 and mutants...... 65 2.1.3. pDEST-HisMBP-ULK1 1-278 K46N...... 67

2.1.4. pcDNA3-myc-ULK1...... 68 2.1.5. pEF-myc-B-RAF D594A...... 68 2.1.6. pET28a-LIC-MERTK-571-864wt and K619N...... 68 2.1.7. pc5FLAG-Pim1 wt and K67M...... 69 2.2. Buffers...... 69 2.2.1. SDS-PAGE and western blotting...... 69 2.2.2. Protein purification...... 69 2.2.3. Cell Lysis...... 70 2.2.4. Kinase assay:...... 70 2.2.5. In-gel kinase assay:...... 71 2.2.6. Isoelectric Focusing:...... 71 2.3. Recombinant proteins...... 71 2.4. His-MBP-ULK1 1-278 K46N purification...... 72 2.4.1. Pilot experiment...... 72 2.4.2. Column purification...... 73 2.5. His-MERTK 571-864 purification...... 74 2.6. Bradford assay...... 75 2.7. SDS-PAGE and western blotting...... 75 2.8. Cell culture, transfection, treatment and lysis...... 76 2.8.1. S2 cells...... 76 2.8.2. Mammalian cells lines (MEF, HEK293, Cos7, HeLa)...... 77 2.9. ULK1 expression in Drosophila S2 cells...... 77 2.10. Pim1/ULK1 pull down assay...... 78 2.11. Kinase assay...... 78 2.11.1. Kinase...... 79 2.11.1.1. Recombinant kinases...... 79 2.11.1.2. V5-His-ULK1...... 79 2.11.1.3. myc-ULK1...... 79 2.11.2. Substrate...... 80 2.11.2.1. Recombinant substrates...... 80 2.11.2.2. B-RAF...... 80 2.12. Phospho-site mapping by mass spectrometry...... 80

2.12.1. Kinase assay and sample preparation...... 80 2.12.2. Mass Spectrometry...... 81 2.12.3. Data Analysis...... 81 2.13. In-gel kinase assay...... 82 2.14. 2D in-gel kinase assay...... 82 2.15. Ion exchange chromatography...... 83 2.16. Pim1/ULK1/MBP kinase assay...... 83 2.17. Microarray screening...... 84 3. ULK1 substrate screening...... 87 3.1. Purification of ULK1...... 88 3.2. Probing the microarray...... 93 3.3. Testing the candidates...... 97 3.3.1. MERTK...... 97 3.3.2. B-RAF...... 99 3.4. Discussion...... 100 3.4.1. Obtaining active ULK1...... 100 3.4.2. Screening results...... 102 4. Upstream regulation of ULK1...... 108 4.1. ULK1 1-278 K46N purification...... 110 4.2. In-gel kinase assay...... 112 4.3. Identification of the 34 kDa kinase...... 113 4.4. Testing kinases for ULK1 phosphorylation...... 118 4.5. Phopshorylation of ULK1 by Pim1 in vivo...... 121 4.6. Binding between Pim1 and ULK1...... 122 4.7. Identification of ULK1 sites phosphorylated by Pim1...... 123 4.8. ULK1 activation by Pim1...... 129 4.9. In vivo role of Pim1 in autophagy...... 133 4.10. Discussion...... 134 4.10.1. Identification of Pim1 as a kinase phosphorylating ULK1...... 134 4.10.2. Identification of ULK1 sites phopshoprylated by Pim1...... 138 4.10.3. Activation of ULK1 by Pim1...... 140 4.10.4. Role of Pim1 in vivo...... 142

5. Final discussion...... 145 6. References...... 151 Final word count: 37145

List of Figures

Fig. 1. Model of Cvt (left) and autophagy (right) pathways in yeast...... 24 Fig. 2. Model of autophagy and its molecular machinery in mammals...... 27 Fig. 3. Domain structure of ULK1...... 38 Fig. 4. Illustration of the mammalian ULK1 complex...... 50 Fig. 5. mTOR signalling and autophagy in mammalian cells...... 53 Fig. 6. Regulation of ULK1 by AMPK and mTOR...... 59 Fig. 7. ULK1 pull down assay...... 90 Fig. 8. ULK1 kinase assay...... 91 Fig. 9. Testing activity of recombinant GST-ULK1 (Abnova)...... 93 Fig. 10. Microarray screening...... 96 Fig. 11. MERTK phosphorylation by ULK1...... 98 Fig. 12. B-RAF phosphorylation by ULK1...... 100 Fig. 13. ULK1 activation loop mutagenesis...... 110 Fig. 14. Purification of His-MBP-ULK1 1-278 K46N – pilot experiment...... 112 Fig. 15. Detection of a ULK1 kinase by in-gel kinase assay...... 113 Fig. 16. MonoQ chromatography and in-gel kinase assay...... 115 Fig. 17. 2D in-gel kinase assay...... 116 Fig. 18. ULK1 upstream kinase candidates...... 118 Fig. 19. Testing potential ULK1 kinases...... 119 Fig. 20. Phosphorylation of ULK1 by Pim isoforms...... 120 Fig. 21. Electrophoretic mobility of endogenous ULK1...... 122 Fig. 22. Binding between Pim1 and ULK1...... 123 Fig. 23. Detection of ULK1 phosphorylation sites by mass spectrometry...... 125 Fig. 24. Identification of ULK1 sites phosphorylated by Pim1 using LC-MS/MS: S147...... 126 Fig. 25. Identification of ULK1 sites phosphorylated by Pim1 using LC-MS/MS: S224...... 127 Fig. 26. Alanine screening of ULK1 phosphorylation sites...... 129 Fig. 27. Effect of mutagenesis on ULK1 kinase activity...... 130 Fig. 28. ULK1 activation by Pim1 in vitro...... 132

Fig. 29. Role of Pim1 in vivo...... 134 Fig. 30. Pim1 phosphorylation motifs...... 139 Fig. 31. Proposed role of Pim1 in regulation of autophagy and energy metabolism of the cell...... 149

Abstract

The University of Manchester

Stefan Ludwik Loska

A thesis for a degree of Doctor of Philosophy

Regulation of ULK1 in autophagy

March 2012

ULK1 (UNC-51 like kinase 1) is a serine/threonine protein kinase that has been shown to play a crucial role in autophagy, a process of self digestion implicated in maintaining cellular homeostasis and in mediating type II programmed cell death. However, the exact mechanism by which ULK1 controls autophagy remains elusive, mostly because none of the known ULK1 targets have been directly linked to autophagy. To address this issue, I have employed a protein microarray screening approach to identify novel ULK1 substrates. I found five putative targets: MERTK (proto-oncogene tyrosine-protein kinase MER), B-RAF (v-raf murine sarcoma viral oncogene homologue B1), NOL4 (nucleolar protein 4), TBC1D22B (TBC1 domain family member 22B) and ACVRL1 (activin A receptor type II-like 1). My preliminary experiments have not confirmed that MERTK or B-RAF can be phosphorylated by ULK1 in vitro. However, further investigation will be required to firmly rule out MERTK and B-RAF as downstream targets of ULK1 and to test the ability of ULK1 to phosphorylate the other candidates. In addition, I have identified by in-gel kinase assay a ULK1 kinase at 34-kDa whose ability to phosphorylate the kinase domain of ULK1 was increased upon starvation. Using the genome information, I predicted this upstream kinase to be Pim1 (Proto-oncogene serine/threonine-protein kinase pim-1). I confirmed that Pim1 phosphorylated ULK1 in vitro at S147 and S224. Results of site directed mutagenesis suggest that phosphorylation at S224 correlates with increased ULK1 activity. This is consistent with observation that Pim1 is capable of activating ULK1 in vitro. Furthermore, I present preliminary data suggesting that Pim1 promotes autophagy in HeLa cells.

Declaration

I hereby declare that no portion of the work referred to in the thesis has been submitted in support of an application for another degree or qualification of this or any other university or other institute of learning.

i. The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he has given The University of Manchester certain rights to use such Copyright, including for administrative purposes.

ii. Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with licensing agreements which the University has from time to time. This page must form part of any such copies made.

iii. The ownership of certain Copyright, patents, designs, trade marks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the thesis, for example graphs and tables (“Reproductions”), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions.

iv. Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property and/or Reproductions described in it may take place is available in the University IP Policy (see http://www.campus.manchester.ac.uk/medialibrary/policies/intellectual- property.pdf), in any relevant Thesis restriction declarations deposited in the University Library, The University Library’s regulations (see http://www.manchester.ac.uk/library/aboutus/regulations) and in The University’s policy on presentation of Theses.

Acknowledgements

I would like to thank my supervisor, Dr Cathy Tournier for her support and feedback on my work during my research and for helpful comments on this thesis. I thank previous and and current members of Cathy's group: Katie Finegan, Clare Davies, Auriane Destrument, Eunju Lee, Sonia Mazzitelli, Diana Perez Madrigal, Blanca Paramo Sanchez and Andy Robinson for their support and assistance during my project. I am also grateful to Dr Alan Whitmarsh and the members of his lab for help and advice. I thank my advisor, Prof David Thornton for guiding me through my course and Wellcome Trust for funding my project.

I thank Dr Imanol Arozarena for providing me with pEF-myc-B-RAF D594A construct. I owe special thanks to Prof Naoya Fujita for sending me pc5FLAG-Pim1 constructs, despite all difficulties caused by the tsunami which hit Japan that time.

I am indebted to Prof Stephen Taylor for enabling me to use the Akta purification system in his lab. I also thank Dr David Knight and the staff of Biomolecular Analysis Facility for consultation and for performing mass spectrometry analysis of my samples.

I thank my friends for all nice moments in Manchester and for their support during my project; especially Elżbieta Piątkowska, who helped me with 2D protein electrophoresis; and Michael Ehrhardt, who had taught me the basic lab techniques when I was a research student in Bangor, and later, throughout my PhD project, served with help and advice.

I owe special thanks to my Thai Boxing instructors: Mike, Abs and Horace and all my friends from the G-Camp team for teaching me how to fight and making my spirit and body strong, which helped me to survive difficult moments during my research.

Finally I would like to thank my family: my brother, Rafał Loska, my Parents and my beloved fiancée, Lidia Koszkało for their constant support at every stage of my course.

Autobiographical statement

I studied Biotechnology at the Jagiellonian University, Krakow, specialising in Biochemistry. At the 4th year of my studies, I was awarded with a Socrates/Erasmus Scholarship and spend 6 months in North West Cancer Research Fund Institute, Bangor, Wales doing a project in Dr Jürgen Müller's Cell Signalling Group. Investigating the interaction between C-TAK1 kinase and 14-3-3 proteins, I practised my research skills and obtained data to produce the Master Thesis at my home University, where I graduated with first honours in 2007.

After graduation I was awarded with a Wellcome Trust scholarship at the University of Manchester and I joined Dr Cathy Tournier's group. In my project I investigated signalling of ULK1 kinase, which is thought to be a key regulator of autophagy. In my research, apart from standard experimental methods, like cloning, protein expression and purification, cell culturing, pull down and kinase assays, 2D electrophoresis and chromatography, I used some novel screening techniques, like protein microarray screening and in-gel kinase assay. I am going to continue my career in science by doing postdoctoral research.

Abbreviations

4E-BP1 - eIF4E binding protein 1

ACVRL1 - activin A receptor type II-like 1

AGC - PKA/ PKG/PKC family

AICAR - aminoimidazole carboxamide ribonucleotide

Akt - v-akt murine thymoma viral oncogene homologue 1 (protein kinase B)

AMBRA - activating molecule in Beclin-1-regulated autophagy

AMP - adenosine monophosphate

AMPK - AMP-activated protein kinase

ASK1 - apoptosis signaling kinase 1

Atg - autophagy related

ATP - Adenosine-5'-triphosphate

AVd - degradative AV

AVi - initial autophagic vacuole

B-RAF - v-raf murine sarcoma viral oncogene homologue B1

BAD - Bcl-xl/Bcl-2-associated death promoter

Bak - Bcl2-antagonist/killer

Bax - BCL2-associated X protein

Bcl-2 - apoptosis regulator Bcl (B-cell lymphoma)-2

Bcl-xl - B-cell lymphoma extra large

BH3 - Bcl-2-homology

Bif-1 - Bax interacting factor 1

BSA - bovine serum albumin

c-IAP2 - apoptosis inhibitor 2 c-Myc - avian myelocytomatosis viral oncogene homologue cAMP - cyclic adenosine monophosphate

CDC25A/C – cell division cycle 25 homologue A/C

CDK - cyclin dependent kinases

CGN - cerebellar granule nerones

CHAPS - 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate

COPI - coat protein complex I

CT - C-terminal

Cvt - cytoplasm-to-vacuole targeting

DFCP1 - double FYVE domain containing protein 1

DIC - dynein intermediate chain

DLC1/2 - dynein light chain 1 and 2

DMEM- Dulbecco/Vogt modified Eagle's minimal essential medium

DNA - deoxyribonucleic acid

DTT – dithiothreitol

EBSS - Earl's balanced salt solution

ECL - Enzymatic Chemiluminescence

EDTA - ethylenediaminetetraacetic acid

EGTA - ethylene glycol tetraacetic acid eIF4E - eukaryotic translation initiation factor 4E

ER - endoplasmic reticulum

Erk1/2 - extracellular signal-regulated kinase 1/2

ESCRT - endosomal sorting complex required for transport

FBS - fetal bovine serum

FEZ1 - fasciculation and elongation protein zeta 1

FIP200 – FAK (focal adhesion kinase) family-interacting protein of 200kD

FOXO3a – forkhead box O3a

FSBA – 5’-fluorosulfonylbenzoyladenosine

GABARAP - gamma-aminobutyric acid receptor associated protein

GAP - GTPase activating protein

GATE-16 - Golgi-associated ATPase enhancer-16

GEF - guanine nucleotide exchange factor

GFP - green fluorescent protein

Grb2 - growth factor receptor-bound protein 2

GST - glutathione S-transferase

GTP – guanosine-5'-triphosphate

HEPES - 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

IEF – isoelectric focusing

IGKA - in gel kinase assay

IL - interleukine

IPTG - isopropyl β-D-1-thiogalactopyranoside

JAK – Janus kinase

KD - kinase domain kd – kinase dead kDa – kilo Dalton

LAMP2 - lysosome associated membrane protein 2

LB - Luria broth

LC3 - Microtubule-associated protein light chain 3

LKB1 - serine/threonine kinase 11

MAPK14 - mitogen-activated protein kinase 14

MAPKAP - mitogen-activated protein kinase associated protein 1

MBP - maltose binding protein

MBP* - myelin basic protein

MEFs - mouse embryonic fibroblasts

MERTK - proto-oncogene tyrosine-protein kinase MER

MRLC - myosin regulatory light chain Drosophila homologue mRNA – messenger RNA mTOR - mammalian target of rapamycin mTORC1/2 - mammalian target of rapamycin complex 1/2

NEK - NIMA (never in mitosis gene a)- related kinase

NF-κB - nuclear factor of kappa light polypeptide gene enhancer in B-cells

NGF - nerve growth factor

NOL4 - nucleolar protein 4

OD600 - optical density at 600 nm

PAGE - polyacrylamide gel electrophoresis

PAS - preautophagosomal structure

PBK - PDZ-binding kinase

PBS - phosphate buffered saline

PCD - programmed cell death

PCNA - proliferating cell nuclear antigen

PDK1 - phosphoinositide-dependent kinase 1

PGC-1α - Peroxisome proliferator-activated receptor gamma coactivator 1-alpha

PI3KC1 - class 1 phosphatidylinositol 3-kinase

PI3KC3 - class 3 phosphatidylinositol 3-kinase

PI3P – phosphatidylinositol-3-phosphate

Pim1 - Proto-oncogene serine/threonine-protein kinase pim-1

PIP3 – phosphatidylinositol-3,4,5-trisphosphate

PKCη - protein kinase C isoform η

PMSF - phenylmethylsulphonyl fluoride

PP2A - protein phosphatase 2A

PRAS40 – 40 kDa proline-rich Akt substrate

PS - proline/serine-rich

Raptor - regulatory associated protein of mTOR

RelA - v-rel reticuloendotheliosis viral oncogene homologue A

Rheb - Ras homologue enriched in brain

Rictor - rapamycin insensitive companion of mTOR

RNA - ribonucleic acid

RT - room temperature

Rubicon - RUN domain and cystein rich domain containing, Beclin1 interacting

S6K - p70 ribosomal protein S6 kinase

SDS - sodium dodecyl sulphate

SILAC -stable isotope labelling with amino acids in cell culture siRNA - small interfering RNA

Sqh - Spaghetti squash

STAT - signal transducer and activator of transcription

STK16 - serine threonine kinase 16

SynGAP - synaptic GTPase activating protein

TBC1D22B - TBC1 domain family member 22B

TBS-T - tris buffer saline with Tween

TEV - tobacco etch virus

TGF-β - transfroming growth factor β

TGN - trans Golgi network

TLB - triton lysis buffer

TOR - target of rapamycin

TrkA - neurotrophic tyrosine kinase receptor type 1

TSC1/2 - tubero sclerosis complex1/2

UBA - Ubiquitin associating

Ubl - ubiquitin like

ULK1/2 - UNC-51-like-kinase 1/2

UNC-51 - uncoordinated 51

UVRAG - UV radiation resistance-associated gene

Vps - vacuolar protein sorting

Vps34 - vacuolar protein sorting 34

WIPI-1 - WD repeat domain phosphoinositide-interacting protein 1 wt – wild type

XIAP - X-linked inhibitor of apoptosis protein

ZIPK - zipper interacting protein kinase

18 1. Introduction 1. Introduction

1. Introduction

1.1. Autophagy

Autophagy is a process of cell self-digestion, which takes part in maintaining the cellular homeostasis between biosynthetic and catabolic processes. Contrary to the other large scale degradation mechanism, the ubiquitin/proteasome system, autophagy is capable of removing entire organelles. Three types of autophagy can be distinguished

[reviewed in Cuervo 2004]. In chaperone mediated autophagy, cytosolic proteins selectively bind to a receptor in the lysosome membrane that mediates their translocation to the lumen. In microautophagy, cytosolic elements designated for degradation are engulfed by the lysosome membrane and the resulting vesicle is digested inside the lysosome. Finally, in macroautophagy, which is often termed simply as autophagy, the cytosolic content is enwrapped into an isolating membrane to form a double membrane vesicle called autophagosome. The autophagosome is next fused with the lysosome where its content is degraded. Here, I will focus on macroautophagy and the term autophagy will refer to this process if not indicated otherwise.

1.1.1. Role

Autophagy is induced by nutrient deprivation and is believed to maintain cellular homeostasis and reestablish energy levels under starvation conditions [Kim 2000]. It can be observed in cultured hepatocytes upon nutrient deprivation [Seglen 1992] and in muscles of starved transgenic mice expressing GFP-tagged LC3, a marker of autophagy

[Mizushima 2004]. It is thought that degradation of intracellular content provides

19 1. Introduction 1.1. Autophagy energy and amino acids required for minimal cell function and synthesis of crucial proteins when nutrients are scare [Kim 2000]. A good example of the critical role of autophagy in physiological conditions is delivered by observation of Atg5 knockout mice in which autophagy is inhibited. These mice, in spite of normal embryonic development, die within 1 day after birth, which is explained by failure to survive the starvation period before switching to breast feeding. Consistently, autophagy was shown to be upregulated in wild type mice after birth, returning to the basal level within 1-2 days [Kuma 2004]. Autophagy is also a mechanism of removal of unwanted organelles.

For example, in hepatocytes, peroxisomes are degraded upon treatment with antilipolitic agents [reviewed in Kim 2000]. There are also other lines of evidence illustrating protective role of autophagy. It plays role in removing protein aggregates or damaged organelles [Lemasters 2002, Webb 2003]. It was suggested that sequestration of damaged mitochondria may protect cells from apoptosis [Ravikumar 2006]. Not only self content of the cell can be removed by autophagy, but also toxins and pathogens

[Walker 1997, Tallóczy 2002].

While autophagy plays a protective role in cells and helps to maintain homeostasis, it can also mediate type II programmed cell death (PCD) [reviewed in

Thorburn 2008]. In contrast to type I PCD, known as apoptosis, autophagic cell death is caspase independent. Morphological differences may be observed between cells undergoing apoptotic and autophagic cell death. In apoptosis, caspase cleavage causes cytoskeleton degradation, while organelles are preserved until late stages of the process.

In contrast, in autophagy, the cytoskeleton remains intact while organelles are degraded in numerous autophagic vesicles.

20 1. Introduction 1.1. Autophagy

Autophagy can be a route of PCD alternative to apoptosis. It has been reported that autophagy instead of apoptosis, is induced in response to DNA damage when treatment with lower doses of etoposide is used [Gao 2011]. Autophagy is observed when extensive cell elimination is required or phagocytes, which normally remove cells dying by apoptosis, do not have an access to the tissue [Yuan 2003]. It has been also shown that autophagic cell death is induced in cells incapable to undergo apoptosis following the knockout of proapoptotic proteins (namely Bax and Bak) [Shimizu 2004] or caspase inhibitor treatment [Yu 2004]. In the former case, the effect was enhanced by overexpression of antiapoptotic proteins, Bcl-2 and Bcl-xL, which suggests that balance between Bax/Bak and Bcl-2/Bcl-xL plays a role in determining the occurrence of autophagic cell death. Interestingly, autophagic cell death can be induced by caspase inhibitors only, without any additional treatment [Yu 2004]. It has been proposed that autophagy could be a backup mechanism of cell death in case of infection by viral pathogens which possess anticaspase activity.

Apoptosis and autophagy may coexist in cells. Autophagy may precede and induce apoptosis [Scott 2007]. However, autophagy could be a primary attempt of reestablishing cellular homeostasis. Apoptosis would be triggered in situations when the autophagic capacity of the cell is exceeded [Rodriguez-Enriquez 2004]. Consistently, in

Atg5 knockout mouse embryos inhibition of autophagy caused increased apoptosis

[Kuma 2004]. On the other hand, apoptosis may precede autophagy [Lee 2001]. In this case, it could be speculated that autophagy guarantees the complete execution of cell death and clearance of dead cells.

Autophagy is also involved in numerous pathological processes [reviewed in

Shintani 2004, Cuervo 2004], which makes investigating the basic mechanism of this

21 1. Introduction 1.1. Autophagy phenomenon interesting in a medical context. Since it is capable of promoting both cell survival and cell death, the role of autophagy in disease is compared to "a double edged sword". Inhibition of cell growth and promotion of cell death by autophagy makes its inhibition beneficial for cancer cells. In fact, Beclin1, a homologue of yeast Atg6, was found to act as a tumour suppressor silenced in several types of breast cancers

[Liang 1999]. Overexpression of Beclin1 in these cells leads to the restoration of autophagy and the reversion of the malignant phenotype. However, in some stages of progression, induction of autophagy may be beneficial for cancer cells. For example, during solid tumour growth, nutrients are scare in its inner part. Autophagy could help cells located in this part to survive these extreme conditions until the tumour's vessel system is developed. Autophagy can also participate in the resistance of cancer cells to radiation and chemotherapy by removing damaged organelles and preventing activation of apoptosis [reviewed in Cuervo 2004]. Thus, the role of autophagy depends on the phase of cancer progression. Its understanding might provide opportunity of developing new anti-cancer therapies.

Accumulation of damaged materials in cells associated with defects in autophagy has severe consequences in nonproliferative cells, like muscle cells and neurones.

Indeed, morphological analysis provides evidence for a connection between autophagy and many types of myopathy. The best studied example is Danon disease, in which the accumulation of phagosomes in cells leads to cardiomyopathy, myopathy and mental retardation. Lysosome associated membrane protein 2 (LAMP2) was found to be mutated in this disease [Yamamoto 2001]. Although its role in autophagy is unclear, targeted deletion of its gene in mice leads to a similar phenotype as that of patients with

Danon disease [Tanaka 2000]. A dramatic increase of autophagic vesicles has been

22 1. Introduction 1.1. Autophagy observed in many neurodegenerative disorders associated with the accumulation of misfolded protein aggregates, including Alzheimer, Huntington, Parkinson and prion diseases. It is believed that neuronal death in these diseases is caused, at least in part, by autophagy. A protective role of autophagy connected with its role in removing newly formed aggregates has also been reported [Ravikumar 2002, Webb 2003]. Only in the later stages of the disease, when the number of aggregates increases, the capability of degradation via the lysosomal pathway is exhausted and type II PCD is triggered. Thus, induction of autophagy in early stages of the disorder might have potential therapeutic value.

1.1.2. Mechanism

In yeast, autophagy is initiated in the structure called PAS (preautophagosomal structure), which is a perivacuolar compartment where all regulating proteins required for autophagy are recruited (Fig. 1) [Suzuki 2001, Kim 2002b]. PAS expands to form double membrane, called the phagophore or the isolation membrane. Subsequently, a bulk of cytoplasm and organelles is enwrapped by the isolation membrane to form an autophagosome. The autophagosome is then fused to the vacuole and the autophagic body is released to the lumen, where it is degraded to be recycled for essential biosynthetic processes [reviewed in Kim 2000, Suzuki 2010].

23 1. Introduction 1.1. Autophagy

Fig. 1. Model of autophagy in yeast. The isolation membrane or phagophore is formed at the perivacuolar site called PAS (preautophagosomal structure), where the proteins required for autophagy are recruited. The isolation membrane expands and sequesters the cytoplasm and organelles to close and form an autophagosome. The autophagosome fuses with the vacuole and the autophagic body is released for degradation. Based on [Suzuki 2010].

In mammals, the autophagosome fuses with endosomes and lysosomes to form an amphisome (called also a degradive autophagosome), which then, after degradation of the sequestered content, becomes an autolysosome [Eskelinen 2005]. Otherwise, most of the components of yeast mechanism are conserved in higher eukaryotes (Fig. 2)

[reviewed in Kim 2000, Levine 2004]. However, in mammals the origin of the isolation membrane is uncertain. There is no evidence for PAS existence in mammals and it seems that autophagosomes can be formed anywhere in the cytoplasm. Two models for the autophagosome generation are debated. One postulates de novo formation of the isolation membrane from localised lipid synthesis, whereas the other suggests its

24 1. Introduction 1.1. Autophagy emergence from a preexisting organelle. While various organelles, like the ER

(endoplasmic reticulum), Golgi complex, and the plasma membrane were proposed as the phagophore source, discrepancies in compartment specific markers identified by different groups do not allow to conclude about the source of isolation membrane

[reviewed in Reggiori 2006].

Recently PI3P (phosphatidylinositol 3-phosphate) rich structures, called omegasomes, were observed at the ER upon starvation treatment. They also contained autophagy marker proteins, like LC3 and Atg5 (see below) and newly formed autophagosomes emerged from omegasomes [Axe 2008]. These observations were confirmed by electron tomography studies which revealed close proximity between the

ER and the autophagosomes, indicating that the ER can be a platform for the creation of the isolation membrane [reviewed in Reggiori 2009].

On the other hand, observed translocation of Atg9 protein (see below) from the trans Golgi to autophagy related structures [Young 2006] suggests that the membrane for the growing phagophore can be delivered form the Golgi network. Moreover, other studies using advanced fluorecent microscopy imaging show that mitochondria can be a source of the isolation membrane. Emergence of cup-like structures positive for autophagy markers and continuous with the outer mitochondria membrane was observed [Hailey 2010]. Therefore, it is likely that multiple sources of the phagophore membrane may exist in mammalian cells and that autophagosomes can emerge from different organelles. It is possible that they can also differ in their function or the specificity of cargo recognition.

1.1.3. Molecular machinery of autophagy

Although autophagy was first observed as early as in 1950s [Clark 1957], only in

25 1. Introduction 1.1. Autophagy

1990s, due to advances in yeast genetics, did the molecular machinery regulating this process start to be revealed. Morphological and immunological screens were performed, in which mutants defective in accumulating autophagic bodies [Tsukada 1993] or proteolysis of cytosolic marker proteins [Thumm 1994], respectively, were isolated.

This resulted in identification of a number of genes crucial for autophagy regulation.

Since these genes appeared to be conserved in higher eucaryotes [Meijer 2007], studying of the autophagic machinery in mammalian cells became possible. The core autophagy regulating proteins can be divided into four modules (Fig. 2): 1)

Atg1/ULK1(Unc51-like kinase 1) complex, 2) Vps34 (vacuolar protein sorting 34) complex I, 3) Ubiquitin-like protein (Atg12, Atg8/LC3) conjugation system and 4) transmembrane Atg9/mAtg9 protein. Most of these proteins are recruited to PAS in yeast or the isolation membrane in mammals and regulate subsequent steps of autophagy [reviewed in Simonsen 2009, Yang 2010].

26 1. Introduction 1.1. Autophagy

Fig. 2. Model of autophagy and its molecular machinery in mammals. a) Initiation and nucleation. The isolation membrane or phagophore is formed at the ER sites called omegasomes. The process is initiated by ULK1, which acts upstream to the PI3KC3 complex. PI3KC3 complex is anchored to the membrane through myristoylated p150 and facilitates nucleation by producing PI3P on the surface of the omegasome and the forming phagophore. DFCP1 is a PI3P effector which is recruited to the omegasome. b) Expansion. WIPI-1 is recruited to the membrane by PI3P. mAtg9 is translocated to the phagophore from the TGN (trans Golgi network), which could be also a source of the membrane for the expanding phagophore. Atg5-Atg12/Atg16L complex recruits LC3 facilitating its lipidation and anchoring to the isolation membrane. c) Closure. The isolation membrane closes sequestrating cytoplasm and organelles and an autophagosome is formed. The regulating proteins are retrieved from the autophagosome. LC3 is removed form the outer surface, but remains bound to the inner membrane. d), e) Maturation. The autophagosome fused with the components of the endosomal pathway (d) to form an intermediate structure called an amphisome. The amphosome finally fuses with a lysosome (e) to form an autolysome, where sequestratedated content is degraded. Based on [Simonsen 2009] and [Tooze 2010] and the publication cited in the text.

1.1.4. Initiation

Autophagy is initiated by activation of Atg1/ULK1 kinase which is thought to be the most upstream regulator of autophagy. In yeast Atg1 forms a multiprotein complex

27 1. Introduction 1.1. Autophagy that includes Atg17, Atg11, Atg13 and Vac8. Atg1 is regulated by TOR (target of rapamycin) kinase, which functions as a nutrient and energy sensor. Studies of TOR function in yeast revealed that inhibition of TOR by rapamycin is able to induce autophagy even in nutrient rich conditions by a mechanism dependent on Atg1

[Kamada 2000, Noda 1998]. In normal conditions, TORC1 maintains Atg13 in a phosphorylated state, thus preventing its interaction with Atg1. It is not clear whether

TORC1 phosphorylates Atg13 directly or this event is mediated by other protein kinases. Upon TORC1 downregulation by nutrient deprivation or rapamycin treatment,

Atg13 is no longer phosphorylated. Its rapid dephosphorylation enables formation of the

Atg1 complex, leading to activation of Atg1. Atg1 complex is recruited to the PAS and autophagosome formation is initiated [Kabeya 2005, Suzuki 2007].

Similarly, mammalian homologue of Atg1, ULK1, forms a multiprotein complex containing Atg13, FIP200 and Atg101 [Hosokawa 2009, Jung 2009, Ganley 2009,

Hara 2008, Mercer 2009]. ULK1 is also regulated by mammalian mTORC1

(mammalian TOR complex 1). However, the details of ULK1 regulation are different than in yeast. Atg13 binding to ULK1 is stable and not affected during autophagy induction and mTORC1 is thought to directly phosphorylate and activate ULK1

[Hosokawa 2009, Jung 2009, Mercer 2009]. ULK1 signalling in mammalian cells and its role in autophagy will be discussed in details below (see 1.2.ULK1).

1.1.5. Nucleation

Autophagy was found to be regulated by phosphatidylinositol 3-kinases (PI3K), which phopshorylate phosphatidylinositol at the 3-position of the inositol ring. Yeast posses only one PI3K, Vps34 [Takegawa 1995], which produces PI3P and forms two distinct complexes [Kihara 2001]. Both contain Atg6 and the serine threonine kinase

28 1. Introduction 1.1. Autophagy

Vps15. Vps15 is anchored to the membrane to recruit and activate Vps34. Complex I is autophagy related and contains Atg14, which associates specifically with the vacuolar membranes and PAS [Obara 2006]. Complex II, containing Vps38, regulates the Vps

(vacuolar protein sorting) pathway, which delivers proteins such as carboxypeptidase Y form trans Golgi network to the vacuole and localises to the vacuolar membrane and endosomes [Kihara 2001].

In mammals, complex I is formed by homologous class III phosphatidylinositol

3-kinase (PI3KC3), designated Vps34. Its components involve p150, a homologue of

Vps15, Beclin1, a homologue of Atg6, and Atg14L or Barkor, a homologue of Atg14

[Zhong 2009, Itakura 2008, Sun 2008].

Beclin 1 interacts with Vps34 and Atg14L via its central coiled coil domain. It can also directly bind AMBRA (activating molecule in Beclin-1-regulated autophagy), which positively regulates Beclin1 function in autophagy, by so far undiscovered mechanism [Fimia 2007, Di Bartolomeo 2010]. Beclin1 is also a novel BH3 (Bcl-2- homology) domain protein [Oberstein 2007]. It can interact with an antiapoptotic protein Bcl-2, which negatively regulates Beclin1 and inhibits autophagy

[Panttigre 2005].

Upon starvation, Atg14L localises to the isolation membrane independently on the interaction with Vps34 and Beclin1 [Itakura 2008, Sun 2008, Matsunaga 2009].

Overexpression of Atg14L stimulates the kinase activity of Vps34 and induces autophagy even in nutrient rich conditions, whereas depletion of Atg14L reduces PI3P production and inhibits autophagy [Sun 2008, Zhong 2009, Itakura 2008]. Moreover,

Atg14L levels influence stability of Vps34 and Beclin1 [Itakura 2008]. These data indicate that Atg14L may mediate recruitment of the PI3KC3 complex to the isolation

29 1. Introduction 1.1. Autophagy membrane, where it exerts its kinase activity and regulates the initial steps of autophagy.

Atg14 punctae formation during starvation induced autophagy is blocked in

FIP200 knockout MEFs (mouse embryonic fibroblasts). On the other hand, PI3K inhibitor, wortmannin does not affect formation of ULK1 positive punctae. This suggests that the PI3KC3 complex containing Atg14 functions downstream to the ULK1 complex [Itakura 2010].

Wortmannin potently blocks autophagy [Blommaart 1997], which indicates that the kinase activity of Vps34 and synthesis of PI3P is crucial for autophagosome formation. However, the exact role of PI3P in this process remains to be elucidated. Two candidate PI3P binding proteins possibly involved in regulation of autophagy have been identified so far. DFCP1 (double FYVE domain containing protein 1) was shown to translocate from the Golgi to the ER during starvation, specifically localising to the omegasome [Axe 2008]. Another PI3P effector protein, WIPI-1 (WD repeat domain phosphoinositide-interacting protein 1), a homologue of yeast Atg18, localises to autophagic membrane in a PI3P-dependent manner [Jeffries 2004, Proikas-

Cezanne 2004]. The localisation pattern of both proteins is disrupted by Vps34 and

Atg14 knockdown [Itakura 2010]. However, further studies are necessary to explain the role of both proteins in autophagosome formation.

1.1.6. Expansion and closure

In yeast, Atg9, a multi spanning membrane protein [Noda 2000], was proposed to take part in delivering membrane to the PAS [Reggiori 2004]. Similarly in mammals, mAtg9 was demonstrated to translocate from the trans Golgi network and late endosomes to autophagosomes upon starvation and this process depends on ULK1 and

Beclin1 activity [Young 2006, Tooze 2010]. As a transmembrane protein, mAtg9 is

30 1. Introduction 1.1. Autophagy most likely delivered in membrane vesicles, which would contribute to expansion of the phagophore [Tooze 2010].

In mammals, phagophore expansion is thought to be regulated by another Vps34 complex that contains UVRAG (UV radiation resistance-associated gene) protein.

UVRAG is a homologue of Vps38 [Itakura 2008] and its interaction with p150/Vps34/Beclin1 is mutually exclusive with Atg14L [Itakura 2008, Sun 2008].

Therefore p150/Vps34/Beclin1/UVRAG complex is thought to be a counterpart of the yeast PI3K complex II. However, UVRAG was found to positively regulate autophagosome formation. Overexpression of UVRAG increases Vps34 activity and stimulates autophagy [Liang 2006]. UVRAG was shown to interact with Bif-1 (Bax interacting factor 1) [Takahashi 2007]. Bif-1 possesses the N-BAR domain, a crescent shaped motif which is involved in membrane binding and bending events

[Takahashi 2009]. Therefore, it is proposed that UVRAG recruits the machinery responsible for inducing the curvature of the isolation membrane.

Expansion of the isolation membrane requires ubiquitin like proteins Atg12 and

Atg8 (LC3 in mammals) and their conjugating machinery, which is conserved between yeast and mammals [reviewed in Yoshimori 2008]. The first pathway involves Atg5,

Atg7, Atg10, Atg12 and Atg16 (Atg16L in mammals) proteins. A covalent bond is formed by ATP hydrolysis between a cysteine residue of the active site of Atg7, which acts as an E1-like enzyme, and the C-terminus of Atg12. Then, Atg12 is translocated to a lysine residue of Atg5, in a reaction which requires an E2-like enzyme, Atg10. Finally

Atg12 bound Atg5 associates with Atg16(Atg16L) to create a multiprotein

Atg5-Atg12/Atg16(Atg16L) complex. The complex is bound to the phagophore membrane and is necessary for its expansion. In the second pathway, Atg8(LC3) is

31 1. Introduction 1.1. Autophagy cleaved by Atg4 protease to leave a conserved glycine residue. Atg8 is then linked to

Atg7 (E1), then Atg3(E3) and finally phosphatidylethanolamine (PE). Atg8 lipidation is crucial for its association with the membrane. It has been revealed that

Atg5-Atg12/Atg16L complex recruits Atg3 and LC3 to the plasma membrane and serves as a scaffold for LC3 lipidation. Therefore it is proposed that the

Atg5-Atg12/Atg16L complex may act as an E3-like enzyme for LC3 [Fujita 2008,

Hanada 2007].

Formation of LC3 and Atg16L positive punctae is suppressed in FIP200 knockout

MEFs or upon wortmannin treatment. Contrary, Atg3 or Atg5 knockout does not affect recruitment of Atg14 to the isolation membrane. This indicates, that the Ubiquitin like conjugation system functions downstream to the Atg14 containing PI3KC3 complex

[Itakura 2010].

LC3 seems to play a crucial role in selective autophagy. Although so far autophagy was considered to be an unspecific process, it is becoming more and more evident that some cargo can be specifically packed into the forming autophagosome.

This process is mediated by adaptor proteins which use their so called LIR (LC3 interacting region) motif [Noda 2008] to bind to LC3. p62 (SQSTM1, sequestosome) and NBR1, besides the LIR motif, contain the UBA (Ubiquitin associating) domain to bind and recruit ubiquitinated protein agregates for degradation in the autophagosome

[Kirkin 2009, Bjørkøy 2005, Pankiv 2007]. p62 and NIX recruit mitochondria

[Geisler 2010, Novak 2009], whereas p62, NDP52 and Optineurin mediate targeting of ubiquitinated bacterial pathogens [Wild 2011].

In Atg3 deficient mice in which LC3 lipidation is not detected, autophagosomes are formed but they are smaller and are either open-ended or multilamellar [Sou 2008].

32 1. Introduction 1.1. Autophagy

Similarly, expression of inactive mutant of Atg4 inhibits lipidation of LC3 and results in nearly complete autophagosomes which are not closed [Fujita 2008]. This indicates that

LC3 could play a role in elongation and regulation of membrane closure and autophagosome completion, which is supported by the observation that lipidated Atg8 is able to induce liposome fusion in vitro [Nakatogawa 2007].

1.1.7. Maturation

In the maturation process, the autophagosome is fused with the ensdosomal/lysosomal system of the cell. Atg8/LC3 is removed from the autophagosome surface by the deconjugation from PE, which is crucial for the fusion event. The reaction is catalysed by Atg4 [Krisako 2000] , the same enzyme which is involved in activation of Atg8/LC3 before lipidation. However, the regulation of this dual activity of Atg4 remains to be elucidated [reviewed in Chen 2011].

While in yeast the autophagosome is fused with the vacuole in a single event, it is proposed that in mammals maturation takes place by multiple fusions with different endosome polulations, like early endosomes, multi vesicular bodies, late endosomes and lysosomes. Subsequent steps would deliver proton pumps and enzymes necessary for cargo degradation as well as proteins required for the fusion with the next type of vesicle. This model is supported by the observation that the elements of the early endocytic pathway machinery, like COPI (coat protein complex I) and the endosomal sorting complex required for transport (ESCRT) are necessary for the formation of degradive autophagic vesicles [Razi 2001, reviewed in Rusten 2009].

PI3KC3 kinase complex can also play a role in the autophagosome maturation.

Rubicon (RUN domain and cystein rich domain containing, Beclin1 interacting) is a protein which binds to the p150/Vps34/Beclin1/UVRAG complex in a UVRAG

33 1. Introduction 1.1. Autophagy dependent manner. Overexpression of Rubicon decreases Vps34 activity and results in aberrant endosomal structures and inhibition of autophagosome maturation

[Matsunaga 2009, Zhong 2009]. UVRAG can also regulate autophagosome maturation and endocytic vesicle trafficking in a Beclin1 independent manner. It was found to interact with the C-Vps complex, which is required for vesicle tethering and fusion with lysosomes. After recruiting C-Vps to the autophagosomes, UVRAG stimulates Rab7

GTPase activity and autophagosome fusion with the endocytic vesicles [Liang 2008].

Autophagosome fusion with the ensdosomal/lysosomal vesicles results in degradation of its content. This process depends on a number of hydrolitic enzymes, including proteinases A and B and the lipase Atg15 in yeast [Epple 2001, Teter 2001] and cathepsins B, D, and L in mammals [Tanida 2005]. The degradation products are retrieved for recycling. Their transport to the cytoplasm is facilitated by permeases, like yeast Atg22 [Yang 2006b].

While more and more information is collected about components and functioning of certain modules of the autophagic machinery, little is know about connections between them. For example, we do not know the function of PI3P in autophagy, how the ubiquitin like protein conjugation is triggered, and how mAtg9 is recruited to the isolation membrane. In my project, I focused on the initial steps of autophagy. It is still not clear how the ULK1 complex activates this process and how it interacts with the

PI3KC3 complex. Therefore I decided to investigate the upstream and downstream signalling of the ULK1 complex.

34 1. Introduction 1.2. ULK1

1.2. ULK1

ULK1 is a mammalian homologue of yeast Atg1. It is a serine/threonine kinase that was identified as a homologue of another protein, UNC-51 [Yan 1998,

Tomoda 1999], a member of unc (uncoordinated phenotype) family in C. elegans

[Brenner 1974]. The unc-51 mutants display paralysed, egg lying defective and dumpy phenotype, which is related to defects in axonal formation [Hedgecock 1985]. Similarly,

ULK1 was shown to be crucial for neurite extension in mammals [Tomoda 1999].

However, its expression pattern is not limited to neurones and it is found in most tissues, including brain, skeletal muscles, heart, kidney, testis, lung and liver [Yan 1998,

Tomoda 1999], which suggests that it may play additional roles in mammalian cells. In fact, recent data show that, similar to its yeast homologue Atg1, ULK1 is a key regulator of autophagy [Young 2006, Chan 2007]. Mammalian cells possess another homologue of Atg1, ULK2, which is also involved in neurite extension [Yan 1999,

Tomoda 1999]. However, its role in autophagy is uncertain.

1.2.1. Domain architecture of ULK1

ULK1 contains 3 domains: the kinase domain (KD), the proline/serine-rich (PS) domain and the C-terminal (CT) domain [Yan 1998] (Fig. 3). The kinase domain possessing 12 subdomain motifs is typical of serine/threonine kinases [Hanks 1995].

The kinase activity exhibited by ULK1 was confirmed by in vitro autophosphorylation assays [Yan 1998, Tomoda 1999]. Lysine 46 localised in the ATP binding pocket is crucial for the activity and K46 mutants (K46N [Yan 1998], K46R [Tomoda 1999],

K46I [Chan 2009]) are kinase dead. The kinase activity is essential for ULK1 function, which is supported by the evidence that overexpression of kinase dead ULK1 in

35 1. Introduction 1.2. ULK1

HEK293 cells inhibits autophagy [Chan 2009]. Another evidence comes from cultured cerebellar granule neurones (CGNs), where overexpression of the kinase dead mutant inhibits neurite extension [Tomoda 1999]. These results indicate that the kinase dead

ULK1 is a dominant negative protein that acts by titrating out substrates, upstream regulators or scaffolding proteins. Furthermore, chimeric UNC-51 protein in which the kinase domain was substituted with that of murine ULK1 was able to rescue unc-51 mutant phenotype when expressed in C. elegans, while no effect was observed with

K46R mutant. In addition, the wild type phenotype was not restored when the kinase domain was substituted with that of the mouse cAMP dependent protein kinase. Thus, the kinase domain of ULK1/UNC-51 is, at least partly, responsible for substrate specificity and this specificity is shared between species. Moreover, overexpression of chimeric UNC-51 protein with the kinase domain of murine ULK1 harbouring the

K46R mutation in wild type C. elegans resulted with the phenotypic abnormalities associated with unc-51 mutants, which is a further example of dominant negative action of the kinase dead mutant [Tomoda 1999].

The PS domain is characterised by a high percentage of proline (15%) and serine

(16%) residues and contains a putative autophosphorylation site(s) (presumably between residues 287-351). Deletion of this fragment caused loss of autophosphorylation. However, it cannot be ruled out that this region is necessary for

ULK1 kinase activity, while the autophosphorylation site is localised somewhere else in the sequence [Yan 1998, Tomoda 1999]. The PS domain also contains binding sites for

GATE-16 (Golgi-associated ATPase enhancer-16) and GABARAP

(gamma-aminobutyric acid receptor associated protein) proteins (287-416)

36 1. Introduction 1.2. ULK1

[Okazaki 2000] and AMPK (AMP-activated protein kinase, 711-828) [ Lee 2010,

Kim 2011].

The CT domain is species specific, which is supported by the observation that murine ULK1 overexpressed in C. elegans was able to rescue unc-51 mutant phenotype only when the CT domain was substituted with that of C. elegans UNC-51. Even though the CT domain is not necessary for the kinase activity [Yan1998, Tomoda1999], four of the six mutations of the homologous UNC-51 responsible for the aberrant phenotype in

C. elegans result in truncation of this domain [Ogura 1994]. Molecules binding to the

CT domain of ULK1 include SynGAP (synaptic GTPase activating protein), Syntein

(with the last 3 C-terminal aa: VYA crucial for the binding) [Tomoda 2004], FIP200

(FAK family-interacting protein of 200kD) [Hara 2008] and Atg13 (829-1001 region)

[Jung 2009, Chan 2009]. The CT domain also contains a membrane binding motif

(864-1001) [Chan 2009]. It has been also proposed that the CT domain is responsible for the inhibition of autophagy by the kinase dead ULK1. In fact the CT domain alone inhibits autophagy when overexpressed and the 1041-1047 fragment was found to be crucial for this effect, thus designated as autophagy inhibition motif [Chan 2009]. The authors speculated that the lack of autophosphorylation in the kinase dead mutant promotes conformational changes in ULK1 and exposure of the CT domain. This hypothesis was confirmed in limited proteolysis experiments. However, the mechanism of the inhibition is unclear since the 1041-1047 fragment does not overlap with the membrane binding motif and was not found to be crucial for interaction with any known

ULK1 binding proteins.

37 1. Introduction 1.2. ULK1

Fig. 3. Domain structure of ULK1. ULK1 contains the kinase domain (KD), the proline/serine-rich domain (PS) and the C-terminal domain (CT). K46 is the lysine crucial for the ULK1 kinase activity. The substrate and ATP binding pockets and the catalytic loop are discontinuous regions, i.e. only certain fragments of the sequence regions marked in the figure belong to these motifs. Binding partners of ULK1 and important regions are indicated. Based on NCBI entry NP_033495 and the publications cited in the text.

1.2.2. Function of ULK1 in axon formation

ULK1 contribution in axon formation involves membrane structure reorganisation. This is a common feature of autophagy, thus some mechanism may be shared between the two processes. The first evidence of the role of ULK1 in neurite formation was presented by Tomoda et al. [Tomoda 1999], who investigated axon extension in CGNs during the development of the cerebellar circuitry. The authors showed that overexpression of the kinase dead ULK1 K46R mutant in CGN precursors impaired their differentiation, as demonstrated by axon truncation. Gene expression analysis revealed that the cells expressing ULK1 K46R exit the cell cycle, but fail to progress through the programme of gene expression required for axon formation.

38 1. Introduction 1.2. ULK1

The dominant negative kinase dead ULK1 mutant probably acts via titration of the substrates, thereby preventing endogenous ULK1 from exerting its kinase activity. It is interesting that overexpression of ULK1 K46R mutant lacking the CT domain caused only a moderate inhibition of axon formation. It could be speculated that the CT domain of the full length protein additionally titrates some regulatory or scaffolding proteins important for ULK1 function. However, overexpression of ULK1 fragment comprising the PS and CT domains did not affect axon formation [Tomoda 1999]. Another possibility is that the CT domain regulates the cellular localisation of ULK1. Then, the full length kinase dead mutant would colocalise with the endogenous ULK1 and titrate substrates in its direct neighbourhood, which would explain its stronger dominant negative effect compared to the truncated form.

In a screen for ULK1 binding partners two proteins were identified: GATE-16 and GABARAP [Okazaki 2000]. Binding of both of them to ULK1 was independent of its kinase activity. GATE-16 (Golgi-associated ATPase enhancer-16) is essential for intra Golgi transport [Sagiv 2000]. GABARAP (gamma-aminobutyric acid receptor associated protein) is a docking protein which links GABA receptor to the tubulin cytoskeleton [Wang 1999]. Okazaki et al. speculated that GABARAP could take part in endocytosis, recycling and trafficking of the GABA-A receptor. These findings indicate that ULK1 may influence axon extension by regulating vesicular transport and membrane structures organisation. In fact, vesicular structure disorganisation along the axon of CGNs expressing kinase dead ULK1 was observed in another study

[Tomoda 2004].

ULK1 also binds SynGAP (synaptic GTPase activating protein) and Syntein

[Tomoda 2004]. Syntein is an endocytic vesicular membrane protein [Fialka 1999] and

39 1. Introduction 1.2. ULK1 functions as a scaffolding molecule for synaptic proteins [Hirbec 2003]. Tomoda et al. showed that its two PZD domains bind ULK1 and this interaction is dependent on the

VYA motif present at the C-terminus of ULK1. Syntein also interacts with the small

GTPase, Rab5, but no direct binding between ULK1 and Rab5 was detected, thus

Syntein probably serves as a scaffolding protein between ULK1 and Rab5. SynGAP is a brain specific Ras GTPase-activating protein [Chen 1998] and Tomoda et al. showed that it downregulates Rab5 and Ras. ULK1 inhibited SynGAP in a way dependent on

ULK1 kinase activity. However, the exact mechanism of this process is unknown, since no phosphorylation of SynGAP by ULK1 was detected. The inhibition of SynGAP by

ULK1 activates Ras/Rab5 signalling, which was proposed to promote membrane reorganisation and axon elongation. In fact Ras signalling plays a positive role in neurite extension [Noda 1985, Eggert 2000] and Rab5 is a marker of early endosomes that takes part in endocytic membrane fusion [Fischer von Mollard 1994].

In another study, ULK1 was shown to promote axon elongation by downregulation of the NGF (nerve growth factor) receptor, TrkA and inhibition of filopodia formation. In this model, TrkA stimulation by NGF induces ULK1 polyubiquitination and its subsequent recruitment to TrkA trough p62 protein. This promotes endocytosis of the NGF/TrkA complex, which results in decreased activity of

Akt. Consistently, Akt phosphorylation was observed to be increased upon ULK1 silencing [Zhou 2007]. Since Akt activates mTOR pathway which is involved in autopphagy regulation (see below), the ability of ULK1 to downregulate Akt signalling might contribute to activation of autophagy.

Although the kinase activity of ULK1 is essential for neurone development, no

ULK1 substrates involved in this process have been discovered. However, the

40 1. Introduction 1.2. ULK1

Drosophila homologue, UNC-51/Atg1 has been shown to phosphorylate UNC-76/FEZ1

(fasciculation and elongation protein zeta1) [Toda 2008]. UNC-76 is an adaptor protein taking part in anterograde transport of synaptic vesicles. UNC-76 associates with the heavy chain of kinesin-1 [Blasius 2007] and recruits a cargo by binding Syt-1, a synaptic vesicle transmembrane protein. Toda et al. showed that UNC-51 binds and phosphorylates UNC-76 at S143, which is crucial for Syt-1 binding. The loss of

UNC-51 impairs UNC-51/Syt-1 interaction and leads to severe axonal transport defects.

However,the phosphorylation of mammalian FEZ1 by ULK1 remains to be examined.

1.2.3. Function of ULK1 in autophagy

Since LC3 lipidation results in electromobility shift, it can be observed by

SDS-PAGE and therefore employed as an autophagy marker [Mizushima 2004]. Chan et al. used a 753-member kinome siRNA library designed to target all known and predicted human kinases to identify those involved in autophagy. Cells transfected with the library were analysed for LC3 lipidation upon starvation treatment and ULK1 depletion was found to impair autophagy [Chan 2007]. ULK1 involvement in stimulating autophagy was confirmed by demonstrating that its silencing by siRNA decreased long-lived protein degradation in starved cells. Interestingly, in the whole library, ULK1 was the only candidate which fulfilled both criteria, i.e. LC3 lipidation and protein degradation. The effect of ULK2 knockdown was also tested, but it was found to be unable to modulate LC3 conversion. This indicates a unique role of ULK1 in the regulation of autophagy.

These findings are consistent with the data obtained from research in Drosophila, where Atg1 was demonstrated to be an important autophagy regulator. Overexpression

41 1. Introduction 1.2. ULK1 of Atg1 was found to rapidly induce autophagy in several tissues, most prominently in larval fat bodies, a nutrient storage organ of flies [Scott 2007]. The effect was dependent on Atg1 kinase activity, since it was not observed when a kinase dead mutant was used.

Conversely, the kinase dead Atg1 acted as a dominant negative protein inhibiting starvation induced autophagy.

The role of ULK1 in autophagy regulation was confirmed in vivo by studying knockout mice. However, these results suggest that ULK1 is involved only in certain types of autophagy [Kundu 2008]. In particular, increased level of ULK1 expression in erythroid precursors isolated from wild type mice correlated with autophagic clearance of mitochondria. Consistently, in ulk1-/- reticulocytes exhibited impaired removal of mitochondria and RNA-bound ribosomes. Furthermore, increased mitochondria mass was detected in ULK1 deficient mouse embryonic fibroblasts (MEFs). Intriguingly,

ULK1 knockout mice were viable and showed no developmental defects. Moreover, when ULK1 deficient MEFs were subjected to starvation, LC3 lipidation was detected, indicating that autophagy can be induced in these cells. Together these results support the hypothesis that ULK1 is a component of a selective autophagy machinery essential for organelle elimination, but is not essential for mediating autophagy induced by starvation. This suggests the existence of a redundant pathway. Consistently, studies performed in our laboratory demonstrate that nutrient deprivation induced autophagy was impaired by silencing ULK1 with siRNA, but only in MEFs isolated from ULK2 knockout mice. However, ULK1 knockdown was sufficient to inhibit low potassium treatment induced autophagy in CGNs isolated from wild type mice [Lee 2011].

Recently ULK1/2 knockout mice were generated. Although the detailed phenotype of these animals has not yet been published, the authors report that they die shortly after

42 1. Introduction 1.2. ULK1 birth [Cheong 2011]. This phenotype is similar to that observed in Atg5 knockout mice

[Kuma 2004] and indicates that ULK1 and ULK2 together may be critical for activating autophagy in physiological conditions. However, MEFs isolated from the ULK1/2 knockout mice were capable to undergo ammonia induced autophagy [Cheong 2011].

Together these results support the idea that ULK2 can compensate ULK1 function.

However, this redundancy is tissue or treatment specific. Furthermore, under certain conditions autophagy can be induced by a mechanism independent of ULK1 and ULK2.

Investigation of the molecular mechanism of autophagy regulation by ULK1 revealed that its kinase activity is increased in MEFs upon starvation conditions

[Hara 2008]. Moreover, overexpression of the kinase dead ULK1 K46N mutant in

NIH3T3 cells or K46I mutant in HEK293 cells inhibited LC3 conversion and the formation of punctae structures positive for Atg16L, a marker of the isolation membrane

[Hara 2008, Chan 2009]. In contrast, overexpression of wild type ULK1 had no effect on autophagy. Instead, it was reported that it may induce apoptotic cell death

[Hara 2008].

ULK1 was shown to localise to autophagy-related structures in starved cells.

Hara et al. showed that ULK1 colocalises with Atg16L, a marker of expanding isolation membrane (phagophore) [Hara 2008]. These results are consistent with data obtained by

Chan et al. who demonstrated that upon nutrient deprivation ULK1 was distributed to punctae structures which were positive for LC3, a marker of autophagic vesicles. This specific distribution was dependent on the CT domain of ULK1, since a mutant lacking this domain failed to colocalise with LC3. However, the effect was not abolished by deleting the 3-amino acid C-terminal PZD-binding motif of ULK1, indicating that the recruitment of ULK1 to autophagic vesicles does not require Syntein [Chan 2007].

43 1. Introduction 1.2. ULK1

More detailed information about the molecular function of ULK1 in autophagy was provided by Young et al. [Young 2006]. The authors investigated changes in the localisation of mAtg9 protein upon autophagy induction. mAtg9 was found to be localised in juxtra-nuclear structures identified as trans-Golgi network and peripheral punctae structures, which were shown to be endosomes. Upon starvation, the juxtra-nuclear fraction of mAtg9 was diminished while the peripheral fraction increased, suggesting translocation of mAtg9 to endosomes. Moreover, it colocalised with LC3, which indicates that the punctae structures were processed into autophagy vesicles. A similar event was observed upon induction of autophagy by rapamycin treatment. Translocation of mAtg9 was inhibited by ULK1 knockdown. In contrast,

ULK2 knockdown had no effect on mAtg9 distribution. Although these data demonstrate that mAtg9 redistribution is dependent on ULK1, it is unclear if ULK1 directly regulates mAtg9 translocation, or autophagy inhibition caused by ULK1 knockdown results in the loss of the compartment which serves as an mAtg9 target.

The mechanism by which ULK1 could regulate mAtg9 translocation to the autophagosome was proposed by Tang et al., who investigated autophagy in wing imaginal discs and larval fat bodies of Drosophila and proposed that myosin II could take part in this process [Tang 2011]. The authors observed that overexpression of wild type Atg1, but not the kinase dead mutant, induced autophagy and was associated with increased phosphorylation of MRLC (myosin regulatory light chain) Drosophila homologue, Sqh (Spaghetti squash). Then, the authors identified a novel myosin light chain kinase, Sqa, which phosphorylated MRLC. Depletion of Sqa inhibited MRLC phosphorylation and autophagy induced by overexpression of Atg1, thereby indicating that Sqa acts downstream to Atg1.

44 1. Introduction 1.2. ULK1

In fact, Atg1 was found to phosphorylate Sqa at T279 in its kinase domain, as demonstrated in in vitro kinase assay. Phosphorylation of T279 was crucial for Sqa function and activity, as T279A mutation reduced its ability to phosphorylate MRLC in vitro and overexpression of Sqa T279A failed to induce MRLC phosphorylation in vivo. Sqa T279A also acted as a dominant negative mutant and its overexpression abolished Atg1 induced phosphorylation of MRLC. Further experiments showed that regulation of myosin I by ULK1 plays an important role in starvation induced autophagy. Starvation treatment caused increased phosphorylation of MRLC, which was not observed in Atg1 knockout flies and blocked by depletion of Sqa or expression of the Sqa T279A mutant. Also autophagy was impaired by expression of Sqa T279A or the nonphosphorylable mutant of MRLC.

The main findings were confirmed in mammalian cells [Tang 2011]. Mammalian homologue of Sqa, ZIPK (zipper interacting protein kinase) was bound by the kinase dead K46I mutant of ULK1, but not the wild type form, when coexpressed in HEK293T cells. Moreover, overexpression of ULK1 wild type, but not the K46I mutant induced

ZIPK electromobility shift. Together these results suggest that ULK1 phosphorylates

ZIPK. Starvation induced increased MRLC phosphorylation in MCF7 cells, which was suppressed by depletion of ULK1 and ZIPK. Importantly, blocking myosin II by inhibitor treatment or silencing myosin heavy chains impaired starvation induced autophagy, as assessed by LC3 positive punctae formation and LC3 conversion. This confirms the role of ULK1/ZIPK/myosin II cascade in starvation induced autophagy in mammals.

To study the mechanism of autophagy regulation by myosin II, Tang et al. performed microscopic and cell fractionation studies, which revealed that upon

45 1. Introduction 1.2. ULK1 starvation, phosphorylated MRLC migrates from peripheral sites to the perinuclear regions colocalising with LC3 and that the membrane fraction is enriched in MRLC.

Therefore, the authors hypothesised that myosin II could take part in delivering membrane to the phagophore. To verify this hypothesis, Tang et al. tested the interaction between MRLC and mAtg9. The two proteins colocalised and bound upon starvation and the binding was disrupted by ULK1 and ZIPK knockdown. Finally, inhibition of myosin II impaired translocation mAtg9 from the Golgi to autophagosomes.

Therefore, Tang et al. proposed that upon starvation ULK1 phosphorylates myosin light chain kinase ZIPK in mammals, which in turn phosphorylates MRLC and activates myosin II. Myosin II binds to Atg9 and transports it to the site of autophagy induction, delivering membrane to the phagophore. This would indicate that ULK1 can take part not only in autophagy initiation, but also in further steps of autophagosome formation, like phagophore expansion.

ULK1 was shown to act upstream to PI3KC3 complex [Itakura 2010]. Recently,

AMBRA was discovered to be a potential molecular link between the two kinases and a substrate of ULK1. AMBRA was shown by Di Bartolomeo et al. to tether the

Beclin1/Vps34 complex to microtubules [Di Bartolomeo 2010]. The authors demonstrated that AMBRA binds to DLC1/2 (dynein light chain 1 and 2) and DIC

(dynein intermediate chain), components of the dynein motor complex, as well as tubulin. Beclin1 also associated with dynein and this was mediated by AMBRA, since the interaction was impaired by AMBRA knockdown. Binding between AMBRA and dynein was disrupted when autophagy was induced by nutrient deprivation. The loss of this interaction was not observed when ULK1 was depleted with siRNA. Upon nutrient deprivation, AMBRA underwent a modification, possibly phosphorylation, as indicated

46 1. Introduction 1.2. ULK1 by a spot shift in 2D electrophoresis followed by western blot analysis. This shift was also inhibited by ULK1 siRNA. In fact, ULK1 was shown to phosphorylate AMBRA when both proteins were overexpressed and purified from HEK293 cells and in vitro kinase assay was performed. Moreover, ULK1 wild type, but not the kinase dead K46I mutant, induced electrophoretic mobility shift of AMBRA. This data suggest that

AMBRA might be a ULK1 substrate.

Th role of AMBRA phosphorylation by ULK1 proposed by Di Bartolomeo et al. was to release the PI3KC3 complex from microtubules. This model was confirmed by microscopic studies, which revealed that AMBRA localises to the ER upon starvation with a close proximity to the DFCP1 positive punctae interpreted as omegasomes.

Moreover, and Beclin1 followed AMBRA localisation pattern. Furthermore, depletion of DLC1 by siRNA activated autophagy in nutrient rich conditions. This was inhibited by wortmannin, which suggests the role of PI3KC3 in his process. Similarly, expression of AMBRA mutants which were unable to bind DLC1 induced autophagy in unstarved cells. These mutants localised to the ER and induced similar localisation of Beclin1.

Therefore, Di Bartolomeo et al. hypothesised that upon starvation ULK1 could phosphorylate AMBRA and release it from microtubules which would allow the whole

PI3KC3 complex to translocate to the autophagy initiation sites and induce autophagy.

1.2.4. ULK1 complex

Atg1 forms a multiprotein complex in yeast [Kamada 2000, Noda 1998].

Similarly in mammals, gel filtration analysis demonstrated that ULK1 is present in a complex of about 3,000 kDa [Hosokawa 2009]. In another study, native gel electrophoresis revealed two complexes, one of mass higher than 1,200 kDa, and

47 1. Introduction 1.2. ULK1 another of about 400-500 kDa, while the CT domain was shown to be necessary for entering the higher molecular weight complex [Chan 2009].

Screening for ULK1 binding partners involved in its regulation revealed two proteins: FIP200 (FAK family-interacting protein of 200kD) and Atg13 (Fig. 4)

[Hosokawa 2009, Jung 2009, Ganley 2009, Hara 2008]. Atg13 had been previously identified as a homologue of the yeast protein [Meijer 2007]. This was confirmed by bioinformatics analysis by other authors [Hosokawa 2009, Jung 2009]. FIP200 is a multifunctional protein involved in cell migration, proliferation and death, and in tumour suppression. It interacts with a broad spectrum of molecules, including FAK

(focal adhesion kinase) [Abbi 2002].

Both Atg13 and FIP200 are necessary for autophagy, as demonstrated in siRNA experiments [Hosokawa 2009, Jung 2009, Mercer 2009] and by analysis of cells isolated from knockout mice [Hara 2008], respectively. Furthermore, both proteins are required for the localisation of ULK1 to the isolation membrane [Ganley 2009] and colocalised with ULK1 to the Atg16L positive structures upon starvation

[Hosokawa 2009, Hara 2008, Mercer 2009].

Atg13 and FIP200 bind to the CT domain of ULK1. While the association between Atg13 and ULK1 seems to be direct, the mechanism of FIP200/ULK1 interaction is unclear. According to some results, the binding between ULK1 and

FIP200 is mediated by Atg13 [Hosokawa 2009, Jung 2009]. However, in another study

FIP200 alone was shown to be capable of interacting with ULK1 [Ganley 2009].

Although mTOR was shown to phosphorylate Atg13 in nutrient dependent manner

[Hosokawa 2009, Jung 2009], in contrast to yeast the binding of Atg13 to ULK1 was

48 1. Introduction 1.2. ULK1 not altered upon starvation or rapamycin treatment [Hosokawa 2009, Jung 2009,

Mercer 2009].

Atg13 knockdown or FIP200 knockout decreased ULK1 expression, which suggests that both molecules stabilise ULK1 [Hosokawa 2009, Jung 2009, Hara 2008].

Furthermore, addition of recombinant Atg13 or FIP200 increased ULK1 kinase activity in vitro, indicating that both of these proteins positively regulate ULK1 activity

[Jung 2009, Ganley 2009]. Finally, ULK1 was shown to phosphorylate Atg13 and

FIP200 both directly, in in vitro kinase assay, as well as in cells, which was shown by analysing the electrophoretic mobility shift upon overexpression or depletion of ULK1

[Hosokawa 2009, Jung 2009, Ganley 2009]. However, the biological role of this event remains elusive. Regarding the role of FIP200 and Atg13 in ULK1 localisation it can be speculated that FIP200 and Atg13 phosphorylation may affect ULK1 translocation to the isolation membrane.

Hara et al. postulated that FIP200 is a mammalian counterpart of Atg17

[Hara 2009]. Both FIP200 and Atg17 bind a broad spectrum of proteins, not necessarily related to autophagy, and both possess multiple coiled-coil domains. Moreover, similarly to FIP200, Atg17 interacts with the C-terminal part of Atg1 and is necessary for its targeting to PAS [Cheong 2008]. Finally, Atg17 is necessary for the kinase activity of Atg1 [Kamada 2000].

Another member of the ULK1 complex is Atg101 protein (Fig. 4) [Mercer 2009].

However, Atg101 does not interact directly with ULK1, but the binding is mediated by

Atg13. Upon nutrient starvation, Atg101 colocalises in punctae structures together with

Atg13 and ULK1. The binding between Atg101 and Atg13 is not modulated by nutrient

49 1. Introduction 1.2. ULK1 deprivation and appeared to be involved in stabilising Atg13, as demonstrated by tracing degradation of overexpressed Atg13 upon cyclohexamide treatment. Furthermore, in cells coexpressing Atg101, Atg13 degradation was significantly inhibited. Importantly,

Atg101 appeared to be necessary for autophagy induction as shown by Atg101 knockdown.

Fig. 4. Illustration of the mammalian ULK1 complex. Arg13 binds directly with ULK1 and FIP200, mediating the interaction between these two proteins [Jung 2009, Hosokawa 2009]. According to other authors FIP200 can also bind ULK1 [Ganley 2009]. Atg101 interacts with the complex through Atg13 [Mercer 2009].

1.2.5. Upstream regulation of ULK1

1.2.5.1. mTOR signalling

It has been shown that ULK1 acts downstream to mTOR (mammalian target of rapamycin) kinase [Chan 2007, Hosokawa 2009, Jung 2009]. mTOR is a protein kinase that integrates intracellular and extracellular signals, such as growth factors

50 1. Introduction 1.2. ULK1

[Inoki 2002], nutrients [Kim 2002a], energy level [Inoki 2003] and stress. mTOR forms two distinctive complexes in mammalian cells: mTORC1 and mTORC2 (Fig. 5).

mTORC1 complex is rapamycin sensitive [Sabers 1995] and contains Raptor

(regulatory associated protein of mTOR) and mLST8. There are two well characterised mTORC1 substrates: S6K (p70 ribosomal protein S6 kinase) and 4E-BP1 (eIF4E binding protein 1). S6K phosphorylation leads to its activation. Activated S6K phosphorylates the S6 ribosomal protein, thereby stimulating translation. Similarly, phosphorylated 4EBP1 releases the eIF4E translation factor from its inhibitory effect, which results in the activation of translation. The ability of mTORC1 to stimulate protein synthesis is consistent with its role in cell growth [reviewed in Fingar 2004].

The main mTORC1 regulator is TSC1/TSC2 heterodimer (tubero sclerosis complex) [Gao 2002]. TSC2 is a GAP (GTPase activating protein), which accelerates

GTPase activity of Rheb. Since GTP bound Rheb stimulates mTORC1 activity

[Long 2005], the effect of TSC1/TSC2 on mTORC1 is inhibitory. Stimulation with growth factors activates PI3KC1 (class 1 phosphatidylinositol 3-kinase), which generates PIP3 (phosphatidylinositol-3,4,5-trisphosphate). PIP3 facilitates recruitment of PDK1 (phosphoinositide-dependent kinase 1) to the membrane where it activates

Akt, a member of AGC kinase family by phosphorylation at T308. Phosphorylation of

TSC2 by Akt inhibits TSC2 function, thereby stimulating mTORC1 activity in response to growth factor [Yang 2007, Inoki 2002].

Another regulator of mTORC1 is AMPK (AMP-activated protein kinase), which is a cellular energy sensor. AMPK consists of a catalytic (AMPKα) and two regulatory

(AMPKβ and AMPKγ) subunits and is activated by LKB1 (serine/threonine kinase 11)

51 1. Introduction 1.2. ULK1 kinase when the intracellular AMP/ATP ratio increases [Shackelford 2009]. AMPK directly phosphorylates and activates TSC2, which leads to mTORC1 downregulation

[Inoki 2003]. AMPK also phosphorlyates two serine residues on Raptor, which induces

14-3-3 protein binding and inhibition of mTORC1 [Gwinn 2008].

The mTORC2 complex is much less characterised. It is rapamycin insensitive

[Jacinto 2004]. mTORC2 consists of mTOR, Rictor (rapamycin insensitive companion of mTOR) [Sarbassov 2004], Sin1 [Yang 2006a] and mLST8 [Loewith 2002]. The only well characterised substrate of the mTORC2 complex is Akt [Sarbassov 2005,

Mora 2004]. mTORC2 phosphorylates S473 in the hydrophobic motif of Akt, which is necessary for subsequent phosphorylation of its activation loop by PDK1

(phosphoinositide-dependent kinase 1) and full activation of Akt.

52 1. Introduction 1.2. ULK1

Fig. 5. mTOR signalling and autophagy in mammalian cells. mTOR forms two complexes: mTORC1, containing Raptor and mLST8 and mTORC2, containing Rictor and mLST8 and Sin1. mTORC1 is activated by growth factor/Akt pathway and nutrients and inhibited by AMPK and rapamycin. Phosphorylating S6K and 4E-BP1 mTORC1 stimulates protein synthesis. It also inhibits autophagy by downregulating ULK1. mTORC2 activates Akt by phosphorylation at S473. Based on [Yang 2007].

53 1. Introduction 1.2. ULK1

1.2.5.2. Role of mTOR and AMPK in regulation of ULK1

Consistent with the data obtained from the studies in yeast, mTORC1 activity is downregulated upon induction of autophagy by starvation. When ULK1 expression was silenced, autophagy was inhibited, even though mTORC1 signalling remained downregulated. Similarly, rapamycin treatment failed to induce autophagy in ULK1 knockdown cells [Chan 2007]. These data indicate that ULK1 is downstream of mTORC1, consistent with the mechanism described in yeast.

A link between mTOR and ULK1 was demonstrated by the discovery that ULK1 is an mTOR substrate [Hosokawa 2009, Jung 2009]. Amino acid starvation or rapamycin treatment caused increased gel mobility of ULK1, which is interpreted as decreased phosphorylation [Hosokawa 2009, Jung 2009]. Furthermore, rapamycin inhibited incorporation of 32P into ULK1 in vivo [Jung 2009]. The direct phosphorylation of ULK1 by mTOR was confirmed by an in vitro kinase assay, where either endogenous mTOR purified by immunoprecipitation or a recombinant mTOR kinase was shown to phosphorylate a ULK1 fragment 651-1051 [Hosokawa 2009,

Jung 2009]. mTOR phosphorylation inhibits ULK1 activity. The ability of endogenous

ULK1 to phosphorylate myelin basic protein was increased by rapamycin treatment or amino acid starvation and decreased by overexpression of Rheb [Jung 2009]. The effect of rapamycin on ULK1 phosphorylation indicates involvement of mTORC1 complex.

In fact, Raptor was shown to interact with ULK1 in a nutrient dependent manner, while no Rictor/ULK1 interaction was detected [Hosokawa 2009]. The ULK1 region responsible for Raptor binding was shown to be the PS domain (279-828)

[Hosokawa 2009]. However, other authors showed the association of Raptor with the kinase domain of ULK1 (1-278) [Lee 2010]. In another study, ULK1 fragment 1-517

54 1. Introduction 1.2. ULK1 was still able to interact with Raptor, and there was a very weak binding observed for

ULK1 fragment 1-425 [Kim 2011]. Thus, it seems likely that Raptor binding site is localised somewhere between the kinase and PS domains of ULK1.

More recently it has been demonstrated that mTORC1 inhibitor, AMPK, can directly regulate ULK1. In hepatocytes deficient in AMPK and ULK1, p62 accumulation was observed, consistent with a defect in autophagy. Furthermore, these cells displayed impaired mitophagy, which was demonstrated by accumulation of the mitochondrial marker, CoxIV and by increased levels of abnormal mitochondria

[Egan 2011]. AMPK was shown to activate ULK1. Upon glucose starvation, increased activation and phosphorylation of ULK1 was observed, consistent with increased autophosphorylation and decreased gel mobility of the ULK1. This effect was prevented in cells treated with an AMPK inhibitor or following overexpression of AMPKα kinase dead mutant or knocking out AMPKα. In contrast, overexpression of the wild type form of AMPK induced ULK1 mobility shift even in glucose rich medium. Furthermore,

ULK1 activity, measured by its ability to phosphorylate Atg13, was increased by incubation with AMPK and ATP [Kim 2011].

ULK1 sequence was analysed for AMPK phosphorylation consensus motifs. Four sites conserved among higher eucaryotes were identified: S467, S555, T574 and S637.

In vivo phosphorylation of ULK1 following AMPK activation by phenformin was confirmed at three of these sites: S555, T574 and S637 by mass spectrometry and at

S467 and S555 by western blot using phospho-site specific antibodies. Furthermore, phosphorylation of S555 induced by AMP-mimetic AICAR (aminoimidazole carboxamide ribonucleotide) was diminished in AMPK knockout MEFs [Egan 2011].

To investigate the functional role of ULK1 phopshorylation by AMPK, Egan et al.

55 1. Introduction 1.2. ULK1 overexpressed ULK1 wild type, kinase dead or a mutant with all four AMPK phosphorylaiton sites substituted with alanine (4SA mutant) in ULK1 knockout MEFs in which ULK2 was silenced by siRNA. While the mock transfected MEFs showed p62 accumulation upon starvation, autophagy was reconstituted by ectopically expressing wild type ULK1, but not the kinase dead or 4SA mutants. Furthermore, ULK1 kinase dead or 4SA expressing MEFs showed impaired mitophagy as demonstrated by increased number of mitochondria displaying aberrant morphology and decreased mitochondrial potential. Finally, survival of ULK1/2 deficient cells upon starvation was decreased when compared to wild type cells, which was explained by increased apoptosis in favour of autophagy. This effect was rescued by ULK1 wild type expression, but not kinase dead or 4SA ULK1. Altogether, these data indicate a crucial role of ULK1 phosphorylation by AMPK in autophagy induction.

In another study, AMPK was shown to directly phosphorylate ULK1 at two other sites: S317 and S777. The phosphorylation was dependent on glucose starvation and was diminished by AMPK knockout or by treatment with the AMPK inhibitor, compound C. The role of the phosphorylation in activating ULK1 was demonstrated by alanine mutant analysis. Contrary to the wild type form,ULK1 S317A/S777A did not show mobility shift or increase in activity upon glucose starvation and was not activated by incubation with AMPK. The mutant also failed to restore autophagy when expressed in ULK1 knockout cells [Kim 2011].

AMPK binds to ULK1 and this interaction is important for the regulation

[Lee 2010]. The binding region was mapped to the PS domain of ULK1 at 654-828. Lee et al. also showed that this region is necessary for AMPK dependent autophagy. When autophagy was induced by activating AMPK with metformin, LC3 punctae formation

56 1. Introduction 1.2. ULK1 was inhibited when 654-828 deletion ULK1 mutant was expressed following ULK1 knockdown. Moreover, the 654-828 ULK1 fragment inhibited autophagy when overexpressed in cells, probably by titrating AMPK and thereby preventing its binding to ULK1. The authors further showed that AMPK phosphorylates Raptor and inhibits mTORC1 activity in the ULK1 complex, which is accompanied with 14-3-3 protein binding to Raptor. The importance of this mechanism in autophagy regulation was confirmed by Lee et al. in MEFs where TSC2 dependent regulation of mTORC1 was impaired. When the endogenous Raptor was substituted by a human wild type version, the TSC2 knockout cells responded with autophagy upon activation of AMPK by

AICAR treatment. However, when alanine Raptor mutant defective in AMPK phosphorylation was used, autophagy was inhibited. This confirms the significance of

Raptor phosphorylation and mTORC1 inhibition by AMPK in autophagy stimulation.

On the other hand, mTORC1 regulates AMPK binding to ULK1 [Kim 2011]. The interaction between AMPK and ULK1 was shown to be disrupted following overexpression of Rheb or preincubation of ULK1 with mTORC1 and increased in cells treated with rapamycin. mTORC1 phosphorylates ULK1 within the AMPK binding region, at S757. Phosphorylation of S757 was decreased in cells starved for glucose or treated with rapamycin and increased upon overexpression of Rheb. Interaction between

ULK1 and AMPK was retained when S757 was mutated to cystein, but then it was no longer modulated by Rheb or rapamycin. Thus, phosphorylation of ULK1 at S757 by mTORC1 is responsible for disrupting AMPK/ULK1 interaction.

Interestingly, the activation of AMPK mediated autophagy is dependent on the starvation mode [Kim 2011]. The ULK1 band shift was observed only upon glucose starvation but not upon amino acid starvation. Moreover, the increase in ULK1 activity

57 1. Introduction 1.2. ULK1 was induced by glucose and amino acid starvation or rapamycin treatment, but only in the case of glucose starvation it was inhibited by overexpression of the AMPKα kinase dead mutant. Phosphorylation of S317 and S777 was also specific for glucose starvation. Finally, glucose, but not amino acid starvation, failed to induce autophagy in

AMPKα knockout cells. These results indicate that there are more than one mechanisms of ULK1 activation and autophagy induction and they may be AMPK dependent or independent.

To summarise, the mechanism of ULK1 regulation by AMPK and mTORC1 could be as follows (Fig. 6). Under nutrient rich conditions, mTORC1 remains bound to

ULK1 via Raptor and phosphorylates multiple ULK1 residues inhibiting ULK1 activity.

These include S757 phosphorylation, which inhibits AMPK binding. Upon nutrient deprivation, mTORC1 is inactivated. Activated AMPK takes part in mTORC1 downregulation by phosphorylating TSC2 and Raptor. mTORC1 dissociates from

ULK1 and dephosphorylation of S757 allows AMPK binding. AMPK phosphorylates multiple ULK1 sites, including S317 and S777, and activates ULK1, which leads to induction of autophagy.

58 1. Introduction 1.2. ULK1

Fig. 6. Regulation of ULK1 by AMPK and mTOR. a) Under nutrient rich conditions, mTORC1 complex binds to ULK1 via Raptor, probably in the region between the kinase and PS domainof ULK1. Active mTOR phosphorylates and inhibits ULK1. Phosphorylated sites include S757, which inhibits AMPK binding to ULK1. b) Upon starvation, disactivated mTORC1 dissociates from ULK1. Dephosphorylation of S757 facilitates binding of AMPK, which is activated by high AMP/ATP ratio. AMPK activates ULK1 by phosphorylating its multiple sites. Additionally, AMPK inhibits mTORC1 by phosphorylating TSC2 (not shown) and Raptor. Inhibition of mTORC1 by Raptor phosphorylation is facilitated by binding 14-3-3 protein.

59 1. Introduction 1.2. ULK1

However, this model is disputed by another study showing that AMPK has an inhibitory effect on ULK1 [Shang 2011]. The authors used SILAC (stable isotope labelling with amino acids in cell culture) method to quantitatively analyse phosphorylation of ULK1 sites in nutrient rich conditions and upon starvation by medium removal (total starvation). Dephosphorylation of a number of sites was observed upon starvation, among which two were chosen for further study: S638, corresponding to mouse ULK1 S637, reported to be phosphorylated by AMPK

[Egan 2011] and S758, corresponding to mouse ULK1 S757, reported to be phosphorylated by mTORC1 [Kim 2011]. Indeed, Shang et al. showed that the phosphorylation of ULK1 at S638 and S758 was inhibited by AMPK knockdown and rapamycin treatment, respectively. Moreover, the dephosphorylation of S638 resulted from the lack of calcium upon medium removal. Calcium deprivation alone was sufficient to decrease S638 phosphorylation and adding calcium after total starvation led to rephosphorylation of S638.

The authors also showed that AMPK bound to ULK1 and the binding was disrupted upon starvation. They argue that AMPK dissociation from ULK1 was caused by dephosphorylation of S758, which is phosphorylated by mTORC1 in nutrient rich conditions. Their conclusion was supported by the observation that S758A mutation decreased the binding. However, alanine does not mimic unphosphorylated serine perfectly. The structure of alanine is different than that of serine and it does not contain the hydroxyl group which may be crucial for the interaction between AMPK and ULK1.

Moreover, the binding was also decreased for S758D mutant, which is supposed to imitate phosphorylation. Furthermore, these conclusions also contradict the results obtained by Kim et al., who provided strong evidence for inhibition of ULK1/AMPK

60 1. Introduction 1.2. ULK1 interaction by mTORC1 [Kim2011]. Thus, the mechanism of AMPK dissociation from

ULK1 upon total starvation may be different than proposed by Shang et al. Taken together these data suggest that ULK1 regulation may dramatically differ in response to various treatment.

Finally signalling feedback loops were discovered between ULK1 and its regulators: AMPK and mTORC1. ULK1 was shown to phosphorylate all three subunits of AMPK resulting in its downregulation [Loffler 2011]. Furthermore, mTORC1 activity was decreased in cells when wild type ULK1, but not the kinase dead mutant, was overexpressed and increased by ULK1 knockdown [Lee 2007]. The upregulation of mTORC1 upon ULK1 knockdown was observed even in the absence of TSC2, thereby suggesting that ULK1 directly inhibits mTORC1 [Jung 2011]. Consistently, ULK1 was shown to bind and phosphorylate Raptor, leading to mTORC1 downregulation

[Jung 2011, Dunlop 2011]. The ability of ULK1 to inhibit mTORC1 may be responsible for decreasing protein synthesis under conditions in which autophagy is induced.

1.3. Conclusions and aims of the project

While evidence accumulate that ULK1 and its kinase activity are essential for autophagy induction, the molecular mechanisms of ULK1 function remain elusive.

Although ULK1 was shown to phosphorylate Atg13, FIP200 [Hosokawa 2009,

Jung 2009, Ganley 2009], Raptor [Jung 2011, Dunlop 2011] and AMPK [Loffler 2011], very little is known about its downstream targets. Recently Di Bartolomeo et al. proposed that ULK1 could function by releasing the PI3KC3 complex form microtubules [Di Bartolomeo 2010]. However, although the authors present some data supporting phosphorylation of AMBRA by ULK1, they do not provide any evidence

61 1. Introduction 1.3. Conclusions and aims of the project that this event is responsible for PI3KC3 complex release and activation of autophagy.

Therefore, it cannot be excluded that other proteins are also phosphorylated by ULK1 to facilitate this process. Moreover, depletion of AMBRA by siRNA blocked translocation of Beclin1 to ER and inhibited autophagy, which indicates that simply releasing

PI3KC3 complex from the microtubules is not sufficient for autophagy induction. Then, it remains to be clarified how targeting of the PI3KC3 complex to the phagophore is regulated and if ULK1 takes part in this process. In fact, autophagy induced by overexpression of AMBRA mutants not binding to dynein was inhibited by coexpression of ULK1 K46I, indicating that the kinase activity of ULK1 is still required after releasing of AMBRA from microtubules [Di Bartolomeo 2010].

In another study Tang et al. propose that ULK1 could be involved in later stages of autophagosome formation [Tang 2011]. According to their model, myosin II, activated indirectly by ULK1, interacts with mAtg9 and delivers membrane to the expanding phagophore. However, it is unclear how this transport would be directed towards the isolation membrane and if this would also be regulated by ULK1 mediated phosphorylation events. Another questions are if myosin II also takes part in the earlier stages of autophagy, for example omegasome formation, if this process is regulated by

ULK1 and if other ULK1 substrates are involved.

Finally, AMBRA and ZIPK phosphorylation would take place in the cytoplasm.

On the other hand, ULK1 was shown to translocate to the phagophore during autophagy

[Hara 2008]. The question arises, if ULK1 exerts its kinase activity on the surface of the isolation membrane, and if so, what are the substrates and the role of their phosphorylation.

62 1. Introduction 1.3. Conclusions and aims of the project

Another extensively investigated subject is the regulation of ULK1. With discovering mTOR and AMPK as the upstream kinases phosphorylating ULK1, we are starting to understand more and more in this subject. However, although these kinases were shown to modulate ULK1 activity, it is still not clear how ULK1 is delivered to the phagophore and if this process is also a point of its regulation. Furthermore, discrepancies between results obtained by different authors (for example activation

[Kim 2011] and inhibition [Shang 2011] of ULK1 by AMPK) indicate that various mechanisms of ULK1 regulation may exist, activated in different conditions.

Moreover, mTOR and AMPK were demonstrated to phosphorylate ULK1 within its PS and CT domains [Hosokawa 2009, Jung 2009, Kim 2011, Egan 2011]. On the other hand, the kinase domain of ULK1 possesses a motif characteristic of serine/threonine protein kinases called the activation loop [NCBI: NP_033495.2,

Conserved Domain Database: cd00180, Marchler-Bauer 2011]. Phosphorylation of this motif is well known to induce conformational changes within the kinase domain which affects kinase activity [Hanks 1995, Johnson 1998]. Thus, it can be speculated that other kinases than mTOR and AMPK may be involved in phosphorylating and regulating

ULK1.

Concluding, despite extensive investigation in the field and all data recently reported, there are still significant gaps remaining above and below ULK1 in the autophagy signalling network. Elucidating the mechanisms of regulation of ULK and the effects of its activity is crucial for understanding the process of autophagy activation. Therefore, in my project I decided to study upstream and downstream signalling of ULK1. The specific objectives were:

63 1. Introduction 1.3. Conclusions and aims of the project

• to identify novel ULK1 substrates

• to identify kinases upstream to ULK1 and the phosphorylation sites of ULK1

crucial for its regulation

64 2. Materials and Methods 2. Materials and Methods

2. Materials and Methods

2.1. DNA Constructs

2.1.1. Introducing TEV site into pAc5.1/V5-HisB

A DNA fragment encoding a motif recognised by the TEV protease was introduced into pAc5.1/V5-HisB using the following oligonucleotide pair:

5' GATCGGAAAACCTGTATTTTCAGGGCC 3'

5' GATCGGCCCTGAAAATACTGGTTTTCC 3'

Oligonucleotides were mixed together to final concentration of 50 μM in Buffer1

(New England BioLabs) and incubated as follows: 95ºC, 2 min; 65ºC, 5 min; RT (room temperature), 10 min. The duplex was ligated into pAc5.1/V5-HisB (Invitrogen) using

AgeI site to obtain pAc5.1/V5-TEV-HisB.

2.1.2. pAc5.1/V5-TEV-HisB-ULK1 and mutants

The insert covering the full mouse ULK1 open reading frame (GeneBank accession number AF072370, region 41..3196) was amplified by PCR using the following primers:

5' ATGGAGCCGGGCCGCGG 3'

5' GGCATAGACACCACTCAGC 3'

and pRKS vector containing ULK1 insert as a template (kindly provided by Dr

Alan Whitmarsh).

65 2. Materials and Methods 2.1. DNA Constructs

The insert was introduced into pJET1.2 vector (Fermentas) and then subcloned into pAc5.1/V5-TEV-HisB using NotI and XbaI restriction sites.

pAc5.1/V5-TEV-HisB-ULK1 was mutated using Quick Change II Site Directed

Mutagenesis Kit (Stratagene). Primers used were as follows (mutated nucleotides are highlighted):

Kinase dead mutant (K46N):

5' CGACCTGGAGGTGGCCGTTAACTGCATTAACAAGAAGAACC 3'

5' GGTTCTTCTTGTTAATGCAGTTAACGGCCACCTCCAGGTCG 3'

(one additional base pair was changed to produce a silent mutation introducing

HpaI restriction site which was later used to identify mutants)

Activation loop mutants:

S174A:

5' GGATTCGCTCGGTACCTCCAGGCCAACATGATGGCGGCC 3'

5' GGCCGCCATCATGTTGGCCTGGAGGTACCGAGCGAATCC 3'

T180A:

5' CCAGAGCAACATGATGGCGGCCGCACTCTGTGGTTCTCC 3'

5' GGAGAACCACAGAGTGCGGCCGCCATCATGTTGCTCTGG 3'

T180D:

5' CCAGAGCAACATGATGGCGGCCGACCTCTGTGGTTCTCC 3'

5' GGAGAACCACAGAGGTCGGCCGCCATCATGTTGCTCTGG 3'

S184A:

66 2. Materials and Methods 2.1. DNA Constructs

5' GGCGGCCACACTCTGTGGTGCTCCTATGTACATGGCTCC 3'

5' GGAGCCATGTACATAGGAGCACCACAGAGTGTGGCCGCC 3'

S184D:

5' GGCGGCCACACTCTGTGGTGATCCTATGTACATGGCTCC 3'

5' GGAGCCATGTACATAGGATCACCACAGAGTGTGGCCGCC 3'

2.1.3. pDEST-HisMBP-ULK1 1-278 K46N

An insert covering 1-278 amino acids of ULK1 sequence was amplified by PCR using the following primers:

5' ATGGAGCCGGGCCGCGGC 3'

5' TACTGCGGCCGCTCACAAGAAAGGGTGGTGGAAAAATTC 3'

and pAc5.1/V5-TEV-HisB-ULK1 K46N as a template. The insert was cloned into pENTR11 vector (Invitrogen) using XmnI and NotI restriction sites. Then, the insert was moved to pDEST-HisMBP (Addgene), pDEST15 or pDEST17 (both

Invitrogen) vectors by recombination reaction, using Gateway® LR Clonase® enzyme mix (Invitrogen).

pDEST-HisMBP-ULK1 1-278 K46N was mutated using Quick Change II Site

Directed Mutagenesis Kit (Stratagene). Primers used were as follows (mutated nucleotides are highlighted):

S147A:

5' CCCAAAACATCCTGCTGGCCAACCCTGGGGGCCGCCGG 3'

5' CCGGCGGCCCCCAGGGTTGGCCAGCAGGATGTTTTGGG 3'

67 2. Materials and Methods 2.1. DNA Constructs

S224A

5' GGCCCCTTTTCAGGCCGCCAGCCCTCAGGATTTGCGCC 3'

5' GGCGCAAATCCTGAGGGCTGGCGGCCTGAAAAGGGGCC 3'

2.1.4. pcDNA3-myc-ULK1

pcDNA3-myc-ULK1 wt and pcDNA3-myc-ULK1K46R were created by other members of the lab. pcDNA3-myc-ULK1 wt was mutated using Quick Change II Site

Directed Mutagenesis Kit (Stratagene). For S147A and S224A mutations, primers used were the same as described above (pDEST-HisMBP-ULK1 1-278 K46N). For S147d and S224D the following primers were used:

S147D:

5' CCCAAAACATCCTGCTGGACAACCCTGGGGGCCGCCGG 3'

5' CCGGCGGCCCCCAGGGTTGTCCAGCAGGATGTTTTGGG 3'

S224D:

5' GGCCCCTTTTCAGGCCGACAGCCCTCAGGATTTGCGCC 3'

5' GGCGCAAATCCTGAGGGCTGTCGGCCTGAAAAGGGGCC 3'

2.1.5. pEF-myc-B-RAF D594A

pEF-myc-B-RAF D594A was kindly provided by Dr Imanol Arozarena.

2.1.6. pET28a-LIC-MERTK-571-864wt and K619N

pET28a-LIC-MERTK-571-864 was kindly provided by Cheryl Arrowsmith via

Addgene service (Addgene plasmid 25178). K619N mutation was introduced using

68 2. Materials and Methods 2.1. DNA Constructs

Quick Change II Site Directed Mutagenesis Kit (Stratagene). Primers used were as follows (mutated nucleotides are highlighted):

5' GGACCTCTCTGAAAGTGGCAGTGAATACCATGAAGTTGG 3'

5' CCAACTTCATGGTATTCACTGCCACTTTCAGAGAGGTCC 3'

2.1.7. pc5FLAG-Pim1 wt and K67M

pc5FLAG-Pim1 wt and K67M were kindly provided by Prof Naoya Fujita.

2.2. Buffers

2.2.1. SDS-PAGE and western blotting

SDS-Loading Buffer (6x) (0.2 M Tris pH=6.8, 10% SDS, 10 mM DTT, 20% glycerol, 0.05% bromophenol blue)

Running Buffer (25 mM Tris, 200 mM glycine, 0.1% SDS)

Transfer Buffer (25 mM Tris, 200 mM glycine, 20% methanol)

TBS-T (20 mM Tris pH=7.6, 137 mM NaCl, 0.1% Tween 20)

2.2.2. Protein purification

Column Buffer (20 mM Tris pH=7.4, 200 mM NaCl, 1 mM EDTA, 1 mM DTT,

5 μg/ml aprotinin, 5 μg/ml leupeptin, 1 mM PMSF)

His Purification Phosphate Buffer (20 mM sodium phosphate, 500 mM NaCl,

25 mM imidazole, 5 μg/ml aprotinin, 5 μg/ml leupeptin, 1 mM PMSF)

Resuspension Buffer (20mM Tris pH=8.0)

69 2. Materials and Methods 2.2. Buffers

Isolation Buffer (2 M urea, 20mM Tris pH=8.0, 500 mM NaCl, 2% Triton X-

100)

Binding Buffer (6 M guanidine hydrochloride, 20mM Tris pH=8.0, 500 mM

NaCl, 5 mM imidazole, 1 mM β-mercaptoethanol)

Wash Buffer (6 M urea, 20mM Tris pH=8.0, 500 mM NaCl, 20 mM imidazole,

1 mM β-mercaptoethanol)

Refolding Buffer (20mM Tris pH=8.0, 500 mM NaCl, 20 mM imidazole, 1 mM

β-mercaptoethanol)

Elution Buffer (20mM Tris pH=8.0, 500 mM NaCl, 500 mM imidazole, 1 mM

β-mercaptoethanol)

2.2.3. Cell Lysis

PBS (8.1 mM Na2HPO4, 1.76 mM KH2PO4, 137 mM NaCl, 2.68 mM KCl, pH=7.4)

S2 Lysis Buffer (50 mM Tris pH=7.8, 150 mM NaCl, 1% Nonidet P-40, 1 μg/ml leupeptin, 1 μg/ml pepstatin, 1 mM PMSF)

Triton Lysis Buffer (TLB) (20 mM Tris pH=7.4, 137 mM NaCl, 2 mM EDTA,

10% glycerol, 1% Triton X-100, 1 mM PMSF, 5 μg/ml leupeptin, 5 μg/ml aprotinin)

2.2.4. Kinase assay:

Kinase Buffer ( 50 mM HEPES pH=7.5, 10 mM MgCl2, 10 mM MnCl2, 1 mM

DTT, 30 μM ATP )

70 2. Materials and Methods 2.2. Buffers

2.2.5. In-gel kinase assay:

IGKA Lysis Buffer (20 mM Tris pH=7.4, 137 mM NaCl, 2 mM EDTA, 1 mM

DTT, 5 mM NaF, 25 mM sodium β-glycerophosphate, 1mM sodium orthovanadate,

1 mM PMSF, 5 μg/ml leupeptin, 5 μg/ml aprotinin)

IGKA Buffer A (20 mM Tris pH=8.0, 5 mM β-mercaptoethanol)

IGKA Buffer B (40 mM HEPES pH=7.4, 0.1 mM EGTA, 5 mM MgCl2, 5 mM

MnCl2, 2 mM DTT)

2.2.6. Isoelectric Focusing:

IEF Solubilisation Solution (8 M urea, 50 mM DTT, 4% CHAPS, 0.2% carrier ampholytes, 0.0002% bromophenol blue)

IEF Equilibration Buffer (50 mM Tris pH= 8.8, 6 M urea, 2% SDS, 20% glycerol, 2% DTT)

2.3. Recombinant proteins

The following proteins were purchased from companies:

GST-ULK1 (Abnova)

GST-Pim1 (SignalChem)

GST-Pim2 (SignalChem)

His-Pim3 (Millipore)

GST-PBK (Abnova)

GST-STK16 (Abnova)

MBP* (Sigma)

71 2. Materials and Methods 2.3. Recombinant proteins

The following proteins were expressed in bacteria and purified by other members of the lab:

GST-Sin1

His-p27

The following proteins were expressed in bacteria and purified as described below:

His-MBP-ULK1 1-278 K46N and mutants

His-MBP

His-MERTK 571-856 wt and K619N

2.4. His-MBP-ULK1 1-278 K46N purification

2.4.1. Pilot experiment

BL21 RIPL E. coli strain (Stratagene) was transformed with pDEST-HisMBP-ULK1 1-278 K46N plasmid and 100 ml of culture was grown to

OD600=0.6 in LB with 100 μg/ml ampicillin, 34 μg/ml chloramphenicol and 2% glucose.

A control culture of BL21 RIPL transformed with pDEST-His-MBP without the ccdB gene was grown. Expression was induced with 0.3 mM IPTG for 4 h at 27ºC. Cultures were split in two and centrifuged (3000 g, 20 min, 4ºC). All subsequent steps were performed on ice or in a cold room. Pellets were resuspended in 5 ml of Column Buffer or His Purification Phosphate Buffer and sonicated. The lysates were centrifuged

(10000 g, 20 min, 4ºC) and the supernatants were incubated with 100 μl of amylose resin (New England BioLabs) or Ni-NTA-agarose (QIAGEN) for 2 h at 4ºC with rotating. The mixtures were centrifuged (800 g, 1 min, 4ºC) and beads were washed 4

72 2. Materials and Methods 2.4. His-MBP-ULK1 1-278 K46N purification times with 1 ml of Column Buffer or His Purification Phosphate Buffer. The proteins were eluted with 60 μl aliquots of Column Buffer with 10 mM maltose or His

Purification Phosphate Buffer with 250 mM imidazole in 1.5 ml tube, by repeated resuspension of the beads and centrifugation (800 g, 1 min, 4ºC). 15 μl samples of the lysate, the pellet, the supernatant, the flow through, the first 2 wash and the first 3 elution fractions were taken. The pellet was resuspended in 5 ml of Column Buffer or

His Purification Phosphate Buffer before a sample was taken. Additionally, after 4 elution steps, 50 μl of Column Elution Buffer or His Purification Elution Buffer was added to the beads (100 μl) and 15 μl sample was taken. 5 μl of SDS-Loading Buffer

(6x) was added and samples were analysed by SDS-PAGE and Coomassie staining.

2.4.2. Column purification

Bacterial cultures described above were scaled up to 1 litre. All subsequent steps were performed on ice or in a cold room. Pellets were resuspended in 50 ml of Column

Buffer and sonicated. The lysates were centrifuged (10000 g, 20 min, 4ºC) and the supernatants were incubated with 2 ml of amylose resin (New England BioLabs) for 4 h at 4ºC with rotating. Then, the resin was packed into a gravity flow chromatography column (Bio-Rad) and washed in 25 ml of Column Buffer. Protein was eluted with

Column Buffer with 10 mM maltose and 0.4 ml fraction were collected. Protein concentration was estimated by Bradford assay (Bio-Rad) and the fractions with the highest protein concentration were pulled (usually 3 and 4). Glycerol was added to final concentration of 20%, the samples were frozen in liquid nitrogen and stored at -80ºC.

Protein concentration was assessed by SDS-PAGE with BSA (bovine serum albumin) standards and Coomassie staining.

73 2. Materials and Methods 2.5. His-MERTK 571-864 purification

2.5. His-MERTK 571-864 purification

BL21 RIPL E. coli strain (Stratagene) was transformed with pET28a-LIC-

MERTK 571-864 wt or K619N plasmid and 100 ml of culture was grown to OD600=0.6 in LB with 100 μg/ml ampicillin, 34 μg/ml chloramphenicol and 2% glucose.

Expression was induced with 0.1 mM IPTG for 4 h at 30ºC. Bacteria were harvested by centrifugation (3000 g, 20 min, 4ºC). All subsequent steps were performed on ice or in a cold room. Pellets were resuspended in 4 ml of Resuspension Buffer, sonicated and the lysates were centrifuged (10000 g, 20 min, 4ºC).

For purification from the soluble fraction, NaCl, imidazole and β- mercaptoethanol was added to the supernatant to the concentration indicated in

Refolding Buffer and the supernatant was incubated with 100 μl Ni-NTA-agarose

(QIAGEN) for 4 h at 4ºC with rotating. The incubated mixtures were centrifuged

(800 g, 1 min, 4ºC) and the beads were washed 4 times with 1 ml of Refolding Buffer.

The protein was eluted with 60 μl portions of Elution Buffer by repeated resuspension of the beads and centrifugation (800 g, 1 min, 4ºC).

For purification from the inclusion bodies, the pellet was washed twice by resuspention in 3 ml of Isolation Buffer, sonication and centrifugation (10000 g, 10 min,

4ºC). Then, the pellet was dissolved in 5 ml of Binding Buffer by stirring for 1 h at RT.

The solution was centrifuged (10000 g, 15 min, 4ºC) and incubated with 100 μl

Ni-NTA-agarose (QIAGEN) for 4 h at 4ºC with rotating. The incubated mixtures were centrifuged (800 g, 1 min, 4ºC) and the beads were washed 3 times with 1 ml of Wash

Buffer and 3 times with Refolding Buffer. The protein was eluted with 60 μl portions of

Elution Buffer by repeated resuspension of the beads and centrifugation (800 g, 1 min,

4ºC).

74 2. Materials and Methods 2.5. His-MERTK 571-864 purification

For all eluted fractions, protein concentration was estimated by Bradford assay

(Bio-Rad) and the fractions with the highest protein concentration were pulled. Glycerol was added to final concentration of 20%, the samples were frozen in liquid nitrogen and stored at -80ºC. Protein concentration was assessed by SDS-PAGE with BSA standards and Coomassie staining.

2.6. Bradford assay

Bradford reagent (Bio-rad) was diluted 4x in distilled water and 300 μl was mixed in 96-well plate with 5 μl of a sample. Absorbance was measured at 595 nm.

BSA (Pierce) was used as a concentration standard.

2.7. SDS-PAGE and western blotting

SDS polyacrylamide gel electrophoresis (SDS-PAGE) was run as described

[Laemmli 1970]. Running gel was prepared as follows: 0.375 M Tris pH=8.8, 0.1%

SDS, acrylamide/bis-acrylamide (30%/0.8% stock), 0.1% APS, 0.07% TEMED.

Stacking gel was prepared as follows: 0.125 M Tris pH=6.8, 0.1% SDS, 4%/0.1% acrylamide/bis-acrylamide, 0.1% APS, 0.1% TEMED. Electrophoresis was run in

Running Buffer at 120 V, 1.5 h. gels were stained with Instant Blue Stain (Expedeon) or proteins were transferred to PVDF membrane.

For western blotting, semi dry transfer (Transfer Buffer, 11 V, 3 h) was used for: p62, tubulin and Pim1 and wet transfer (Transfer Buffer with 0.1% SDS, 400 mA, 1 h) was used for ULK1. Membranes were blocked in TBS-T with 5% milk for 1 h at RT

(Blocking Buffer) and stained with a primary antibody diluted in Blocking Buffer overnight at 4ºC. Dilutions were as follows:

75 2. Materials and Methods 2.7. SDS-PAGE and western blotting

anti-ULK1 (N17, Santa Cruz, #sc-10900): 1:200

anti-Pim1 (12H8, Santa Cruz, #sc-13513): 1:1000

anti-p62 (MBL, #PM045): 1:2000

anti-tubulin (Sigma, #T6199): 1:4000

anti-V5 (Invitrogen, #R960-25): 1:5000

anti-myc (9E10, Santa Cruz, #sc-40): 1:400

anti-FLAG (M2, Sigma, #F3165): 1:500

After incubation, the membranes were washed in TBS-T (3x5min) and stained with secondary antibodies diluted 1:10000 in Blocking Buffer for 1 h at RT. As the secondary antibody, HRP-conjugated (GE Healthcare) or IRDye (Licor) antibodies were used. Membranes were washed in TBS-T (3x5min), and were either stained with ECL reagent (Pierce or GE Healthcare) and exposed to film or scanned using Odyssey system (Licor).

2.8. Cell culture, transfection, treatment and lysis

2.8.1. S2 cells

S2 cells were grown in Schneider's medium (Invitrogen) supplemented with 10%

FBS, 25 U/ml penicillin and 25 μg/ml streptomycin. For transfection, cells were seeded at concentration of 1 million cells/ml in 10 cm plates (10 ml medium/plate). After 24 h, cells were transfected (60 μg DNA/plate) using calcium phosphate transfection kit

(Invitrogen). For lysis, cells were harvested 48 h post transfection and washed 3 times in ice cold PBS. Then, cells were lysed in S2 Lysis Buffer for 30 min, on ice and the lysates were cleared by centrifugation (20,000 g, 10 min, 4ºC).

76 2. Materials and Methods 2.8. Cell culture, transfection, treatment and lysis

2.8.2. Mammalian cells lines (MEF, HEK293, Cos7, HeLa)

Cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) - high glucose (Sigma) supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin. For transfection, cells were seeded at 50% confluency and the next day were transfected using 15 μg DNA/10cm plate and jetPEI reagent

(Polyplus-transfection) according to the manufacturer's protocol. Medium was changed

24 hours post transfection.

For starvation, cells were washed twice with PBS and incubated in Earl's balanced salt solution (EBSS, Invitrogen) for 2 hours at 37°C. For the control cells, fresh DMEM was used instead of EBSS. For SMI4a treatment, cells were incubated with 0.5 μM SMI4a (Enzo) for 3 h. DMSO was used as negative control (5 μl/10 ml medium). For dephosphorylation assay, MnCl2 (1 mM) and 2 μl of λ Phosphatase (New

England BioLabs) was added to the lysate and the mixture was incubated for 30 min at

30 ºC.

For lysis, 48 h post transfection cells were washed with ice cold PBS, harvested in an indicated volume of ice cold TLB (Triton Lysis Buffer) and incubated on ice for

20 min. The lysates were cleared by centrifugation (20,000 g, 10 min, 4ºC). Protein concentration in the lysates (about 1g/ml) was adjusted by Bradford assay.

2.9. ULK1 expression in Drosophila S2 cells

S2 cells were transfected with pAc5.1/V5-TEV-HisB-ULK1wt or mutants. Cells were lysed in 500 μl of S2 Lysis Buffer per 10 cm plate. ULK1 was then pulled down using His or V5 tag. All incubations were performed at 4ºC with rotating. 1/3 of 10 cm plate was used per reaction. For His tag purification, lysates were incubated with of

77 2. Materials and Methods 2.9. ULK1 expression in Drosophila S2 cells

Ni-NTA-agarose beads (QIAGEN) for 3 h (20 μl beads/plate). For V5 tag, lysates were precleared by incubation with G-protein beads (GE Healthcare) for 1 h (20 μl beads/plate). Then, supernatants were incubated with anti-V5 antibody for 1 h

(2 μg/plate). Finally, G-protein beads were added (20 μl bead solution/plate) and lysates were incubated for 1 h. After incubation, beads were washed 3 times with S2 Lysis

Buffer, 30 μl of SDS-Loading Buffer (6x) was added and samples were analysed by western blot.

2.10. Pim1/ULK1 pull down assay

Cos7 cells were cotransfected with pcDNA3-myc-ULK1 and pc5FLAG-Pim1. pcDNA3 was used for mock transfection. One 10 cm plate was used per reaction. Cells were lysed in 1 ml TLB per plate. Aliquot of each lysate was mixed with of SDS-

Loading Buffer (6x) and saved for anti-myc western blot. 10 μg of anti-FLAG antibody

(Sigma) and 30 μl G-protein beads (GE Healthcare) were added per reaction, and the lysates were incubated with rotating for 4 h at 4ºC. Then, the beads were washed 5 times with TLB, resuspended in 30 μl of SDS-Loading Buffer (6x) and the samples were analysed by western blot.

2.11. Kinase assay

The kinase was combined with the substrate in a final volume of 30 μl of Kinase

Buffer with 0.25 μl of [γ-32P]-ATP (about 2.5 μCi). For GST-ULK1 activity testing additional reactions were set up using ARRAY Kinase Buffer supplied with the microarray kit (Invitrogen). For testing B-RAF as an ULK1 substrate, Kinase Buffer was supplemented with phosphatase inhibitors: 5 mM NaF, sodium 25 mM β-

78 2. Materials and Methods 2.11. Kinase assay glycerophosphate, 5 mM sodium pirophosphate. Reaction was performed for 30 min at

30ºC and stopped by adding 15 μl of SDS-Loading Buffer (6x). Samples were run on

SDS-PAGE and gels were dried, stained with Coomassie and exposed to film (Kodak).

2.11.1. Kinase

2.11.1.1. Recombinant kinases

The following recombinant kinases were used (amount per reaction specified in brackets): GST-ULK1 (75 ng), GST-Pim1 (0.5 μg), GST-Pim2 (0.5 μg), His-Pim3

(0.3 μg), GST-PBK (1 μg), GST-STK16 (1 μg).

2.11.1.2. V5-His-ULK1

ULK1 wt and the mutants were expressed in S2 cells and immunoprecipitated with anti-V5 antibody and washed twice with Kinase Buffer.

2.11.1.3. myc-ULK1

Cos7 cells were transfected with pcDNA3-myc-ULK1 and mutants. One 10 cm plate was used per reaction. Cells were lysed in 0.75 ml TLB per plate. 1 μg of anti-myc

9E10 antibody (Santa Cruz) and 30 μl G-protein beads (GE Healthcare) were added per reaction, and the lysates were incubated with rotating for 4 h at 4ºC. Then, the beads were washed 5 times with TLB and 3 times with Kinase Buffer.

79 2. Materials and Methods 2.11. Kinase assay

2.11.2. Substrate

2.11.2.1. Recombinant substrates

The following recombinant proteins were used as substrates (approximate amount per reaction specified in brackets): His-MERTK 571-856 wt or K619N (1 μg), His-

MBP-ULK1 1-278 K46N and alanine mutants (2 μg), His-p27 (2 μg), His-MBP (2 μg),

MBP* (myelin basic protein, 2 μg), GST-Sin1 (2 μg), GST (2 μg).

2.11.2.2. B-RAF

For myc-B-RAF kinase dead mutant overexpression, HEK293 cells were transfected with pEF-myc-B-RAF D594A and the cells were lysed in 1 ml TLB. One

10 cm plate was used per reaction. 1 μg of anti-myc 9E10 antibody (Santa Cruz) and

30 μl G-protein beads (GE Healthcare) were added per reaction, and the lysates were incubated with rotating for 4 h at 4ºC. Then, the beads were washed 5 times with TLB and 3 times with Kinase Buffer supplemented with phosphatase inhibitors: 5 mM NaF, sodium 25 mM β-glycerophosphate, 5 mM sodium pyrophosphate.

2.12. Phospho-site mapping by mass spectrometry

2.12.1. Kinase assay and sample preparation

0.5 μg of GST-Pim1 was incubated with about 2.5 μg of His-MBP-ULK1 1-

278 K46N or 1 μg of His-MERTK 571-856 K619N (purified from the soluble fraction) in 30 μl of Kinase Buffer at 30°C for 2 h. No GST-Pim1 was added to the negative control. 6 μl of SDS-Loading Buffer (6x) was added and 20 μl of each sample was loaded on SDS-PAGE. The gel was stained with Instant Blue Stain (Expedeon), the His-

MBP-ULK1 1-278 K46N band was excised from the gel and dehydrated using

80 2. Materials and Methods 2.12. Phospho-site mapping by mass spectrometry acetonitrile followed by vacuum centrifugation. Dried gel pieces were reduced with

10 mM dithiothreitol and alkylated with 55 mM iodoacetamide. Gel pieces were then washed alternately with 25 mM ammonium bicarbonate followed by acetonitrile. This was repeated, and the gel pieces dried by vacuum centrifugation. Samples were digested with trypsin, overnight at 37 °C.

2.12.2. Mass Spectrometry

Digested samples were analysed by LC-MS/MS using a NanoAcquity LC

(Waters, Manchester, UK) coupled to a LTQ Velos (Thermo Fisher Scientific, Waltham,

MA) mass spectrometer.

Peptides were concentrated on a pre-column (20 mm x 180 μm i.d, Waters). The peptides were then separated using a gradient from 99% A (0.1% formic acid in water) and 1% B (0.1% formic acid in acetonitrile) to 25% B, in 45 min at 200 nL/min, using a

75 mm x 250 μm i.d. 1.7 µM BEH C18, analytical column (Waters). Peptides were selected for fragmentation automatically by data dependent analysis.

2.12.3. Data Analysis

Data produced were searched using Mascot (Matrix Science UK), against the

Mouse IPI database, with phosphorylation included as a variable modification. Data were validated using Scaffold (Proteome Software, Portland, OR). Suggested sites of phosphorylation were further validated by manual inspection of the data.

81 2. Materials and Methods 2.13. In-gel kinase assay

2.13. In-gel kinase assay

Following starvation, cells were harvested in IGKA Lysis Buffer (300 μl per two

10 cm plates) and lysed by sonication. After the sonication, Triton X-100 was added to final concentration 1% and the lysates were incubated on ice for 30 min. The lysates were cleared by centrifugation (20,000 g, 10 min, 4ºC) and SDS-Loading Buffer (6x) was added. Polyacrylamide gel was prepared as described above, but His-MBP-

ULK1 1-278 K46N or His-MBP was added to final concentration of 0.25 mg/ml prior to electrophoresis.

The gel was washed twice in 50 mM Tris with 20% isopropanol, twice in

Buffer A and twice in Buffer A with 6 M guanidine hydrochloride. All washes were at

RT, in 100 ml volume, with shaking. Proteins were renatured by washing in 200 ml

Buffer A with 0.04% Tween-40 at 4°C with shaking. The buffer was changed 5 times, every few hours.

For the kinase assay, the gel was washed in 25 ml Buffer B at RT for 30 min and the kinase assay was performed by incubation in 25 ml Buffer B with 0.2 μM ATP and

2 μCi/ml [γ-32P]-ATP for 1 h at RT, with shaking. Then, the gel was washed in 200 ml

5% trichloroacetic acid with 1% sodium pyrophosphate at RT with several changes every few hours, until the radioactivity on the edges of the gel reached the background level. Then the gel was washed with water, dried and exposed to film (Kodak).

2.14. 2D in-gel kinase assay

MEFs were grown and starved as described above. For lysis, cells from one

10 cm plate were collected in 2.5 ml of IEF Solubilisation Solution, sonicated and centrifuged (20,000 g, 10 min, 4ºC). Precast immobilized pH gradient IPG gel strips pH

82 2. Materials and Methods 2.14. 2D in-gel kinase assay

3-10 non linear (Bio-Rad) were used for isoelectric focusing. Strips were rehydrated using 125 μl of the cell lysates and proteins were isoelectrofocused at 50μA/strip for

8000 V-h. For the second dimension separation, the strips were incubated for 10 min in

IEF Equilibration Buffer and laid over acrylamide gel prepared for in-gel kinase assay as described above. The strip was covered with 1% agarose gel in Running Buffer and

SDS-PAGE was run. Then, in-gel kinase assay was performed as described above.

2.15. Ion exchange chromatography

MEFs were grown, starved and lysed as described above, but four 10 cm plates were lysed in 1 ml of IGKA Lysis Buffer per sample. Samples of control and nutrient deprived cells were passed through 0.22 μm filter and fractionated using AKTA purification system and Resource Q column (GE Healthcare). 20 mM Tris pH=8.0 was used for separation. Elution in NaCl gradient was applied with the concentration ranging from 0 to 1 mM over 20 ml. 1 ml fractions were collected and 200 μl of SDS

Loading Buffer (6x) was added into each fraction. The whole procedure was performed at 4 °C. Fractions were pulled into groups of 3 or 4 and analysed with in-gel kinase assay as described above.

2.16. Pim1/ULK1/MBP kinase assay

HeLa cells were transfected with pcDNA3-ULK1 wt or K46R. Half of 10 cm plate was used per reaction. Following starvation, cells were lysed in 0.5 ml TLB per plate. Aliquot of each lysate was mixed with of SDS-Loading Buffer (6x) and saved for p62 western blot. 1 μg of anti-myc 9E10 antibody (Santa Cruz) and 30 μl G-protein beads (GE Healthcare) were added per plate and the lysates were incubated with rotating for 4 h at 4ºC. Then, the beads were washed 5 times with TLB and 3 times with

83 2. Materials and Methods 2.16. Pim1/ULK1/MBP kinase assay

Kinase Buffer. For a control reaction, 0.2 μg of GST-Pim1 and/or 2 μg of MBP* were added to the beads and incubated together with 0.25 μl of [γ-32P]-ATP (about 2.5 μCi) in 30 μl of Kinase Buffer for 30 min at 30ºC. The reaction was stopped by adding 15 μl of SDS Loading Buffer (6x). For the Pim1/ULK1/MBP* kinase assay, GST-Pim1 was added to the beads and the mixture was incubated in 30 μl of Kinase Buffer for 60 min at 30ºC. Then, the beads were washed 3 times with TLB and 3 times with Kinase Buffer and 2 μg of MBP* with 0.25 μl [γ-32P]-ATP (about 2.5 μCi) were added. Mixtures were incubated in total volume of 30 μl of Kinase Buffer for 30 min at 30ºC and stopped by adding 15 μl of SDS Loading Buffer (6x). Samples were run on SDS-PAGE and gels were dried, stained with Coomassie and exposed to film (Kodak). Phosphorylation was quantified using a phosphoimager (Fujifilm) and densitometry analysis.

2.17. Microarray screening

ProtoArray® Human Protein Microarray v5.0 Kinase Substrate Identification

(KSI) Complete Kit (Invitrogen) was used. The screening was performed according to the manufacturer's protocol with modifications. Briefly, the array was blocked for 1 h at

4°C with shaking in PBS with 1% BSA. Then the array was covered with ARRAY

Kinase Buffer (Invitrogen) containing 33 nM [γ-33P]-ATP (0.083 μCi/μl) and 120 nM

MAPK14 (positive control), no kinase (negative control) or 10 nM GST-ULK1 and incubated at 30°C for 30 min (positive control) or 1 h (negative control and ULK1 probed). After incubation, the array was washed with 0.5% SDS and water, dried and exposed to film for 6 h at RT, with an intensifying screen. In the second round of screening, only GST-ULK1 was used for probing and the reaction time was extended to

3 h.

84 2. Materials and Methods 2.17. Microarray screening

The film was scanned with 2400 dpi resolution, saved as 16-bit grayscale TIFF file and analysed with ProtoArray Prospector 5.2 (Invitrogen). A grid was aligned with the visible spots and the signal on the ULK1 probed array was compared to the signal on the negative control array. Positive hits were identified on the basis of Z-Factor and the criterion is described by the three rules outlined in the Prospector manual:

• The average Z-Factor is greater than 0.4, AND

• The coefficient of variation for the signals from the two replicates is less than

0.5, AND

• The mean signal of the replicates is at least 1.5 times that of the mean signals

from the corresponding features on the reference array, when data from a

reference microarray is available

The Z-Factor is defined as:

3 3 Z =1− s c− ∣s −c−∣

where:

σs - signal sample standard deviation for the protein features

σc- - signal sample standard deviation for the negative control features

μs - mean signal for the protein features

μc- - mean signal for the negative control features

85 2. Materials and Methods 2.17. Microarray screening

Additionally, each spot was inspected visually to eliminate false positives and pick up any possible spots missed by the programme.

86 3. ULK1 substrate screening 3. ULK1 substrate screening

3. ULK1 substrate screening

Several strategies for kinase substrates identification have been developed. One of the methods is screening of protein-expressing phage cDNA libraries in solid phase phosphorylation assay [Fukunaga 1997, Fukunaga 2004]. However, this technique is very labour and time consuming and appears to be often unsuccessful. It tends to give high background levels resulting in low signal to noise ratio and many identified colonies are false positives [M. Ehrhardt, personal information]. In another approach the kinase of interest is purified from cells together with proteins bound to it and a kinase assay is performed within the complex. Phosphorylated proteins are then identified by mass spectrometry. The limitation of this method is that it relies on a stable binding between the kinase and its substrates. Moreover, a number of ULK1 binding partners have already been identified in coprecipitation assays and none of them appeared to be a

ULK1 substrate. Thus, I decided to use a novel approach which is protein microarray screening.

ProtoArray Human Protein Microarray available from Invitrogen is a nitrocellulose coated glass slide containing about 9000 human proteins printed on its surface. Screening is performed by incubation of the array with the kinase of interest and radiolabelled ATP. The array is then exposed to a film and detected spots are compared to negative control (no kinase or a kinase dead mutant added). Specific spots are likely to represent substrates, but candidates must be confirmed in standard kinase assays.

87 3. ULK1 substrate screening 3. ULK1 substrate screening

Even though using protein chips is easy, quick and efficient, there are also some drawbacks of this method. Firstly, not all human proteins are included in the array.

Moreover, some of those which are present are truncated versions. Especially kinases are represented as kinase domains only. Thus, they may lack regulatory regions, which may be phosphorylated by the kinase investigated. Secondly, some of the proteins are kinases themselves which is a source of false positive signal due to autophosphorylation. Finally, proteins printed are expressed in insect cells. This means they may lack specific posttranslational modifications. However, most of these issues are also present in the phage library screening method. On the other hand, protein microarrays provide simple, fast and sensitive methods for kinase substrate identification. The main difficulty in performing the screening appeared to be obtaining sufficient amount of pure and active ULK1.

3.1. Purification of ULK1

Purity of the kinase is essential for the screening since contamination with other protein kinases will produce false positive signals. Thus, I decided to use the TEV

(tobacco etch virus) purification system [Waugh 2005, Jeon 2005] for ULK1 purification. In this system, a tagged protein is purified by affinity chromatography.

Then, the tag is cleaved off by TEV protease and the sample is loaded again on the column. Unspecifically binding proteins are retained in the column, while the protein of interest is collected in the flow through fraction.

To obtain a sufficient amount of ULK1, I considered using bacterial or insect cell expression system. To express ULK1 in E. coli, I tried to clone a fragment encoding the first 400 amino acids into pMALc2X vector providing the MBP tag. The MBP-tagged

88 3. ULK1 substrate screening 3.1. Purification of ULK1

ULK1 was then to be subcloned into a vector containing features for TEV purification.

However, due to a single base pair deletion which occurred at the ligation site during the cloning into pMALc2X vector, I did not manage to express ULK1 in bacteria (data not shown). Importantly, all clones which were confirmed by restriction enzyme analysis to carry ULK1 insert contained this mutation. I tried to introduce the missing base by site directed mutagenesis, but this was unsuccessful. One explanation is that basal expression of ULK1 protein could be toxic for the bacteria, resulting in selection of clones carrying the frame shift mutation.

For insect cell expression system, I chose the Drosophila S2 cell line. To use the

TEV system, I modified pAc5.1/V5-HisB vector by introducing the TEV digestion site between the His and V5 tags, and cloned the full length ULK1 open reading frame into the resulting vector. I also mutated lysine 46 to asparagine, to produce a kinase dead mutant. To test if the His tag introduced was functional and could be used for purification, I performed pull down assays using Ni-NTA-agarose resin (Fig. 7). Both the wild type form and the K46N mutant were successfully precipitated using

Ni-NTA-agarose beads or the anti-V5 antibody. The K46N mutant migrated faster than the wild type form and the yield of protein was higher. No band corresponding to ULK1 was observed in mock transfected cells. These results indicated that both ULK1 tags were functional and His tag could be used for the purification of ULK1.

89 3. ULK1 substrate screening 3.1. Purification of ULK1

Fig. 7. ULK1 pull down assay. Wild type ULK1 (wt) or the kinase dead K46N mutant (kd) were overexpressed in S2 cells and the proteins were pulled down (PD) using Ni2+-beads or immunoprecipitated with an anti-V5 antibody (V5). Mock transfected cells were used as a negative control (-). ULK1 was detected by western blot (WB, anti- V5). Asterisk (*) indicates the antibody heavy chain band. Hash (#) corresponds to an unspecific band. Upward mobility shift was observed for the wild type form of ULK1.

To verify the activity of recombinant ULK1, I tested its ability to phosphorylate

GST-tagged Sin1 expressed and purified from bacteria in our laboratory. Sin1 was identified by our group as a ULK1 substrate [A. Whitmarsh, unpublished data], by homology analysis of about 200 putative substrates of yeast Atg1 identified in microarray screening experiment [Ptacek 2005]. The result shows that ULK1 wt overexpressed and pulled down from S2 cells with anti-V5 antibody phosphorylates

GST-Sin1, while only background phosphorylation was observed for mock transfected cells (Fig. 8). The kinase activity of ULK1 was specific towards Sin1, since no GST phosphorylation was detected. This supports the idea that Sin1 is a substrate of ULK1.

Sin1 phosphorylation by ULK1 K46N was comparable to the background signal, which confirms that this mutant is kinase dead and that Sin1 phopshorylation results from

ULK1 activity and not from any co-purified endogenous kinase. Autophosphorylation

90 3. ULK1 substrate screening 3.1. Purification of ULK1 of ULK1 wt, but not K46N, was also observed and addition of the substrate was accompanied by a decrease in the autophosphorylation signal detected.

Fig. 8. ULK1 kinase assay. Wild type ULK1 (wt) or kinase dead K46N mutant (kd) were overexpressed in S2 cells. Mock transfected cells were used as a negative control (-). The proteins were immunoprecipitated using anti-V5 antibody and a kinase assay was performed using GST-Sin1 or GST as a substrate, in the presence of radiolabelled ATP. Phosphorylation of Sin1 and autophosphorylation was observed for the wild type form of ULK1.

To scale up the expression in S2 cells, I tried to establish a stable cell line. I cotransfected the cells with pCoHygro vector and pAc5.1/V5-TEV-HisB-ULK1 to select stably transfected clones with hygromycin. However, a few trials using different

S2 cells substrains failed. The main problems appeared to be adjusting the hygromycin concentration and the toxicity associated with ULK1 overexpression.

91 3. ULK1 substrate screening 3.1. Purification of ULK1

Meanwhile, a recombinant full length GST-tagged ULK1 became commercially available from Abnova. Since company dos not guarantee GST-ULK1 kinase activity and does not sell it as an active protein, I verified the possibility of using this recombinant protein for the screening by testing its ability to phosphorylate myelin basic protein (MBP*) in in vitro protein kinase assay. In the assay I used both HEPES kinase buffer (HEPES KB) and the kinase buffer supplied with the microarray kit

(ARRAY KB). ULK1 phosphorylated MBP* in both buffers, although its activity was lower in the ARRAY KB, which was demonstrated both by weaker MBP* phosphorylation, as well as lower autophosphorylation signal (Fig. 9). It is also indicative that GST-ULK1 kinase activity changed from batch to batch (1 and 2 in Fig.

9). It is possible that the storage of batch 2 at -80ºC for a few months had affected its activity. Therefore I used batch 1 to probe the array immediately after this experiment to prevent any potential loss of activity.

92 3. ULK1 substrate screening 3.1. Purification of ULK1

Fig. 9. Testing activity of recombinant GST-ULK1 (Abnova). Kinase assay was performed by incubating GST-ULK1 with MBP* in the presence of radiolabelled ATP. Two different kinase buffers were used: HEPES KB or ARRAY KB, the latter one supplied with the microarray kit. Two different batches of ULK1 were tested: (1) and (2). results of the assay were analysed by autoradiography and MBP* was visualised by Coomassie staining. ULK1 was able to phosphorylate MBP* and autophosphorylate. ULK1 activity was lower when ARRAY KB was used. The two batches also differed in the level of kinase activity, with batch (2) being less active.

3.2. Probing the microarray

I probed the protein microarray with GST-ULK1 according to the protocol supplied by the manufacturer (Fig. 10a). Additionally, I included two other arrays in the screening corresponding to negative and positive controls. The negative control microarray was treated the same way as the one probed with GST-ULK1, but no kinase was present in the reaction buffer. In the positive control, GST-ULK1 was substituted by

MAPK14 (mitogen-activated protein kinase 14) supplied with the kit. Arrays were then exposed to a film and the images were analysed. Autophosphorylation signal from the control kinase printed on the array (PKCη, protein kinase C isoform η) was detected

(Fig. 10b), which allowed to align the image with a grid to identify the spots. Also,

93 3. ULK1 substrate screening 3.2. Probing the microarray

MAPK14 phosphorylated its control substrate, MAPKAP (mitogen-activated protein kinase associated protein 1) (Fig. 10b), which indicates that the conditions of the assay were optimal.

Specific spots were identified using Prospector software supplied by the manufacturer. Additionally, I inspected each spot printed on the array visually, to eliminate false positives and pick up any possible spots missed by the programme.

Using the Z-factor based criterion, Prospector identified 4 positive hits. However, after visual inspection, only one of them, proto-oncogene tyrosine-protein kinase MER

(MERTK, amino acids 578-872) appeared to be true positive (Fig. 10c). A signal on one of the two MERTK spots was observed also on the negative control array. However, it clearly originates from strong autophosphorylation of the neighbouring protein. The signal observed on the other MERTK spot was at the background level. In contrast, both spots were phosphorylated on the array treated with GST-ULK1, which indicates specific phosphorylation of MERTK by ULK1.

The limited number of ULK1 substrate candidates detected in the screening might have resulted from low GST-ULK1 kinase activity. On the other hand, the autophosphorylation signal on the array was lower when it was treated with GST-ULK1 compared to the negative control treatment (Fig. 10b PKCη, compare Ctrl and ULK1).

Thus, I repeated the screening using one more microarray incubated with ULK1. The kinase reaction was performed for 3 h instead of 1 h. Then, I compared the result to the same control array which was used in the first round of the screening. This time,

Prospector identified 17 positive hits, of which 5 were confirmed visually (Fig. 10d).

Again, a specific signal was observed for MERTK. A much weaker, but specific signal was also detected for: nucleolar protein 4 (NOL4), TBC1 domain family member 22B

94 3. ULK1 substrate screening 3.2. Probing the microarray

(TBC1D22B), v-raf murine sarcoma viral oncogene homologue B1 (B-RAF, aa 452-

719) and activin A receptor type II-like 1 (ACVRL1, aa 139-503). Notably, no specific signal was observed for the spot representing known ULK1 substrates, Raptor and

Atg13. To validate the data obtained from the screening, phosphorylation of MERTK and B-RAF was tested by in vitro kinase assay.

95 3. ULK1 substrate screening 3.2. Probing the microarray

Fig. 10. Microarray screening. The microarray was incubated with MAPK14, ULK1 or no kinase (Ctrl) and radiolabelled ATP and exposed to a film. a) General overview of the array treated with ULK1. b) Phosphorylation of the control spots: PKCη (autophosphorylating kinase), MAPKAP (positive control for MAPK14) and GST (negative control). c) Results of the first round of screening showing positive hit (MERTK) and false positive hits picked up by Prospector software (CAMK1D, S100A7, PRKD2). d) Results of the second round of screening showing positive hits (MERTK, NOL4, TBC1D22B, BRAF, ACVRL1). Raptor and Atg13 were not phosphorylated by ULK1 in this assay (bottom panel).

96 3. ULK1 substrate screening 3.3. Testing the candidates

3.3. Testing the candidates

3.3.1. MERTK

His-tagged 571-856 fragment of MERTK, both wild type and kinase dead K619N mutant, was expressed in E. coli. This fragment corresponds to the kinase domain of

MERTK and covers the one represented on the microarray. Since the protein was not entirely soluble, I purified it both from the soluble fraction and the inclusion bodies. The protein obtained from the inclusion bodies was much purer than the one from the soluble fraction (Fig. 11).

Wild type MERTK purified from the soluble fraction displayed high level of autophosphorylation, while no autophosphorylation was observed for the kinase dead mutant (Fig. 11a). This was consistent with upward mobility band shift of the wild type form, but not of the kinase dead mutant. The wild type kinase purified from the inclusion bodies was inactive. This is most probably caused by the inability of the protein to refold properly after the purification process involving denaturation. Activity of GST-ULK1 was validated by MBP* phosphorylation and autophosphorylation (Fig.

11b). GST-ULK1 phosphorylated the inactive variants of MERTK (Fig. 11a). However, the level of phosphorylation was significantly lower, compared to that of MERTK autophosphorylation. Therefore, at this point it is difficult to firmly confirm that

MERTK is a substrate of ULK1.

97 3. ULK1 substrate screening 3.3. Testing the candidates

Fig. 11. MERTK phosphorylation by ULK1. a) Kinase assay was performed using GST-ULK1 and His-MERTK 571-856 in the presence of radiolabelled ATP. His- MERTK 571-856 wild type (wt) or kinase dead K619N mutant (kd) was expressed in bacteria and purified either from the soluble fraction (S) or the inclusion bodies (IB). Weak phosphorylation of MERTK by ULK1 was observed. b) GST-ULK1 activity was confirmed by MBP* (myelin basic protein) phosphorylation. His-MBP was used as a negative control.

Although the phosphorylation of MERTK by ULK1 in the in vitro kinase assay was weak, it could play a role under physiological conditions. Thus, I tried to identify

MERTK sites phosphorylated by ULK1. Such information would allow to verify the specificity of the signal observed in the kinase assay by mutating these sites to alanine and observing a decrease in band intensity. Moreover, mutants could be analysed for biological activity, in particular the potential role of MERTK phosphorylation in autophagy could be investigated. Thus, I performed a kinase reaction with GST-ULK1

98 3. ULK1 substrate screening 3.3. Testing the candidates and bacterially expressed His-MERTK 571-856 K619N purified from the soluble fraction and analysed MERTK modifications by mass spectrometry. However, no phosphorylation was detected.

3.3.2. B-RAF

The optimal substrate for ULK1/B-RAF kinase assay would be B-RAF expressed in bacterial system. However, several attempts to produce recombinant B-RAF have been unsuccessful [I. Arozarena, personal information]. Thus, I overexpressed myc- tagged full length B-RAF D594A kinase dead mutant in HEK293 cells. B-RAF was purified by immunoprecipitation prior to being used as a substrate in the kinase assay

(Fig. 12). A high level of B-RAF phosphorylation was detected even in the absence of

GST-ULK1 and addition of GST-ULK1 did not cause any increase in signal intensity.

GST-ULK1 activity was confirmed by MBP* phosphorylation. Therefore, these results did not allow to confirm that B-RAF is a ULK1 substrate.

99 3. ULK1 substrate screening 3.3. Testing the candidates

Fig. 12. B-RAF phosphorylation by ULK1. myc-B-RAF D594A was overexpressed in HEK 293 cells, immunoprecipitated with anti-myc antibody and a kinase assay was performed with GST-ULK1 in the presence of radiolabelled ATP. The presence of myc- B-RAF D594A in the reaction mixture was confirmed by western blot (WB, anti-myc). GST-ULK1 activity was confirmed by MBP* phosphorylation. His-MBP was used as a negative control. B-RAF phosphorylation was not increased by GST-ULK1.

3.4. Discussion

3.4.1. Obtaining active ULK1

To produce active ULK1, I considered two expression systems: bacteria and insect cells. Expression in bacterial cells is easy and produces high yields of protein.

Moreover, there are not many kinases in bacteria which are likely to phosphorylate

100 3. ULK1 substrate screening 3.4. Discussion human proteins. Thus, bacterial kinases co-purified with ULK1 are unlikely to give false positives during the screening. On the other hand, bacterial systems do not reproduce the posttranslational modifications observed in mammalian cells and important for protein activity. Furthermore, mammalian proteins in bacteria may not fold properly and resulting in formation of inclusion bodies. To address the later issue, I decided to express only the first 400 aa of ULK1, which comprises a fragment shown to posses the kinase activity [Yan 1998, Tomoda 1999]. I tried to clone ULK1 1-400 into pMALc2X vector, providing MBP tag, which was reported to increase protein solubility

[Kapust 1999]. However, the cloning was unsuccessful, since a single base pair deletion occurred in all clones containing the insert. It is possible that ULK1 expression is toxic for the bacteria, thereby leading to the selection of colonies carrying this frame shift mutation, which impaired ULK1 translation. The toxicity may arise from the kinase activity of ULK1, which is consistent with the fact that I managed to express the kinase dead kinase domain of ULK1 in bacteria (see 4. Upstream regulation of ULK1).

In contrast to bacteria, most posttranslational modifications occur in insect cells and the folding environment is similar to the one found in mammalian cells.

Furthermore, although insect cells contain more kinases, the evolutionary distance between mammals and insects suggests that insect kinases are unlikely to phosphorylate human substrates. Although the yield of protein expression is much lower in S2 than in bacterial cells, S2 cells can be grown in solution and purification of the recombinant protein is easier than for mammalian cells. In this study, I expressed ULK1 in S2 cells. I also successfully precipitated both wt and kinase dead forms of ULK1 using either His or V5 tag (Fig. 7). ULK1 wt migrated slower than the kinase dead form, which is consistent with the idea that ULK1 autophosphorylates [Yan 1998, Tomoda 1999].

101 3. ULK1 substrate screening 3.4. Discussion

To examine the activity of ULK1 expressed in S2 cells, I performed a kinase assay using GST-Sin1 as a substrate (Fig. 8). I found that ULK1 specifically phosphorylated Sin1, confirming that Sin1 is a putative ULK1 substrate. Sin1 was predicted by our group to be phosphorylated by ULK1 on the basis of protein homology analysis [A. Whitmarsh, unpublished data]. It is a homologue of yeast AVO1, which was identified as a substrate of Atg1, the yeast homologue of ULK1, in a global analysis of protein phosphorylation [Ptacek 2005]. Sin1 is a component of mTORC2 and is necessary for mTOR activity [Yang 2006a]. Its phosphorylation by myc-tagged ULK1 overexpressed in Cos7 cells was also shown by our group [K.E. Lee, unpublished data].

However, the function of the phosphorylation remains unknown.

Although both His and V5 tag were functional and could be used for purifying

ULK1, a significant amount of contamination was observed on the Coomassie stained gel and unspecific signals were detected by autoradiography. For this reason additional purification steps, including gradient elution from Ni2+-resin and TEV cleavage should be considered prior to using ULK1 expressed in S2 cells for the array screening. To obtain sufficient amounts of the protein, I decided to generate a stable S2 cell line.

However, a few trials using different S2 cells substrains failed. Meanwhile, recombinant, full length ULK1 became available commercially. I found that the kinase was active (Fig. 9), thus I decided to use it for protein microarray experiment.

3.4.2. Screening results

To perform the substrate screening, I probed the protein microarrays with no kinase (negative control), ULK1 (experimental sample) or MAPK14 (positive control).

MAPK14 successfully phosphorylated its control substrate, MAPKAP, and no

102 3. ULK1 substrate screening 3.4. Discussion phosphorylation was observed for GST, a negative control. Autophosphorylation of the reference spots, which were PKCη, was observed for all three arrays (Fig. 10b).

Interestingly, these signals decreased when the microarray was probed with ULK (Fig.

10b). This effect is hard to explain. One could expect that it could be due to some components present in the buffer in which ULK1 was supplied. However, according to the company, this buffer contained only Tris base and glutathione. Other explanation could be that ULK1 competes with the printed kinases for ATP to autophosphorylate.

Despite this artefact, I considered that the method was properly set up to obtain specific phosphorylation signal. In the first round of screening, MERTK was the only positive hit identified. (Fig. 10c).

I anticipated that the limited number of positive hits could be a result of a low level of ULK1 activity. Although activity of different kinases cannot be compared by their molar concentrations, the manufacturer recommends using 50 μM kinase for the screening. The concentration of ULK1 that I used was 10 μM. This was the maximum possible amount, due to the fact that the volume added should not exceed 10% of the total reaction volume to prevent dilution of the kinase buffer. Thus I decided to probe one more array, this time prolonging the reaction time from 1 to 3 hours. Since ULK1 inhibited autophosphorylation of the kinases printed on the array, I was able to compare the results to the control array from the first screening. In the second round, 5 hits were identified: MERTK, NOL4, TBC1D22B, B-RAF, ACVRL1 (Fig. 10d).

During my research project I tested two of the identified potential ULK1 substrates. B-RAF is a serine/threonine kinase involved in MAP kinase signalling

[Hagemann 1999]. Phosphorylation of B-RAF by ULK1 could not be confirmed by in vitro kinase assay using immunoprecipitated kinase dead B-RAF overexpressed in

103 3. ULK1 substrate screening 3.4. Discussion

Cos7 cells (Fig. 12). The result shows that B-RAF was already phosphorylated when no

ULK1 was included in the assay. Consequently, it is possible that the phosphorylation of

B-RAF by ULK1 was masked by the background, which is likely to originate from kinases coprecipitated with B-RAF. Therefore, the ideal solution for this problem would be to express B-RAF in bacteria. However, I could not find any reports about successful bacterial expression of B-RAF, which was confirmed by our collaborators [I. Arozarena, personal information]. Another solution would be to use a kinase inhibitor, like FSBA

(5’-fluorosulfonylbenzoyladenosine), to diminish the kinase activity in the immunoprecipitate. FSBA inhibits kinases permanently binding covalently to the ATP binding site of a kinase [Vereb 2001]. Thus, the free FSBA could be washed away before performing the ULK1 kinase assay.

Another substrate I tested was MERTK. MERTK is a receptor tyrosine kinase expressed in monocytes and tissues of epithelial and reproductive origin (thus: MER) and was identified as a human protooncogene. Its overexpression was observed in B- and T-cell acute leukemia cell lines [Graham 1994]. The role of MERTK in promoting cell proliferation is based on its ability to activate numerous signalling pathways, such as: Erk1/2 [Chen 1997], Grb2/PI3KC1/Akt and NF-κB [Georgescu 1999]. Furthermore, mutations leading to MERTK depletion are associated with a genetic disease called retinis pigmentosa [Gal 2000]. This disease is associated with the accumulation of shed off outer segments of rod cones due to defects in their phagocytosis by retinal pigment epithelial cells [reviewed in Strick 2010]. MERTK depletion was also shown to impair clearance of apoptotic cells [Camenisch 1999]. The investigation of the molecular role of MERTK in phagocytosis revealed Gas6 to be a MERTK ligand. Gas6 opsonises apoptotic cells binding to phosphatidylserine exposed on their surface [Nakano 1997].

104 3. ULK1 substrate screening 3.4. Discussion

Binding of Gas6 to MERTK results in cytoskeleton rearrangements by activating PKC,

FAK (focal adhesion kinase) [Tibrewal 2008] and Rho family proteins like Rac, Cdc42 and RhoA [Mahajan 2003]. MERTK was also shown to recruit myosin to the sites of cargo binding [Strick 2009]. All these events lead to membrane invagination thus facilitating the cargo ingestion. Since membrane remodelling is a feature observed in autophagy, I speculated that MERTK could be involved in autophagy initiation and vesicle nucleation. In fact, recent studies by Tang et al. demonstrated that myosin II plays a crucial role in autophagy and that it is regulated by ULK1 in this process

[Tang 2011]. Therefore, phosphorylation of MERTK by ULK1 could be responsible for recruiting myosin II to the sites of autophagosome formation.

However, although strong signal was observed for MERTK on the microarray, I could not confirm MERTK phosphorylation by ULK1 in the in vitro kinase assay (Fig.

11). The substrate used for the assay was a bacterially expressed kinase domain of

MERTK. Therefore, it is possible that the phosphorylation of MERTK by ULK1 requires posttranslational modifications which do not occur in bacteria. Thus, further investigation of the role of MERTK in autophagy will be required. For example, changes in its activity upon starvation, which can be achieved by anti phospho-tyrosine western blot, or the effect of MERTK depletion on autophagy could be examined.

Furthermore, the localisation of MERTK to the LC3 positive structures in cells undergoing autophagy could be determined by immunostaining and fluorescent microscopy.

Three other potential ULK1 targets remain to be tested: NOL4, a nucleolar protein of unknown function [Ueki 1998], ACVRL1, a TGF-β (transfroming growth factor β) receptor [Attisano 1993] and TBCD22B. The exact function of TBCD22B is

105 3. ULK1 substrate screening 3.4. Discussion unknown, but it contains a TBC domain which is characteristic of Rab GTPase activating proteins [Ishibashi 2009]. Interestingly, ULK1 interaction with Rab proteins was found to play a role in neurite outgrowth regulation [Tomoda 2004].

The limited number of novel ULK1 substrates identified may be a consequence of the quality of the kinase used. The protein sold by Abnova is GST-tagged full length

ULK1 expressed in wheat germ extract. Although the method used by the company allows to obtain high yields of very pure protein, posttranslational modifications are not carried out in this system. Moreover, although the company report that correct folding and biological functions are retained for most of the proteins expressed this way, they do not guarantee the kinase activity of ULK1. In fact, I observed significant variations in the level of kinase activity in different batches (Fig. 9), supporting the idea that the kinase activity and the specificity of substrate recognition may be affected by the expression method. Consistently, I could not observe phosphorylation of either Atg13 or

Raptor printed on the microarray (Fig. 11), even though it was reported that multiple

Raptor sites are phosphorylated by ULK1 [Dunlop 2011].

In my study I chose the approach recommended by the manufacturer, which is using highly pure, recombinant kinase. An alternative strategy could be to overexpress a tagged protein in mammalian cells and a small scale purification. The main drawback of this method would be dealing with proteins co-purified with ULK1. These may be kinases (like AMPK, mTOR and possibly other undiscovered binding partners of

ULK1, as well as unspecifically bound proteins), which would result in high number of false positives. However, a kinase dead version of ULK1 could be used as negative control to subtract this background.

106 3. ULK1 substrate screening 3.4. Discussion

Apart from the problems with the quality of the kinase used for the screening, one has to bear in mind that the number of proteins printed on the microarray is limited.

Moreover, some of them are represented in truncated versions. Thus, other methods of

ULK1 substrate identification should be considered, like analysing protein complexes co-purified with ULK1 by mass spectrometry. However, a number of ULK1 binding partners have been identified in such studies, but none of them have been shown to be phosphorylated by ULK1 [Okazaki 2002, Hara 2008].

107 4. Upstream regulation of ULK1 4. Upstream regulation of ULK1

4. Upstream regulation of ULK1

The kinase domain of ULK1 possesses a motif characteristic of serine/threonine protein kinases called the activation loop comprising 165-174 and 178-191 residues

[NCBI: NP_033495.2, Conserved Domain Database: cd00180, Marchler-Bauer 2011].

Phosphorylation of this motif is well known to induce conformational changes within the kinase domain which affects kinase activity [Hanks 1995, Johnson 1998]. Since mTORC1 and AMPK were shown to phosphorylate the PS or CT domain of ULK1

[Hosokawa 2009, Jung 2009, Kim 2011, Egan 2011], I anticipated that ULK1 activity could be affected by other kinases.

To test if phosphorylation of the activation loop of ULK1 could modulate ULK1 activity, I mutated serines and threonines within this region, namely S174, T180 and

S184, in the S2 cell expression construct and analysed the activity of the mutants based on their ability to phosphorylate GST-Sin1. The activity of ULK1 T180A and

ULK1 S184A was dramatically decreased compared to that of the wild type form and was comparable to the K46N mutant (Fig. 13). Background level of phosphorylation of

GST-Sin1 was observed, even though the amount of ULK1 T180A and S184A present in the assay was higher than the wild type form, as detected by western blot.

Furthermore, autophosphorylation of both mutants was diminished, which is consistent with accelerated migration of these proteins analysed by SDS-PAGE. To examine whether the decrease in the activity is caused by the loss of phosphorylation, I tested if mutating T180 and S184 to aspartic acid would affect ULK1 activity. In contrast to what

I expected, both mutations appeared to have an inhibitory effect on the kinase activity of

108 4. Upstream regulation of ULK1 4. Upstream regulation of ULK1

ULK1. A possible explanation is that the aspartic acid residue failed to mimic phosphorylation and the mutations led to conformational changes of ULK1 structure which impaired its kinase activity.

Interestingly, S174A mutant appeared to be hyperactive as demonstrated by high level of ULK1 S174A autophosphorylation and increased phosphorylation of GST-Sin1.

Consistently, ULK1 S174A migrated at the same level as the wild type form. These results support the idea that ULK1 activity is regulated by phosphorylation within its activation loop. Thus, I decided to identify a kinase responsible for phosphorylating the kinase domain of ULK1 by in-gel kinase assay.

109 4. Upstream regulation of ULK1 4. Upstream regulation of ULK1

Fig. 13. ULK1 activation loop mutagenesis. Serine and threonine residues present in the activation loop of ULK1 were mutated to alanine or aspartic acid. Proteins were expressed in S2 cells and immunoprecipitated with anti-V5 antibody. Kinase assay was performed in the presence of radiolabelled ATP, using GST-Sin1 as a substrate. GST-Sin1 was visualised by Coomassie staining and the expression of ULK1 wt and mutants was determined by western blot (WB, anti-ULK1). GST-Sin1 phosphorylation was quantified by phosphoimager. T180 and S184 mutation to either alanine or aspartic acid decreased ULK1 activity. Interestingly, S174A mutant appeared to be hyperactive.

4.1. ULK1 1-278 K46N purification

To obtain enough recombinant protein for the in-gel kinase assay, I decided to express the ULK1 kinase domain K46N mutant in E. coli. The 1-278 fragment of

ULK1 K46N was subcloned into a set of pDEST vectors to obtain His-MBP-ULK1 1-

110 4. Upstream regulation of ULK1 4.1. ULK1 1-278 K46N purification

278 K46N, GST-ULK1 1-278 K46N and His-ULK1 1-278 K46N. All three proteins were efficiently expressed in E. coli BL21 RIPL strain (data not shown). At first, I decided to continue with GST-ULK1 1-278 K46N. However, after lysis, almost all GST-

ULK1 1-278 K46N was present in the insoluble fraction (data not shown). Thus, I decided to use the construct expressing His-MBP-ULK1 1-278 K46N protein, since the

MBP tag was shown to efficiently improve protein solubility [Kapust 1999]. In fact, when His-MBP was used, a significant portion of His-MBP-ULK1 1-278 K46N was found in the soluble fraction (Fig. 14). I performed a pilot experiment to purify

ULK1 1-278 K46N from 50 ml of bacterial culture using either His or MBP tag (Fig.

14). His-MBP protein served as a positive control. His-MBP was successfully purified using either tag, but His tag purification was much more efficient. In the case of His-

MBP-ULK1 1-278 K46N, the yield was similar when either His or MBP tag was used.

However, the protein was much purer in the latter case. Then, I scaled up the process to

1 litre cultures. After a few rounds of purification using amylose resin, I managed to obtain a few milligrams of His-MBP-ULK1 1-278 K46N which could be used to perform the in-gel kinase assay.

111 4. Upstream regulation of ULK1 4.1. ULK1 1-278 K46N purification

Fig. 14. Purification of His-MBP-ULK1 1-278 K46N – pilot experiment. His-MBP- ULK1 1-278 K46N was expressed in bacteria in small volume (50 ml) and purified using either the His tag (Ni2+) or the MBP tag (amylose) (a). His-MBP was used as a positive control (b). Samples of each fraction were taken and analysed by SDS-PAGE. Fractions analysed were as follows: P - pellet, S - supernatant, FT - flow trough, W1, W2 - first and second wash, F1, F2, F3 - first, second and third eluted fraction, B - beads. Amylose purification resulted with higher purity and yields of His-MBP- ULK1 1-278 K46N.

4.2. In-gel kinase assay

In the in-gel kinase assay I analysed lysates prepared from MEFs. To identify kinases whose activity is regulated during autophagy, I used unstarved (control) or nutrient deprived fibroblasts. Autophagy induction was confirmed by the decrease in p62 level [Bjørkøy 2009] (Fig. 15b). His-MBP-ULK1 1-278 K46N was mixed into polyacrylamide gel prior to SDS-PAGE analysis of the cell lysates. His-MBP protein was used as a negative control. The proteins were then renatured within the gel by sequential washing. The kinase assay was performed by incubating the gel in kinase

112 4. Upstream regulation of ULK1 4.2. In-gel kinase assay buffer with radiolabelled ATP. The radioactive spots detected by autoradiography represented kinases present in the cell lysates which phosphorylated the substrate (His-

MBP-ULK1 1-278 K46N) contained in the gel (Fig. 15a). Autophosphorylation of the renatured kinases and unspecific phosphorylation of His-MBP was demonstrated in the control gel containing His-MBP. In the gel containing His-MBP-ULK1 1-278 K46N, one strong and specific band was detected at 34 kDa. Importantly, this band was observed only in the starved cells, which indicates the presence of a kinase activated during autophagy and phosphorylating the kinase domain of ULK1.

Fig. 15. Detection of a ULK1 kinase by in-gel kinase assay. a) Lysates of untreated (Ctrl) or nutrient deprived (ND) MEFs were run on a polyacrylamide gel containing His-MBP-ULK1 1-278 K46N. His-MBP was used as a negative control. Resolved proteins were renatured and a kinase assay was performed in the presence of radiolabelled ATP. A 34 kDa kinase specifically phosphorylating ULK1 1-278 K46N was detected in nutrient deprived MEFs only. b) Autophagy induction in starved MEFs was confirmed by decreased p62 level (WB, anti-p62). Tubulin was used to monitor protein loading (anti-Tub).

4.3. Identification of the 34 kDa kinase

Identification of the ULK1 kinase could not be achieved by mass spectrometry analysis of the band found in the in-gel kinase assay, because the presence of the

113 4. Upstream regulation of ULK1 4.3. Identification of the 34 kDa kinase substrate would result in high noise disrupting detection of the endogenous kinase. One solution would be to run a standard SDS-PAGE and to cut out the area corresponding to

34 kDa. However, regarding a limited resolution of SDS-PAGE, many proteins would be included in this gel area.

Thus, my idea was to use an additional separation step, prior to resolving the sample by molecular weight. Therefore, I fractionated the lysates using an ion exchange

Mono-Q column and analysed each fraction by in-gel kinase assay to identify the fraction containing the kinase of interest. However, although the 34 kDa kinase was present in the sample containing the whole lysate, it could not be detected in any of the fractions (Fig. 16). The reason for this could be that the 34 kDa kinase of interest did not retain its activity over the fractionation process.

114 4. Upstream regulation of ULK1 4.3. Identification of the 34 kDa kinase

Fig. 16. MonoQ chromatography and in-gel kinase assay. a) Lysates of untreated (Ctrl) or nutrient deprived (ND) MEFs were fractionated on a Mono Q column using NaCl gradient elution. Protein elution was monitored by absorption at 280 nm (Abs). Green line represents elution gradient. Flow through (0) and eluted fractions (1-7) were collected. b) Samples were run on a polyacrylamide gel containing His-MBP or His- MBP-ULK1 1-278 K46N. Resolved proteins were renatured and a kinase assay was performed in the presence of radiolabelled ATP. While phosphorylation signal was observed for unfractionated lysates (Lys), and the 34 kDa kinase phosphorylating ULK1 1-278 K46N in starved cells could be detected, very low phosphorylation signals were observed for the fractionated samples.

115 4. Upstream regulation of ULK1 4.3. Identification of the 34 kDa kinase

Another approach I tried to use was to modify the in-gel kinase assay into a 2D variant. Namely, I used pH gradient strips to perform isoelectric focusing of the samples and then resolved the proteins in the second dimension using a substrate containing gel.

However, although some unspecific signal was visible, no band at 34 kDa was detected in the gel containing His-MBP-ULK1 1-278 K46N (Fig. 17).

Fig. 17. 2D in-gel kinase assay. Lysates of nutrient deprived MEFs were separated by isoelectric focusing (isoelectric point, pI) and SDS-PAGE with polyacrylamide gel containing His-MBP or His-MBP-ULK1 1-278 K46N (molecular weight, MW). Resolved proteins were renatured and a kinase assay was performed in the presence of radiolabelled ATP. Very low phosphorylation signal was observed and the 34 kDa kinase phosphorylating ULK1 1-278 K46N could be detected.

116 4. Upstream regulation of ULK1 4.3. Identification of the 34 kDa kinase

Thus I decided to guess what the 34 kDa kinase could be. For this, I analysed the list of all mouse protein kinases identified so far [Caenepeel 2004] and selected those with a molecular weight between 29 and 39 kDa (Fig. 18). I eliminated the kinases known to display no activity (kinase dead) and the ones expressed in specific tissues only (i.e. testis). The remaining candidates comprised a significant number of cyclin dependent kinases (CDK). I decided to put this group of kinases away at the first guess.

Basing on assumption that proteins usually migrate slower than expected due to posttranslational modifications, I focused on the kinases with a molecular weight close to or below 34 kDa. Thus, I considered STK16 (serine threonine kinase 16), NEK6

(NIMA (never in mitosis gene a) - related kinase 6), NEK7, Pim1 (Proto-oncogene serine/threonine-protein kinase pim-1), Pim3 and PBK (PDZ-binding kinase). NEKs

(NIMA related kinases) are known to take part in mitotic spindle formation

[Quarmby 2005], thus I removed them from the final list. I also decided not to test

Pim3, since its substrate specificity is likely to be similar to that of Pim1, as Pim proteins can compliment each other's function [Mikkers 2004]. Therefore, I decided to test the ability of STK16, Pim1, PBK to phosphorylate ULK1.

117 4. Upstream regulation of ULK1 4.3. Identification of the 34 kDa kinase

Fig. 18. ULK1 upstream kinase candidates. Murine protein kinases [Caenepeel 2004] displaying a molecular weight between 29 and 39 kDa are listed. The marked kinases were selected to test their ability to phosphorylate ULK1.

4.4. Testing kinases for ULK1 phosphorylation

To test the selected candidates, I performed an in vitro kinase assays using recombinant kinases and His-MBP-ULK1 1-278 K46N as a substrate (Fig. 19). All three kinases were active as indicated by their ability to autophosphorylate. No phosphorylation of His-MBP-ULK1 1-278 K46N was observed in the absence of

STK116, Pim1 or PBK. Pim1 was the only kinase that phosphorylated His-MBP-

ULK1 1-278 K46N. Background phosphorylation of His-MBP by Pim1 was observed, which demonstrates the specificity of the reaction.

118 4. Upstream regulation of ULK1 4.4. Testing kinases for ULK1 phosphorylation

Fig. 19. Testing potential ULK1 kinases. Kinase assay was performed in the presence of radiolabelled ATP using GST-Pim1, GST-PBK or GST-STK16 as a kinase and His- MBP-ULK1 1-278 K46N as a substrate. His-MBP was used as a negative control. Autophosphorylation was observed for all three kinases confirming their activity. Pim1 specifically phosphorylated ULK1 1-278 K46N.

Then, I tested the ability of other Pim isoforms, Pim2 and Pim3, to phosphorylate

ULK1. Equimolar amounts of all kinases were used in the assay (Fig. 20). Pim3 phosphorylated His-MBP-ULK1 1-278 K46N, but the signal was unspecific, since phosphorylation of His-MBP protein was also observed. The activity of Pim2 was much weaker than that of Pim1, but autophosphorylation was still observed. However, His-

119 4. Upstream regulation of ULK1 4.4. Testing kinases for ULK1 phosphorylation

MBP-ULK1 1-278 K46N phosphorylation could not be detected. Finally ULK1 1-

278 K46N phosphorylation by Pim1 was again confirmed in this assay and I decided to focus on this isoform in my further studies.

Fig. 20. Phosphorylation of ULK1 by Pim isoforms. Kinase assay was performed in the presence of radiolabelled ATP using GST-Pim1, GST-Pim2 or His-Pim3 as a kinase and His-MBP-ULK1 1-278 K46N as a substrate. His-MBP was used as a negative control. Autophosphorylation was detected for all three kinases confirming their activity. Specific phosphorylation of ULK1 1-278 K46N by Pim1 was observed.

120 4. Upstream regulation of ULK1 4.5. Phopshorylation of ULK1 by Pim1 in vivo

4.5. Phopshorylation of ULK1 by Pim1 in vivo

To elucidate if Pim1 affects ULK1 phopshorylation in vivo, I used western blot to analyse band shift of endogenous ULK upon Pim1 inhibition or overexpression (Fig.

21). ULK1 phosphorylation/ dephosphorylation influences its mobility in SDS-PAGE

[Ganley 2009, Kim 2011]. Upon starvation, the ULK1 band was shifted downwards compared to the control cells, which can be interpreted as a result of dephosphorylation.

The mobility shift was comparable to that caused by phosphatase treatment of the lysate. When the cells were treated with Pim1 inhibitor, SMI4a, no obvious change in the migration of ULK1 was observed. Similarly, overexpression of Pim1 K67M and

Pim1 wt, as well as overexpression of Pim1 wt together with SMI4a treatment did not affect the migration pattern of ULK1. However, since protein phosphorylation is not always accompanied by the changes in its electrophoretic mobility, these results do not exclude the possibility, that Pim phosphorylates ULK1.

121 4. Upstream regulation of ULK1 4.5. Phopshorylation of ULK1 by Pim1 in vivo

Fig. 21. Electrophoretic mobility of endogenous ULK1. HeLa cells were grown in rich medium or subjected to nutrient deprivation (ND). Where indicated, the cells were treated with a Pim1 inhibitor, SMI4a and/or overexpressed FLAG-Pim1 wt or K67M. Lysates were also treated with lambda phosphatase where indicated (PP). a) Endogenous ULK1 bandshift was analysed by western blot (WB, anti-ULK1). ULK1 migrated faster in the starved cells. However this was not affected by SMI4a treatment or ectopic overexpression of Pim1. c) FLAG-Pim1 expression was monitored by western blot (anti-FLAG).

4.6. Binding between Pim1 and ULK1

Pim has been shown to bind many of its substrates, including p21 [Wang 2002],

Cdc25A [Mochizuki 1999], C-TAK1 [Bachmann 2004] and Cdc25C [Bachmann 2006].

Thus, I tested whether ULK1 could interact with Pim1. To this end, I coexpressed myc- tagged ULK1 and FLAG-tagged Pim1 in Cos7 cells. Pim1 was immunoprecipited with an anti-FLAG antibody and ULK1 present in the immunocomplex was detected by western blot using an anti-myc antibody. myc-ULK1 was precipitated only if myc-

122 4. Upstream regulation of ULK1 4.6. Binding between Pim1 and ULK1

ULK1 and FLAG-Pim1 were simultaneously overexpressed (Fig. 22). Control experiments with mock transfected cells confirm that the binding was specific and not due to antibody or resin derived artefacts. The equal amounts of myc-ULK1 in the lysates was confirmed by western blot. Thus, these data suggest that Pim binds ULK1, which further supports the hypothesis that ULK1 is a Pim1 substrate.

Fig. 22. Binding between Pim1 and ULK1. FLAG-Pim1 and myc-ULK1 were coexpressed in Cos7 cells and Pim1 was immunoprecipitated with anti-FLAG antibody (IP: FLAG). The immunocomplexes were analysed by western blot using anti-myc and anti-FLAG antibodies. ULK1 was present in the complex only if Pim1 and ULK1 were overexpressed simultaneously. Expression level of ULK1 was monitored in cell lysates by western blot (anti-myc).

4.7. Identification of ULK1 sites phosphorylated by Pim1

To identify the sites phosphorylated by Pim1, I performed a kinase reaction using

GST-Pim1 and His-MBP-ULK1 1-278 K46N and analysed ULK1 modifications by LC-

MS/MS (liquid chromatography-tandem mass spectrometry) (Fig. 23). The peptides identified in the precursor ion scanning covered about 60% of ULK1 kinase domain.

The modified peptides were fragmented and further analysed by product ion scanning.

123 4. Upstream regulation of ULK1 4.7. Identification of ULK1 sites phosphorylated by Pim1

Two phosphopeptides were identified: DLKPQNILLpSNPGGR, containing phospho-

S147 (Fig. 24) and APFQApSSPQDLR, containing phospho-S224 (Fig. 25).

Phosphorylation of specific residues was confirmed by analysing the neutral loss products. Since phosphorylation changes the chemical properties of peptides, it is impossible to determine the stoichiometry of phosphorylation using this method. To do this a quantitative mass spectrometry should be applied, for example using isotope labelled standard peptides. When Pim1 was excluded from the kinase reaction, the precursor ion scanning signal corresponding to the identified phosphopeptides was at the noise level, which indicates that phosphorylation of ULK1 S147 and S224 is a result of Pim1 kinase activity.

124 4. Upstream regulation of ULK1 4.7. Identification of ULK1 sites phosphorylated by Pim1

Fig. 23. Summary of identification of ULK1 sites phosphorylated by Pim1. Kinase assay was performed using GST-Pim1 and His-MBP-ULK1 1-278 K46N and His-MBP- ULK1 1-278 K46N was analysed by LC-MS/MS (liquid chromatography-tandem mass spectrometry). a) ULK1 full length sequence. The PS and CT domains (not included in the kinase assay) are shaded. Precursor ions identified in mass spectrometry (highlighted yellow) covered 60% of the kinase domain. Modifications detected are marked green. These include phosphorylation of S147 and S224. b) Schematic representation of ULK1 domain structure. The identified sites were marked together with ones previously reported to be phosphorylated by AMPK [Egan 2011, Kim 2011] and mTOR [Kim 2011].

125 4. Upstream regulation of ULK1 4.7. Identification of ULK1 sites phosphorylated by Pim1

Fig. 24. Identification of ULK1 sites phosphorylated by Pim1 using LC-MS/MS: S147. a) Upper panel: a fragment of the chromatogram. RT - retention time AA - peak area AH - peak height. Lower panel: precursor ion spectrum of LC peak corresponding to RT= 32.48 min. A triple protonated ion of m/z=568.06 corresponding to a phosphopeptide DLKPQNILLpSNPGGR was detected. b) Product ion spectrum of m/z=568.06. Phosphorylation was confirmed by the presence of the neutral loss peak ([M+3H]3+-98). S147 is the only serine/threonine present in the peptide. Its phopshorylation is further confirmed by the presence of the y6-98 ion.

126 4. Upstream regulation of ULK1 4.7. Identification of ULK1 sites phosphorylated by Pim1

Fig. 25. Identification of ULK1 sites phosphorylated by Pim1 using LC-MS/MS: S224. a) Upper panel: a fragment of the chromatogram. RT - retention time AA - peak area AH - peak height. Lower panel: precursor ion spectrum of LC peak corresponding to RT= 29.19 min. A double protonated ion of m/z=698.87 corresponding to a phosphopeptide APFQApSSPQDLR was detected. b) Product ion spectrum of m/z=698.87. Phosphorylation was confirmed by the presence of the neutral loss peak ([M+2H]2+-98). There are two serines present in the peptide: S224 and S225. The presence of neutral loss peaks y7-98 and b6-98 indicates that S224 is the site of phosphorylation. 127 4. Upstream regulation of ULK1 4.7. Identification of ULK1 sites phosphorylated by Pim1

To confirm the phosphorylation of S147 and S224 by Pim1, I mutated both sites to alanine and tested the mutants in a kinase assay with GST-Pim1 (Fig. 26).

Phosphorylation of ULK1 1-278 K46N by Pim1 was confirmed and its level was similar to that of p27, which is a known Pim1 substrate [Wang 2002]. However, phosphorylation of ULK1 was not significantly decreased for any of the alanine mutants. Indicatively, S147A/S224A mutation did not abolish the phosphorylation.

Interestingly, an additional phosphorylation band, migrating slower than the His-MBP-

ULK1 1-278 K46N band visualised by Coomassie staining, could be detected by autoradiography. This band was specific for the samples containing MBP-ULK1 1-

278 K46N and GST-Pim1, which suggests that it corresponds to different phosphorylation state of ULK1 1-278 K46N. It could be hypothesised that a fraction of

MBP-ULK1 1-278 K46N is phosphorylated at additional sites, which results in a mobility shift. All these data suggest that apart from the identified S147 and S224, other

ULK1 sites phosphorylated by Pim1 may exist.

128 4. Upstream regulation of ULK1 4.7. Identification of ULK1 sites phosphorylated by Pim1

Fig. 26. Alanine screening of ULK1 phosphorylation sites. a) GST-Pim1 kinase assay was performed in the presence of radiolabelled ATP. His-MBP-ULK1 1-278 K46N and mutants (147A, 224A and 147A/224A) were tested as substrates. ULK1 1-278 K46N was specifically phosphorylated by Pim1. However, no significant decrease in phosphorylation was observed when S147 and S224 were mutated to alanine. b) p27 and His-MBP were used as a positive and negative control respectively.

4.8. ULK1 activation by Pim1

To elucidate the function of ULK1 phosphorylation by Pim1, I examined whether

Pim1 affects ULK1 activity. I generated myc-ULK1 mammalian expression constructs in which S147 and S224 were substituted with alanine or aspartic acid. The wild type

129 4. Upstream regulation of ULK1 4.8. ULK1 activation by Pim1 and mutant proteins were overexpressed in Cos7 cells and immunoprecipitated. Their activity was measured by in vitro kinase assay using MBP* as a substrate. The kinases, expressed at similar level, displayed significant difference in activity with S147A,

S147D and S224D causing hyperactivity of ULK1 (Fig. 27). Although it is difficult to conclude about the role of S147 phosphorylation, it can be speculated that substitution to aspartic acid mimicked S224 phosphorylation and activated ULK1. This result suggests that Pim1 positively regulates ULK1.

Fig. 27. Effect of mutagenesis on ULK1 kinase activity. myc-ULK1 wt and mutants were overexpressed in Cos7 cells, immunoprecipitated with anti-myc antibody and a kinase assay was performed in the presence of radiolabelled ATP with MBP* as a substrate. ULK1 expression was monitored by western blot (WB, anti-myc). MBP* was visualised by Coomassie staining. Hyperactivity of S147A, S147D and S224D mutants was observed.

To clarify the functional effect of Pim1 mediated phosphorylation of ULK1, I performed a dual protein kinase assay, whereby I compared levels of ULK1 activity incubated with or without recombinant Pim1 using MBP* as a substrate (Fig. 28). myc-

ULK1 overexpressed in HeLa cells untreated or subjected to nutrient deprivation was immunoprecipitated. The immunocomplex was incubated with GST-Pim1 and non

130 4. Upstream regulation of ULK1 4.8. ULK1 activation by Pim1 radiolabelled ATP. GST Pim1 autophosphorylated and phosphorylated MBP* and kinase dead myc-ULK1 in the reaction conditions set in this experiment (Fig. 28c). After the incubation, the beads were washed to remove GST-Pim1. myc-ULK1 retained by the beads was incubated with MBP* in the presence of radiolabelled ATP (Fig. 28a). As expected, ULK1 K46R kinase dead mutant displayed background activity, whether or not it had been incubated with GST-Pim1, which confirms that GST-Pim1 was removed from the reaction. In contrast, wild type ULK1 expressed in non starved cells phosphorylated MBP* and this was enhanced by pre-incubation of ULK1 with GST-

Pim1. The effect of Pim1 was not observed when ULK1 was purified from starved cells.

This may be due to the fact that upon starvation ULK1 was already phosphorylated by

Pim1 in vivo. Equal amounts of ULK1 in all reactions were confirmed by western blot.

The mobility of the wild type form was clearly decreased compared to the kinase dead mutant, which indicates its autophosphorylation. Additionally, a very slight shift upwards of the ULK1 band can be observed in the reactions including GST-Pim1, consistent with the ability of Pim1 to phosphorylate ULK1. To summarise, this results suggest that Pim1 is able to phosphorylate and activate ULK1 in vitro.

131 4. Upstream regulation of ULK1 4.8. ULK1 activation by Pim1

Fig. 28. ULK1 activation by Pim1 in vitro. See next page for the figure legend. 132 4. Upstream regulation of ULK1 4.9. In vivo role of Pim1 in autophagy

4.9. In vivo role of Pim1 in autophagy

To investigate the role of Pim1 in autophagy in vivo, I tested the effect of inhibition or overexpression of Pim1 in HeLa cells. (Fig. 29). I analysed degradation of p62 as the autophagy marker. p62 level was decreased in cells upon starvation, consistent with induction of autophagy. However, this was partially inhibited when the cells were treated with the Pim1 inhibitor, SMI4a. These data suggest that Pim1 promotes autophagy activation upon starvation. This hypothesis was further confirmed by evidence that p62 level decreased in cells overexpressing Pim1 independently of nutrient deprivation. This effect was less pronounced when Pim1 K67M was overexpressed instead of the wild type form or when the cells were treated with SMI4a while overexpressing Pim1 wt. Thus, these results suggest that Pim1 promotes autophagy in HeLa cells.

Fig. 28. ULK1 activation by Pim1 in vitro. myc-ULK1 wt or the K46N kinase dead mutant were overexpressed in HeLa cells, which remained untreated or were subjected to nutrient deprivation (ND). myc-ULK1 was immunoprecipitated with an anti-myc antibody and incubated with GST-Pim1 and non-radiolabelled ATP. After incubation, myc-ULK1 bound to the beads was washed to remove GST-Pim1 and then MBP* was added together with radiolabelled ATP to determine myc-ULK1 activity. The amount of myc-ULK1 in the reaction mixture was verified by western blot (anti-ULK1). Phosphorylation was visualised by autoradiography and additionally quantified by phosphoimager. ULK1 activity is represented as a percentage of the activity of ULK1 wild type without GST-Pim1. The error bars were fitted on the basis of two independent experiments. Significant increase of ULK1 activity upon GST-ULK1 treatment was observed when myc-ULK1 was pulled down from the unstarved cells. b) To confirm autophagy activation in the starved cells, p62 levels were analysed by western blot (WB, anti-p62). Tubulin was used as a protein loading control. c) Radiolabelled ATP was used in a control reactions, to confirm GST-Pim1 activity and ULK1 phosphorylation. MBP* was used instead of myc-ULK1 as a control substrate for Pim1.

133 4. Upstream regulation of ULK1 4.9. In vivo role of Pim1 in autophagy

Fig. 29. Role of Pim1 in vivo. HeLa cells were grown in rich medium or subjected to nutrient deprivation (ND). Where indicated, the cells were treated with a Pim1 inhibitor, SMI4a and/or overexpressed FLAG-Pim1 wt or K67M. Autophagy induction was analysed by western blot (anti-p62). p62 band intensities were measured by densitometry and normalised to the intensity of the corresponding tubulin bands. The error bars were fitted on the basis of two independent experiments. p62 degradation was inhibited by SMI4a treatment. On the other hand, Pim1 wt overexpression stimulated p62 degradation. This effect was less pronounced when the kinase dead mutant K67M was overexpressed or cells were additionally treated with SMI4a. FLAG-Pim1 expression was monitored by western blot (anti-Pim1).

4.10. Discussion

4.10.1. Identification of Pim1 as a kinase phosphorylating ULK1

In my project I aimed to increase our understanding of the mechanisms underlying the regulation of ULK1 function. I discovered that mutations within the activation loop affected ULK1 activity (Fig. 13). Thereby, I decided to identify protein kinases involved in phosphorylating the kinase domain of ULK1. I used in-gel kinase

134 4. Upstream regulation of ULK1 4.10. Discussion assay to analyse lysates of control and starved fibroblasts. As a result, I found a 34-kDa

ULK1 kinase specifically activated in starved cells (Fig. 15).

The identification of the detected kinase turned out to be challenging. Attempts to improve the resolution of the in-gel kinase assay and find the isoelectric point of the kinase by ion exchange chromatography and two-dimensional gels was unsuccessful

(Fig. 16, 17). Thus, I decided to use the genome information to list the kinases that display a molecular weight of around 34 kDa. This led me to identify Pim1 as a ULK1 kinase (Fig. 19). pim1 gene has been discovered as a preferential integration site of

Moloney leukemia virus in mouse lymphoma samples [Cuypers 1984]. The integration results in overexpression of Pim1 protein [Wingett 1992]. Further experiment showed that when Pim1 is coexpressed in mice together with c-Myc (avian myelocytomatosis viral oncogene homologue), 100% of the animals die from lymphomas [Verbeek 1991].

Since then, Pim1 was found to be a marker for a number of cancers including: myeloid and lymphoid leukemias, prostate, pancreas, gastric and colorectal cancer and head and neck carcinomas [reviewed in Magnuson 2010].

Prooncogenic properties of Pim1 are associated with its antiapoptotic function. overexpression of Pim1 protects cells from apoptosis induced either by stress, like drug treatment [Möröy 1993], or by deprivation of essential growth factors [Rahman 2001].

Pim1 phosphorylated a braod range of substrates whcih include proteins involved in regulation of autpphagy. Phosphorylation by Pim1 promotes binding of 14-3-3 protein to BAD (Bcl-xl/Bcl-2-associated death promoter), thereby preventing it from inhibiting the antiapoptotic proteins, Bcl-2 and Bcl-xl [Aho 2004], protects NF-κB (nuclear factor

κB) subunit, RelA/p65 from ubiquitin mediated proteolysis [Nihira 2010] and induces

135 4. Upstream regulation of ULK1 4.10. Discussion translocation of proapoptotic transcription factor FOXO3a (forkhead box O3a) from the nucleus to the cytoplasm, leading to FOXO3a degradation [Morishita 2008].

Pim1 is also involved in the regulation of cell cycle progression. Pim1 levels were observed to be increased at the G1/S cell cycle phase boundary, decreased during the S phase and again elevated at the G2 phase [Liang 1996]. Pim1 phosphorylates

CDC25A [Mochizuki 1999] and CDC25C [Bahmann 2006] thereby enhancing their phosphatase activity and stimulating G1/S and G2/M transition. In addition, Pim1 phosphorylates and downregulates cell cycle inhibitors p21 and p27 which results in their translocation from the nucelu to the cytoplasm and degradation [Wang 2002,

Zhang 2007, Morishita 2008].

Demonstrating that Pim1 phosphorylates ULK1 in vitro does not necessarily mean that Pim1 was responsible for the signal detected in the in-gel kinase assay. This could be verified by observing if the signal disappears when Pim1 is inhibited. Pim1 expression could be specifically silenced in cells using siRNA. Another approach is to perform in-gel kinase reaction in the presence of Pim inhibitor. The ATP binding pocket of Pim kinases has an unusual architecture which contains an additional proline residue not present in other kinases [Bullock 2005]. This makes an opportunity of finding Pim specific inhibitors inhibitors [Xia:13]. One of them is SMI4a, which blocks Pim1 with

IC50 of about 125nM and whose specificity towards Pim1 was tested against a set of 50 protein kinases [Xia 2009].

If SMi4a did not cause depletion of the signal in the in-gel kinase assay, kinases other than Pims should be considered as potential ULK1 regulators. Interestingly, the list of kinases displaying a molecular weight of around 34 kDa contains a few cyclin

136 4. Upstream regulation of ULK1 4.10. Discussion dependent kinases (CDKs). Connections between the cell cycle and autophagy induction have been reported [Tasdemir 2007, Kaminskyy 2011]. Thus, since a broad spectrum of CDK inhibitors of different specificity is available [Leitch 2009], it would be interesting to use them in a series of in-gel kinase assays, to elucidate if any of CDKs could be involved in ULK1 regulation.

Along with Pim1, two other Pim kinases were identified: Pim2 and Pim3. All three proteins display high sequenceand structural similarities and are thought to have similar functions and substrate specificity [Mikkers 2004, Bullock 2005]. Therefore, having confirmed that Pim1 was capable of phosphorylating ULK1 in vitro (Fig. 19), I tested if higher phosphorylation signal could be obtained in the presence of any of two other Pims. I demonstrated that Pim1 is the most likely isoform to phosphorylate ULK1

(Fig. 20). Thus, I focused on Pim1 in my further studies.

To test if ULK1 is phosphorylated by Pim1 in vivo, I analysed electrophoretic mobility changes of endogenous ULK1. Consistent with previous results [Ganley 2009,

Hosokawa 2009, Shang 2011], I found increased mobility of endogenous ULK1 in cells deprived of nutrients. However, this pattern was not affected in cells incubated with

SMI4a or overexpressing Pim1 (Fig. 21). This result does not exclude the possibility that Pim1 phosphorylates ULK1 in vivo. Phosphorylation of a protein does not always correlate with a mobility shift. Furthermore, during starvation, ULK1 is subjected to multiple phosphorylation and dephosphorylation events [Ganley 2009, Hosokawa 2009,

Jung 2009, Kim 2011, Egan 2011], which makes the interpretation of the band shift even more difficult. Consistently, the ULK1 mobility shift is dependent on the type of starvation, for example, in contrast to total starvation, glucose deprivation induces decreased mobility [Kim 2011]. Thus, in this experiment, I did not confirm ULK1

137 4. Upstream regulation of ULK1 4.10. Discussion phopshorylation by Pim1 in vivo. Further investigation involves using the Phos-tag technology, which allows to analyse distinct phosphorylation species by SDS-PAGE

[Kinoshita 2006].

4.10.2. Identification of ULK1 sites phopshoprylated by Pim1

To further characterise the functional connection between Pim1 and ULK1, I tried to identify ULK1 sites phosphorylated by Pim1. The Pim1 phosphorylation consensus sequence found by peptide library screening is: K/R-K/R-R-K/R-L-S/T-X, where X is a residue with a small side chain [Palaty 1997]. More recent studies including structure analysis of the Pim1 complex with a substrate peptide revealed that -5 and -3 arginines are critical for the substrate binding by the Pim1 active site [Bullock 2005]. No such sites could be identified in the sequence of the kinase domain of ULK1. However, this may not be surprising, considering that most of the Pim1 phosphorylation sites identified in its substrates show only limited similarity to the consensus motif (Fig. 30).

Furthermore, in the case of PAP1, alanine screening and analysis of protein fragments suggests the existence of multiple phosphorylation sites [Maita 2000]. There are also

Pim1 substrates that do not contain the consensus motif at all, like C-TAK1

[Bachmann 2004]. Finally, Xenopus Pim1 was shown to autophosphorylate at S4

(MLLSK), S190 (KLIDFGSG) and T205 (YTDFDGTR), which are strictly conserved in mouse and human Pim1 [Bachmann 2005]. Thus, it seems likely that the motif recognised by Pim1 is not stringent and other factors, like residue accessibility and the three-dimensional structure of the surrounding region, may play a significant role.

138 4. Upstream regulation of ULK1 4.10. Discussion

Fig. 30. Pim1 phosphorylation motifs. Consensus motif discovered by peptide library screening [Palaty 1997], and motifs found in Pim1 substrates: PTP-U2S [Wang 2001], p21 [Wang 2002], NuMA [Bhattacharya 2002], PAP1 [Maita 2000], RelA/p65 [Nihira 2010] and BAD [Aho 2004]. Residues present in the consensus motif are shadowed.

Thus, I used mass spectrometry analysis to map the sites of the ULK1 kinase domain phosphorylated by Pim1 in vitro and S147 and S224 were identified.

Unfortunately, substitution of S147 and S224 with alanine residue did not cause any decrease in phosphorylation (Fig. 26). This led me to propose that Pim1 phosphorylates

ULK1 on multiple sites. This is consistent with the detection of an additional phosphorylation form of ULK1 in the in vitro kinase assay with Pim1 (Fig. 26). During

SDS-PAGE analysis, this form, detected by autoradiography, migrated slower than

ULK1 visualised by Coomassie staining. This form was omitted in mass spectrometry, since only the Coomassie band was included in the analysis.

This problem can be overcome by optimising the conditions of the kinase reaction, like ATP concentration and incubation time, to improve the yield of phosphorylation. The efficiency of phosphorylation could be monitored by using the

Phos-tag technology [Kinoshita 2006]. In this method, a reagent is added to

139 4. Upstream regulation of ULK1 4.10. Discussion polyacrylamide gel before running SDS-PAGE. Its binding to the phosphorylated sites slows down protein migration, which results in a mobility shift. Therefore, unphosphorylated and phosphorylated protein species form distinct bands and their intensities can be compared. Moreover, this method can be employed to enrich the phosphorylation form prior to the mass spectrometry analysis.

Another issue of the mass spectrometry analysis is the coverage. Here, only 60% of the ULK1 kinase domain sequence was represented by the identified peptides. The remaining 40% of the sequence contain serine and threonine residues which might have been phosphorylated by Pim1. This problem can be overcome by using different digestion method. The quality of the machine used for the analysis is also an important factor. Thus, using a different facility may improve the results.

Mapping of ULK1 sites phosphorylated by Pim1 would allow to elucidate the precise function of the phosphorylation by analysing the activity of alanine and aspartic or glutamic acid mutants, as well as their cellular localisation and the ability to activate autophagy or associate with the known ULK1 binding partners. In addition, generation of phosphospecific antibodies would allow to monitor phosphorylation of certain ULK1 sites upon autophagy induction.

4.10.3. Activation of ULK1 by Pim1

To investigate the effect of S147 and S224 phosphorylation on ULK1 activity, I muted both residues to alanine or aspartic acid and tested the ability of full length ULK1 expressed in Cos7 cells to phosphorylate myelin basic protein (MBP*). Both S147A and

D mutants exhibited hyperactivity, while only S224D, but not S224A, was hyperactive compared to the wild type form (Fig. 27).

140 4. Upstream regulation of ULK1 4.10. Discussion

Interpretation of the results of S/A and S/D mutagenesis is not always straight forward. Substitution of serine to aspartic acid only sometimes mimics phosphorylation

[Lizcano 2004]. Moreover, serine to alanine mutation cannot be simply considered as blocking phosphorylation, since the difference between serine and alanine may disturb interactions between residues and affect the kinase activity, due to conformational changes. Thus, S147 phosphorylation may activate ULK1 by disturbing the interaction of S147 with other residues and resulting in ULK1 transition into an active state. This could be imitated both by S147D and S147A mutations. Alternatively, S147 phosphorylation may be crucial for keeping ULK1 in an inactive conformation and dephosphorylation may result in increasing ULK1 activity. In this scenario, if substitution to aspartic acid failed to mimic phosphorylation, both S147A and S147D mutations would inhibit phosphorylation and result in ULK1 hyperactivity. At the moment it is not possible to distinguish between these two opposite interpretations. The only conclusion is that phosphorylation of S147 can play a role in regulating ULK1 activity, but it remains to be elucidated if its effect is activating or inhibiting.

Interpretation is easier if A and D mutations have different effects on the activity as it is in the case of S224. I propose that this site remains unphosphorylated under normal conditions. Consistently, S224A mutation did not affect the basal activity of

ULK1. Increased ULK1 activity was associated with the substitution of S224 with aspartic acid, indicating that S224 phosphorylation by Pim1 activates ULK1 in response to starvation. This model could be further confirmed by analysing the activity of ULK1 mutants in starved cells. It would be interesting to examine if the activity of S224A and

S224D can be increased during autophagy.

141 4. Upstream regulation of ULK1 4.10. Discussion

The positive effect of Pim1 on ULK1 activity was demonstrated by incubating

ULK1 with Pim1 in the presence of ATP. (Fig. 28). This was not observed when ULK1 was purified from cells deprived of nutrients, probably because ULK1 is already phopshorylated by Pim1 in cells undergoing autophagy. Although I showed that Pim1 phosphorylates immunoprecipitated ULK1 in the designed experimental system (Fig.

28c), I cannot rule out the possibility that increase in ULK1 activity is not a consequence of Pim1 binding to ULK1. To demonstrate that ULK1 activation is phosphorylation dependent, a kinase dead Pim1 mutant could be used or a Pim1 inhibitor, for example SMi4a, could be added to the kinase reaction. If the ULK1 sites phosphorylated by Pim1 were known, another option would be to mutate them to alanine and test if these mutants can still be activated by Pim1. It may still be worthy to perform this experiment with S147 and S224 sites, since it is possible that these are crucial for ULK1 regulation, even if more sites phosphorylated by Pim1 exist.

4.10.4. Role of Pim1 in vivo

To investigate the potential role of Pim1 in autophagy in vivo, I analysed the effect of Pim1 inhibition and overexpression in Hela cells. p62 is a molecule that labels proteins designated for degradation and targets them to autophagosomes [Pankiv 2007].

Thus, degradation of p62 can be used as an autophagy marker [Bjørkøy 2009].

Consistently, I observed that starved HeLa cells displayed decreased level of p62 (Fig.

29, compare 1 and 2). It has been demonstrated that SMI4a induces AMPK activation and mTORC1 inhibition in cells [Beharry 2011]. Thus, one could expect that SMI4a treatment would activate autophagy. However, only a minor decrease in p62 level was observed in unstarved cells upon SMI4a treatment (Fig. 29, 3). This indicates that

142 4. Upstream regulation of ULK1 4.10. Discussion inhibition of Pim activity prevented full activation of autophagy pathways. Indeed, upon starvation the p62 level was significantly higher when the cells were treated with SMI4a

(Fig. 29, compare 4 and 2). This indicates, that Pim1 inhibition attenuates autophagic response to starvation treatment.

Pim1 overexpression decreased p62 level in unstarved cells (Fig. 29, 7) and starvation did not cause further drop of p62 level (Fig. 29, 8). This effect was attenuated by SMI4a treatment or when the Pim1 K67M kinase dead mutant was expressed.

Although this suggests that Pim1 activates autophagy, it should be noted that Pim1 kd expression level was lower than that of the wt form. This makes the interpretation of the the effect of Pim1 overexpression less confident. However, together with the data obtained from SMI4a treatment, these results suggest that Pim1 promotes autophagy by a mechanism which is dependent on Pim1 kinase activity. This conclusion could be strengthened by using another assay for monitoring autophagy induction. For example,

GFP-LC3 can be overexpressed in cells together with Pim1 to determine by fluorescent microscopy whether Pim1 affects formation of LC3-positive puncta.

Another issue which remains to be elucidated is the regulation of ULK1 phosphorylation by Pim1. Pim1 is a constitutively active kinase and its function is regulated by modulation of its expression level and stability [Qian 2005]. Pim1 expression is stimulated by a number of cytokines and hormones like IL-2, -3, -6, -7 and prolactine, which activate the JAK/STAT pathway and thereby pim1 gene transcription

[Narimatsu 2001, Buckley 1995, Jaster 1999, Didichenko 2008]. Pim1 stability is regulated by Hsp90 heat shock protein which binds to Pim1 preventing its degradation by 26S proteasome [Mizuno 2001, Shay 2005]. Another molecule regulating Pim1 stability is PP2A (protein phosphatase 2A), which binds and dephosphorylates Pim1,

143 4. Upstream regulation of ULK1 4.10. Discussion increasing ULK1 ubiquitination and degradation [Ma 2007]. Therefore, it would be interesting to determine if the level of Pim1 is affected in cells undergoing autophagy.

Interestingly, dephosphorylation by PP2A also decreased Pim1 ability to phosphorylate histone H1 in vitro, which indicates a possibility that Pim1 activity may be dependent on its phosphorylation state [Ma 2007]. To test if Pim1 activity is regulated in autophagy, Pim1 could be overexpressed in control and starved cells and following purification its activity could be analysed in an in vitro kinase assay using ULK1 as a substrate. Finally, in my study, I showed that Pim1 and ULK1 associate when overexpressed in cells (Fig. 22). Modulation of this binding could affect ULK1 phosphorylation by Pim1 being another mechanism of regulating ULK1 activity. Thus it would be interesting to investigate, whether the interaction is starvation dependent and, if so, what mechanisms are responsible for facilitating Pim/ULK1 binding.

It would also be interesting to test if Pim1 colocalises with the autophagy markers

(LC3, Atg16L, Atg9) or ULK1 upon starvation. Since Pim1 tends to be equally distributed in the cell [Bachman 2006], it could be difficult to observe its localisation to the punctae structures. However, fluorescence lifetime imaging microscopy (FLIM) could be used [Chang 2007]. In this technique, proteins tagged with specific fluorophores are expressed and interaction between them can be observed in living cells in a spatial and temporal context. Therefore, it would be possible to trace, for example,

Pim1/ULK1 interaction over autophagy progression, to find out in which stage of the process they associate, as well as where the interaction occurs in the cell, for example if this is the cytoplasm or the autophagic vesicles.

144 5. Final discussion 5. Final discussion

5. Final discussion

Autophagy takes part in many physiological and pathological processes, including embryonic and early postnatal development, neurodegenerative diseases and tumourigenesis [Cuervo 2004, Levine 2004]. The role of ULK1 in autophagy regulation was demonstrated in vivo by analysis of transgenic mice. Although the targeted deletion of ulk1 gene resulted only in minor defects of autophagy, like impaired mitochondria removal during erythropoiesis [Kundu 2008], ulk1-/-ulk2-/- mice were reported to die shortly after birth. MEFs isolated from these mice were shown to be defective in autophagy induction upon amino acid starvation [Cheong 2011]. The importance of

ULK1 is further confirmed by recent report showing a correlation between single nucleotide polymorphism within the ulk1 gene and the risk of Crohn's disease

[Henckaerts 2010]. This disease is characterised by chronic inflammation of the gastrointestinal tract and is linked to defects in autophagy. It is proposed that impaired autophagy results in failure to sequestrate intracellular pathogens and leads to bacterial inflammation [Cooney 2010, Travassos 2010]. The mutation identified in the ulk1 gene occurs in an intron region and its effect on the function of the protein remains to be elucidated. However, it was demonstrated that its frequency is significantly higher among patients with Crohn's disease [Henckaerts 2010].

Thus, understanding the molecular function of ULK1 may have important clinical applications. The kinase activity of ULK1 appears to be important for its function in autophagy. It it is supported by evidence that ULK1 activity is increased during autophagy [Hara 2008] and regulated by mTORC1 [Hosokawa 2009] and AMPK

145 5. Final discussion 5. Final discussion

[Kim 2011]. However, phosphorylation of ULK1 substrates identified so far: Atg13,

FIP200 [Hosokawa 2009, Jung 2009, Ganley 2009], Raptor [Jung 2011, Dunlop 2011] and AMPK [Loffler 2011], does not explain the mechanism by which ULK1 regulates autophagy. To identify novel ULK1 targets, I performed a screening using protein microarray and identified 5 potential ULK1 substrates: MERTK, B-RAF, NOL4,

ACVRL1 and TBCD22B. However, testing MERTK and B-RAF in an in vitro kinase assay, I could not confirm their phosphorylation by ULK1. This observation is surprising particularly in the case of MERTK, which function in phagocytosis and membrane remodelling made it a plausible ULK1 target. Further studies will be necessary to verify the functional connection between ULK1 and MERTK and to test the other potential substrates of ULK1.

It is possible that the predominant role of ULK1 kinase activity is signalling in the feedback loops (phosphorylation of AMPK [Loffer 2011] and Raptor

[Dunlop 2011]), while ULK1 could have some other function in regulation of autophagy. For example, it could serve as a scaffolding protein by recruiting other molecules to the vesicle nucleation site. This role of ULK1 could be facilitated by binding and phosphorylating FIP200 and Atg13 [Hara 2008, Hosokawa 2009,

Jung 2009, Ganley 2009]. Finally, ULK1 itself could be its main functional substrate. It has been proposed by Chan et al. that ULK1 undergoes conformational changes upon autophosphorylation and that the 1041-1047 fragment is responsible for inhibiting autophagy by the kinase dead form of ULK1 [Chan 2009]. Thus, it could be speculated, that upon nutrient rich conditions exposure of this region inhibits autophagy. Upon starvation, ULK1 autophosphorylation may induce conformational changes, thereby

146 5. Final discussion 5. Final discussion hiding the inhibitory fragment and triggering autophagy. The exact mechanism of autophagy inhibition by inactive ULK1 remains to be elucidated [Chan 2009].

Recent research shed some light on the upstream regulation of ULK1, demonstrating a crucial role of AMPK and mTORC1. In my study, I identified Pim1 as another kinase activating ULK1. I demonstrated that Pim1 phosphorylates ULK1 in vitro. I identified two putative sites targeted by Pim1: S147 and S224.

Phosphorylation of at least one of them, S224 is likely to activate ULK1 consistent with evidence that Pim1 is capable of activating ULK1 in vitro. Furthermore, my preliminary observations suggest that Pim1 promotes autophagy in HeLa cells. Noteworthy, another

Pim kinase, Pim2 has been reported to take part in autophagy in in chondrocytes, which were shown to express exclusively this isoform of all three Pim kinases. Upon nutrient deprivation, autophagy, as assessed by LC3 punctae formation and lysosomal activity monitoring, was greatly impaired in the Pim2 knockdown chondrocytes. However, the molecular mechanism by which Pim2 would regulate autophagy remains to be elucidated [Bohensky 2007].

Recently Pim kinases have been shown to play a role in regulation of the energy metabolism of the cell. Treating K562 cells with a Pim inhibitor, SMI4a resulted in activation of AMPK and inhibition of mTORC1 [Beharry 2011]. Similarly, AMPK was hyperactivated in triple knockout MEFs where all three Pim kinases were depleted.

Therefore, one could expect that Pim1 antagonises AMPK function and possibly inhibits autophagy. However, the data presented by Beharry et al. indicate that the interaction between Pim kinases and AMPK is not direct. The authors showed that

AMPK activation correlated with increased AMP/ATP ratio, hypothesising that Pim depletion resulted in impaired energy metabolism. Therefore, I propose that Pim1 and

147 5. Final discussion 5. Final discussion

AMPK constitute parallel mechanisms of maintaining low AMP/ATP level. Thus, inhibition of one of them (in Beharry et al.'s study: Pim1) can be compensated by the activation of the other one (respectively: AMPK, Fig. 31). In this context, activation of autophagy by Pim1 would be responsible for keeping the AMP/ATP ratio low during starvation conditions.

Furthermore, Beharry et al. propose that Pim1 regulates the energy metabolism of the cell by stimulating mitochondria synthesis through the PGC-1α transcription factor.

PGC-1α is a coactivator of a number of transcription factors inducing mitochondria biogenesis and increased oxidative phosphorylation [Cantó 2009]. In fact, PGC-1α level was decreased in the Pim triple knockout cells [Beharry 2011]. On the other hand, autophagy has been shown to play an important role in removing damaged mitochondria, thereby protecting cells from apoptosis [Ravikumar 2006]. Consistently, depletion of ULK1/2 results in accumulation of abnormal mitochondria displaying decreased membrane potential [Egan 2011]. Interestingly, maintaining high mitochondrial membrane potential was shown to be one of the mechanisms by which

Pim1 protects cells from apoptosis [Rahman 2001]. Therefore, I propose that by activating autophagy, Pim1 could stimulate the removal of damaged mitochondria, making space for newly synthesised and functional ones, thereby regulating the energy metabolism of the cell (Fig. 31).

148 5. Final discussion 5. Final discussion

Fig. 31. RoleProposed role of Pim1 in regulation of autophagy and energy metabolism of the cell. Pim1 maintains low AMP/ATP ratio by activating ULK1 and inducing autophagy. Increased AMP level stimulates Pim1 by a mechanism that remains to be elucidated. Pim1 also takes part in maintaining mitochondria in their functional state by stimulating their synthesis through PGC-1α upregulation [Beharry 2011] and removing the damaged ones by mitophagy. Thus, inhibition of Pim1 leads to increased AMP/ATP ratio, activation of AMPK and inhibition of mTORC1, as described by Beharry et al.

Since triple knockout Pim1/2/3 mice have been described [Mikkers 2004,

Beharry 2011], these animals could be used to investigate the physiological significance of autophagy regulation by Pim kinases. For example, to confirm the hypothesis that

Pim1 regulates energy metabolism of the cell by stimulating mitophagy, mitochondria function could be analysed in these mice. Since hepatocytes were observed to undergo spontaneous mitophagy in culture [Rodriguez-Enriquez 2009], it would be very interesting to determine whether hepatocytes isolated from the triple knockout mice exhibit defective mitochondria accumulation and decreased mitochondrial membrane potential.

149 5. Final discussion 5. Final discussion

Like ULK1, investigating the role of Pim1 in autophagy is interesting from the medical point of view. Autophagy can be induced in cancer cells by radiation to promote their survival [Paglin 2001]. Furthermore, autophagy is upregulated in the premalignant stages of a tumour, allowing the cells to survive starvation conditions before developing the tumour's vessel system [Tóth 2002]. Similarly, Pim1 has been shown to be activated by stress and anti-cancer drug treatment [Chen 2009,

Zemskova 2008].

Thus, one could hypothesise that autophagy induction is one of the mechanisms by which Pim1 promotes tumour development. Consequently, the downregulation of autophagy in cancer cells following Pim1 inhibition could be a strategy to promote apoptotic cell death. Pim1 inhibitors were demonstrated to impair the growth of cancer cell lines in vitro [reviewed in Magnuson 2011]. However, it is possible that their effect may be undermined by activating autophagy by alternative mechanisms, for example

AMPK upregulation. Thus, to be even more effective, Pim1 inhibitors could be accompanied by targeting other kinases, like AMPK or ULK1. Therefore, understanding the autophagy regulating pathways could contribute to development of novel strategies for anti-cancer therapies.

150 6. References 6. References

6. References

Abbi S, Ueda H, Zheng C, Cooper LA, Zhao J, Christopher R, Guan JL: Regulation of focal adhesion kinase by a novel protein inhibitor FIP200. Mol Biol Cell 2002; 13(9):3178-91.

Aho TL, Sandholm J, Peltola KJ, Mankonen HP, Lilly M, Koskinen PJ: Pim-1 kinase promotes inactivation of the pro-apoptotic Bad protein by phosphorylating it on the Ser112 gatekeeper site. FEBS Lett 2004; 571(1-3):43-9.

Attisano L, Cárcamo J, Ventura F, Weis FM, Massagué J, Wrana JL: Identification of human activin and TGF beta type I receptors that form heteromeric kinase complexes with type II receptors. Cell 1993; 75(4):671-80.

Axe EL, Walker SA, Manifava M, Chandra P, Roderick HL, Habermann A, Griffiths G, Ktistakis NT: Autophagosome formation from membrane compartments enriched in phosphatidylinositol 3-phosphate and dynamically connected to the endoplasmic reticulum. J Cell Biol 2008; 182(4):685-701.

Bachmann M, Kosan C, Xing PX, Montenarh M, Hoffmann I, Möröy T: The oncogenic serine/threonine kinase Pim-1 directly phosphorylates and activates the G2/M specific phosphatase Cdc25C. Int J Biochem Cell Biol 2006; 38(3):430-43.

Bachmann M, Möröy T: The serine/threonine kinase Pim-1. Int J Biochem Cell Biol 2005; 37(4):726-30.

Beharry Z, Mahajan S, Zemskova M, Lin YW, Tholanikunnel BG, Xia Z, Smith CD, Kraft AS: The Pim protein kinases regulate energy metabolism and cell growth. Proc Natl Acad Sci U S A 2011; 108(2):528-33.

Bhattacharya N, Wang Z, Davitt C, McKenzie IF, Xing PX, Magnuson NS: Pim-1 associates with protein complexes necessary for mitosis. Chromosoma 2002; 111(2):80- 95.

Bjørkøy G, Lamark T, Brech A, Outzen H, Perander M, Overvatn A, Stenmark H, Johansen T: p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J Cell Biol 2005; 171(4):603-14.

Bjørkøy G, Lamark T, Pankiv S, Øvervatn A, Brech A, Johansen T: Monitoring autophagic degradation of p62/SQSTM1. Methods Enzymol 2009; 452:181-97.

Blasius TL, Cai D, Jih GT, Toret CP, Verhey KJ: Two binding partners cooperate to activate the molecular motor Kinesin-1. J Cell Biol 2007; 176(1):11-7.

Blommaart EF, Luiken JJ, Blommaart PJ, van Woerkom GM, Meijer AJ: Phosphorylation of ribosomal protein S6 is inhibitory for autophagy in isolated rat hepatocytes. J Biol Chem 1995; 270(5):2320-6.

151 6. References 6. References

Bohensky J, Shapiro IM, Leshinsky S, Watanabe H, Srinivas V: PIM-2 is an independent regulator of chondrocyte survival and autophagy in the epiphyseal growth plate. J Cell Physiol 2007; 213(1):246-51.

Brenner S: The genetics of Caenorhabditis elegans. Genetics 1974; 77(1):71-94.

Buckley AR, Buckley DJ, Leff MA, Hoover DS, Magnuson NS: Rapid induction of pim-1 expression by prolactin and interleukin-2 in rat Nb2 lymphoma cells. Endocrinology 1995; 136(12):5252-9.

Bullock AN, Debreczeni J, Amos AL, Knapp S, Turk BE: Structure and substrate specificity of the Pim-1 kinase. J Biol Chem 2005; 280(50):41675-82.

Caenepeel S, Charydczak G, Sudarsanam S, Hunter T, Manning G: The mouse kinome: discovery and comparative genomics of all mouse protein kinases. Proc Natl Acad Sci U S A 2004; 101(32):11707-12.

Camenisch TD, Koller BH, Earp HS, Matsushima GK: A novel receptor tyrosine kinase, Mer, inhibits TNF-alpha production and lipopolysaccharide-induced endotoxic shock. J Immunol 1999; 162(6):3498-503.

Cantó C, Auwerx J: PGC-1alpha, SIRT1 and AMPK, an energy sensing network that controls energy expenditure. Curr Opin Lipidol 2009; 20(2):98-105.

Chan EY, Kir S, Tooze SA: siRNA screening of the kinome identifies ULK1 as a multidomain modulator of autophagy. J Biol Chem 2007; 282(35):25464-74.

Chan EY, Longatti A, McKnight NC, Tooze SA: Kinase-inactivated ULK proteins inhibit autophagy via their conserved C-terminal domains using an Atg13-independent mechanism. Mol Cell Biol 2009; 29(1):157-71.

Chang CW, Sud D, Mycek MA: Fluorescence lifetime imaging microscopy. Methods Cell Biol 2007; 81:495-524.

Chen HJ, Rojas-Soto M, Oguni A, Kennedy MB: A synaptic Ras-GTPase activating protein (p135 SynGAP) inhibited by CaM kinase II. Neuron 1998; 20(5):895-904.

Chen J, Carey K, Godowski PJ: Identification of Gas6 as a ligand for Mer, a neural cell adhesion molecule related receptor tyrosine kinase implicated in cellular transformation. Oncogene 1997; 14(17):2033-9.

Chen J, Kobayashi M, Darmanin S, Qiao Y, Gully C, Zhao R, Kondo S, Wang H, Wang H, Yeung SC, Lee MH: Hypoxia-mediated up-regulation of Pim-1 contributes to solid tumor formation. Am J Pathol 2009; 175(1):400-11.

Chen Y, Klionsky DJ: The regulation of autophagy - unanswered questions. J Cell Sci 2011; 124(Pt 2):161-70.

Cheong H, Lindsten T, Wu J, Lu C, Thompson CB: Ammonia-induced autophagy is independent of ULK1/ULK2 kinases. Proc Natl Acad Sci U S A 2011; 108(27):11121-6.

152 6. References 6. References

Cheong H, Nair U, Geng J, Klionsky DJ: The Atg1 kinase complex is involved in the regulation of protein recruitment to initiate sequestering vesicle formation for nonspecific autophagy in Saccharomyces cerevisiae. Mol Biol Cell 2008; 19(2):668-81.

Clark SL Jr: Cellular differentiation in the kidneys of newborn mice studies with the electron microscope. J Biophys Biochem Cytol 1957; 3(3):349-62.

Cooney R, Baker J, Brain O, Danis B, Pichulik T, Allan P, Ferguson DJ, Campbell BJ, Jewell D, Simmons A: NOD2 stimulation induces autophagy in dendritic cells influencing bacterial handling and antigen presentation. Nat Med 2010; 16(1):90-7.

Cuervo AM: Autophagy: in sickness and in health. Trends Cell Biol 2004; 14(2):70-7.

Cuypers HT, Selten G, Quint W, Zijlstra M, Maandag ER, Boelens W, van Wezenbeek P, Melief C, Berns A: Murine leukemia virus-induced T-cell lymphomagenesis: integration of proviruses in a distinct chromosomal region. Cell 1984; 37(1):141-50.

Di Bartolomeo S, Corazzari M, Nazio F, Oliverio S, Lisi G, Antonioli M, Pagliarini V, Matteoni S, Fuoco C, Giunta L, D'Amelio M, Nardacci R, Romagnoli A, Piacentini M, Cecconi F, Fimia GM: The dynamic interaction of AMBRA1 with the dynein motor complex regulates mammalian autophagy. J Cell Biol 2010; 191(1):155-68.

Didichenko SA, Spiegl N, Brunner T, Dahinden CA: IL-3 induces a Pim1-dependent antiapoptotic pathway in primary human basophils. Blood 2008; 112(10):3949-58.

Dunlop EA, Hunt DK, Acosta-Jaquez HA, Fingar DC, Tee AR: ULK1 inhibits mTORC1 signaling, promotes multisite Raptor phosphorylation and hinders substrate binding. Autophagy 2011; 7(7):737-47.

Egan DF, Shackelford DB, Mihaylova MM, Gelino S, Kohnz RA, Mair W, Vasquez DS, Joshi A, Gwinn DM, Taylor R, Asara JM, Fitzpatrick J, Dillin A, Viollet B, Kundu M, Hansen M, Shaw RJ: Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 2011; 331(6016):456-61.

Eggert A, Ikegaki N, Liu X, Chou TT, Lee VM, Trojanowski JQ, Brodeur GM: Molecular dissection of TrkA signal transduction pathways mediating differentiation in human neuroblastoma cells. Oncogene 2000; 19(16):2043-51.

Epple UD, Suriapranata I, Eskelinen EL, Thumm M: Aut5/Cvt17p, a putative lipase essential for disintegration of autophagic bodies inside the vacuole. J Bacteriol 2001; 183(20):5942-55.

Eskelinen EL: Maturation of autophagic vacuoles in Mammalian cells. Autophagy 2005; 1(1):1-10.

Fialka I, Steinlein P, Ahorn H, Böck G, Burbelo PD, Haberfellner M, Lottspeich F, Paiha K, Pasquali C, Huber LA: Identification of syntenin as a protein of the apical early endocytic compartment in Madin-Darby canine kidney cells. J Biol Chem 1999; 274(37):26233-9.

153 6. References 6. References

Fimia GM, Stoykova A, Romagnoli A, Giunta L, Di Bartolomeo S, Nardacci R, Corazzari M, Fuoco C, Ucar A, Schwartz P, Gruss P, Piacentini M, Chowdhury K, Cecconi F: Ambra1 regulates autophagy and development of the nervous system. Nature 2007; 447(7148):1121-5.

Fingar DC, Blenis J: Target of rapamycin (TOR): an integrator of nutrient and growth factor signals and coordinator of cell growth and cell cycle progression. Oncogene 2004; 23(18):3151-71.

Fischer von Mollard G, Stahl B, Walch-Solimena C, Takei K, Daniels L, Khoklatchev A, De Camilli P, Südhof TC, Jahn R: Localization of Rab5 to synaptic vesicles identifies endosomal intermediate in synaptic vesicle recycling pathway. Eur J Cell Biol 1994; 65(2):319-26.

Fujita N, Hayashi-Nishino M, Fukumoto H, Omori H, Yamamoto A, Noda T, Yoshimori T: An Atg4B mutant hampers the lipidation of LC3 paralogues and causes defects in autophagosome closure. Mol Biol Cell 2008; 19(11):4651-9.

Fukunaga R, Hunter T: MNK1, a new MAP kinase-activated protein kinase, isolated by a novel expression screening method for identifying protein kinase substrates. EMBO J 1997; 16(8):1921-33.

Fukunaga R, Hunter T: Identification of MAPK substrates by expression screening with solid-phase phosphorylation. Methods Mol Biol 2004; 250:211-36.

Gal A, Li Y, Thompson DA, Weir J, Orth U, Jacobson SG, Apfelstedt-Sylla E, Vollrath D: Mutations in MERTK, the human orthologue of the RCS rat retinal dystrophy gene, cause retinitis pigmentosa. Nat Genet 2000; 26(3):270-1.

Ganley IG, Lam du H, Wang J, Ding X, Chen S, Jiang X: ULK1.ATG13.FIP200 complex mediates mTOR signaling and is essential for autophagy. J Biol Chem 2009; 284(18):12297-305.

Gao W, Shen Z, Shang L, Wang X: Upregulation of human autophagy-initiation kinase ULK1 by tumor suppressor p53 contributes to DNA-damage-induced cell death. Cell Death Differ 2011; 18(10):1598-607.

Gao X, Zhang Y, Arrazola P, Hino O, Kobayashi T, Yeung RS, Ru B, Pan D: Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling. Nat Cell Biol 2002; 4(9):699-704.

Geisler S, Holmström KM, Skujat D, Fiesel FC, Rothfuss OC, Kahle PJ, Springer W: PINK1/Parkin-mediated mitophagy is dependent on VDAC1 and p62/SQSTM1. Nat Cell Biol 2010; 12(2):119-31.

Georgescu MM, Kirsch KH, Shishido T, Zong C, Hanafusa H: Biological effects of c- Mer receptor tyrosine kinase in hematopoietic cells depend on the Grb2 binding site in the receptor and activation of NF-kappaB. Mol Cell Biol 1999; 19(2):1171-81.

154 6. References 6. References

Graham DK, Dawson TL, Mullaney DL, Snodgrass HR, Earp HS: Cloning and mRNA expression analysis of a novel human protooncogene, c-mer. Cell Growth Differ 1994; 5(6):647-57.

Gwinn DM, Shackelford DB, Egan DF, Mihaylova MM, Mery A, Vasquez DS, Turk BE, Shaw RJ: AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol Cell 2008; 30(2):214-26.

Hagemann C, Rapp UR: Isotype-specific functions of Raf kinases. Exp Cell Res 1999; 253(1):34-46.

Hailey DW, Rambold AS, Satpute-Krishnan P, Mitra K, Sougrat R, Kim PK, Lippincott- Schwartz J: Mitochondria supply membranes for autophagosome biogenesis during starvation. Cell 2010; 141(4):656-67.

Hanada T, Noda NN, Satomi Y, Ichimura Y, Fujioka Y, Takao T, Inagaki F, Ohsumi Y: The Atg12-Atg5 conjugate has a novel E3-like activity for protein lipidation in autophagy. J Biol Chem 2007; 282(52):37298-302.

Hanks SK, Hunter T: Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J 1995; 9(8):576-96.

Hara T, Takamura A, Kishi C, Iemura S, Natsume T, Guan JL, Mizushima N: FIP200, a ULK-interacting protein, is required for autophagosome formation in mammalian cells. J Cell Biol 2008; 181(3):497-510.

Hedgecock EM, Culotti JG, Thomson JN, Perkins LA: Axonal guidance mutants of Caenorhabditis elegans identified by filling sensory neurones with fluorescein dyes. Dev Biol 1985; 111(1):158-70.

Henckaerts L, Cleynen I, Brinar M, John JM, Van Steen K, Rutgeerts P, Vermeire S: Genetic variation in the autophagy gene ULK1 and risk of Crohn's disease. Inflamm Bowel Dis 2011; 17(6):1392-7.

Hirbec H, Francis JC, Lauri SE, Braithwaite SP, Coussen F, Mulle C, Dev KK, Coutinho V, Meyer G, Isaac JT, Collingridge GL, Henley JM: Rapid and differential regulation of AMPA and kainate receptors at hippocampal mossy fibre synapses by PICK1 and GRIP. Neuron 2003; 37(4):625-38.

Hosokawa N, Hara T, Kaizuka T, Kishi C, Takamura A, Miura Y, Iemura S, Natsume T, Takehana K, Yamada N, Guan JL, Oshiro N, Mizushima N: Nutrient-dependent mTORC1 association with the ULK1-Atg13-FIP200 complex required for autophagy. Mol Biol Cell 2009; 20(7):1981-91.

Ichimura Y, Kirisako T, Takao T, Satomi Y, Shimonishi Y, Ishihara N, Mizushima N, Tanida I, Kominami E, Ohsumi M, Noda T, Ohsumi Y: A ubiquitin-like system mediates protein lipidation. Nature 2000; 408(6811):488-92.

Inoki K, Li Y, Zhu T, Wu J, Guan KL: TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 2002; 4(9):648-57.

155 6. References 6. References

Inoki K, Zhu T, Guan KL: TSC2 mediates cellular energy response to control cell growth and survival. Cell 2003; 115(5):577-90.

Ishibashi K, Kanno E, Itoh T, Fukuda M: Identification and characterization of a novel Tre-2/Bub2/Cdc16 (TBC) protein that possesses Rab3A-GAP activity. Genes Cells 2009; 14(1):41-52.

Itakura E, Kishi C, Inoue K, Mizushima N: Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Mol Biol Cell 2008; 19(12):5360-72.

Itakura E, Mizushima N: Characterization of autophagosome formation site by a hierarchical analysis of mammalian Atg proteins. Autophagy 2010; 6(6):764-76.

Jacinto E, Loewith R, Schmidt A, Lin S, Rüegg MA, Hall A, Hall MN: Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol 2004; 6(11):1122-8.

Jaster R, Tschirch E, Bittorf T, Brock J: Interferon-alpha inhibits proliferation of Ba/F3 cells by interfering with interleukin-3 action. Cell Signal 1999; 11(10):769-75.

Jeffries TR, Dove SK, Michell RH, Parker PJ: PtdIns-specific MPR pathway association of a novel WD40 repeat protein, WIPI49. Mol Biol Cell 2004; 15(6):2652-63.

Jeon WB, Aceti DJ, Bingman CA, Vojtik FC, Olson AC, Ellefson JM, McCombs JE, Sreenath HK, Blommel PG, Seder KD, Burns BT, Geetha HV, Harms AC, Sabat G, Sussman MR, Fox BG, Phillips GN Jr: High-throughput purification and quality assurance of Arabidopsis thaliana proteins for eukaryotic structural genomics. J Struct Funct Genomics 2005; 6(2-3):143-7.

Johnson LN, Lowe ED, Noble ME, Owen DJ: The Eleventh Datta Lecture. The structural basis for substrate recognition and control by protein kinases. FEBS Lett 1998; 430(1-2):1-11.

Jung CH, Jun CB, Ro SH, Kim YM, Otto NM, Cao J, Kundu M, Kim DH: ULK-Atg13- FIP200 complexes mediate mTOR signaling to the autophagy machinery. Mol Biol Cell 2009; 20(7):1992-2003.

Jung CH, Seo M, Otto NM, Kim DH: ULK1 inhibits the kinase activity of mTORC1 and cell proliferation. Autophagy 2011; 7(10):Epub.

Kabeya Y, Kamada Y, Baba M, Takikawa H, Sasaki M, Ohsumi Y: Atg17 functions in cooperation with Atg1 and Atg13 in yeast autophagy. Mol Biol Cell 2005; 16(5):2544- 53.

Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T, Kominami E, Ohsumi Y, Yoshimori T: LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 2000; 22(17):4577.

156 6. References 6. References

Kamada Y, Funakoshi T, Shintani T, Nagano K, Ohsumi M, Ohsumi Y: Tor-mediated induction of autophagy via an Apg1 protein kinase complex. J Cell Biol 2000; 150(6):1507-13.

Kaminskyy V, Abdi A, Zhivotovsky B: A quantitative assay for the monitoring of autophagosome accumulation in different phases of the cell cycle. Autophagy 2011; 7(1):83-90.

Kapust RB, Waugh DS: Escherichia coli maltose-binding protein is uncommonly effective at promoting the solubility of polypeptides to which it is fused. Protein Sci 1999; 8(8):1668-74.

Kihara A, Noda T, Ishihara N, Ohsumi Y: Two distinct Vps34 phosphatidylinositol 3- kinase complexes function in autophagy and carboxypeptidase Y sorting in Saccharomyces cerevisiae. J Cell Biol 2001; 152(3):519-30.

Kim DH, Sarbassov DD, Ali SM, King JE, Latek RR, Erdjument-Bromage H, Tempst P, Sabatini DM: mTOR interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery. Cell 2002a; 110(2):163-75.

Kim J, Huang WP, Stromhaug PE, Klionsky DJ: Convergence of multiple autophagy and cytoplasm to vacuole targeting components to a perivacuolar membrane compartment prior to de novo vesicle formation. J Biol Chem 2002b; 277(1):763-73.

Kim J, Klionsky DJ: Autophagy, cytoplasm-to-vacuole targeting pathway, and pexophagy in yeast and mammalian cells. Annu Rev Biochem 2000; 69:303-42.

Kim J, Kundu M, Viollet B, Guan KL: AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol 2011; 13(2):132-41.

Kinoshita E, Kinoshita-Kikuta E, Takiyama K, Koike T: Phosphate-binding tag, a new tool to visualize phosphorylated proteins. Mol Cell Proteomics 2006; 5(4):749-57.

Kirisako T, Ichimura Y, Okada H, Kabeya Y, Mizushima N, Yoshimori T, Ohsumi M, Takao T, Noda T, Ohsumi Y: The reversible modification regulates the membrane- binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to vacuole targeting pathway. J Cell Biol 2000; 151(2):263-76.

Kirkin V, Lamark T, Sou YS, Bjørkøy G, Nunn JL, Bruun JA, Shvets E, McEwan DG, Clausen TH, Wild P, Bilusic I, Theurillat JP, Øvervatn A, Ishii T, Elazar Z, Komatsu M, Dikic I, Johansen T: A role for NBR1 in autophagosomal degradation of ubiquitinated substrates. Mol Cell 2009; 33(4):505-16.

Kuma A, Hatano M, Matsui M, Yamamoto A, Nakaya H, Yoshimori T, Ohsumi Y, Tokuhisa T, Mizushima N: The role of autophagy during the early neonatal starvation period. Nature 2004; 432(7020):1032-6.

Kundu M, Lindsten T, Yang CY, Wu J, Zhao F, Zhang J, Selak MA, Ney PA, Thompson CB: Ulk1 plays a critical role in the autophagic clearance of mitochondria and ribosomes during reticulocyte maturation. Blood 2008; 112(4):1493-502.

157 6. References 6. References

Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227(5259):680-5.

Lee CY, Baehrecke EH: Steroid regulation of autophagic programmed cell death during development. Development 2001; 128(8):1443-55.

Lee EJ, Tournier C: The requirement of uncoordinated 51-like kinase 1 (ULK1) and ULK2 in the regulation of autophagy. Autophagy 2011; 7(7):689-95.

Lee JW, Park S, Takahashi Y, Wang HG: The association of AMPK with ULK1 regulates autophagy. PLoS One 2010; 5(11):e15394.

Lee SB, Kim S, Lee J, Park J, Lee G, Kim Y, Kim JM, Chung J: ATG1, an autophagy regulator, inhibits cell growth by negatively regulating S6 kinase. EMBO Rep 2007; 8(4):360-5.

Leitch AE, Haslett C, Rossi AG: Cyclin-dependent kinase inhibitor drugs as potential novel anti-inflammatory and pro-resolution agents. Br J Pharmacol 2009; 158(4):1004- 16.

Lemasters JJ, Qian T, He L, Kim JS, Elmore SP, Cascio WE, Brenner DA: Role of mitochondrial inner membrane permeabilization in necrotic cell death, apoptosis, and autophagy. Antioxid Redox Signal 2002; 4(5):769-81.

Levine B, Klionsky DJ: Development by self-digestion: molecular mechanisms and biological functions of autophagy. Dev Cell 2004; 6(4):463-77.

Liang C, Feng P, Ku B, Dotan I, Canaani D, Oh BH, Jung JU: Autophagic and tumour suppressor activity of a novel Beclin1-binding protein UVRAG. Nat Cell Biol 2006; 8(7):688-99.

Liang C, Lee JS, Inn KS, Gack MU, Li Q, Roberts EA, Vergne I, Deretic V, Feng P, Akazawa C, Jung JU: Beclin1-binding UVRAG targets the class C Vps complex to coordinate autophagosome maturation and endocytic trafficking. Nat Cell Biol 2008; 10(7):776-87.

Liang H, Hittelman W, Nagarajan L: Ubiquitous expression and cell cycle regulation of the protein kinase PIM-1. Arch Biochem Biophys 1996; 330(2):259-65.

Liang XH, Jackson S, Seaman M, Brown K, Kempkes B, Hibshoosh H, Levine B: Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature 1999; 402(6762):672-6.

Lizcano JM, Göransson O, Toth R, Deak M, Morrice NA, Boudeau J, Hawley SA, Udd L, Mäkelä TP, Hardie DG, Alessi DR: LKB1 is a master kinase that activates 13 kinases of the AMPK subfamily, including MARK/PAR-1. EMBO J 2004; 23(4):833-43.

Loewith R, Jacinto E, Wullschleger S, Lorberg A, Crespo JL, Bonenfant D, Oppliger W, Jenoe P, Hall MN: Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol Cell 2002; 10:457-468.

158 6. References 6. References

Löffler AS, Alers S, Dieterle AM, Keppeler H, Franz-Wachtel M, Kundu M, Campbell DG, Wesselborg S, Alessi DR, Stork B: Ulk1-mediated phosphorylation of AMPK constitutes a negative regulatory feedback loop. Autophagy 2011; 7(7):696-706.

Long X, Lin Y, Ortiz-Vega S, Yonezawa K, Avruch J: Rheb binds and regulates the mTOR kinase. Curr Biol 2005; 15(8):702-13.

Ma J, Arnold HK, Lilly MB, Sears RC, Kraft AS: Negative regulation of Pim-1 protein kinase levels by the B56beta subunit of PP2A. Oncogene 2007; 26(35):5145-53.

Mahajan NP, Earp HS: An SH2 domain-dependent, phosphotyrosine-independent interaction between Vav1 and the Mer receptor tyrosine kinase: a mechanism for localizing guanine nucleotide-exchange factor action. J Biol Chem 2003; 278(43):42596-603.

Maita H, Harada Y, Nagakubo D, Kitaura H, Ikeda M, Tamai K, Takahashi K, Ariga H, Iguchi-Ariga SM: PAP-1, a novel target protein of phosphorylation by pim-1 kinase. Eur J Biochem 2000; 267(16):5168-78.

Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Lu F, Marchler GH, Mullokandov M, Omelchenko MV, Robertson CL, Song JS, Thanki N, Yamashita RA, Zhang D, Zhang N, Zheng C, Bryant SH: CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Res 2011; 39(Database issue):D225-9.

Matsunaga K, Saitoh T, Tabata K, Omori H, Satoh T, Kurotori N, Maejima I, Shirahama-Noda K, Ichimura T, Isobe T, Akira S, Noda T, Yoshimori T: Two Beclin 1- binding proteins, Atg14L and Rubicon, reciprocally regulate autophagy at different stages. Nat Cell Biol 2009; 11(4):385-96.

Meijer WH, van der Klei IJ, Veenhuis M, Kiel JA: ATG genes involved in non-selective autophagy are conserved from yeast to man, but the selective Cvt and pexophagy pathways also require organism-specific genes. Autophagy 2007; 3(2):106-16.

Mercer CA, Kaliappan A, Dennis PB: A novel, human Atg13 binding protein, Atg101, interacts with ULK1 and is essential for macroautophagy. Autophagy 2009; 5(5):649- 62.

Mikkers H, Nawijn M, Allen J, Brouwers C, Verhoeven E, Jonkers J, Berns A: Mice deficient for all PIM kinases display reduced body size and impaired responses to hematopoietic growth factors. Mol Cell Biol 2004; 24(13):6104-15.

Mizuno K, Shirogane T, Shinohara A, Iwamatsu A, Hibi M, Hirano T: Regulation of Pim-1 by Hsp90. Biochem Biophys Res Commun 2001; 281(3):663-9.

Mizushima N: Methods for monitoring autophagy. Int J Biochem Cell Biol 2004; 36(12):2491-502.

159 6. References 6. References

Mochizuki T, Kitanaka C, Noguchi K, Muramatsu T, Asai A, Kuchino Y: Physical and functional interactions between Pim-1 kinase and Cdc25A phosphatase. Implications for the Pim-1-mediated activation of the c-Myc signaling pathway. J Biol Chem 1999; 274(26):18659-66.

Mora A, Komander D, van Aalten DM, Alessi DR: PDK1, the master regulator of AGC kinase signal transduction. Semin Cell Dev Biol 2004; 15(2):161-70.

Morishita D, Katayama R, Sekimizu K, Tsuruo T, Fujita N: Pim kinases promote cell cycle progression by phosphorylating and down-regulating p27Kip1 at the transcriptional and posttranscriptional levels. Cancer Res 2008; 68(13):5076-85.

Möröy T, Grzeschiczek A, Petzold S, Hartmann KU: Expression of a Pim-1 transgene accelerates lymphoproliferation and inhibits apoptosis in lpr/lpr mice. Proc Natl Acad Sci U S A 1993; 90(22):10734-8.

Nakano T, Ishimoto Y, Kishino J, Umeda M, Inoue K, Nagata K, Ohashi K, Mizuno K, Arita H: Cell adhesion to phosphatidylserine mediated by a product of growth arrest- specific gene 6. J Biol Chem 1997; 272(47):29411-4.

Nakatogawa H, Ichimura Y, Ohsumi Y: Atg8, a ubiquitin-like protein required for autophagosome formation, mediates membrane tethering and hemifusion. Cell 2007; 130(1):165-78.

Narimatsu M, Maeda H, Itoh S, Atsumi T, Ohtani T, Nishida K, Itoh M, Kamimura D, Park SJ, Mizuno K, Miyazaki J, Hibi M, Ishihara K, Nakajima K, Hirano T: Tissue- specific autoregulation of the stat3 gene and its role in interleukin-6-induced survival signals in T cells. Mol Cell Biol 2001; 21(19):6615-25.

Nihira K, Ando Y, Yamaguchi T, Kagami Y, Miki Y, Yoshida K: Pim-1 controls NF- kappaB signalling by stabilizing RelA/p65. Cell Death Differ 2010; 17(4):689-98.

Noda M, Ko M, Ogura A, Liu DG, Amano T, Takano T, Ikawa Y: Sarcoma viruses carrying ras oncogenes induce differentiation-associated properties in a neuronal cell line. Nature 1985; 318(6041):73-5.

Noda NN, Kumeta H, Nakatogawa H, Satoo K, Adachi W, Ishii J, Fujioka Y, Ohsumi Y, Inagaki F: Structural basis of target recognition by Atg8/LC3 during selective autophagy. Genes Cells 2008; 13(12):1211-8.

Noda T, Kim J, Huang WP, Baba M, Tokunaga C, Ohsumi Y, Klionsky DJ: Apg9p/Cvt7p is an integral membrane protein required for transport vesicle formation in the Cvt and autophagy pathways. J Cell Biol 2000; 148(3):465-80.

Noda T, Ohsumi Y: Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. J Biol Chem 1998; 273(7):3963-6.

Novak I, Kirkin V, McEwan DG, Zhang J, Wild P, Rozenknop A, Rogov V, Löhr F, Popovic D, Occhipinti A, Reichert AS, Terzic J, Dötsch V, Ney PA, Dikic I: Nix is a selective autophagy receptor for mitochondrial clearance. EMBO Rep 2010; 11(1):45- 51.

160 6. References 6. References

Obara K, Sekito T, Ohsumi Y: Assortment of phosphatidylinositol 3-kinase complexes-- Atg14p directs association of complex I to the pre-autophagosomal structure in Saccharomyces cerevisiae. Mol Biol Cell 2006; 17(4):1527-39.

Oberstein A, Jeffrey PD, Shi Y: Crystal structure of the Bcl-XL-Beclin 1 peptide complex: Beclin 1 is a novel BH3-only protein. J Biol Chem 2007; 282(17):13123-32.

Ogura K, Wicky C, Magnenat L, Tobler H, Mori I, Müller F, Ohshima Y: Caenorhabditis elegans unc-51 gene required for axonal elongation encodes a novel serine/threonine kinase. Genes Dev 1994; 8(20):2389-400.

Okazaki N, Yan J, Yuasa S, Ueno T, Kominami E, Masuho Y, Koga H, Muramatsu M: Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res 2000; 85(1-2):1-12.

Paglin S, Hollister T, Delohery T, Hackett N, McMahill M, Sphicas E, Domingo D, Yahalom J: A novel response of cancer cells to radiation involves autophagy and formation of acidic vesicles. Cancer Res 2001; 61(2):439-44.

Palaty CK, Clark-Lewis I, Leung D, Pelech SL: Phosphorylation site substrate specificity determinants for the Pim-1 protooncogene-encoded protein kinase. Biochem Cell Biol 1997; 75(2):153-62.

Pankiv S, Clausen TH, Lamark T, Brech A, Bruun JA, Outzen H, Øvervatn A, Bjørkøy G, Johansen T: p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J Biol Chem 2007; 282(33):24131-45.

Pattingre S, Tassa A, Qu X, Garuti R, Liang XH, Mizushima N, Packer M, Schneider MD, Levine B: Bcl-2 antiapoptotic proteins inhibit Beclin 1-dependent autophagy. Cell 2005; 122(6):927-39.

Proikas-Cezanne T, Waddell S, Gaugel A, Frickey T, Lupas A, Nordheim A: WIPI- 1alpha (WIPI49), a member of the novel 7-bladed WIPI protein family, is aberrantly expressed in human cancer and is linked to starvation-induced autophagy. Oncogene 2004; 23(58):9314-25.

Ptacek J, Devgan G, Michaud G, Zhu H, Zhu X, Fasolo J, Guo H, Jona G, Breitkreutz A, Sopko R, McCartney RR, Schmidt MC, Rachidi N, Lee SJ, Mah AS, Meng L, Stark MJ, Stern DF, De Virgilio C, Tyers M, Andrews B, Gerstein M, Schweitzer B, Predki PF, Snyder M: Global analysis of protein phosphorylation in yeast. Nature 2005; 438(7068):679-84.

Qian KC, Wang L, Hickey ER, Studts J, Barringer K, Peng C, Kronkaitis A, Li J, White A, Mische S, Farmer B: Structural basis of constitutive activity and a unique nucleotide binding mode of human Pim-1 kinase. J Biol Chem 2005; 280(7):6130-7.

Quarmby LM, Mahjoub MR: Caught Nek-ing: cilia and centrioles. J Cell Sci 2005; 118(Pt 22):5161-9.

161 6. References 6. References

Rahman Z, Yoshikawa H, Nakajima Y, Tasaka K: Down-regulation of Pim-1 and Bcl-2 is accompanied with apoptosis of interleukin-6-depleted mouse B-cell hybridoma 7TD1 cells. Immunol Lett 2001; 75(3):199-208.

Ravikumar B, Berger Z, Vacher C, O'Kane CJ, Rubinsztein DC: Rapamycin pre-treatment protects against apoptosis. Hum Mol Genet 2006; 15(7):1209-16.

Ravikumar B, Duden R, Rubinsztein DC: Aggregate-prone proteins with polyglutamine and polyalanine expansions are degraded by autophagy. Hum Mol Genet 2002; 11(9):1107-17.

Razi M, Chan EY, Tooze SA: Early endosomes and endosomal coatomer are required for autophagy. J Cell Biol 2009; 185(2):305-21.

Reggiori F: Membrane origin for autophagy. Curr Top Dev Biol 2006; 74:1-30.

Reggiori F, Tooze SA: The EmERgence of autophagosomes. Dev Cell 2009; 17(6):747- 8.

Reggiori F, Tucker KA, Stromhaug PE, Klionsky DJ: The Atg1-Atg13 complex regulates Atg9 and Atg23 retrieval transport from the pre-autophagosomal structure. Dev Cell 2004; 6(1):79-90.

Rodriguez-Enriquez S, Kai Y, Maldonado E, Currin RT, Lemasters JJ: Roles of mitophagy and the mitochondrial permeability transition in remodeling of cultured rat hepatocytes. Autophagy 2009; 5(8):1099-106.

Rodriguez-Enriquez S, He L, Lemasters JJ: Role of mitochondrial permeability transition pores in mitochondrial autophagy. Int J Biochem Cell Biol 2004; 36(12):2463-72.

Rusten TE, Stenmark H: How do ESCRT proteins control autophagy. J Cell Sci 2009; 122(Pt 13):2179-83.

Sabers CJ, Martin MM, Brunn GJ, Williams JM, Dumont FJ, Wiederrecht G, Abraham RT: Isolation of a protein target of the FKBP12-rapamycin complex in mammalian cells. J Biol Chem 1995; 270(2):815-22.

Sagiv Y, Legesse-Miller A, Porat A, Elazar Z: GATE-16, a membrane transport modulator, interacts with NSF and the Golgi v-SNARE GOS-28. EMBO J 2000; 19(7):1494-504.

Sarbassov DD, Ali SM, Kim DH, Guertin DA, Latek RR, Erdjument-Bromage H, Tempst P, Sabatini DM: Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptorindependent pathway that regulates the cytoskeleton. Curr Biol 2004; 14:1296-1302.

Sarbassov DD, Guertin DA, Ali SM, Sabatini DM: Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 2005; 307(5712):1098-101.

162 6. References 6. References

Scott RC, Juhász G, Neufeld TP: Direct induction of autophagy by Atg1 inhibits cell growth and induces apoptotic cell death. Curr Biol 2007; 17(1):1-11.

Seglen PO, Bohley P: Autophagy and other vacuolar protein degradation mechanisms. Experientia 1992; 48(2):158-72.

Shackelford DB, Shaw RJ: The LKB1-AMPK pathway: metabolism and growth control in tumour suppression. Nat Rev Cancer 2009; 9(8):563-75.

Shang L, Chen S, Du F, Li S, Zhao L, Wang X: Nutrient starvation elicits an acute autophagic response mediated by Ulk1 dephosphorylation and its subsequent dissociation from AMPK. Proc Natl Acad Sci U S A 2011; 108(12):4788-93.

Shay KP, Wang Z, Xing PX, McKenzie IF, Magnuson NS: Pim-1 kinase stability is regulated by heat shock proteins and the ubiquitin-proteasome pathway. Mol Cancer Res 2005; 3(3):170-81.

Shimizu S, Kanaseki T, Mizushima N, Mizuta T, Arakawa-Kobayashi S, Thompson CB, Tsujimoto Y: Role of Bcl-2 family proteins in a non-apoptotic programmed cell death dependent on autophagy genes. Nat Cell Biol 2004; 6(12):1221-8.

Shintani T, Klionsky DJ: Autophagy in health and disease: a double-edged sword. Science 2004; 306(5698):990-5.

Simonsen A, Tooze SA: Coordination of membrane events during autophagy by multiple class III PI3-kinase complexes. J Cell Biol 2009; 186(6):773-82.

Sou YS, Waguri S, Iwata J, Ueno T, Fujimura T, Hara T, Sawada N, Yamada A, Mizushima N, Uchiyama Y, Kominami E, Tanaka K, Komatsu M: The Atg8 conjugation system is indispensable for proper development of autophagic isolation membranes in mice. Mol Biol Cell 2008; 19(11):4762-75.

Strick DJ, Feng W, Vollrath D: Mertk drives myosin II redistribution during retinal pigment epithelial phagocytosis. Invest Ophthalmol Vis Sci 2009; 50(5):2427-35.

Strick DJ, Vollrath D: Focus on molecules: MERTK. Exp Eye Res 2010; 91(6):786-7.

Sun Q, Fan W, Chen K, Ding X, Chen S, Zhong Q: Identification of Barkor as a mammalian autophagy-specific factor for Beclin 1 and class III phosphatidylinositol 3- kinase. Proc Natl Acad Sci U S A 2008; 105(49):19211-6.

Suzuki K, Kirisako T, Kamada Y, Mizushima N, Noda T, Ohsumi Y: The preautophagosomal structure organized by concerted functions of APG genes is essential for autophagosome formation. EMBO J 2001; 20(21):5971-81.

Suzuki K, Kubota Y, Sekito T, Ohsumi Y: Hierarchy of Atg proteins in preautophagosomal structure organization. Genes Cells 2007; 12(2):209-18.

Suzuki K, Ohsumi Y: Current knowledge of the pre-autophagosomal structure (PAS). FEBS Lett 2010; 584(7):1280-6.

163 6. References 6. References

Takahashi Y, Coppola D, Matsushita N, Cualing HD, Sun M, Sato Y, Liang C, Jung JU, Cheng JQ, Mulé JJ, Pledger WJ, Wang HG: Bif-1 interacts with Beclin 1 through UVRAG and regulates autophagy and tumorigenesis. Nat Cell Biol 2007; 9(10):1142- 51.

Takahashi Y, Meyerkord CL, Wang HG: Bif-1/endophilin B1: a candidate for crescent driving force in autophagy. Cell Death Differ 2009; 16(7):947-55.

Takegawa K, DeWald DB, Emr SD: Schizosaccharomyces pombe Vps34p, a phosphatidylinositol-specific PI 3-kinase essential for normal cell growth and vacuole morphology. J Cell Sci 1995; 108(12):3745-56.

Tallóczy Z, Jiang W, Virgin HW 4th, Leib DA, Scheuner D, Kaufman RJ, Eskelinen EL, Levine B: Regulation of starvation- and virus-induced autophagy by the eIF2alpha kinase signaling pathway. Proc Natl Acad Sci U S A 2002; 99(1):190-5.

Tanaka Y, Guhde G, Suter A, Eskelinen EL, Hartmann D, Lüllmann-Rauch R, Janssen PM, Blanz J, von Figura K, Saftig P: Accumulation of autophagic vacuoles and cardiomyopathy in LAMP-2-deficient mice. Nature 2000; 406(6798):902-6.

Tang HW, Wang YB, Wang SL, Wu MH, Lin SY, Chen GC: Atg1-mediated myosin II activation regulates autophagosome formation during starvation-induced autophagy. EMBO J 2011; 30(4):636-51.

Tanida I, Minematsu-Ikeguchi N, Ueno T, Kominami E: Lysosomal turnover, but not a cellular level, of endogenous LC3 is a marker for autophagy. Autophagy 2005; 1(2):84- 91.

Tasdemir E, Maiuri MC, Tajeddine N, Vitale I, Criollo A, Vicencio JM, Hickman JA, Geneste O, Kroemer G: Cell cycle-dependent induction of autophagy, mitophagy and reticulophagy. Cell Cycle 2007; 6(18):2263-7.

Teter SA, Eggerton KP, Scott SV, Kim J, Fischer AM, Klionsky DJ: Degradation of lipid vesicles in the yeast vacuole requires function of Cvt17, a putative lipase. J Biol Chem 2001; 276(3):2083-7.

Thorburn A: Apoptosis and autophagy: regulatory connections between two supposedly different processes. Apoptosis 2008; 13(1):1-9.

Thumm M, Egner R, Koch B, Schlumpberger M, Straub M, Veenhuis M, Wolf DH: Isolation of autophagocytosis mutants of Saccharomyces cerevisiae. FEBS Lett 1994; 349(2):275-80.

Tibrewal N, Wu Y, D'mello V, Akakura R, George TC, Varnum B, Birge RB: Autophosphorylation docking site Tyr-867 in Mer receptor tyrosine kinase allows for dissociation of multiple signaling pathways for phagocytosis of apoptotic cells and down-modulation of lipopolysaccharide-inducible NF-kappaB transcriptional activation. J Biol Chem 2008; 283(6):3618-27.

164 6. References 6. References

Toda H, Mochizuki H, Flores R 3rd, Josowitz R, Krasieva TB, Lamorte VJ, Suzuki E, Gindhart JG, Furukubo-Tokunaga K, Tomoda T: UNC-51/ATG1 kinase regulates axonal transport by mediating motor-cargo assembly. Genes Dev 2008; 22(23):3292-307.

Tomoda T, Bhatt RS, Kuroyanagi H, Shirasawa T, Hatten ME: A mouse serine/threonine kinase homologous to C. elegans UNC51 functions in parallel fiber formation of cerebellar granule neurones. Neuron 1999; 24(4):833-46.

Tomoda T, Kim JH, Zhan C, Hatten ME: Role of Unc51.1 and its binding partners in CNS axon outgrowth. Genes Dev 2004; 18(5):541-58.

Tooze SA, Jefferies HB, Kalie E, Longatti A, McAlpine FE, McKnight NC, Orsi A, Polson HE, Razi M, Robinson DJ, Webber JL: Trafficking and signaling in mammalian autophagy. IUBMB Life 2010; 62(7):503-8.

Tóth S, Nagy K, Pálfia Z, Réz G: Cellular autophagic capacity changes during azaserine-induced tumour progression in the rat pancreas. Up-regulation in all premalignant stages and down-regulation with loss of cycloheximide sensitivity of segregation along with malignant transformation. Cell Tissue Res 2002; 309(3):409-16.

Travassos LH, Carneiro LA, Ramjeet M, Hussey S, Kim YG, Magalhães JG, Yuan L, Soares F, Chea E, Le Bourhis L, Boneca IG, Allaoui A, Jones NL, Nuñez G, Girardin SE, Philpott DJ: Nod1 and Nod2 direct autophagy by recruiting ATG16L1 to the plasma membrane at the site of bacterial entry. Nat Immunol 2010; 11(1):55-62.

Tsukada M, Ohsumi Y: Isolation and characterization of autophagy-defective mutants of Saccharomyces cerevisiae. FEBS Lett 1993; 333(1-2):169-74.

Ueki N, Kondo M, Seki N, Yano K, Oda T, Masuho Y, Muramatsu M: NOLP: identification of a novel human nucleolar protein and determination of sequence requirements for its nucleolar localization. Biochem Biophys Res Commun 1998; 252(1):97-102.

Verbeek S, van Lohuizen M, van der Valk M, Domen J, Kraal G, Berns A: Mice bearing the E mu-myc and E mu-pim-1 transgenes develop pre-B-cell leukemia prenatally. Mol Cell Biol 1991; 11(2):1176-9.

Vereb G, Balla A, Gergely P, Wymann MP, Gülkan H, Suer S, Heilmeyer LM Jr: The ATP-binding site of brain phosphatidylinositol 4-kinase PI4K230 as revealed by 5'-p- fluorosulfonylbenzoyladenosine. Int J Biochem Cell Biol 2001; 33(3):249-59.

Walker DH, Popov VL, Crocquet-Valdes PA, Welsh CJ, Feng HM: Cytokine-induced, nitric oxide-dependent, intracellular antirickettsial activity of mouse endothelial cells. Lab Invest 1997; 76(1):129-38.

Wang H, Bedford FK, Brandon NJ, Moss SJ, Olsen RW: GABA(A)-receptor-associated protein links GABA(A) receptors and the cytoskeleton. Nature 1999; 397(6714):69-72.

165 6. References 6. References

Wang Z, Bhattacharya N, Meyer MK, Seimiya H, Tsuruo T, Tonani JA, Magnuson NS: Pim-1 negatively regulates the activity of PTP-U2S phosphatase and influences terminal differentiation and apoptosis of monoblastoid leukemia cells. Arch Biochem Biophys 2001; 390(1):9-18.

Wang Z, Bhattacharya N, Mixter PF, Wei W, Sedivy J, Magnuson NS: Phosphorylation of the cell cycle inhibitor p21Cip1/WAF1 by Pim-1 kinase. Biochim Biophys Acta 2002; 1593(1):45-55.

Waugh DS: Making the most of affinity tags. Trends Biotechnol 2005; 23(6):316-20.

Webb JL, Ravikumar B, Atkins J, Skepper JN, Rubinsztein DC: Alpha-Synuclein is degraded by both autophagy and the proteasome. J Biol Chem 2003; 278(27):25009-13.

Wild P, Farhan H, McEwan DG, Wagner S, Rogov VV, Brady NR, Richter B, Korac J, Waidmann O, Choudhary C, Dötsch V, Bumann D, Dikic I: Phosphorylation of the autophagy receptor optineurin restricts Salmonella growth. Science 2011; 333(6039):228-33.

Wingett D, Reeves R, Magnuson NS: Characterization of the testes-specific pim-1 transcript in rat. Nucleic Acids Res 1992; 20(12):3183-9.

Yamamoto A, Morisawa Y, Verloes A, Murakami N, Hirano M, Nonaka I, Nishino I: Infantile autophagic vacuolar myopathy is distinct from Danon disease. Neurology 2001; 57(5):903-5.

Yan J, Kuroyanagi H, Kuroiwa A, Matsuda Y, Tokumitsu H, Tomoda T, Shirasawa T, Muramatsu M: Identification of mouse ULK1, a novel protein kinase structurally related to C. elegans UNC-51. Biochem Biophys Res Commun 1998; 246(1):222-7.

Yan J, Kuroyanagi H, Tomemori T, Okazaki N, Asato K, Matsuda Y, Suzuki Y, Ohshima Y, Mitani S, Masuho Y, Shirasawa T, Muramatsu M: Mouse ULK2, a novel member of the UNC-51-like protein kinases: unique features of functional domains. Oncogene 1999; 18(43):5850-9.

Yang Q, Guan KL: Expanding mTOR signaling. Cell Res 2007; 17(8):666-81.

Yang Q, Inoki K, Ikenoue T, Guan KL: Identification of Sin1 as an essential TORC2 component required for complex formation and kinase activity. Genes Dev 2006a; 20(20):2820-32.

Yang Z, Huang J, Geng J, Nair U, Klionsky DJ: Atg22 recycles amino acids to link the degradative and recycling functions of autophagy. Mol Biol Cell 2006b; 17(12):5094- 104.

Yang Z, Klionsky DJ: Mammalian autophagy: core molecular machinery and signaling regulation. Curr Opin Cell Biol 2010; 22(2):124-31.

Yoshimori T, Noda T: Toward unraveling membrane biogenesis in mammalian autophagy. Curr Opin Cell Biol 2008; 20(4):401-7.

166 6. References 6. References

Young AR, Chan EY, Hu XW, Köchl R, Crawshaw SG, High S, Hailey DW, Lippincott-Schwartz J, Tooze SA: Starvation and ULK1-dependent cycling of mammalian Atg9 between the TGN and endosomes. J Cell Sci 2006; 119(Pt 18):3888-900.

Yu L, Alva A, Su H, Dutt P, Freundt E, Welsh S, Baehrecke EH, Lenardo MJ: Regulation of an ATG7-beclin 1 program of autophagic cell death by caspase-8. Science 2004; 304(5676):1500-2.

Yuan J, Lipinski M, Degterev A: Diversity in the mechanisms of neuronal cell death. Neuron 2003; 40(2):401-13.

Zemskova M, Sahakian E, Bashkirova S, Lilly M: The PIM1 kinase is a critical component of a survival pathway activated by docetaxel and promotes survival of docetaxel-treated prostate cancer cells. J Biol Chem 2008; 283(30):20635-44.

Zhang Y, Wang Z, Magnuson NS: Pim-1 kinase-dependent phosphorylation of p21Cip1/WAF1 regulates its stability and cellular localization in H1299 cells. Mol Cancer Res 2007; 5(9):909-22.

Zhong Y, Wang QJ, Li X, Yan Y, Backer JM, Chait BT, Heintz N, Yue Z: Distinct regulation of autophagic activity by Atg14L and Rubicon associated with Beclin 1- phosphatidylinositol-3-kinase complex. Nat Cell Biol 2009; 11(4):468-76.

Zhou X, Babu JR, da Silva S, Shu Q, Graef IA, Oliver T, Tomoda T, Tani T, Wooten MW, Wang F: Unc-51-like kinase 1/2-mediated endocytic processes regulate filopodia extension and branching of sensory axons. Proc Natl Acad Sci U S A 2007; 104(14):5842-7.

167