EXPLORING the INTERACTIONS and FUNCTIONS of the ULK1 COMPLEX in the AUTOPHAGY PATHWAY a Dissertation SUBMITTED to the FACULTY OF

EXPLORING THE INTERACTIONS AND FUNCTIONS OF THE ULK1 COMPLEX IN

THE AUTOPHAGY PATHWAY

A Dissertation SUBMITTED TO THE FACULTY OF UNIVERSITY OF MINNESOTA BY

Neil Michael Otto

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

Dr. Do-Hyung Kim, Advisor

February 2014

Acknowledgements

I would like to thank my graduate advisor Dr. Kim for his knowledge and insight. He played a pivotal role in the development of my thesis work, and provided great advice for my scientific writing and experimental design.

To the past and present members of the Kim lab, thank you for your camaraderie and support through the years. I especially want to thank Drs. Chang-Hwa Jung, Young-Mi Kim, and Jing

Cao, not only for your technical expertise, but also for your words of wisdom that helped guide me through my graduate school experience.

I would also like to thank the members of my committee, Drs. Howard Towle, Thomas Neufeld,

Timothy Griffin, and Dennis Livingston for their input over the last 5 years. Especially Dr.

Howard Towle, thank you for being an incredibly supportive committee chair.

I had tremendous help from several collaborators. Drs. Ebbing de Jong and Matthew Stone, thank you for your support in mass spectrometry techniques that were used for the p62 phosphorylation project. Drs. Branden Moriarity, and Eric Rahrmann, thank you for your help in creating the

Atg13 KO cell line and other stable cell lines that were invaluable to my research. Also, thank you all for being fun friends and making science enjoyable.

Finally, thanks to all of those who worked on the 7th floor of MCB during my stay. Whether you were directly involved in my projects, or were just friends, you helped shape my graduate experience and provided me with advice and memories that will stay with me.

Dedication

To my wife, family, and friends. I wouldn’t be involved in anything that didn’t include

you in some way. Thank you all for being there.

Abstract

Autophagy, an evolutionarily conserved process through which cellular components or organelles are degraded through lysosomes, is induced when eukaryotic cells are under nutrient starvation or cellular stress conditions. The ULK1 (UNC-51 like kinase 1) complex consisting of ULK1, Atg13, FIP200, and Atg101 plays a key role in mediating cellular nutritional status to the regulation of autophagy. Despite the recent advance in our understanding of the ULK1 functions, how the ULK1 complex regulates autophagy induction remains unclear. Here, we identify that the ULK1 complex interacts with mammalian Atg8 homologs via Atg13 and the interaction is important for autophagosome formation. Through a yeast two-hybrid screen, we identified a clone harboring the full length GATE-16 (Golgi-associated ATPase enhancer of 16 kDa) as an Atg13 binding protein. Through co-immunoprecipitation and in vitro binding assays, we confirmed that Atg13 directly interacts with GATE-16, as well as GABARAP (Gamma- aminobutyric acid receptor-associated protein) and GABARAPL1 (GABA-A receptor-associated protein-like 1), but not LC3B (Microtubule-associated protein1B-light chain 3), via a conserved LC3 interacting region (LIR) near its C-terminus. The Atg13-Atg8 interaction was greatly increased when cells were induced to accumulate protein aggregates or mitochondrial damage, but not by nutrient starvation, implying that the interaction might respond to selective autophagy inducing conditions. The LIR-disrupting mutation of Atg13 suppressed the degradation of p62/sequestosome 1, poly-ubiquitinated protein aggregates, and damaged mitochondria. These results suggest that Atg13 might participate in autophagy, especially selective autophagy, via interacting with GABARAP subfamily Atg8 proteins. p62 is a protein involved in selective autophagy that also interacts with Atg8 proteins via its LIR motif. My study revealed that ULK1 binds and phosphorylates p62. Several phosphorylation sites of p62 were identified by mass spectrometry. Mutational approaches revealed that some of the identified phosphorylations are important for colocalization of p62 with LC3 and for autophagic clearance of mutant huntingtin aggregates. The culmination of this work suggests that the ULK1 complex recruits GABARAP subfamily proteins and phosphorylates p62 in the pathway of autophagy induction.

iii

Table of Contents

Acknowledgements………………………………………………………………………………..i

Dedication…………………………………………………………………………………………ii

Abstract…………………………………………………………………………………………..iii

List of Figures………………………………………………………………………………….....vi

List of Tables……………………………………………………………………………………viii

Chapter1: Introduction. 1

1.1 The Makeup of Autophagy. 2

1.2 Molecular Signaling of Autophagy in Mammalian Cells. 5

1.3 The Ulk1/2-Atg13-FIP200 Complex in Autophagy. 13

1.4 Mammalian Atg8s. 17

1.5 Autophagy Adaptor Proteins. 26

1.6 Objectives. 32

Chapter2: Atg13 binding to GABARAP subfamily proteins is important for the

autophagic clearance of protein aggregates and damaged mitochondria. 34

2.1 GATE-16, GABARAP, and GABARAPL1, but not LC3B, interact with Atg13. 35

2.2 Atg13 binds to GATE16, GABARAP, and GABARAPL1 via its LIR motif. 39

2.3 The interaction between Atg8 and Atg13 is promoted by high ULK1 activity

and conditions that induce protein aggregates and damaged mitochondria. 39

2.4 The Atg13-Atg8 interaction is important for the degradation of p62. 42

2.5 The Atg13-Atg8 interaction is important for the clearance of protein aggregates. 48

2.6 The Atg13-Atg8 interaction is important for the clearance of damaged mitochondria. 48

2.7 The Atg13-Atg8 interaction is important for Atg13 punctate formation in response

to starvation. 52

2.8 The Atg13-Atg8 interaction is important for autophagosome formation. 54

2.9 The Atg13-Atg8 interaction is important for ULK1 kinase activity. 56

2.10 Discussion. 58

2.11 Materials and Methods. 62

Chapter 3: Regulation of Autophagy Adaptor Proteins by the ULK1 Complex. 68

3.1. ULK1 has selective autophagy functions toward polyubiquitinated aggregates. 69

3.2. The ULK1-Atg13 complex interacts with p62 and induces its phosphorylation. 74

3.3. ULK1 induces p62 phosphorylation at several residues. 79

3.4. Mutations in p62 phosphorylation sites affect its functions. 81

3.5 Discussion. 85

3.6 Materials and Methods. 90

Chapter 4: Discussion. 95

Bibliography. 102

List of Figures

Figure 1. The process of autophagy involves autophagosome formation and fusion

with lysosome. 3

Figure 2. Molecular Signaling of Autophagy. 5

Figure 3. Overview of GABARAP and LC3 Subfamily Proteins. 25

Figure 4. Selective Autophagy. 27

Figure. 5. P62 Functional Domains. 29

Figure 6. GATE-16, GABARAP, and GABARAPL1 directly bind to ATG13. 37

Figure 7. The binding of GABARAP to ATG13 is promoted by conditions

inducing protein aggregates and mitochondrial dysfunction. 40

Figure 8. Atg13 KO cells exhibit an impairment of autophagy. 44

Figure 9. The ATG13-ATG8 interaction is important for the clearance of p62, protein aggregates, and damaged mitochondria. 46

Figure 10. The Atg13-Atg8 interaction is important for the clearance of damaged mitochondria. 50

Figure 11. The ATG13-ATG8 interaction is important for ATG13

puncta formation. 53

Figure 12. The Atg13-Atg8 interaction is important for autophagosome formation 55

Figure 13. The Atg13-Atg8 interaction is important for the phosphorylation

of ULK1 substrates. 57

Figure 14. ULK1 is involved in the selective removal of ubiquitinated structures. 71

Figure 15. ULK1 is involved in the selective removal of HTTQ aggregates. 73

Figure 16. ULK1-Atg13 complex interacts with and phosphorylates P62. 76

Figure 17. In-gel trypsinaztion and kinase assays suggest several potential ULK1

phosphorylation sites of p62. 80 vi

Figure 18. Putative ULK1 phosphorylations mutants of p62 show

functional significance. 82

Figure 19. Potential ULK1 phosphorylation sites on p62 functional domains. 86

Figure 20. Putative ULK1 kinase activity impedes the interaction between

p62 and TRAF6. 89

Figure 21. Securing the ULK complex to the autophagosome surface may direct

autophagosome development. 97

vii

List of Tables

Table 1. Oligonucleotides for Atg13 site-directed mutagenesis. 67

Table 2. Oligonucleotides for constructs to express GFP-tagged Atg proteins. 67

viii

Chapter 1

Introduction

Homeostasis of cellular metabolic processes is vital to cell survival and proper functions. Cells use external nutrition as their primary energy source during cell growth and division. When cells are deprived of extracellular nutrients, they provide themselves with energy and building blocks through degradation of intracellular components. Cells can achieve this through a process called autophagy. Autophagy is a lysosomal degradation process, in which cellular proteins, lipids,

DNA, RNA, or entire organelles are degraded, thus providing new supplies of amino acids, fatty acids, and nucleosides for the cell to use (Rabinowitz & White, 2010). Autophagy is highly induced when cells are under nutrient starvation or stress. However, autophagy under basal cellular conditions is important for the clearance of damaged organelles and other harmful protein aggregates.

The importance of autophagy for cellular homeostasis has been demonstrated through the study of autophagy-defective cellular systems. Accumulating evidence also implicates autophagy is involved in development, cellular differentiation, neurodegenerative diseases, immune disorders, ageing, and cell death (Levine & Kroemer, 2008; N. Mizushima, Levine, Cuervo, & Klionsky,

2008). Despite the wide spread importance of autophagy, its exact role in the cellular and patho- physiological processes remains elusive, and our knowledge of its molecular mechanisms is far from perfect. This chapter reviews the current understanding of the cellular and physiological roles of autophagy and of the molecular mechanisms for the autophagy processes, which will provide the basis for my thesis works described in chapters 2 and 3.

1.1. The Makeup of Autophagy

Autophagy was first observed mammalian cells, where lysosomes where discovered along with their captured cellular content (DE DUVE, 1963). Upon the induction of autophagy, cup-shaped structures called the isolation membrane (IM) begin to develop (Fig. 1). The IM then expands to form a double-membraned vesicle, termed autophagosomes. During the expansion of the IM, cellular components are non-selectively captured by autophagosomes. Once the formation of the autophagosome is complete, the outer membrane of the autophagosome fuses with the lysosome, thus becoming an autophagolysosome. In this step, the captured cellular material is released into the lumen of the lysosome and subsequently degraded by lysosomal enzymes. The processed materials are then exported and recycled to cytoplasm for cellular use.

Figure 1. The process of autophagy involves autophagosome formation and fusion with lysosome. The initiation of autophagy results in nucleation and assembly of the isolation membrane (IM). The IM continues to expand and forms a double-membrane vesicle, termed the autophagosome. During the expansion of the IM, cellular components are captured into autophagosomes. The outer membrane of autophagosomes fuse with lysosomes to form autophagolysosomes. The captured cellular components are released into the lumen of the lysosome and degraded by the lysosomal enzymes. The model diagram was modified based on the paper by (Gozuacik & Kimchi, 2004).

The source for autophagosomal membrane lipids remains controversial. Although the endoplasmic reticulum (ER) is considered as a main source of the autophagosomal membrane

(Axe et al., 2008), other studies show that the mitochondria, Golgi apparatus and the plasma membrane can serve as a membrane source (Hailey et al., 2010; Nair et al., 2011; Ravikumar,

Moreau, Jahreiss, Puri, & Rubinsztein, 2010). Evidence that the ER contributes to the autophagosomal membranes has come from immunostaining analysis showing that, ER-resident membrane proteins are present in the inner and outer autophagosome membranes (Dunn, 1990).

Furthermore, omegasomes, which are the membrane structures emerging from ER regions enriched in PI3P, contain autophagy-related (Atg) proteins (Axe et al., 2008). Apart from the ER, other observations suggest that the mitochondrial outer membrane may provide a lipid source for the forming autophagosome (Hailey et al., 2010). Upon autophagy stimulation, Atg proteins,

Microtubule-associated protein 1A/1B-light chain 3 (LC3) and Atg5, transiently localized to the outer mitochondrial membrane. In addition, loss of the mitochondrial protein, Mitofusin-2

(MFN2), impeded autophagy. Another recent study showed that the Golgi apparatus can aid as a membrane source for developing autophagosomes in an Atg9-dependent manner(Nair et al.,

2011). SNARE proteins may facilitate the fusion of Atg9-positive Golgi vesicles with remodeled of tubulo-vesicle clusters in autophagosome assembly (Nair et al., 2011). Finally, several observations have also implied that the plasma membrane (PM) is capable of donating membrane components to autophagosomes (Ravikumar et al., 2010). The interaction between the plasma membrane-associated membrane trafficking proteins and Atg protein, Atg16L1 has been identified in the autophagosomal membranes, and the interaction was found to be important for autophagosome formation (Ravikumar et al., 2010). Furthermore, it was found that LC3 is sufficient to tether plasma membrane PE, possibly mediating the action of plasma membrane

SNAREs (Nair et al., 2011).

1.2. Molecular Signaling of Autophagy in Mammalian Cells

Autophagy was first reported more that 50 years ago, however its molecular mechanisms remain to be fully understood. The molecular dissection of the autophagy pathway was triggered by the discovery of over 30 ATG (autophagy-related) genes in yeast (Nakatogawa, Suzuki, Kamada, &

Ohsumi, 2009). In mammals, many of the ATG proteins are conserved, suggesting preserved roles of ATG proteins across all eukaryotes (Meijer, van der Klei, Veenhuis, & Kiel, 2007). The fact that there are a large number of genes involved in autophagy suggests that it is a tightly controlled process involving many steps. The following sections summarize the current knowledge on the molecular processes involved in autophagosome formation in mammalian cells, as outline in (Fig. 2).

Figure 2. The molecular signaling of autophagy. Autophagy Initiation: A majority of input signals, such as starvation, converge at mTORC1 resulting in autophagy activation. Following this, the ULK complex is activated, which results in ULK1/2 autophosphorylation, and phosphorylation of Atg13 and FIP200. Nucleation Autophagosome membrane assembly requires the PIK3C3 complex, which phosphorylates phosphatidylinositol, generating phosphatidyl-inositol-3-phosphate (PI3P). This event recruits PI3P binding proteins, including WIPI1 and DFCP1. Elongation Two ubiquitin-like systems contribute to the membrane expansion and completion of autophagosomes. Following the Atg4-dependent cleavage of Atg8, Atg8 and Atg12 are activated by the E1-like enzyme Atg7. Atg8 and Atg12 are then conjugated with their final substrates, PE and Atg5, through the actions of Atg3 and Atg10, respectively. Atg12-Atg5 forms a large complex with Atg16, which also stimulates the conjugation of Atg8-PE. Image modified from (Wirawan, Vanden Berghe, Lippens, Agostinis, & Vandenabeele, 2012).

Autophagy Initiation

Induction of autophagy is controlled by diverse input signals, including nutrients, growth factors, hypoxia, adenosine triphosphate (ATP) levels, and misfolded protein aggregates (Wirawan et al.,

2012). The majority of input signals converge at mTORC1 (mammalian target of rapamycin complex 1) (Jung, Ro, Cao, Otto, & Kim, 2010). Under high nutrient conditions, mTORC1 suppresses autophagy by binding to and phosphorylating ULK1 (UNC-51-like kinase 1) (Ganley et al., 2009; Hosokawa, Hara, et al., 2009a; Jung et al., 2009; J. Kim, Kundu, Viollet, & Guan,

2011a). ULK1 binds to Atg13, focal adhesion kinase family interacting protein of 200 kDa

(FIP200), and Atg101 to form a protein complex (Hosokawa, Sasaki, et al., 2009b; Jung et al.,

2009; Mercer, Kaliappan, & Dennis, 2009). Starvation or rapamycin represses mTORC1 activity, resulting in autophagy induction (Jung et al., 2009). When mTORC1 is inactive, it dissociates from the ULK1 complex resulting in ULK1 activation. The activated ULK1 may phosphorylate itself, Atg13 and FIP200 (Jung et al., 2009). The exact role of the ULK complex in the autophagy induction process has remained largely elusive. A recent study showed that the ULK complex is required for the localization of vital autophagy kinase, the phosphatidylinositol-3-kinase class-III

(PIK3C3 or called hVps34) complex (Di Bartolomeo et al., 2010). Under high nutrient conditions, the PIK3C3 complex is bound to the cytoskeleton. This interaction is facilitated by activating molecule in Beclin-1-regulated autophagy 1 (Ambra1), which interacts with both the

PIK3C3 complex and the microtubule-associated dynenin motor complex (Di Bartolomeo et al.,

2010). Following autophagy induction, ULK1 phosphorylates Ambra1, which results in the release of the PIK3C3 complex and Ambra1 from the microtubule cytoskeleton (Di Bartolomeo et al., 2010). This frees up the PIK3C3 complex to localize to the ER, which is thought to be a major organelle contributing to autophagosome formation (Di Bartolomeo et al., 2010).

Nucleation

Autophagosome nucleation is the initial step involving the recruitment of ATG proteins and lipids to the IM (Loos, Engelbrecht, Lockshin, Klionsky, & Zakeri, 2013). The exact mechanism for the nucleation is unclear, however, the activation of the PIK3C3 complex is crucial. The core of the

PIK3C3 complex consists of Bcl-1-interacting protein (Beclin-1), PIK3C3, and phosphoinositide-

3-kinase regulatory subunit 4 (Vps15 or p150)(He & Levine, 2010; Itakura, Kishi, Inoue, &

Mizushima, 2008). This complex can further bind to either UV-radiation resistance associated gene (UVRAG), Atg14L, or Ambra1 (He & Levine, 2010; Itakura et al., 2008). The regulation of

PIK3C3 kinase activity is determined by its binding partners, where UVRAG, AMBRA1 and

Atg14L positively regulate the kinase activity, and Bcl-2 and Bcl-xl are negative regulators

(Funderburk, Wang, & Yue, 2010). Upon localization to the membrane compartment developing into autophagosomes, PIK3C3 phosphorylates phosphatidylinositol (PI) to generate phosphatidylinositol-3-phosphate (PI3P). The production of PI3P may recruit proteins that have affinities towards PI3P, including WD repeat domain phosphoinositide interacting 1 (WIPI1) and WIPI2, mAtg2, and double-FyVE contacting protein-1 (DFCP1) (Polson et al., 2010). These early events appear to be regulated through phosphorylation, as shown by a recent report that ULK1 phosphorylates Beclin-1 in response to amino acid starvation (Fogel et al., 2013). Additionally, mTORC1-mediated phosphorylation of Atg14L appears to be involved in the regulation. (Yuan,

Russell, & Guan, 2013).

Elongation

Upon the activation of PIK3C3, two ubiquitin-like conjugation systems are recruited to the IM, which are responsible for the elongation and expansion of the autophagosomal membrane (He &

Klionsky, 2009; Klionsky, 2005). First, an E1 like enzyme, Atg7, activates and transfers Atg12 to

Atg10, an E2-like enzyme. Ultimately, Atg12 is covalently linked to Atg5, which together form a 9 trimeric complex with Atg16L. The Atg12-Atg10-Atg16L complex attaches to the IM, and acts as an E3 ligase, allowing the second conjugation reaction to take place (Fujita et al., 2008; Kuma,

Mizushima, Ishihara, & Ohsumi, 2002; N. Mizushima et al., 2003; N. Mizushima, Noda, &

Ohsumi, 1999).

The second ubiquitin-like conjugation machinery involves Atg8 lipidation. Atg8 is cleaved by

Atg4, a cysteine protease, which exposes a glycine residue at the C-terminal end (Tanida et al.,

2004). Following Atg4 processing, Atg8 is activated by Atg7, and subsequently transferred to

Atg3. This allows for Atg8 to be conjugated to phosphatidylethanolamine (PE), producing a form-II of Atg8, which is covalently attached to the membrane, and has been suggested to drive elongation of the IM (Kabeya et al., 2004). A number of observations suggested that the two conjugation systems cross-talk, as Atg8 conjugation to PE depends on Atg5-Atg12 (Hanada et al.,

2007). Although both Atg12-Atg10-Atg16L and Atg8-PE are found on the outer surface of the

IM, only Atg8-PE localizes to both the inner and outer surfaces (Nair, Cao, Xie, & Klionsky,

2010). Furthermore, it is suggested that Atg16L determines the curvature of the forming autophagosomes (Fujita et al., 2008). Following completion of the autophagosome formation, the

PE group is removed from Atg8, allowing it to detach from the autophagosomes (Kabeya et al.,

2004). In addition, Atg12-Atg5-Atg16L complex also dissociates from the autophagosomes following the completion of the autophagosome formation (Nair et al., 2010).

Among the Atg proteins involved in autophagosome expansion, only Atg9 is a known integral membrane protein, which is proposed to deliver membrane to forming autophagosomes (Orsi et al., 2012). Mammalian Atg9 localizes to both the trans-Golgi network (TGN), and endosomal compartments. Upon starvation, the TGN population of Atg9 redistributes in an ULK1-dependent manner, suggesting that Atg9 is employed by autophagy machinery to support the growth of 10 forming autophagosomes (Orsi et al., 2012). The membrane source for autophagosomes is thought to come from multiple sources, including the ER, Golgi, mitochondria, and plasma membrane (Orsi et al., 2012). Due to the widespread distribution of Atg9, it is speculated that

Atg9 is an ideal candidate for appropriating membrane from these multiple sources for autophagosome formation. Interestingly, when mammalian Atg9 is restricted in its ability to traffic to dispersed peripheral sites, autophagy is compromised (Orsi et al., 2012). However, further work is needed to elucidate the molecular signals controlling mammalian Atg9.

Lysosome Fusion and Degradation

Once autophagosome formation is completed, fully formed autophagosomes have two routes.

Autophagosomes can become amphisomes by fusing with early or late endosomes. This lowers the pH of the membrane compartment before subsequent fusion with the lysosome. With the help of microtubules, autophagosomes can also be directly targeted to the lysosomes (Köchl, Hu,

Chan, & Tooze, 2006). In both routes, numerous proteins are required for these fusion events, including LAMP-1, the UVRAG-C- Vps tethering complex, Rab (Ras-related GTP-binding protein), HOPS (homotypic fusion and protein sorting), SNAREs (soluble N-ethylmalemide- sensitive factor attachment protein receptor), AAA ATPases, LC3, FYCO1 and the ESCRT

(endosomal sorting complex required for transport) machinery (Tong, Yan, & Yu, 2010). When the autophagosome and lysosome meet, the outer autophagosomal membrane fuses with the lysosome, releasing the inner autophagosomal membrane and its contents (the autophagic body) into the lysosomal lumen. Once the autophagic body is taken up by the lysosome, it is disintegrated and its cargo is degraded by lysosomal hydrolases and lipases. Subsequently, lysosomal efflux transporters, e.g., Atg22 in yeast (mammalian ortholog not yet identified),

11 mediate the release of the resulting amino acids, fatty acids and nucleosides back into the cytosol

(Yang, Huang, Geng, Nair, & Klionsky, 2006).

Autophagosome Formation by Hierarchy of Atg Proteins

The interrelation of Atg proteins suggests a hierarchy of Atg proteins that are needed for the proper ordering of steps leading to maturation of autophagosomes. This hierarchical relationship has been demonstrated in yeast as well as mammals through the examination of Atg protein localization to the IM in various Atg knockout backgrounds (Itakura & Mizushima, 2010; Suzuki,

Kubota, Sekito, & Ohsumi, 2007). Under autophagy inducing conditions, ULK1, Atg14L, LC3,

WIPI1, and Atg16L1 localize to the same structure (Itakura & Mizushima, 2010). The ULK complex is thought to be the most upstream unit and is required for the puncta formation of

PI3K3C3 containing Atg14L (Itakura & Mizushima, 2010). The localization of Atg14L- containing PI3K3C3 to the IM is followed by WIPI1, DFCP1, and other PI3P binding proteins.

This is a prerequisite for the localization of the Atg12-Atg5-Atg16L complex to the IM before the final attachment of PE-conjugated LC3 to the IM (Itakura & Mizushima, 2010).

All of this suggests a precise ordering of Atg proteins localizing to the IM, where upstream Atg proteins are required for the function of all downstream events. However, Atg proteins involved in downstream events of autophagosome formation can also affect the function of Atg proteins involved in upstream events, creating feedback loops. Recent evidence demonstrates that proper localization of ULK1 to the IM requires PI3P (Karanasios et al., 2013). Originally, it was thought that ULK1 puncta formation associated with the IM occurred independently of PI3P (Itakura &

Mizushima, 2010). Upon autophagy induction, the ULK1 complex forms puncta associated with the ER. If PI3P is available, the IM is allowed to further develop. In the absence of PI3P, ULK1 12 puncta number and duration were greatly reduced (Karanasios et al., 2013). This mechanism opens the possibility for downstream Atg protein being important for anchoring ULK1 and other upstream ATG proteins to the forming autophagosome.

1.3. The ULK1-Atg13-FIP200 Complex in Autophagy

There are five mammalian Atg1 homologs (unc-51-like kinase 1 (Ulk1), Ulk2, Ulk3, Ulk4 and

STK36) (Alers, Löffler, Wesselborg, & Stork, 2012). Currently, Ulk1 and Ulk2 are known to regulate autophagy. While knockdown of ULK1 was sufficient to block autophagy in multiple cell types, ULK1 knockout mice are viable and exhibited a mild autophagy defect phenotype

(Kundu et al., 2008). This has been attributed to the redundancy between ULK1 and ULK2. This notion is supported by recent reports that double knockout mice for ULK1 and ULK2 (Cheong,

Lindsten, Wu, Lu, & Thompson, 2011), as well as Atg13 knockout mice (Shang et al., 2011), have the same neonatal death phenotype as other autophagy essential genes such as Atg3, Atg5 and Atg7. Although some studies suggest a redundancy between ULK1 and ULK2, ULK1 is thought to be the main kinase involved in autophagy induction, because knockdown of ULK1, but not ULK2, impaired the recycle of Atg9 (Chan, Longatti, McKnight, & Tooze, 2009; Hara et al.,

2008; Young et al., 2006).

Upstream signals that regulate the ULK1 complex

Numerous studies in varying organisms suggest that the ULK1 complex mainly senses nutrient and energy signals through the change of its phosphorylation status. It is well known that ULK1 and its binding partner Atg13 are hyperphosphorylated under nutrient-rich conditions and undergo dephosphorylation upon starvation. The key nutrient/energy sensor, mTOR, has been demonstrated to directly phosphorylate ULK1 and ATG13 (Ganley et al., 2009; Hosokawa, Hara, 13 et al., 2009a; Jung et al., 2009; J. Kim, Kundu, Viollet, & Guan, 2011a), thus deterring ULK1 complex function and ultimately autophagosome formation.

Another important cellular energy sensor, AMPK, can indirectly promote autophagy induction through the phosphorylation of TSC2 and RAPTOR, leading to the inactivation of mTOR and activation of the ULK1 complex. Recently, AMPK has also been shown to directly interact with and phosphorylate ULK1 in a nutrient-dependent manner (J. Kim, Kundu, Viollet, & Guan,

2011b; J. W. Lee, Park, Takahashi, & Wang, 2010; Mack, Zheng, Asara, & Thomas, 2012).

Under glucose starvation, ULK1 activity is promoted through direct phosphorylation by AMPK

(J. Kim, Kundu, Viollet, & Guan, 2011b). Apart from ULK1, AMPK may regulate ATG9 localization together with ULK1 (Mack et al., 2012). Furthermore, AMPK regulation of ULK1 can be important for mitophagy (Ganley, Wong, Gammoh, & Jiang, 2011). However, the relationship between AMPK and ULK1 is rather complex, as AMPK phosphorylation of ULK1 has been reported to inhibit autophagy as well as promote it. One study has shown that amino acid starvation results in the dephosphorylation of AMPK phosphorylation sites on ULK1.

Furthermore, ULK1 phospho-mutants defective in AMPK binding display more protein degradation (Shang et al., 2011).

Interestingly, the relationship between ULK and AMPK/mTOR is not unidirectional, as ULK1 activity has also been shown to regulate mTOR and AMPK (Jung, Seo, Otto, & Kim, 2011;

Löffler et al., 2011). ULK1 has been shown to phosphorylate RAPTOR, thus negatively regulating MTOR activity (Dunlop, Hunt, Acosta-Jaquez, Fingar, & Tee, 2011). This suggests a positive feedback mechanism that ensures rapid shutdown of mTOR during autophagy inducing or nutrient-limiting conditions. Interestingly, ULK1 has also been shown to phosphorylate the three AMPK subunits (Löffler et al., 2011). In this instance, ULK1 phosphorylation inhibits

AMPK activity, which forms a negative feedback that may diminish autophagy-induction signals 14

(Löffler et al., 2011).

Aside from phosphorylation, acetylation is another post-translational modification that has been reported to play a role in autophagy (McEwan & Dikic, 2011; Yi et al., 2012). Histone acetyltransferase TIP60 was demonstrated to acetylate ULK1. In HCT116 cells, knockdown of

TIP60 impeded starvation-induced autophagy (Lin et al., 2012; Yi et al., 2012). Furthermore, ulk1-/- MEFs reconstituted with acetylation mutants of ULK1 were unable to rescue LC3 conversion (Lin et al., 2012).

Cellular protein turnover is mainly mediated by autophagy and proteasome pathways. Therefore, it is not a surprise to note that these two processes intimately communicate with each other (Gao et al., 2010; Korolchuk, Mansilla, Menzies, & Rubinsztein, 2009a; Korolchuk, Menzies, &

Rubinsztein, 2009b; 2010). In neurons, ULK1 is found to be directly ubiquitinated in response to nerve growth factor. The significance of this modification with respect to autophagy is unknown

(Zhou et al., 2007). However, a recent study showed that ubiquitination of ULK1 negatively regulates autophagy (Nazio et al., 2013). Interestingly, mTORC1 controls the ubiquitination of

ULK1. This adds to the complexity of the mTORC1-ULK1 relationship. Additionally, the

HSP90-CDC37 regulation of ULK1 may involve ubiquitination. Treatment with an HSP90 antagonist results in a reduction in ULK1 protein levels. This effect can be rescued with co- treatment of proteasomal inhibitor MG132 (Joo et al., 2011). Therefore, the HSP90-CDC37 complex helps stabilize the ULK1 complex and its activity in the face of proteasome mediated degradation.

Downstream functions of the ULK1 complex

Most studies have shown that the ULK1 complex may function in the beginning stages of autophagosome formation (Roach, 2011; Russell et al., 2013). However, the connection between

15 the ULK1 complex and other ATG proteins is not completely understood. Recently, the functional relationship between the ULK1 and PIK3C3 complexes has been revealed. In response to nutrient starvation, AMBRA1, a binding protein of PIK3C3, is phosphorylated in an ULK1- dependent manner (Di Bartolomeo et al., 2010). This phosphorylation event releases the

AMBRA1-PIK3C3 complex from the microtubule network, allowing the complex to localize to autophagosome formation sites on the ER.

The ULK1 and ATG5 complexes also exhibit a functional relationship. One study demonstrates that FIP200 knockout can block ATG5 puncta formation. The reverse is also true, as Atg5 knockout can block ULK1 puncta formation (Hara et al., 2008). Furthermore, FIP200 was found to directly interact with ATG16L1, thus providing a working link between the ULK1 and ATG5 complexes (Gammoh, Florey, Overholtzer, & Jiang, 2013).

The ULK1 complex has also been shown to play a role in ATG9 cycling in mammalian cells.

However, this relationship is not well understood, as studies demonstrate conflicting results.

Knockdown of ULK1 was shown to block starvation-induced redistribution of ATG9 (Young et al., 2006). However, it was shown that independent of ULK1, ATG9 could localize to membrane structures adjacent to early autophagy markers such as WIPI2 (Orsi et al., 2012).

The ULK complex is traditionally viewed as facilitating autophagy induction. However, recent evidence demonstrates that the components of the ULK complex, ATG13, FIP200, and ULK1/2, can interact with mammalian Atg8s, which are known to function in the elongation of the autophagosomal membrane (Alemu et al., 2012; Weidberg et al., 2010). Interestingly, Atg8 binding-defective mutants of ULK1 showed a reduced punctate formation (Kraft et al., 2012).

This suggests that the ULK1 complex is stabilized onto the IM to facilitate autophagosome elongation and possibly later steps.

Atg13

The ULK complex contains Atg13, FIP200, and Atg101 in addition to ULK1 or ULK2

(Hosokawa, Sasaki, et al., 2009b). Unlike the Atg1 complex in the yeast, the complex in mammalian cells appears to be constitutively intact (Mack et al., 2012). Interestingly, a recent study showed that Atg13 and FIP200 can act independently of ULK1/2 to induce autophagy

(Alers et al., 2011). In DT40 chicken cells, knockout of ATG13, but not ULK1 and/or ULK2, blocked autophagy upon amino acid starvation. In addition, only ATG13 splice variants that can interact with FIP200 can rescue autophagy. This suggests that in chicken cells, the main role of

Atg13 in autophagy might be independent of ULK1/ULK2 but dependent on FIP200 (Alers et al.,

2011). Whether this phenomenon is translatable in mammals is unknown. Atg13 appears to function separately from ULK1 in the regulation of mitophagy. When the ULK1 complex is stabilized by Ccd37-Hsp90, it phosphorylates Atg13 and release it to localize to damaged mitochondria (Joo et al., 2011). In this study, ULK1 was not found to localize to damaged mitochondria. This suggests a separate function for Atg13 at the site of damaged mitochondria.

Other autophagy proteins, such as mammalian Atg8s, that bind to Atg13 and localize to damaged mitochondria may be involved in the process. However, the presence of Atg13 is essential to the

ULK1 function. The kinase activity of ULK1 is dependent on Atg13, as siRNA mediated knockdown of Atg13 ablated the ULK1 kinase activity (Ganley et al., 2009; Jung et al., 2009).

Furthermore, the presence of Atg13 is necessary for proper localization of ULK1 to the isolation membrane or autophagosomal membranes (Ganley et al., 2009).

1.4. Mammalian Atg8 proteins

Mammals have at least eight Atg8 members: two isoforms of microtubule-associated protein 1 light chain 3 A (MAP1LC3A, hereafter referred to as LC3), LC3B, LC3B2, LC3C, γ- aminobutyric acid receptor-associated protein (GABARAP), Golgi-associated ATPase enhancer 17 of 16 kDa (GATE-16) or (GABARAPL2), GABARAPL1, and GABARAPL3 (Hosokawa,

Sasaki, et al., 2009b; Shpilka, Weidberg, Pietrokovski, & Elazar, 2011). GATE-16, GABARAP, and LC3B are found to conjugate to the autophagosome (Kabeya et al., 2004; Mack et al., 2012).

However, knockdown studies reveal unique roles for the two subfamilies in autophagosome formation (Alers et al., 2011; Weidberg et al., 2010). Atg8 proteins are synthesized as precursors with additional amino acids at their C-termini, which are proteolytically cleaved by Atg4. This yields what is called form I, which has an exposed glycine residue at the C-terminus. Through two conjugation pathways, Atg8 proteins are finally covalently linked to phosphatidylethanolamine (PE), resulting in a protein-phospholipid conjugate called form II

(Alers et al., 2011; Kabeya et al., 2004). This form is attached to the inner and outer autophagosome. Upon autophagosome maturation, Atg4 removes Atg8 from the outer surface of the autophagosome (Joo et al., 2011; Kirisako et al., 2000). Those on the inner surface are degraded in the lysosomes. Conjugated mammalian Atg8s are thought to recruit various proteins to autophagosomes (Ganley et al., 2009; Shpilka et al., 2011). A majority of proteins that interact with mammalian Atg8s contain a LIR (LC3-interacting region) motif (Goold et al., 2013; Shpilka et al., 2011).

Mammalian Atg8 Family Members and Functional Differences

Mammalian Atg8s can be dived into three subgroups based on amino acid sequences. LC3A,

LC3B, LC3B2 and LC3C comprise the LC3 subfamily; GABARAP, GABARAPL1 and

GABARAPL3 constitute the GABARAP subfamily, and GATE-16 compromises the GATE-16 subfamily (Kabeya et al., 2004; Shpilka et al., 2011) These Atg8 proteins are ubiquitously expressed. However, there is some variation between different tissues. The first Atg8 protein to be discovered was mammalian LC3B, which remains the most studied Atg8 protein (Kuznetsov

& Gelfand, 1987; Weidberg et al., 2010). The first function ascribed to LC3B was its association 18 with microtubule-associated proteins (MAPs) 1A and 1B, in order to regulates their binding to microtubules (Kabeya et al., 2004; Kuznetsov & Gelfand, 1987; S. S. Mann & Hammarback,

1994).

Similar to LC3B, the cellular functions originally recognized for the GABARAP and GATE-16 subfamilies proteins were not related to autophagy. GATE-16 was initially shown to promote intra-Golgi protein transport by linking NSF (N-ethylmaleimide sensitive factor) to a SNARE

(soluble NSF attachment receptor) protein on Golgi membranes (Kirisako et al., 2000; Sagiv,

Legesse-Miller, Porat, & Elazar, 2000). Also, GABARAP was first identified as essential for

GABAA receptor trafficking to the plasma membrane (Legesse-Miller, Sagiv, Porat, & Elazar,

1998; Sagiv et al., 2000; Shpilka et al., 2011). It is interesting to note that not LC3, but

GABARAP, GABARAPL1, and GABARAPL2 have all been confirmed to interact with NSF (C.

Chen et al., 2006; Goold et al., 2013; Kittler et al., 2001; Sagiv et al., 2000). This is a piece of evidence that the GABARAP and GATE16 subfamily of Atg8s may play a role in autophagy separately from LC3. Despite the differences in binding partners, all Atg8 proteins show an affinity for tubulin (Coyle, Qamar, Rajashankar, & Nikolov, 2002; Kouno et al., 2005; Shpilka et al., 2011), implying a physical association between mammalian Atg8s and microtubules.

The LIR motif and its interactions

A majority of proteins that interact with mammalian Atg8s contain an LIR (LC3-interacting region) motif. There are several groups of proteins that have LIR motifs: Autophagy adaptor proteins, the ULK complex, and mitophagy receptors. This short motif was first identified in p62, but continues to be found on a growing list of proteins (Birgisdottir, Lamark, & Johansen, 2013;

Kuznetsov & Gelfand, 1987). Point mutation analyses, X-ray crystallography, and other studies revealed that the LIR motif of p62 consists of W-x-x-L (x=any amino acid) (Ichimura, 19

Kominami, Tanaka, & Komatsu, 2008a; Ichimura, Kumanomidou, Sou, Mizushima, Ezaki, et al.,

2008b; Kuznetsov & Gelfand, 1987; S. S. Mann & Hammarback, 1994; N. N. Noda et al., 2008).

Through the studies of other LIR motifs, a more complete core consensus sequence was discovered [W/F/Y]xx[L/I/V] (Birgisdottir et al., 2013; Sagiv et al., 2000). In addition to the core motif, the importance of an acidic charge (E, D, S or T), flanking either the N- or C-terminal end of the motif, is evident. Interestingly, the prevalence of an S or T flanking the core motif suggests that there might be a regulation of Atg8 –LIR interaction through phosphorylation. The choice of amino acid at the first position in the LIR motif appears to be more important for the LIRs of

ULK1 and ATG13, which have a preference for the GABARAP subfamily (Alemu et al., 2012;

Legesse-Miller et al., 1998; Sagiv et al., 2000).

Autophagy Adaptor proteins

Autophagy is thought to be the predominant mechanism for the removal of long-lived proteins, large protein aggregates and organelles. Autophagy achieves its specificity for these targets through a number of autophagy receptor (or adaptor) proteins. These adaptor proteins selectively bind to targets such as protein aggregates and damaged mitochondria, while simultaneously interacting with Atg8 proteins on the autophagosome surface. Adaptor proteins, such as p62 and

NBR1, contain several functional domains important for clearance of autophagic substrates, including an LIR motif (C. Chen et al., 2006; Ichimura, Kumanomidou, Sou, Mizushima, Ezaki, et al., 2008b; Kittler et al., 2001; Sagiv et al., 2000; Seibenhener, Babu, & Geetha, 2004). Thus, adaptor proteins may serve as an interface between autophagy machinery and its substrates.

The interaction between the LIR motif and its binding partners can also be regulated through

20 phosphorylation. Autophagy receptors, such as p62, optineurin and NDP52 are well known to be crucial to the removal of cytoplasmic bacteria (Coyle et al., 2002; Kouno et al., 2005; Thurston,

Ryzhakov, Bloor, Muhlinen, & Randow, 2009; Wild et al., 2011). Interestingly, a serine residue

(S177) closely precedes the LIR of optineurin. When optineurin binds to ubiquitinated Salmonella enterica, S177 is phosphorylated by TANK binding kinase 1 (TBK1) (Birgisdottir et al., 2013;

Wild et al., 2011). This phosphorylation event significantly enhances the affinity of optineurin binding to LC3, resulting in improved efficiency of microbial clearance. Intriguingly, the LIR motifs of p62 and NBR1 also contain serine residues within or immediately flanking the LIR motif.

The components of the ULK Complex

LIR motifs are also found in mammalian Atg13, FIP200, and ULK1/2 (Ichimura, Kominami,

Tanaka, & Komatsu, 2008a; Ichimura, Kumanomidou, Sou, Mizushima, Ezaki, et al., 2008b;

Kraft et al., 2012; N. N. Noda et al., 2008). In contrast to autophagy adaptor proteins, these proteins posses a clear preference for the GABARAP subfamily over LC3 proteins. This implies that GABARAP and LC3 might be needed for distinct functions in autophagosome biogenesis. In yeast, mutations in the LIR motif of Atg1 reduced autophagy, but did not affect the initiation of autophagosome formation (Birgisdottir et al., 2013; Nakatogawa et al., 2012). This suggests that the Atg1-Atg8 interaction may be involved in events following the initiation of autophagy.

Whether this mechanisms holds true in mammals remains to be tested.

Mitophagy Receptors

In mammalian cells, LIR motifs are also found on resident mitochondrial proteins. Bnip3, Nix, and FUNDC1 are outer mitochondrial membrane (OMM) proteins and they all contain one LIR

21 motif in their cytosolic N-terminal domain. Importantly, they are all implicated in mitophagy

(Alemu et al., 2012; J. Zhang & Ney, 2009). Bnip3 promotes the degradation of both mitochondria and endoplasmic reticulum (Hanna et al., 2012; Ichimura, Kumanomidou, Sou,

Mizushima, Ezaki, et al., 2008b; Seibenhener et al., 2004). During mitophagy, Bnip3 homodimerizes through its transmembrane domain, which facilitates the interaction between

Bnip3 and LC3B In contrast to Bnip3, Nix preferably interacts with GABARAP-L1 instead of

LC3B during mitochondrial stress (Novak et al., 2010; Schwarten et al., 2009; Thurston et al.,

2009; Wild et al., 2011). In MEFs, the LIR motif of Nix is required for its involvement in depolarization-induced mitophagy (Novak et al., 2010; Wild et al., 2011). Bnip3 and Nix are also both involved in hypoxia-induced mitophagy (Bellot, Garcia-Medina, & Gounon, 2009; Kraft et al., 2012; H. Zhang et al., 2008). FUNDC1 also participates in hypoxia-induced mitophagy in a

LIR dependent manner through phosphorylation-dependent interaction with LC3B (Lei Liu et al.,

2012; Nakatogawa et al., 2012).

Functions of LC3s and GABARAPs in Autophagy

Through genetic screens in yeast, Atg8 has been demonstrated to be essential to proper autophagy function (Lang et al., 1998; J. Zhang & Ney, 2009). However, this fact is complicated in higher metazoans such as mammals, as there are several Atg8 paralogues. These circumstances complicate gene deletion experiments. For example, knockout mice lacking the Atg8 protein

GABARAP show no marked phenotype (Hanna et al., 2012; O'Sullivan, Kneussel, Elazar, &

Betz, 2005). This suggests that there may be functional redundancy among mammalian Atg8s.

However, a series of Atg8 knockdown experiments imply that the LC3 subfamily members

(LC3A, LC3B, LC3C) are needed for the expansion of the autophagosome membrane, whereas

22 the GABARAP/GATE-16 subfamily members are involved in a later stage, possibly closure of the autophagosomes (Novak et al., 2010; Schwarten et al., 2009; Weidberg et al., 2010).

The functional diversification of mammalian Atg8s can also be demonstrated through its known activities: mediating scaffolding of multi-protein complexes, recruiting ubiquitinated cargo for degradation, and tethering and hemifusion of vesicle membranes. Mammalian Atg8s are well recognized as binding partners of core autophagy proteins and adaptor proteins. Again, the binding specificities may differ between Atg8 family members, depending on the interaction partner. For example, the ULK1/2 complex has a clear preference for GABARAP and GATE-16 members over LC3-like proteins (Alemu et al., 2012; Novak et al., 2010). Current evidence suggests that Atg1/ULK1 is involved in the initiation stages of autophagy (Itakura & Mizushima,

2010; Kraft et al., 2012; Nakatogawa et al., 2009; 2012). Given the reversible association of Atg8 with membranes, the ULK1 LIR motif might function to mediate its membrane association required for efficient autophagosome formation. Furthermore, the capacity of Atg8 to form oligomers may play a role in orchestrating multiple autophagy proteins to be recruited at the same site (Nakatogawa, Ichimura, & Ohsumi, 2007).

Autophagy adaptor proteins (p62, NBR1 and optineurin) have been demonstrated to interact with both GABARAP, GATE-16, and LC3 subfamily proteins (Ichimura, Kumanomidou, Sou,

Mizushima, Ezaki, et al., 2008b; Kirkin, Lamark, Sou, Bjørkøy, Nunn, et al., 2009b; Lang et al.,

1998; Wild et al., 2011). However, an autophagy adaptor NDP52 exclusively interacts with LC3C in microbial clearance (O'Sullivan et al., 2005; Thurston et al., 2009). Furthermore, the adaptor protein FYCO1 (FYVE and coiled-coil domain-containing protein 1), which connects autophagosomes to the microtubule cytoskeleton, shows a preference for LC3 (Pankiv et al.,

2010; Weidberg et al., 2010). This suggests that LC3 may coordinate autophagy through the

23 microtubule cytoskeleton. The microtubule cytoskeleton is thought to play a role in autophagosome transport and autolysosome formation(Köchl et al., 2006; Webb, Ravikumar, &

Rubinsztein, 2004; R. Xie, Nguyen, McKeehan, & Liu, 2010), therefore LC3 may have a hand in these event. These examples suggest a great flexibility of the Atg8 interaction network, which can be adjusted to achieve a high level of specificity.

When lipidated, yeast Atg8 is able to mediate the tethering and hemifusion of vesicle membranes

(Ichimura, Kumanomidou, Sou, Mizushima, Ezaki, et al., 2008b; Kirkin, Lamark, Sou, Bjørkøy,

Nunn, et al., 2009b; Nakatogawa et al., 2007; Wild et al., 2011). The Atg8-PE, unlike non- lipidated Atg8, can form oligomers. Furthermore, Atg8-decorated vesicles are unable to associate with non-Atg8 decorated vesicles. This suggests that the fusion is facilitated by protein-protein interactions between Atg8s. In mammals, GATE-16 and LC3B also possess these functions when conjugated to liposomes (Thurston et al., 2009; Weidberg et al., 2011). Truncation experiments reveal that the short N-terminal α-helix (α1) of GATE-16 and LC3B play an important role in fusogenicity (Pankiv et al., 2010; Weidberg et al., 2011). Intriguingly, GATE-16 and LC3B employ different mechanisms to accomplish this effect. In LC3B, two arginines (R10, R11) are found to be critical for membrane fusion. However, in GATE-16, hydrophobic residues W3 and

M4 are required. In both yeast and mammalian cells, mutant Atg8 proteins, which are defective in membrane tethering or fusion, greatly compromise autophagosome formation (Nakatogawa et al.,

2007; Weidberg et al., 2011). However, in mammals, Atg8 is not sufficient for membrane tethering and fusion, as accumulating evidence suggests that SNARE proteins and NSF play crucial roles in autophagosome biogenesis (Moreau, Ravikumar, Renna, Puri, & Rubinsztein,

2011; Nair et al., 2011; Weidberg et al., 2011).

The diversification of Atg8s in higher eukaryotes suggests both redundancy and functional specialization. However, the individual roles of each Atg8 protein in autophagy are only beginning to be elucidated. These preliminary findings are outlined in (Fig. 3).

Figure 3. Overview of GABARAP and LC3 subfamily proteins. Activities that are essential for the autophagy pathway are highlighted by grey and yellow shading, signifying the involvement of protein-protein and protein-lipid interactions, respectively. Image modified from (Weidberg et al., 2011; Weiergräber, Mohrlüder, & Willbold, 2013).

1.5. Autophagy Adaptor Proteins

Autophagy was classically described as a non-selective, bulk degradation process mainly used to replenish the cell with energy and building blocks upon starvation. However, the starvation- induced autophagy is different from a type of autophagy, called selective autophagy, for quality control that is needed for the removal of old and erroneous proteins and organelles. Selective autophagy is the selective degradation of cellular components such as mitochondria (mitophagy), peroxisome (pexophagy) (Lemasters, 2005; Moreau et al., 2011; Nair et al., 2011; Till, Lakhani,

Burnett, & Subramani, 2012), bacteria (xenophagy) (Weiergräber et al., 2013; Yuk, Yoshimori, &

Jo, 2012), and protein aggregates (aggrephagy) (Lamark & Johansen, 2012; Lemasters, 2005; Till et al., 2012). The target molecules or organelles are marked for autophagic degradation by polyubiquitination. The E3 ligases involved in ubiquitination are variable depending on the targets. For example, the ubiquitination of harmful protein aggregates, such as alpha-synuclein, is accomplished by co-chaperone carboxyl terminus of heat-shock cognate70 (HSC70)-interacting protein (CHIP) (Y. Shin, Klucken, Patterson, Hyman, & McLean, 2005; Yuk et al., 2012), and the ubiquitination of damaged mitochondria is mediated by parkin (Lamark & Johansen, 2012;

Narendra, Tanaka, Suen, & Youle, 2008). The adaptor proteins, such as p62/Sequestosome 1 and neighbor of BRCA1 gene 1 (NBR1), selectively bind to polyubiquitin chains, while simultaneously interacting with Atg8 proteins on the autophagosome surface. Our general knowledge of selective autophagy is outlined in (Fig. 4).

Figure 4. Selective Autophagy A) Under certain conditions i.e., if the capacity of the chaperone-mediated refolding machinery is overloaded, or under oxidative stress, protein aggregation and mitochondrial damage occur (Frank et al., 2012; Pereira, 2013; Y. Shin et al., 2005), which are then targeted for autophagic clearance. B) K63-linked chain is formed by various E3 ligases, depending on the target and cellular conditions. C) Newly formed ubiquitin chains are then recognized by p62 or NBR1, through their ubiquitin-binding domain (UBA) to form inclusion bodies. D) Targeting of the protein aggregates is determined by the LIR motif of p62 and NBR1, which directly interact with Atg8 proteins on the autophagosome surface. E) Thereby, LC3 and other ATG8 proteins such as the GABARAP subfamily recruit p62/NBR1 and their cargo for autophagic degradation. Image modified from (Narendra et al., 2008; Shaid, Brandts, Serve, & Dikic, 2012). 27

Structure of Autophagy Adaptor Proteins

The first autophagy adaptor protein identified is p62, also known as sequestosome-1 (SQSTM1)

(Bjørkøy et al., 2005; Frank et al., 2012; Pereira, 2013). p62 accumulates in ubiquitin-tagged protein inclusions that are the hallmark of many protein-aggregation diseases including

Alzheimer disease, Huntington’s, Pick disease, dementia with Lewy bodies, Parkinson disease and multiple system atrophy (Kuusisto, Salminen, & Alafuzoff, 2001; Shaid et al., 2012;

Stumptner, Fuchsbichler, Heid, Zatloukal, & Denk, 2002). p62 contains an N-terminal PB1 domain, followed by a TRAF6-binding domain, a nuclear shuttling region, an LC3 interacting region (LIR) motif, and a C-terminally located ubiquitin- associating (UBA) domain (Fig.5). The PB1 domain allows p62 to undergo self-oligomerization as well as interaction with protein kinases (i.e MAP-kinases) and NBR1 (Bjørkøy et al., 2005;

Lamark et al., 2003; Nakamura, Kimple, Siderovski, & Johnson, 2010; Wilson, Gill, Perisic,

Quinn, & Williams, 2003). Through its (UBA) domain, p62 is able to bind to mono- or polyubiquitinated proteins (Kuusisto et al., 2001; Stumptner et al., 2002; Vadlamudi, Joung,

Strominger, & Shin, 1996). These features allow p62 to assemble poly-ubiquitinated proteins into larger aggregates that is crucial for their clearance (Bjørkøy et al., 2005; Lamark et al., 2003;

Nakamura et al., 2010; Vadlamudi et al., 1996; Wilson et al., 2003). The importance of p62 as an autophagy adaptor for the degradation of misfolded proteins or aggregates is reflected in the development of several human neurodegenerative diseases when p62 is not expressed (Babu &

Seibenhener, 2008).

Figure. 5. P62 Functional Domains. P62 functional domains are labeled with their amino acid sizes.

After the discovery of p62 as a selective autophagy adaptor, the related neighbor of BRCA1 gene

1 (NBR1) was found to have similar functions to p62 (Bjørkøy et al., 2005; Kirkin, Lamark, Sou,

Bjørkøy, Nunn, et al., 2009b; Vadlamudi et al., 1996). NBR1 has a structure similarity to p62 and shares the same ability to directly bind to ubiquitin and LC3 (Kirkin, Lamark, Sou, Bjørkøy,

Nunn, et al., 2009b). Although NBR1 and p62 differ in sequence and size, they both contain an

N-terminal PB1, a C-terminal UBA domain, and an LIR motif. NBR1 can directly bind to p62, and together they can act as cargo receptors for autophagic degradation of poly-ubiquitinated substrates (Bjørkøy et al., 2005; Kirkin, Lamark, Sou, Bjørkøy, Nunn, et al., 2009b; Pankiv,

Clausen, Lamark, & Brech, 2007). Thus, some of their functions might be redundant. However, the clearance of midbody derivatives through autophagic degradation is only dependent on NBR1 without any noticeable involvement of p62 (Bjørkøy et al., 2005; Kirkin, Lamark, Sou, Bjørkøy,

Nunn, et al., 2009b; Kuo et al., 2011; Pankiv et al., 2007).

Functions of Autophagy Adaptor Proteins

Autophagy adaptor proteins have the ability to mediate the selective autophagic degradation of targeted molecules or organelles that have no structural similarities. However, ubiquitination is one single feature that these structures have in common before they are degraded. Selective autophagy depends on the interaction between the LIR motif of the adaptor proteins and ATG8 homologs that are attached to the inner membrane of the autophagosomes (Kuo et al., 2011;

Lamark, Kirkin, Dikic, & Johansen, 2009). However, the LIR motif by itself is not sufficient for recruiting cargo to the inner surface of autophagosomes (Itakura & Mizushima, 2011; Lamark et al., 2009). Selective autophagy involving p62 depends on its PB1-domain-mediated

30 oligomerization, UBA domain, and interaction with other proteins (Itakura & Mizushima, 2011;

Matsumoto, Wada, Okuno, & Kurosawa, 2011; Narendra, Kane, Hauser, Fearnley, & Youle,

2010; Novak et al., 2010). Other than Atg8 proteins, a protein called ALFY (autophagy-linked

FYVE protein) is recruited to protein aggregates in a p62-dependent manner. ALFY also directly interacts with ATG5 and PI3P and may act as a scaffold protein that induces construction of an autophagy-compatible structure around protein aggregates (Clausen, Lamark, Isakson, & Finley,

2010; Filimonenko et al., 2010; Matsumoto et al., 2011; Narendra et al., 2010; Novak et al.,

2010). Whether other autophagy proteins affect p62 functions remains to be discovered.

Redundancy and/or collaboration clearly exist between different autophagy adaptor proteins.

NBR1 and p62 interact with each other through their PB1 domains, and cooperate in the selective autophagic degradation of misfolded proteins and probably also midbody rings (Clausen et al.,

2010; Filimonenko et al., 2010; Kirkin, Lamark, Sou, Bjørkøy, Nunn, et al., 2009b; Kuo et al.,

2011; Pohl & Jentsch, 2008). p62 and NBR1 also collaborate in pexophagy, where binding and clustering of peroxisomes is mediated by NBR1. Interestingly, although p62 is not required when

NBR1 is in excess, its binding to NBR1 increases the efficiency of NBR1-mediated pexophagy

(Deosaran, Larsen, Hua, & Sargent, 2013; Ganley et al., 2009; Kraft et al., 2012).

One of the most extensively studied types of selective autophagy is mitophagy. Mitophagy is the process of removing mitochondria for the purpose of either eliminating damaged mitochondria as a form of quality control, or removing surplus mitochondria to meet metabolic requirements or during specialized development stages (Kundu et al., 2008; Novak et al., 2010; Schwarten et al.,

2009). The most widely studied mode of mitophagy is parkin-mediated mitophagy. Upon mitochondrial depolarization, E3-ligase parkin localizes to the damaged mitochondria and mediates ubiquitination of mitochodrial proteins such as voltage-dependent anion channel 1

(VDAC1) (Geisler, Holmström, Skujat, & Fiesel, 2010; Narendra et al., 2008). p62 is then 31 recruited to the damaged mitochondria in a K63- and K27- ubiquitin chain-dependent manner

(Geisler et al., 2010; Narendra et al., 2008). p62 facilities the clustering of mitochondria, which is necessary for their autophagic degradation (Geisler et al., 2010; Narendra et al., 2010).

Regulation of autophagy adaptor proteins through phosphorylation

The functions of some autophagy adaptor proteins are controlled through phosphorylation.

OPTN’s affinity for LC3 increases when TBK1 phosphorylates a serine residue near its LIR motif

(Wild et al. 2011). Additionally, the phosphorylation of p62 at its UBA domain by casein kinase

2 enhances the binding affinity towards ubiquitin chains (Matsumoto et al. 2011). P62 is also known to regulate the Keap1-Nrf2 pathway, which is responsible for the induction of cytoprotective genes under oxidative stress (Stepkowski et al. 2011). Here, phosphorylation increases the affinity of p62 towards Keap-1, which leads to an increased expression of cytoprotective genes, and which occurs in an mTORC1-dependent manner (Ichimura et al. 2013).

1.6. Objectives

Although previous studies have provided important insight into the roles of Atg8s in the regulation of autophagy, how they regulate the autophagy processes still remains elusive.

Knowing that both the ULK complex and the autophagy adaptor proteins are capable of interacting with Atg8 proteins through LIR motifs (Hosokawa, Sasaki, et al., 2009b; Jung et al.,

2009; Mercer et al., 2009; Narendra et al., 2010), it is highly plausible that the ULK complex might communicate with the autophagy adaptor proteins via the interaction involving Atg8s.

Furthermore, knowing that GABARAPs have stronger affinities towards the ULK1 complex

32 compared to LC3s, we speculate that the different binding affinities might play an important role for the different Atg8s to participate at different stages of the autophagy processes in a spatio temporally-controlled manner. It remains unclear how the interaction of Atg8s with the ULK1 complex plays a role in the autophagy process. Would it play a role in tethering the ULK1 complex to the autophagosomal membrane or in regulating the kinase activity of ULK1 by recruiting ULK1 substrates nearby?

The starting point of my thesis project was the identification of GATE-16 (or called

GABARAPL2) as an interacting partner of Atg13. From this finding, the central goal of my study was to explore the regulation and nature of the interaction between the ULK complex and Atg8s.

In the course of experiments, I have explored how the interaction is regulated and the differential binding affinities among different Atg8s. I was able to further explore the functions of the interaction in the regulation of autophagy, especially the clearance of protein aggregates and damaged mitochondria. Chapter 2 summarizes my work on the identification and characterization of the interaction between Atg13 and Atg8s. My study has also explored a previously-unknown link between ULK1 and p62, which is summarized in Chapter 3. Combined, the outcomes from my thesis work revealed previously-unknown aspects and regulation of interaction in the autophagy pathway. This finding may advance our knowledge on the mechanism of the autophagy process, especially for the process occurring at the early step of autophagosome formation.

CHAPTER 2

ATG13 BINDING TO GABARAP SUBFAMILY PROTEINS IS IMPORTANT FOR THE AUTOPHAGIC CLEARANCE OF PROTEIN AGGREGATES AND DAMAGED MITOCHONDRIA

The question that drove the first part of my study was: what is the role of the ULK1 complex in autophagy? To address this question, we sought to understand how the ULK1 complex interacts with its interacting partners. As described in Chapter 1, there are few interacting partners discovered for the ULK1 complex, and less known about the function of their interactions. Prior to my study, ULK1 was found to bind to mammalian Atg8 proteins GABARAP and GATE-16

(Okazaki et al., 2000). This interaction was found to be important for vesicle transport, and axonal elongation in mammalian neurons (Okazaki et al., 2000). At the time, it was unknown whether this interaction occurred in the context of autophagy. Before my study began, mammalian Atg8s were shown to have functions in autophagy, as Atg8 proteins can be membrane conjugated and localized to the autophagosome, a process in critical in autophagosome formation (Kabeya et al., 2004). Also, as outlined in chapter 1, the ULK1 complex and its components were found to be important in the regulation of autophagy induction (Chang &

Neufeld, 2009; Ganley et al., 2009; Jung et al., 2009). From this body of knowledge, my thesis work grew from asking the following questions: Which Atg8 proteins interact with the components of the ULK1 complex? Is the interaction regulated? Is the interaction important for autophagy, and if so what is the mechanism of its interaction?

Briefly, my work revealed that Atg13 interacts with GABARAP and GATE-16 family members, but not LC3B via its LIR motif. The interaction was greatly increased when ULK1 activity is 34 high or when cells were induced to accumulate protein aggregates or damaged mitochondria. The clearance of protein aggregates and damaged mitochondria was drastically suppressed when the

Atg13 LIR motif was mutated. Despite the lack of interaction between Atg13 and LC3B, we found that the Atg13-Atg8 interaction is important for LC3B-positive autophagosome formation.

In addition, the Atg13-Atg8 interaction is important for the ULK1-mediated phosphorylation of its downstream targets. These results suggest that the GABARAP subfamily of Atg8 proteins might have functions, distinct from LC3B, in autophagosome formation via their interaction with

Atg13.

2.1. GATE-16, GABARAP and GABARAPL1, but not LC3B, interact with ATG13

To identify binding proteins of ATG13, we screened a human fetal brain cDNA library using

ATG13 as bait by the yeast-two hybrid method (Fields & Song, 1989). From the screen, we identified a clone containing the full-length cDNA sequence of GATE-16 as a positive hit.

GATE-16 is one of the eight mammalian ATG8 proteins and a member of the GABARAP subfamily. To confirm the interaction, we analyzed the interaction between recombinant proteins overexpressed in HEK293T cells. Through co-immunoprecipitation analysis, we found that myc- tagged GATE-16 interacts with HA-tagged ATG13 and ULK1 in HEK293T cells. We also tested three other ATG8 proteins (GABARAP, GABARAPL1 and LC3B) to clarify whether the interaction is specific to GATE16 or can occur with other ATG8 proteins. All the tested ATG8 proteins, except LC3B, were immunoprecipitated with ATG13 and ULK1 (Fig. 6A). This result suggests that ATG13 has binding affinities towards GATE16, GABARAP and GABARAPL1, which are the GABARAP subfamily members, but not towards LC3B. Through in vitro analysis using purified proteins, we confirmed that ATG13 directly interacts with GATE-16, GABARAP, and GABARAPL1 (Fig. 6B). We confirmed the interaction between GABARAP and ATG13 at

35 endogenous levels by immunopreciptating ATG13 using antibodies directed toward epitopes near

N- or C-terminus of ATG13 (Fig. 6C).

Fig.6 (continued)

Figure 6. GATE-16, GABARAP, and GABARAPL1 directly bind to ATG13. (A) GATE-16, GABARAP and GABARAPL1, but not LC3B, interact with ATG13 and ULK1. HA-tagged ULK1 and ATG13 were co-expressed with myc-tagged ATG8 proteins or control protein S6K1 in HEK293T cells. Anti-myc immune complexes were isolated and assessed for the amount of HA-ULK1 and HA-ATG13 recovered with myc-tagged ATG8 by western blotting. (B) ATG13 directly interacts with GATE-16 and GABARAP. GST alone or GST-tagged ATG8 proteins were incubated with purified ATG13. The amount of ATG13 recovered with GST-tagged ATG8 proteins on glutathione (GSH) resin was analyzed by western blotting. (C) ATG13 and GABARAP interact at the endogenous level. Endogenous ATG13 was immunoprecipitated with antibodies directed to the N-terminal or C-terminal region of ATG13, and the amount of endogenous GABARAP was monitored by western blotting. A polyclonal antibody directed toward glycogen synthase kinase 3 (GSK3) was used as a control. (D) ATG13 interacts with GABARAP and GATE-16 through its C-terminal region. GST-tagged ATG13 fragments were incubated with either GABARAP or GATE-16 purified from bacteria. The amounts of GABARAP and GATE-16 recovered with GST-tagged ATG13 fragments were analyzed by western blotting. (E) ATG13 interacts with ATG8 via its LIR motif. Myc-tagged ATG13 wild type or ATG13 LIR mutant was co-expressed with HA-tagged ATG8 proteins in HEK293T cells. The amounts of myc-ATG13 co-immunoprecipitated with anti-HA immune complexes were assessed by western blotting.

2.2. ATG13 binds to GATE16, GABARAP, and GABARAPL1 via its LIR motif

To determine which region of ATG13 is involved in binding to the ATG8 proteins, we conducted a delimitation experiment using ATG13 fragment constructs. To exclude ULK1 and FIP200, which contain LIR motifs, from our analysis, we conducted the experiment using purified ATG13 fragments and ATG8 in vitro. The delimitation analysis allowed us to narrow down the binding site in residues 354-527 (Fig. 6D). The identified region contains a sequence (DFVMID) in residues 443-448 that shows the conserved LIR motif pattern. During this study, Alemu et al. reported that ATG13 contains a LIR motif and binds to GABARAP (Alemu et al., 2012).

Consistent with the report, we found that point mutations in the motif replacing ILE447 and

ASP448 with alanine completely abolished the ability of ATG13 to interact with GATE-16,

GABARAP, and GABARAPL1 (Fig. 6E). This result suggests that ATG13 binds to GABARAP,

GATE-16 and GABARAPL1 via the LIR motif.

2.3. The interaction between ATG8 and ATG13 is promoted by high ULK1 activity and

conditions that induce protein aggregates and damaged mitochondria

Under autophagy inducing conditions, it has been shown that GATE-16, GABARAP, LC3B and the ULK1 complex are localized to autophagosomes (Ganley et al., 2009; Kabeya et al., 2004).

Knowing that ATG13 physically interacts with the GABARAP subfamily proteins, we wondered whether the interaction would be regulated by the ULK1 kinase activity. When myc-tagged

GABARAP proteins were expressed together with HA-tagged ULK1 wild type or kinase dead mutant (M92A) in HEK293T cells, the ATG8 proteins were isolated with ATG13 and ULK1 in higher amounts from cells expressing wild type compared to the M92A mutant (Fig. 7A). This result indicates that the kinase activity of ULK1 might contribute positively to the interaction between the GABRARAP subfamily proteins and ATG13.

Fig. 7

A GABARAPL1 GABARAP GATE-16

HA-ULK1: wt kd wt kd wt kd myc-Atg13: + + + + + + ULK1 Atg13 IP: myc w: myc

cell ULK1 lysate Atg13

B myc-GABARAP myc-GATE16 None DPBS rapamycin torrin Puromycin CCCP None DPBS rapamycin torrin Puromycin CCCP

ULK1 ULK1

IP: IP: myc Atg13 myc Atg13

myc GABARAP myc GATE16

ULK1 ULK1 cell cell lysate lysate Atg13 Atg13

myc GABARAP myc GATE16

Figure 7. The binding of GABARAP to ATG13 is promoted by conditions inducing protein aggregates and mitochondrial dysfunction. (A) The ATG13-ATG8 interaction is strengthened when ULK1 is kinetically active. HA-tagged ATG13 and ULK1, either wild type or kinase dead mutant (M92A), were co-expressed with myc-tagged GATE16, GABARAP or GABARAPL1 in HEK293T cells. The amounts of HA-ATG13 and ULK1 co-immunoprecipitated with myc-tagged ATG8 proteins were analyzed by western blotting. (B) GABARAP binding to ULK1 and ATG13 is strengthened by conditions inducing protein aggregation or mitochondrial damages. Myc- tagged GABARAP or myc-tagged GATE-16 were expressed in HEK293T cells. The cells were cultured in Dulbecco’s phosphate buffered saline (DPBS) or treated with rapamycin (100 nM), torin 1 (250 nM), puromycin (10 ug/ml), or CCCP (20 nM) for 4 h. The amounts of endogenous ATG13 and ULK1 co-immunoprecipitated with anti-myc immune complexes were assessed western blotting.

ULK1 activity is up-regulated by nutrient starvation or mTORC1 inhibition (Ganley et al., 2009;

Jung et al., 2009; J. Kim, Kundu, Viollet, & Guan, 2011b). Therefore, we asked whether those conditions could promote the interaction between the GABRARAP proteins and ATG13. To investigate this possibility, we transduced HEK293T cells with either myc-tagged GABARAP or

GATE-16. We incubated the transfected cells in Dulbecco’s phosphate buffered saline (DPBS) that does not contain nutrients and serum, or treated the cells with rapamycin or torin1. We found that the amounts of endogenous ATG13 and ULK1 co-immunoprecipitated with myc-tagged

GABARAP proteins were only marginally altered under those conditions (Fig. 7B).

However, when cells were treated with puromycin, an agent that induces misfolding of proteins, or CCCP (carbonyl cyanide m-chlorophenyl hydrazine), a chemical that induces mitochondrial damages, we found that GABARAP more strongly interacts with ULK1 and ATG13 (Fig. 7B).

Such an up-regulation of interaction did not occur with GATE16, suggesting that GABARAP might be specifically involved in autophagic processes induced by CCCP and puromycin. Since

CCCP and puromycin are known to induce cargo-specific selective autophagy (Fan, Tang, Chen,

Moughon, & Ding, 2010; Novak et al., 2010), this result suggests that the cellular signal inducing the autophagic clearance of protein aggregates and damaged mitochondria, along with ULK1 activation, might promote the interaction between ATG13 and GABARAP.

2.4. The ATG13-ATG8 interaction is important for the degradation of p62

In order to investigate the functional significance of the ATG8-ATG13 interaction, we first analyzed whether the interaction is important for degradation of p62, a protein that is degraded through autophagy (Ichimura, Kominami, Tanaka, & Komatsu, 2008a). To this end, we generated

ATG13-deficient HCT116 cells by using TAL Effector Nucleases (TALENs) (Cermak et al.,

2011). The TALEN approach led us to completely eliminate the expression of ATG13 in 42

HCT116 cells (Fig. 8A). Deficiency in HCT116 cells induced a large accumulation of p62, implying impairment of basal autophagy (Fig. 8B). To analyze the effect of the LIR mutation on p62 degradation, we stably expressed ATG13 wild type or LIR mutant in ATG13-deficient

HCT116 cells. The reconstitution with wild-type ATG13 resulted in reduction of the basal levels of p62 and promoted the degradation of p62 under amino acid starvation (Fig. 9A). By contrast, the starvation-induced degradation of p62 was suppressed in ATG13 LIR mutant (Fig. 9A). This result suggests that the interaction between ATG13 and ATG8 might be important for the starvation-induced degradation of p62 via autophagy. Given that the ATG13-GABARAP interaction was not increased by nutrient starvation (Fig. 7B), the result implies that the constitutive interaction might be important for the starvation-induced degradation of autophagy.

Figure 8. Atg13 KO cells exhibit an impairment of autophagy. (A) Clones were analyzed by immunoblotting and DNA sequencing to distinguish clones as true knockouts (with nonsense deletions or insertions) rather than clones with in-frame deletions. Double knockout (DKO) indicates that the deletion/insertion mutation was the same for each Atg13 allele. Mutation detected (Mut. dec.) indicates that the deletion/insertion mutation was different in each Atg13 allele. WT indicates clones that did not have mutations in either Atg13 allele. For our studies, we chose clone #23. (B) Knockout of Atg13 inhibits basal and starvation induced autophagy. HCT116WT and ATG13KO cells were cultured in the presence or absence of amino acids and/or 200 nM bafilomycin A for 4 h. The amount of p62 was analyzed by western blotting.

Another noticeable change observed with ATG13-deficient cells was reduction of ATG13 wild type in its expression level under nutrient starved conditions (Fig. 9A). The reduction did not occur with ATG13 LIR mutant. This result suggests that the ATG13-GABARAP interaction might be important to promote the degradation of ATG13 via autophagy. Consistent with this notion, previous study has shown that ULK1 is degraded by amino acid starvation (H.-G. Wang,

2013). It is noteworthy that a point mutation in the LIR motif of ULK1 did not suppress the degradation of ULK1(Alemu et al., 2012). Although we cannot exclude other possibilities, our result supports a possibility that ATG13 LIR motif might be more important for the autophagic degradation of the ULK1 complex.

Figure 9. The ATG13-ATG8 interaction is important for the clearance of p62, protein aggregates, and damaged mitochondria. (A) The ATG13-ATG8 interaction is important for the clearance of p62. ATG13-deficient HCT116 cells were stably transduced to express myc-ATG13 wild type or ATG13 LIR or transduced by empty vector. The stably transduced cells were cultured in the presence or absence of amino acids for 4 h. The amount of p62 was analyzed by western blotting. (B) The ATG13-ATG8 interaction is important for the clearance of polyubiquitinated protein aggregates. HCT116 cells stably expressing myc-ATG13 wild type or ATG13 LIR mutant or transduced by empty vector were treated with puromycin (10 ug/ml) for 4 h, and then allowed to recover in the absence of puromycin for 10 h. Cells were taken for the indicated time points at 0, 4, and 10 h, and immunostained for polyubiquitinated structures using anti-ubiquitin antibody. For the cells recovered for 10 h without puromycin, quantitative analysis was conducted by counting the number of cells containing polyubiquitinated structures relative to the total number of cells for ~40 cells. Data are shown as percentage (mean +/- S.D.) of aggregate-containing cells for each viewing area.

2.5. The ATG13-GABARAP interaction is important for the clearance of protein aggregates

The finding that puromycin largely increased the ATG13-GABARAP interaction prompted us to investigate whether the interaction is important for the clearance of protein aggregates.

Puromycin is an amino acid analog that can terminate the translational elongation prematurely, causing accumulation of misfolded proteins (Fan et al., 2010). Treating HCT116 cells with puromycin resulted in accumulation of poly-ubiquitinated protein aggregates (Fig. 9B).

Puromycin induced a greater amount of poly-ubiquitinated protein aggregates in ATG13-deficient cells compared to wild type cells. When the puromycin-treated cells were transferred to medium absent of puromycin, the accumulated protein aggregates were reduced in ATG13 wild type- reconstituted HCT116 (Fig. 9B). Such a reduction was suppressed in ATG13-deficient cells and

ATG13 LIR-reconstituted cells. These results suggest that the ATG13-GABARAP interaction might be important for the efficient degradation of poly-ubiquitinated protein aggregates.

2.6. The ATG13-GABARAP interaction is important for the clearance of damaged

mitochondria

Previous studies have shown that ATG13 and GABARAP are involved in parkin-mediated mitophagy (Joo et al., 2011; Schwarten et al., 2009). CCCP, the chemical broadly used in mitophagy studies (Kwon, Viollet, & Yoo, 2011; Narendra et al., 2008; 2010; Novak et al.,

2010), is known to induce mitochondrial outer membrane depolarization (Ganote & Armstrong,

2003) and trigger parkin-mediated mitophagy (Geisler et al., 2010; Narendra et al., 2008; 2010).

Since CCCP was also able to largely induce the interaction between ATG13 and GABARAP

(Fig. 7B), we tested whether the ATG13-GABARAP interaction might be important for parkin- mediated mitophagy. We transiently expressed GFP (green fluorescence protein)-tagged parkin in

ATG13 WT- or LIR-reconstituted HCT116 cells. Before CCCP was treated, we observed that

GFP-parkin was widely dispersed in the cytoplasm (Fig. 10A-C). When mitochondria were 48 monitored by RFP-tagged mitotracker, we observed that mitochondria are shaped as tubular structures (Fig. 10A-C). Following 6 h of CCCP treatment, a large number of mitochondria were fragmented and clustered together and colocalized with GFP-parkin. Following 24 h of CCCP treatment, the mitochondria disappeared and GFP-parkin was dispersed in the cytoplasm in

ATG13 WT cells (Fig. 10A). By contrast, GFP-parkin-positive mitochondrial clusters still remained in ATG13 KO cells (Fig. 10C) and ATG13 LIR mutant cells (Fig. 10B). This result suggests that the interaction between ATG13 and GABARAP might be important for the parkin- dependent clearance of damaged mitochondria.

Fig.10 (continued)

Figure 10. The Atg13-Atg8 interaction is important for the clearance of damaged mitochondria. The Atg13-Atg8 interaction is important for parkin-mediated clearance of damaged mitochondria. (A-C) HCT116 cells stably expressing myc-ATG13 wild type or ATG13 LIR mutant or transduced by empty vector were transiently transfected with GFP-parkin. Seventy-two hours post-transfection, the transduced cells were treated with CCCP (20 nM) or DMSO for 6 h and 24 h. Following the incubation period, cells were stained with mitotracker red (200 nM) for 30 min and DAPI (violet) for 1 min. (D) For cells treated with CCCP for 24 h, the number of cells containing mitochondria-positive structures relative to the total number of GFP- parkin transfected cells was counted for 25 randomly selected cells. Data are shown as percentage of cells with or without mitochondria.

2.7. The ATG13-GABARAP interaction is important for ATG13 punctate formation.

Knowing that the ATG13-GABARAP interaction is important for the clearance of p62, protein aggregates and damaged mitochondria, we wondered how the interaction affects the clearances. A critical step for autophagy induction appears to require the formation of ULK1 puncta (Itakura &

Mizushima, 2010). We asked whether the ATG13 LIR motif might be important for the formation of ATG13 puncta. We stably reconstituted GFP-tagged ATG13 wild type or LIR mutant in

ATG13-deficient HCT116 cells. The GFP-tagged ATG13 constructs were engineered to express the proteins only in the presence of doxycycline in medium. This inducible system enabled us to express GFP-ATG13 at a level comparable to that of endogenous ATG13. Following doxycycline treatment for 36 h, cells were incubated in medium deprived of amino acids for additional one hour. The amino acid deprivation induced the formation of GFP-ATG13 puncta in wild type cells (Fig. 11). By contrast, the puncta formation was significantly suppressed with GFP-ATG13

LIR mutant (Fig. 11). This indicates that the ATG13-GABARAP interaction might be important for the formation of ATG13 puncta in response to starvation.

Figure 11. The ATG13-ATG8 interaction is important for ATG13 puncta formation and autophagosome formation. The ATG13-ATG8 interaction is important for ATG13 puncta formation. Doxycycline-inducible GFP-ATG13 wild type- or ATG13 LIR mutant-expression construct was introduced into ATG13-deficient HCT116 cells. The transduced cells were treated with doxycycline (5 ng/mL) for 36 h and then cultured in Hank’s Balanced Salt Solution (HBSS) or nutrient-enriched DMEM medium for 2 h and stained with DAPI (violet). GFP-ATG13 fluorescence images were obtained using a Deltavision fluorescence microscope (see Materials and Methods). Quantitative analysis on the number of puncta per cell was conducted for 25 randomly selected cells. Values are mean ± SD. *, p < 0.05; **, p < 0.01 ; ***, p < 0.001 relative to control cells.

2.8. The ATG13-GABARAP interaction is important for autophagosome formation.

Previous studies have shown that the ULK1 puncta formation might occur earlier than autophagosome formation (Itakura & Mizushima, 2010). Knowing that the interaction between

ATG13 and GABARAP is important for ATG13 puncta formation in response to starvation, we wondered whether the interaction might be important for autophagosome formation. Since LC3B is one of the most well-known autophagosome markers, we analyzed LC3B punctate formation in cells where the ATG13-ATG8 interaction was disrupted. To do this, we stably transduced

HCT116 wild type or LIR mutant cells, which we described above, with GFP-LC3B construct in a doxycycline-inducible vector. The GFP-LC3B transduced cells were treated with doxycycline for 36 h to induce the expression of GFP-LC3B. Then, the cells were incubated for additional 4 hours in the medium deprived of amino acids. We monitored the formation of GFP-LC3B puncta using a fluorescence microscope. The LC3 puncta formation was highly induced in ATG13 wild type cells (Fig. 12). By contrast, the LC3 puncta formation was significantly suppressed in

ATG13 KO and ATG13 LIR cells compared to ATG13 wild type cells. This result suggests that the interaction between ATG13 and GABARAP might be important for autophagosome formation.

Figure 12. The Atg13-Atg8 interaction is important for autophagosome formation. The ATG13-ATG8 interaction is important for autophagosome formation. Doxycycline-inducible GFP-LC3B expression construct was introduced into HCT-116 cells stably expressing myc- ATG13 wild type or ATG13 LIR mutant or transduced by empty vector. The transduced cells were treated with doxycycline (5 ng/mL) for 36 h and then cultured in the presence or absence of amino acids for 4 h and stained with DAPI (violet). GFP-LC3B fluorescence images were obtained using a Deltavision fluorescence microscope. Quantitative analysis of the number of puncta per cell was conducted for 25 randomly-selected cells. Values are mean ± SD. ***, p < 0.001 relative to control cells.

2.9. The Atg13-Atg8 interaction is important for ULK1 kinase activity.

A possible function of Atg8 proteins in the regulation of Atg13 might be through anchoring the

ULK1 complex to lipid membranes where autophagosome formation starts to occur. Knowing that the interaction is important for Atg13 puncta formation, the early event in autophagosome formation (Alemu et al., 2012; Itakura & Mizushima, 2010), we considered a possibility that the interaction is somehow involved in the early step. A possible function of the interaction might be its requirement for the localization of the ULK1 complex properly to the downstream effectors.

Recent studies have shown that Beclin 1 is a substrate of ULK1 (Karanasios et al., 2013;

Weidberg et al., 2010). Thus, we assayed whether the interaction between Atg13 and Atg8 affects the ULK1-mediated phosphorylation of Beclin 1. In response to amino acid starvation, the phosphorylation of Beclin 1 was increased in Atg13 wild type cells (Fig. 13A). We also observed an increase of the phosphorylation in Atg13 LIR mutant cells, but the level was drastically reduced, suggesting that the interaction between Atg13 and Atg8 might be important for the phosphorylation. Atg13 deficiency completely suppressed the phosphorylation, indicating that the phosphorylation is dependent upon Atg13. We found that the phosphorylations of Atg14L and Beclin-1 induced by amino acid deprivation were drastically suppressed in Atg13 KO and

Atg13 LIR reconstituted KO cells (Fig. 13A and 13B). This result indicates that the Atg13-Atg8 interaction is important for the activation of ULK1.

Figure 13. The Atg13-Atg8 interaction is important for the phosphorylation of ULK1 substrates. (A) The Atg13-Atg8 interaction is important for the phosphorylation of Beclin 1 by ULK1. HCT-116 cells stably reconstituted with myc-Atg13 wild type or Atg13 LIR mutant replacing endogenous Atg13, or transduced by empty vector were cultured in HBSS or regular medium for 2 h. Endogenous Beclin 1 was isolated by immunoprecipitation using anti-Beclin 1 antibody, and the extent of phosphorylation of Beclin 1 was analyzed by western blotting using antibody that specifically recognizing phosphorylated Beclin 1. (B) The Atg13-Atg8 interaction is important for the phosphorylation of Atg14L by ULK1. A similar experiment was conducted as in (a) except endogenous Atg14L was analyzed instead of Beclin 1. 57

2.10. DISCUSSION

In this study, we identified that ATG13 preferentially binds to the GABARAP subfamily proteins via its LIR motif near the C-terminus. In agreement with our study, Alemu et al. reported that

ULK1, ULK2, ATG13, and FIP200 have LIR motifs and interact with the GABARAP subfamily members preferentially (Alemu et al., 2012). The different binding affinities imply a functional difference between GABARAP and LC3 subfamilies. Currently, the specific roles of individual

ATG8 proteins in the autophagy pathway remain unclear. It is possible that LC3 and GABARAP subfamilies might act in different steps during the autophagosome biogenesis. Supportive of this notion, a previous study using knockdown approaches proposed that LC3 might be involved in autophagosome elongation, whereas the GABARAP subfamily proteins might be involved in autophagosome sealing needed for maturation (Weidberg et al., 2010). However, other studies showed that LC3 might also be involved in autophagosome closure and microtubule-mediate transport of mature autophagosomes (Fujita et al., 2008; Pankiv et al., 2010). Those studies with respect to the roles of LC3 or GABARAP subfamily members imply that each subfamily might be involved in multiple steps during autophagosome formation. Related to this notion, a recent study showed that there is no sequential order in the recruitment of LC3 and GABARAP proteins during the autophagosome formation (Itakura & Mizushima, 2010). Furthermore, LC3 and

GATE-16/GABARAP were found to co-localize in puncta (Kabeya et al., 2004). Given our meager knowledge on the specific functions of the ATG8 proteins in autophagy, it is hard to discern the roles of the ATG8-ATG13 interaction in the autophagy pathway. Considering that the

ULK1 complex acts upstream of the pathway regulating autophagosome formation (Ganley et al.,

2009; Jung et al., 2009; Wirawan et al., 2012), a possible function of the ATG13-ATG8 interaction might be to facilitate the assembly of the ULK1 complex on membranes where autophagosomes start to form. This notion is supported by the recent report showing that ULK1 binds to the GABARAP subfamily members via its LIR motif, which secures the ULK1 complex 58 onto autophagosomes (Alemu et al., 2012).

Although ULK1 kinase activity was involved in strengthening the interaction between ATG13 and ATG8, we found that only the cellular conditions causing mitochondrial damages and protein aggregation, but not amino acid starvation or mTORC1 inhibition, increased the ATG13-

GABARAP interaction. This indicates that puromycin and CCCP, in addition to increasing ULK1 kinase activity, might induce molecular signals to enhance the interaction between ATG13 and

GABARAP. Studies have shown that CCCP and misfolded protein aggregates are capable of inducing autophagy (Jin & Youle, 2013; Kwon et al., 2011; Yorimitsu, Nair, Yang, & Klionsky,

2006). It is noteworthy that the regulation of interaction occurred only with GABARAP, but not

GATE-16, even though they belong to the same GABARAP subfamily. This suggests that even those in the same subfamilies might have different functions. Perhaps, GABARAP is critical for selective autophagy in response to puromycin and CCCP, whereas other ATG8 proteins might be critical for other types of cargo-specific autophagy or macroautophagy. Consistent with this notion, a recent study showed that GABARAP is colocalized with damaged mitochondria via interacting with a mitochondria residential protein NIX (Schwarten et al., 2009). Thus, the different members of the GABARAP subfamily might direct different target molecules or organelles to the autophagy machinery. It is technically challenging to investigate the individual contribution of the ATG8 proteins because of their potential compensatory roles. Perhaps, their conjugation with lipids might confer the ATG8 proteins a specific function to sense a distinct type of cellular stress that alters membrane compartments. Alternatively, the ATG8 proteins might be localized in different places in cells and be responsible for the location-specific signals.

It might be important to note that ATG13 constitutively interacted with GABARAP subfamily proteins irrespectively of amino acid starvation, implying that the constitutive interaction might be pre-requisition for starvation-induced autophagy. Only the interaction between ATG13 and 59

GABARAP was regulated by puromycin and CCCP, implying that the enhanced interaction might be important for the cargo-specific selective autophagy. The finding that the ULK1 kinase activity positively contributes to the interaction between ATG13 and ATG8 implies that an

ULK1-dependent phosphorylation might play a role in the regulation of the interaction. Although the ATG13-ATG8 interaction is mediated via the ATG13 LIR motif, we cannot exclude a possibility that other part of ATG13 might affect the affinity of the interaction. Since ATG13 is phosphorylated by ULK1 (Joo et al., 2011), ATG13 phosphorylations could play a role in the regulation of the interaction between ATG13 and ATG8. Alternatively, it is possible that ULK1 phosphorylates other binding partners, such as FIP200 and Atg101, to regulate the affinity of interaction between ATG13 and ATG8.

In mammalian cells, amino acid starvation reduced the expression level of ULK1(Wong & Jiang,

2013). In Arabidopsis thaliana, ATG1 and ATG13 can be degraded by autophagy during nutrient starvation (Suttangkakul, Li, Chung, & Vierstra, 2011). This mechanism may act as a negative feedback loop that tightly connects autophagy with the nutritional status in the cell. In this study, we found that the expression level of ATG13 is reduced upon amino acid starvation (Fig. 9A).

This reduction was suppressed in cells expressing ATG13 LIR, a result consistent with an important role of the ATG13-ATG8 interaction in autophagic degradation of ATG13. Unlike the

ATG13 LIR mutation, the ULK1 LIR mutation did not suppress the reduction of ULK1 level in response to amino acid starvation (Alemu et al., 2012). It is possible that ATG13 LIR motif might be more important for the autophagic degradation of the ULK1 complex than ULK1 LIR motif.

It is noteworthy that the ATG13-ATG8 interaction is important for ATG13 puncta formation. 60

Among several possible interpretations, we favor a possibility that the ATG13-ATG8 interaction plays a role in tethering ATG13 to autophagosomes. This possibility is supported by the role of the ULK1-ATG8 interaction in forming ULK1 puncta(Alemu et al., 2012). Through the recruitment, the ULK1 complex might be able to phosphorylate downstream effectors involved in autophagy induction, such as Beclin 1(Russell et al., 2013). By enabling ULK1 to phosphorylate downstream effectors, the ATG13-ATG8 interaction might contribute to the formation of autophagosomes. However, the LIR mutation did not completely suppress the formation of autophagosomes in response to starvation (Fig. 12). We consider this might be due to the presence of LIR motifs in other binding partners of ULK1.

In sum, our study demonstrated that the ATG13-ATG8 interaction is important for autophagosome formation and the autophagic clearance of protein aggregates and parkin-tagged damaged mitochondria. We found that the conditions inducing the selective autophagy clearances increase the ATG13-GABARAP interaction. This finding provides an additional layer of regulation conducted by the ULK1 complex in the autophagy induction pathway. By being involved in responding to different cellular stress signals, the ATG13-GABARAP interaction might play a role in securing the ULK1 complex to the autophagosome formation machinery.

This interaction may enable the ULK1 complex to phosphorylate downstream autophagy regulators. It remains unclear how the ATG13-ATG8 interaction is differently regulated depending on ATG8 proteins in response to different cellular stresses. Further studies to elucidate the distinct functions of the ATG8 proteins may be essential for our comprehensive knowledge on the autophagy induction mechanism and the cargo-specific autophagy process.

2.11. MATERIALS and METHODS

Antibodies. The following antibodies were used in this study: Anti-ULK1 (sc-10900 and sc-

33182), anti-p62 (sc-28359), anti-Beclin 1 (sc-11427 and sc-10086), anti-Atg14L (sc-164767) and anti-tubulin (sc-12462) from Santa Cruz Biotechnology (Santa Cruz, CA); anti-ULK1

(A7481) from Sigma-Aldrich (St. Louis, MO); anti-myc 9E10 (OP10) from EMD Biosciences

(Darmstadt, Germany); anti-HA (AFC-101P) from Covance (Princeton, NJ); anti-GST antibody

(27457701) from GE Healthcare (Little Chalfont, United Kingdom); anti-Atg14L (M184-3), anti-

GABARAP (M135-3B), and GATE-16 (PM038) from MBL (Nagoya, Japan); anti-ubiquitin

(PW8810) from Biomol Res (Plymouth Meeting, PA); ATG13 antibodies were generated as described previously 1.

Chemicals. The following chemicals were used: rapamycin (553210, EMD Chemicals); puromycin (82595, Sigma-Aldrich); zeocin (R250-01, Life Technologies, (Carlsbad, CA) neomycin (10131-035, Life Technologies) and mitotracker Red CM-H2XRos from Life

Technologies; CCCP (sc-202984, Santa Cruz Biotechnology); AICAR (A9978, Sigma-Aldrich);

Torin 1 (4247/10, R&D); Doxycycline (631311, Clonetech).

Yeast two-hybrid screen. The human ATG13 cDNA, was cloned into pDBTrp vector 2, and introduced into AH109 yeast cells using LiAc. The transformed cells were selected on Trp- media. AH109 yeast expressing pDBTrp-ATG13 were incubated on Trp-/His-/3 mM 3AT plates to test for self-activation, and grown overnight in Trp- media to test for toxicity. AH109 cells transformed with pDBTrp-ATG13 plasmid were grown overnight in 50 ml Trp- dropout media.

Cells were diluted to OD600 of 0.23 in 150 ml Trp- media and cultured for several more hours

62 until OD600 reached 0.7. Cells were pelleted, rinsed in ddH2O, washed in 2.5 ml TE/LiAc (550

µl 10xTE; 550 µl 1M LiAc; 3.9 ml dH2O), and resuspended in 2 ml TE/LiAc. The AH109 cells were transformed with a human fetal brain cDNA library (Clontech, Mountain View, CA) using

LiAc/PEG method. We used approximately 80 ug of the cDNA library. The total titer was 1.5 million colonies. After a heat shock at 42oC, the transformed cells were plated in 0.9% NaCl solution onto 30 plates (150 mm) of Trp-/Leu-/His-/3 mM 3AT media and incubated at 30oC for

7-10 days. LacZ assays were conducted by colony lift procedure for primary isolates by re- streaking the isolates on Trp-/Leu-/His-/3 mM 3AT plates. Briefly, colonies were lifted onto a nitrocellulose membrane, frozen in liquid nitrogen and thawed for cell lysis. The membrane was placed on a filter paper containing Z buffer (60 mM Na2HPO4, 40mM NaH2PO4, 10 mM KCL, 1 mM MgSO4-7H2O, 39 mM beta-mercaptoethanol, 1 mg/ml X-gal, pH 7) and incubated at 37˚C for 30 min for 2 h. Positive colonies that showed a color change in LacZ assays were picked for

PCR. Alternatively, DNA was isolated from yeast and transformed into bacteria. DNA was prepared from bacteria and sequenced. Plasmids containing Gal4AD-cDNA clones were recovered by transforming DNA into E. coli MH4 cells. Transformants were plated on M9 minimal medium lacking leucine but containing ampicillin. Plasmid DNA was isolated from bacteria and digested to confirm insert size. After sequencing, plasmid DNA was transformed into yeast strain AH109 in combination with the original bait plasmid. Transformants were selected for growth on Trp-/Leu- plates, and streaked onto Trp-/Leu-/his-/3mM 3-AT plates to test for growth.

DNA Constructs. The cDNA clones for human GATE-16, GABARAP, GABARAPL1, and

LC3B were obtained from Open Biosystems (Huntsville, AL). The cDNA was amplified and cloned into prk-myc, prk-HA, and pGEX6p2 vectors. The LIR motif mutant of ATG13 was made

63 by using the site-directed mutagenesis kit (Stratagene, La Jolla, CA). For primers used, see

(Table S1). For GFP-ATG13wt, GFPATG13LIR and GFP-LC3 constructions, GFP was PCR amplified from pEGFP-C3 (Clonetech Palo Alto, CA) and ATG13wt, ATG13LIR and LC3B were PCR amplified from myc-prk5 vector. For primers used, see (Table S2). GFP-ATG13wt,

GFPATG13LIR and GFP-LC3 were cloned into pENTER vectors (Life Technologies) followed by standard LR Clonase reaction (#11789, Life Technologies), into pPB-TRE-DEST-EF1A-rtTA-

IRES-Neo, following manufacturers protocol.

Preparation of TALE nuclease-mediated knockout. To generate cell lines with knockout (KO) of hATG13, the 5th exon and its immediate flanking region of human KIAA0652 was scanned for

TALEN binding pairs using TALEN-NT (https://tale-nt.cac.cornell.edu/). The binding pairs

ATG13-Left HD HD HD NG NG HD NG NG NN HD NG NI NG NI NI and ATG13-Right HD

HD NG NN NN NI NN NI NN HD HD NG NI NG NI NN NN were assembled into pc_TALd152+63 using Golden Gate TALEN assembly(Cermak et al., 2011). HCT116 cells were targeted for ATG13 KO as previously described(Rahrmann et al., 2013). Briefly, HCT116 cells were transfected with 500 ng each piggyBac 7 Transposase (PB7) and pPB-Ef1A-Puro transposon vector in addition to 2 ug ATG13 TALEN left and right. 3 days post-transfection, cells were seeded into 96-well plates in full media containing puromycin. Wells were screened for single colony formation. Wells with none or 2 or more colonies were discarded. Single colonies were isolated and expanded, and genomic DNA preparations collected. Clones were then analyzed by immunoblotting and DNA sequencing to distinguish clones as true knockouts (with nonsense deletions or insertions) rather than clones with in-frame deletions.

Generation of stable cell lines

To prepare stably transfected cell lines expressing of myc-ATG13wt, myc-ATG13LIR, and empty vector, sequences of interest were cloned into the CSII-EF vector. Transduction was conducted in HCT116 ATG13 KO cells 24 h before antibiotic selection with zeocin. To prepare stably transfected cells expressing doxycycline inducible constructs, transfection was conducted in HCT116 ATG13KO cells stably expressing myc-ATG13wt, myc-ATG13LIR, and PCS2 empty vector, 2 days before antibiotic selection with neomycin. Expression of desired constructs was achieved by treating cells with doxycycline (5 ng/mL) for 36 h before analysis.

Cell culture and transfection. HEK293T and HCT116 cells were cultured in DMEM (Life

Technologies) supplemented with 10% fetal bovine serum, penicillin and streptomycin at 37oC in

5% CO2. For transient expression, cells were transfected with recombinant DNA by using

FuGENETM 6 (Roche diagnostics) or Lipofectamine 2000 (Invitrogen) following the manufacturer’s protocol. Cells were harvested 2 day post-transfection for all transient expression experiments. For nutrient starvation, HBSS (cat# 24020117, Sigma-Aldrich) and DPBS (cat#

14040133, Life Technologies) were used.

Co-immunoprecipitation and western blotting. For co-immunprecpitation studies, whole-cell extracts were prepared in buffer containing 40 mM Hepes, pH 7.4, 120 mM NaCl, 1 mM EDTA,

65 immunoblot polyvinylidene difluoride (PVDF) membranes (Bio-Rad; Hercules, CA) and detected with Western blotting detection reagents (Perkin-Elmer; Wellesley, MA).

GST pull down assay. The DNA constructs for GST-tagged ATG13, ATG13 fragments,

GABARAP, LC3B, and GATE-16 were cloned into the bacterial expression plasmid pGEX-6P-2

(GE Healthcare) and introduced into ArcticExpress bacteria cells (Strategene). The GST-tagged proteins were expressed in the bacteria by induction with 0.1 mM isopropyl-1-thio-b- galatopyranoside for 16 h and purified with glutathione-Sepharose 4B beads (GE Healthcare) according to the manufacturer’s protocol.

Cell imaging. HCT116 cells were fixed with 4% formaldehyde in PBS (phosphate buffered saline) for 15 min, and permeabilized with 0.3% Triton X-100 for 15 min at room temperature.

Permeabilized cells were incubated in PBS containing 1% BSA for 30 min and incubated with antibodies for overnight at 4°C. Nuclei were stained with DAPI (4'-6-Diamidino-2-phenylindole,

Invitrogen, D-1306). After the primary antibody binding, cells were incubated with Alexa Flour

488-conjugated anti-mouse IgG (A-11001, Life Technologies) and/or Alexa Flour 647- conjugated anti-rabbit IgG (Life Technologies, A-21443). Images from stained cells were obtained using a Deltavision PersonelDV microscope (Applied Precision).

Mitophagy Assay. ATG13-deficient HCT116 cells, which were stably expressing myc-

ATG13wt or ATG13LIR, or stably transduced with the empty CSII-EF vector, were transiently transfected with GFP-parkin. 72 h post transfection, cells were treated with 20 nM CCCP or control DMSO for 6 h and 24 h. Following the incubation, cells were stained with mitotracker

(200 nM) for 30 min (red) and DAPI for 1 min (violet). The number of cells containing

66 mitochondria-positive structures relative to the total number of GFP-parkin transfected cells

(mean +/- S.D.) was quantitated for 25 cell images.

Assay of polyubiquitinated aggregate clearance. ATG13 KO HCT-116 cells stably expressing myc-ATG13wt or ATG13LIR, or stably transduced with the empty CSII-EF vector were treated with puromycin (10 ug/ml) for 4 h, and then allowed to recover in the absence of puromycin for

10 h. Samples were taken for each time point and immunostained for polyubiquitinated structures using antibody for mono- and poly-ubiquitinylated Conjugates. The number of cells containing polyubiquitinated structures relative to the total number of cells (mean +/- S.D.) was quantitated for 40 cell images.

Table 1. Oligonucleotides for Atg13 site-directed mutagenesis.

Atg13 LIR FWD: 5’GACTTTGTTATGGCGGCGTTTAAACCAGCT3’ Atg13 LIR REV: 5’AGCTGGTTTAAACGCCGCCATAACAAAGTC3’

Table 2. Oligonucleotides for constructs to express GFP-tagged Atg proteins.

GFP FWD: 5’ TATCAGCTGATGGTGAGCAAGGGCG 3’ GFP REV: 5’ ATAGCGGCCGCCACCCTTGTACAGCTC 3’ Atg13 FWD: 5’ TATGCGGCCGCGAAACTGATCTC 3’ Atg13 REV: 5’ ATATCTAGATTACTGCAGGGTTTCCAC 3’ LC3B FWD: 5’ TATGCGGCCGCCCGTCGGAGAAGA 3’ LC3B REV: 5’ ATATCTAGATTACACTGACAATTTCATCCCG 3’

CHAPTER 3

REGULATION OF AUTOPHAGY ADAPTOR PROTEINS BY THE ULK1 COMPLEX

Previous studies have supported several functions for ULK1 in selective autophagy (Cermak et al., 2011; Kundu et al., 2008). ULK1-deficient blood cells exhibited an accumulation of mitochondria and inhibited blood cell differentiation (Egan et al., 2011; Rahrmann et al., 2013), and ULK1 deficiency in the liver tissue induced accumulation of mitochondria in the tissue

(Itakura, Kishi-Itakura, Koyama-Honda, & Mizushima, 2012; Joo et al., 2011; Kundu et al., 2008;

Roach, 2011). ULK1 was also shown to be important for parkin-mediated mitophagy (Fan et al.,

2010; Kirkin, Lamark, Johansen, & Dikic, 2009a; Kundu et al., 2008; Lamark et al., 2009;

Narendra et al., 2010; Novak et al., 2010). Despite the important function of ULK1 in selective autophagy, the underlying mechanism remains unclear. In the second part of my thesis work, I aimed to elucidate the roles of ULK1 in selective autophagy. My study has been driven by my initial work on the possibility that ULK1 would phosphorylate p62. The experiment was conducted based on the hypothesis that I formulated based on the discovery of interaction between the ULK1 complex and Atg8s, which has been described in Chapter 2. As described in

Chapter 1, p62 is an autophagy adaptor protein involved in the autophagic clearance of protein aggregates and damaged mitochondria (Egan et al., 2011; Novak et al., 2010; Tung, Hsu, Lee,

Huang, & Liao, 2010). p62 accomplishes such a role by binding to poly-ubiquitinated proteins and Atg8s via its UBA domain and LIR motif, respectively. By binding to both ubiquitin and

Atg8, p62 may mediate docking of poly-ubiquitinated protein aggregates to the autophagosomal machinery, ensuring their selective degradation. Indeed, the interaction between LC3 and p62 has been shown to be important for the degradation of damaged mitochondria and mutant huntingtin aggregates (Itakura et al., 2012; Schwarten et al., 2009).

How the interaction between LC3 and p62 is involved in selective autophagy of the huntingtin aggregates remains unclear. A recent study provided a clue about the mechanism by showing that

GABARAP interacts with Nix, a mitochondrial protein present in outer membrane to regulate the removal of damaged mitochondria (Fan et al., 2010; Kirkin, Lamark, Johansen, & Dikic, 2009a;

Lamark et al., 2009; Narendra et al., 2010; Novak et al., 2010; Taylor, 2002; Taylor, Hardy, &

Fischbeck, 2002). Nix harbors one LIR motif capable of binding to GABARAP as described in

Chapter 1. We speculate that the Atg8 proteins may play a role in recruiting the basic autophagy machinery to the degradation-destined protein aggregates or damaged mitochondria. Given the current knowledge of LIR-mediated interactions in selective autophagy, it remains unclear how

ULK1 is involved in the process of selective autophagy. This issue is closely related to the topic that we have addressed in Chapter 2 describing the interaction between Atg13 and Atg8 proteins.

We speculate that somehow ULK1 might induce phosphorylation and alter the protein-protein interaction between the ULK1/Atg13 complex and Atg8 proteins, resulting in recruitment of

Atg8-labeled protein aggregates or damaged organelles destined for degradation. My second part of my thesis work has been focused on elucidating the link between ULK1 and p62 via phosphorylation and how the phosphorylation would regulate the functions of p62.

3.1. ULK1 has selective autophagy functions toward poly-ubiquitinated aggregates

Accumulation of ubiquitin-containing aggregates is a hallmark of neurodegenerative disorders

(Komatsu, Kominami, & Tanaka, 2006; Novak et al., 2010; Tung et al., 2010). Autophagy plays an essential role in protecting cells from toxicity by eliminating the polyubiquitinated aggregates

(Itakura et al., 2012; Kundu et al., 2008; Schwarten et al., 2009). The machinery and mechanisms underlying the selective degradation of toxic ubiquitin aggregates is unclear. ULK1 has been demonstrated to play an essential role for the selective degradation of mitochondria during red blood cell maturation as well as parkin-dependent mitophagy (Fan et al., 2010; Pankiv et al., 69

2007; Taylor, 2002; Taylor et al., 2002). the role of ULK1 in the selective removal of other polyubiquitinated substrates has not been well explored. We inquired whether ULK1 could mediate the removal of polyubiquitinated protein aggregates.

To investigate this possibility, we induced polyubiquitined protein aggregates by treating ULK1

+/+ MEFs and ULK1 -/- MEFs with puromycin. Puromycin, is an amino acid analog that can terminate the translational elongation prematurely, causing accumulation of partly-translated, misfolded proteins (Fan et al., 2010; Pankiv et al., 2007). Puromycin induced a significantly higher accumulation of ubiquitin-positive protein aggregates in the ULK1-deficient MEFs compared to wild-type control cells (Fig. 14). When the puromycin-treated cells were transferred to the medium without puromycin, the ubiquitin-positive protein aggregates were cleared to an undetectable level in wild type cells within 10 hours. By contrast, ubiquitin-positive aggregates remained in ULK1 KO MEFs without being cleared efficiently in comparison to wild-type MEFs.

These results suggest that ULK1 is involved in the efficient degradation of polyubiquitin protein aggregates.

Figure 14. ULK1 is involved in the selective removal of ubiquitinated structures. ULK1 KO MEFs show decreased clearance of polyubiquitnated aggregates. WT and ULK1 KO MEFs were treated with puromycin (10 ug/ml) for 4 h, and then allowed to recover in regular media for 10 h. Samples were taken for each time point and immunostained for polyubiquitinated structures. Quantitative analysis was done on the number of cells containing polyubiquitinated structures relative to the total number of cells for ~40 cells. Data are shown as percentage (mean +/- S.D.) of aggregate containing cells for 10 viewing areas.

In Huntington’s disease, genetic expansion of the huntingtin gene (Htt) results in the addition of polyglutamine tracts (polyQ) to the protein, which leads to toxic Htt aggregates in the brain

(Sarkar & Rubinsztein, 2008; Sieradzan, Mechan, Jones, & Wanker, 1999; Waelter, Boeddrich, &

Lurz, 2001). These Htt aggregates can be targeted for autophagic degradation by being polyubiquitinated (Kalchman, Graham, Xia, & Koide, 1996; Pankiv et al., 2007; Tung et al.,

2010). Given that ULK1 exhibits selective autophagy functions towards polyubiquitinated structures, we examined whether ULK1 is needed for the clearance of Htt aggregates. To test this possibility, we cotransfected Htt-(Q)103-GFP and mCherry-empty vector into ULK1+/+ MEFs and ULK1 KO MEFs. The mCherry vector was used as a marker of transfected cells. The Htt-

(Q)103 construct expresses an N-terminal fragment of Htt encoded by its exon 1 followed by a poly-Q expansion of 103 glutamines. The recombinant Htt-(Q)103-GFP formed a high number of aggregates in the cytoplasm of both ULK1+/+ MEFs and ULK1-/- MEFs. Rapamycin has been shown to remove mutant HttQ in HEK293 cells by inducing autophagy (Tung et al., 2010). To test whether ULK1 has effects on rapamycin-induced clearance of HttQ aggregates, we treated the transduced cells with rapamycin. 48 hours post treatment of rapamycin, we observed that the

GFP-positive HttQ aggregates were mostly removed in the wild type cells. By contrast, the aggregates still remained in ULK1-deficient MEFs (Fig. 15). These results suggest that ULK1 is required for the clearance of the mutant huntingtin proteins in response to rapamycin.

Figure 15. ULK1 is involved in the selective removal of HTTQ aggregates. ULK1 KO MEFs show decreased clearance of HTTQ aggregates. WT and ULK1 KO MEFs were transiently transfected with GFP-HTTQ-103. 24 h post transfection cells were treated with 200 nm rapamycin or DMSO for 48 h. Quantitative analysis was done on the number of cells containing GFP-HTTQ-positive structures relative to the total number of mCherry expressing cells for ~40 cells. Data are shown as percentage (mean +/- S.D.) of aggregate containing cells for more than 10 viewing areas.

3.2. The ULK1-Atg13 complex interacts with p62 and induces its phosphorylation.

The mechanism underlying the involvement of the ULK1 complex in selective autophagy is unknown. Removal of polyubiqutinated aggregates through autophagy requires autophagy adaptor proteins such as p62 (Bjørkøy et al., 2005; Kirkin, Lamark, Johansen, & Dikic, 2009a;

Lamark et al., 2009; Mori et al., 2012; Narendra et al., 2010; Pankiv et al., 2007; Seibenhener et al., 2004). p62 ensures autophagic degradation by simultaneously binding to cytosolic cargo and components of the autophagy machinery (Pankiv et al., 2007). To date, the only autophagy machinery p62 is known to interact with is Atg8 proteins. It is interesting to speculate whether p62 associates with other autophagy machinery proteins, Given the interaction between the ULK1 complex and Atg8s identified by my study as well as by others, we thought it might be highly likely that the ULK1 complex might interact with p62 perhaps in a manner dependent upon

Atg8s. Because p62 is degraded during macroautophagy and selective autophagy, we hypothesized that its interaction with the autophagy machinery increases under conditions that lead to autophagy and selective autophagy. It was already shown that the affinity of p62 binding towards LC3B increases under amino acid starvation (Shvets, Abada, Weidberg, & Elazar, 2011).

Given this knowledge, we expected that the ULK1 complex might also interact with p62 with a stronger affinity in a condition that induces the clearance of p62, if they interact. To test this possibility, we expressed myc-tagged Atg13 together with HA-tagged p62 in HEK293T cells and treated the cells with puromycin (inducing misfolded proteins) or CCCP (inducing mitochondrial depolarization). Those treatments have already shown to induce degradation of polyubiquitinated protein aggregates or organelles by autophagy (Fan et al., 2010; Narendra et al., 2008). When myc-Atg13 was immunoprecipitated by use of anti-myc antibody, we found that a significantly higher amount of p62 was isolated with Atg13 from the cells treated with CCCP (Fig. 16A). p62 was still capable of interacting with Atg13 under normal conditions or puromycin treatment. To exclude a possibility that overexpression of the proteins might lead to an interaction that could 74 not be regulated by any cellular condition, we conducted the experiment by analyzing endogenous Atg13 immunoprecipitates. For this experiment, we included a condition of nutrient starvation using DPBS Interestingly, we found that anti-Atg13 immunoprecipitates pulled down a higher amount of p62 from the cells treated with DPBS, puromycin or CCCP compared to non- treated control cells (Fig. 16B). In this experiment, we did not detect any significant increase of interaction between Atg13 and p62 seen when both proteins were overexpressed.

Knowing the interaction between Atg13 and p62, we wondered whether they might directly interact with each other. To test this possibility, we purified GST-tagged p62 and Atg13 from bacteria and analyzed their interaction in vitro by conducting the glutathione affinity assay. We could not detect any interaction between the recombinant proteins, indicating that they might not directly interact with each other (data not shown). Atg13 and p62 contain an LIR motif that is capable of interacting with various Atg8 homologues. This suggests that Atg8 proteins may mediate the interaction between p62 and Atg13.

Figure 16. ULK1-Atg13 complex interacts with and phosphorylates P62. (A) Atg13 interacts p62 under various cellular stresses at levels. Myc-Atg13 and GFP-p62 were transiently expressed in HEK293T cells. Two days after transfection cells were treated with DPBS, puromycin (10 ug/ml), or CCCP (20 nM) or control DMSO for 3 h. Following treatment, myc-Atg13 immunoprecipitate was isolated from cells and the amounts of GFP-p62 recovered with Atg13 were analyzed by Western blotting. (B) Atg13 interacts p62 under various cellular stresses at endogenous levels. GFP-p62 was transiently transfected into HEK293T cells. 2 days after transfection cells were treated with DPBS, puromycin (10 ug/ml), or CCCP (20 nM) or control DMSO for 3 h. Following treatment, endogenous Atg13 immunoprecipitate was isolated from cells and the amounts of GFP-P62 recovered with Atg13 were analyzed by Western blotting. (C) ULK1 interacts p62 and induces a mobility shift. Myc-P62 was expressed with either HA-tagged ULK1 wild type (wt) or M92A kinase dead mutant (kd) in HEK293T cells. Myc-P62 immunoprecipitate was isolated from cells and its migration pattern and the amounts of ULK1wt or kd recovered with p62 were analyzed by Western blotting. (D) WT MEFs have a higher mobility shift of p62 than ULK1 KO MEFs. Cell lysate was obtained from WT and ULK1 KO MEFs and run on a native gel. p62 migration pattern on SDS-PAGE was analyzed by Western blotting. (E) ULK1 induces phosphorylation of p62. Myc-tagged p62 was expressed with HA- tagged ULK1 wild type (wt) or M92A kinase dead mutant (kd) in HEK293T cells. Myc-p62 and HA-ULK1 were isolated by immunoprecipitation using anti-myc antibody and its migration pattern on SDS-PAGE was analyzed by Western blotting after the immunoprecipitate was treated with or without lambda phosphatase. (F) ULK1 directly phosphorylates p62. p62 purified from bacteria was incubated with purified with enzymatically active ULK1.

The ULK1 complex is known to phosphorylate its interacting proteins such as mTOR, Atg13,

FIP200 and AMPK (Joo et al., 2011; Jung et al., 2009; 2011; Löffler et al., 2011). Knowing that

ULK1 can interact with p62, we wondered whether ULK1 might phosphorylate p62. Indeed, p62 is a phosphorylated protein (Ichimura, Waguri, Sou, & Kageyama, 2013; Linares, Amanchy, &

Diaz-Meco, 2011; Matsumoto et al., 2011). Some of the phosphorylations were shown to regulate the cellular localization and interaction of p62 with polyubiquitin chains and polyubiquitin aggregates (Matsumoto et al., 2011), and other proteins such as Keap-1 (Ichimura et al., 2013). -

To test the possibility, we co-expressed either wild type ULK1 or ULK1 M92A kinase dead mutant together with p62 in HEK293T cells. Consistent with the result above, we found that both wild type and kinase dead ULK1 were immunoprecipitated with p62 (Fig. 16C). Phosphorylated proteins often migrate slowly on SDS-PAGE. We found that the protein band of p62 isolated with ULK1 wild type is shifted upward on SDS-PAGE compared to the band of p62 isolated with

ULK1 kinase dead. The ULK1-dependent mobility shift of p62 band also occurs with endogenous p62 from MEFs (Fig. 16D).

To confirm that the ULK1-dependent mobility shift of the p62 band is due to phosphorylation, we treated the immunoprecipitate containing p62 and ULK1 with lambda phosphatase that can remove every serine or threonine phosphorylation from proteins. The treatment of the immunoprecipitate with lambda phosphatase eliminated the bands that slowly migrated on SDS-

PAGE (Fig. 16E), implying that the band mobility shift might be due to phosphorylation. To determine that ULK1 can phosphorylate 62, we conducted in vitro kinase assay by incubating purified ULK1 kinase and p62 in the presence of 32P-ATP. The incorporation of 32P into p62 was greatly increased in the incubation with ULK1 kinase (Fig. 16F). We also observed that ULK1 autophosphorylation. Combined, these results suggest that ULK1 is a kinase phosphorylating p62. 78

3.3. ULK1 induces p62 phosphorylation at several residues

In order to identify the phosphorylation sites of p62, we isolated p62 by immunoprecipitation from HEK293T cells expressing either ULK1 wild type or its kinase dead mutant. The isolated p62 was resolved on SDS-PAGE (Fig. 17A), and the band corresponding to p62 was isolated from the gel. The isolated gel was subjected to in-gel trypsinization and mass spectrometry (see more details in Materials and Methods). Gel slices containing the protein of interest were then subjected to in-gel tryptic digestion, and resulting peptides were extracted. Mass spectrometry revealed 9 phosphorylation sites, which were detected with p62 from ULK1 wild type-expressing cells but not ULK1 kinase dead-expressing cells. These sites are: Serine 24, Serine 224, Serine

226, Threonine 269, Serine 272, Serine 284, Serine 366, Serine 370, and Serine 407.

It was noteworthy that they are located in the functional domains of p62. Ser24 is in the PB1 domain; Ser224 and Ser226 are in the TRAF6-binding domain; Ser266 is near the Keap1-binding region; Thr269 and Ser272 are near the nuclear localization motif; Ser342 is immediately next to the LIR motif; Ser407 is in the UBA domain. This implies that ULK1 might potentially regulate multiple aspects of p62 in the functional regulation.

To confirm that ULK1 is responsible for the phosphorylation of those sties, we developed polyclonal antibodies directed toward phosphorylated sites of Ser24, Ser224, and Ser342. Among the developed antibodies, we found only the antibody against phospho-Ser342 was able to detect the phosphorylation state that is highly increased by ULK1 (Fig. 17B). The antibody could not detect the phosphorylation when the residue was mutated to alanine. This suggests that ULK1 induces the phosphorylation of S342 in p62 in cells.

Figure 17. In-gel trypsinaztion and kinase assays suggest several potential ULK1 phosphorylation sites of p62. (A) HEK293T cells were co-transfected either ULK1 wild type or its kinase dead mutant together with myc-p62. p62 immunoprecipitates were isolated by using anti-myc antibody. p62 bands (arrows) were isolated were subjected to in-gel tryptic digestion. The peptides were analyzed by mass spectrometry. (B) ULK1 induces the phosphorylation of S342 of p62. HEK293T cells were transfected with either ULK1 wild type or its kinase dead mutant together with p62 wild type or S342/343A mutant. The phosphorylation state of Ser342 of p62 was analyzed by western blotting with use of polyclonal antibodies recognizing phosphorylated Ser342 of p62. The phosphorylation of Ser342 by ULK1 was dramatically reduced in cells expressing ULK1 kinase dead mutant compared to ULK1 wild type. Western blotting with a phospho-specific antibody toward Ser342 assessed the phosphorylation of S342 on p62.

3.4. Mutations in the p62 phosphorylation sites affect its functions

The PB1 domain of p62 is used for oligomerization and aggregation of huntingtin proteins, damaged mitochondria, and other poly-ubiquitinated structures (Bjørkøy et al., 2005; Narendra et al., 2010). Deletion of the PB1 domain abolishes the P62’s recruitment to the autophagosome, and subsequent degradation of poly-ubiquitinated protein aggregates (Itakura & Mizushima,

2011). Knowing that Ser24 is within the PB1 domain, we inquired whether the putative ULK1 phosphorylation site might affect the function of the PB1 domain. To this end, we co-transfected

HeLa cells with either GFP-tagged p62 wild type or its alanine mutant (S24A), along with mCherry-LC3 (Fig. 18A). We found that the S24A mutant-expressing cells showed fewer and smaller GFP-positive p62 puncta compared to wild type-expressing cells, following rapamycin treatment. Furthermore, the S24A mutation drastically suppressed the colocalization of p62 with

LC3 (Fig. 18A). This result suggests that Ser24 phosphorylation might be important for proper p62 puncta formation and colocalization with LC3. Because Ser24 is a potential ULK1 phosphorylation site, this result implies that ULK1 might regulate the oligomerization and colocalization to LC3 of p62.

Figure 18. Putative ULK1 phosphorylations mutants of p62 show functional significance. (A) S24 of p62 is important for p62 punctate formation and localization with LC3. HeLa cells were co-transfected with GFP-p62 and mCherry LC3 and treated with 200nm rapamysin for 4h. Forty-eight hours post transfection, fixed and analyzed. (B) S342/S343 is important for p62 interaction with LC3. HEK293T cells were co-transfected with HA-LC3 and either wild-type myc-p62 or alanine mutant S342/343A myc-p62. Anti-HA immune complexes were assessed for the presence of p62 by Western blotting. (C) p62 KO MEFs expressing S342/343 mutant of p62 show decreased clearance of HTTQ aggregates. p62 KO MEFs were transiently co-transfected with GFP-HTTQ-103 and either mCherry wild-type or S342/343A p62. Twenty four hours post transfection cells were treated with 200 nM rapamycin or DMSO for 48h. Quantitative analysis was done on the number of cells containing GFP-HTTQ-positive structures relative to the total number of mCherry expressing cells for ~50 cells. Data are shown as percentage (mean +/- S.D.) of aggregate containing cells for more than 10 viewing areas.

We also analyzed the functional consequence of S342A mutation that replaces Ser342 with alanine. Ser342 is within the LIR motif of p62. In mouse models, the colocalization of LC3 with p62 was found to be severely reduced when point mutations were introduced into p62

(Ichimura, Kominami, Tanaka, & Komatsu, 2008a). A previous study has shown that LC3 more strongly interacts with p62 under autophagy inducing conditions (Shvets et al., 2011). Since the

ULK1 activity might increase in those conditions, we considered a possibility that the Ser342 phosphorylation might strengthen the interaction between p62 and LC3. This was indeed the case as we found that a higher amount of LC3 was immunoprecipitated from HEK293T cells expressing p62 wild type compared to the cells expressing p62 S342A/S343A mutant (Fig. 18B).

This result supports the possibility that Ser342 phosphorylation by ULK1 might enhance the affinity of interaction between p62 and LC3.

The interaction between p62 and Atg8s are shown to be crucial to the clearance of damaged mitochondria and mutant Huntingtin (Narendra et al., 2010; Pankiv et al., 2007; Schwarten et al.,

2009; Tung et al., 2010). Thus, we examined whether the putative phosphorylation sites at

Ser342/Ser343 would be important for clearance of Huntingtin aggregates. To examine the possibility, we expressed Htt-(Q)103-GFP together with either mCherry-p62 wild type or

S342A/S343A mutant in p62-deficient MEFs. We found that Htt-(Q)103-GFP aggregates were cleared in MEFs expressing p62 wild type in response to rapamycin (Fig. 18c). Such clearance did not occur in MEFs expressing p62 S342A/S343A mutant. This result suggests that the

Ser342/Ser343 phosphorylation of p62 might be important for proper clearance of Huntingtin aggregates. Cumulatively, these results suggest that ULK1 might strengthen the interaction between p62 and LC3 thereby facilitating the clearance of protein aggregates.

3.5. Discussion

A popular model of selective autophagy is that autophagy adaptor proteins like p62 interact with both the polyubiquitin targets and Atg8 proteins, resulting in the autophagic degradation of the polyubiquitinated cargo materials. Prior to my thesis study, p62 was not known to interact with other autophagy proteins. My study revealed that Atg13 and ULK1 are capable of interacting with p62. However, this interaction is not direct. Atg13 and p62 contain an LIR motif that is capable of interacting with various Atg8 homologues. This suggests that Atg8 proteins may mediate the interaction between p62 and Atg13. My study also revealed that the p62-Atg13 interaction is promoted under non-selective and selective autophagy inducing conditions. Thus, when autophagy is activated, Atg8 proteins may bring the ULK1 complex and autophagy adaptor protein p62 together. This result is consistent with the recent reports showing that LIR-mediated interactions are promoted during the autophagy processes (Shvets et al., 2011; Wild et al., 2011).

Since the ULK1 complex is an early participant in the pathway initiating autophagosome formation (Hara et al., 2008; Itakura & Mizushima, 2010; Karanasios et al., 2013; Roach, 2011;

Russell et al., 2013), the interaction may act to direct the ULK1 complex to localize to polyubiquitinated protein/organelle aggregates that are decorated with p62 (Clausen et al., 2010;

Filimonenko et al., 2010).

We also found that p62 is phosphorylated directly by ULK1. Mass spectrometry analysis revealed multiple phosphorylation sites of p62, which were detected only in ULK1 active cells (Fig. 19).

Further validation of those phosphorylation sites reveled that phosphorylation of Ser342 is dependent on ULK1 kinase activity. However, in vitro kinase assay using phospho-antibodies toward Ser342 reveal that S342 on p62 is not directly phosphorylated by ULK1 (data not shown).

It is possible that phosphorylation of Ser342 may be indirectly mediated by ULK1. The validation of Ser24 and Ser224 as true phosphorylation sites mediated by ULK1 remains inconclusive due to 85 poor quality of antibodies developed toward their phosphorylation states. Further studies are needed to confirm that the phosphorylations are genuine ULK1-mediated sites.

Figure 19. Potential ULK1 phosphorylation sites on p62 functional domains. ULK1 Phosphorylation sites of p62 identified by mass spectrometry are mapped along with the functional domains. Potential influences that ULK1 phosphorylations might exert on p62 functions are depicted with arrows.

Despite the unresolved issues with regards to the ULK1-dependent phosphorylations of the identified sites, my mutagenesis study revealed that Ser24 and Ser342/Ser343 are important residues for p62 functions. We found that S24A mutation suppressed the formation of p62 puncta and colocalization with LC3. If Ser24 is the site phosphorylated by ULK1, the result would suggest that ULK1 might regulate p62 puncta formation through phosphorylation of Ser24 in the

PB1 domain. We also found that the residues S342/S343, in the LIR motif of p62, are important for interacting with LC3 and clearance of Huntingtin aggregates. This result implies a possibility that ULK1 phosphorylation of p62 at those sites might enhance the affinity of p62 binding towards LC3 thereby facilitating the clearance of Huntingtin protein aggregates. This is not the first finding showing that phosphorylation at a residue in a LIR motif increases the binding to

Atg8s. A similar result was reported with OPTN, an autophagy adaptor protein, which has a LIR.

A recent study showed that phosphorylation at a residue in the LIR motif by TBK1 increased the affinity of OPTN towards LC3 (Wild et al., 2011). Note that selective autophagy depends on the interaction between the LIR motif and ATG8 homologs that are attached to the inner membrane of the autophagosome (Birgisdottir et al., 2013; Kirkin, Lamark, Johansen, & Dikic, 2009a;

Kirkin, Lamark, Sou, Bjørkøy, Nunn, et al., 2009b). However, the LIR motif by itself is not sufficient for recruiting cargo to the inner surface of the autophagosome (Itakura & Mizushima,

2010). Selective autophagy mediated by p62 also depends on its PB1 domain, UBA domain, and

LIR motif. Knowing that the identified phosphorylation sites are spread over p62 domains, we could speculate that ULK1 might regulate multiple aspects of p62 functions. It appears that p62 functions are regulated by multiple phosphorylations mediated by not only ULK1 but also by other kinases. A recent study showed that direct phosphorylation at serine 403 in the UBA domain of p62 by casein kinase 2 enhances the binding to ubiquitin chains, which promotes the selective degradation of ubiquitinated structures (Matsumoto et al., 2011). Our mass spectrometry data identified Ser407 in the UBA domain as a possible ULK1 phosphorylation site, 87 implying a possibility that ULK1 might also regulate the function of p62 to interact with polyubiquitinated proteins.

p62 is a known autophagy substrate, and involved in the autophagic selective removal of poly ubiquitinated protein/organelle aggregates. However, accumulating evidence indicates that p62 is involved in an antagonist pathway to autophagy induction. p62 was found to be necessary for activation of mTORC1 in response to amino acids (Duran, Amanchy, Linares, Joshi, & Abu-

Baker, 2011). It was also shown that p62 interacts with TRAF6, which is required for mTORC1 translocation to the lysosome and its subsequent activation (Linares, Duran, Yajima, Pasparakis,

& Moscat, 2013). These studies revealed that TRAF6 is recruited to and activates mTORC1 through p62 in amino acid-stimulated cells. Furthermore, TRAF6, through its interaction with p62, suppressed autophagy, and interruption of the interaction increased autophagy. Consistent with the positive regulation of mTORC1 by p62, the absence of p62 in MEFs indeed increased autophagy (Duran et al., 2011).

ULK1 is known to oppose mTORC1 signaling via phosphorylation, and the reverse is also the case (Jung et al., 2009; 2011). Knowing the relation between mTORC1, ULK1 and p62, it is speculative that ULK1 might negatively regulate mTORC1 through phosphorylation and/or degradation of p62. Interestingly, we observed that ULK1 negatively regulates the interaction between TRAF6 and p62 (Fig. 19). Our mass spectrometry identified Ser224 located in the

TRAF6-binding domain. It is attractive to consider that ULK1 might also positively regulate autophagy and negatively regulate mTORC1 through the phosphorylation of p62 at Ser224.

Figure 20. Putative ULK1 kinase activity impedes the interaction between p62 and TRAF6. ULK1 kinase activity impedes the interaction between p62 and TRAF6. HA-tagged ULK1 wt or ULK1 kd were expressed with myc-tagged p62 and flag-tagged TRAF6 in HEK293T cells. Anti- myc immune complexes were assessed for the presence of flag-tagged TRAF6 by Western blotting.

In human HD brains, abnormal accumulation of Huntington proteins in double-membrane structures suggests a defect in the autophagy process (Sarkar & Rubinsztein, 2008; Waelter et al.,

2001). While autophagy might contribute to neuroprotection against accumulation of protein aggregates, as supported by many studies, the mechanisms of autophagic elimination of mutant or disease-causing proteins such as huntingtin remains unclear. My study led to identification of multiple regulatory points, involving phosphorylations and interactions, that might play critical roles in the clearance of such protein aggregates. If any of those regulatory sites is defective in disease conditions, the selective autophagic clearance of protein aggregates might be impaired.

The disease causing mutant proteins might somehow disturb any of the regulatory points to escape from their clearance by autophagy. As a future study, it might be valuable to investigate how the disease-causing mutant proteins affect the molecular events that we identified. My study has made an invaluable contribution to such a study by providing the critical information on the regulatory points as well as the key resources such as antibodies specific to phosphorylated residues.

3.6. Materials and Methods

Antibodies. The following antibodies were used in this study: Anti-ULK1 (sc-10900 and sc-

33182), anti-p62 (sc-28359), anti-Beclin 1 (sc-11427 and sc-10086), anti-Atg14L (sc-164767) and anti-tubulin (sc-12462) from Santa Cruz Biotechnology (Santa Cruz, CA); anti-ULK1

(A7481) from Sigma-Aldrich (St. Louis, MO); anti-myc 9E10 (OP10) from EMD Biosciences

(Darmstadt, Germany); anti-HA (AFC-101P) from Covance (Princeton, NJ); anti-GST antibody

(27457701) from GE Healthcare (Little Chalfont, United Kingdom); anti-Atg14L (M184-3), anti-

GABARAP (M135-3B), and GATE-16 (PM038) from MBL (Nagoya, Japan); anti-ubiquitin 90

(PW8810) from Biomol Res (Plymouth Meeting, PA); ATG13 antibodies were generated as described previously (Jung et al., 2009). AbFrontier generated Phospho-p62 antibodies. The following chemicals were used: rapamycin (553210, EMD Chemicals); puromycin (82595,

Sigma-Aldrich); lambda phosphatase (sc-200312).

DNA Constructs. Mouse and human ULK1 cDNA clones were obtained from Dr. Takahiko

Shimizu and the Katzusa institute, respectively. Human ATG13 homolog cDNAs for three isoforms were obtained from the Katzusa institute (KIAA0652; isoform 1) and the Open

Biosystems (Image# 2961127 and 3936851; Isoforms 2 and 3). ULK1 and Atg13 fragments were obtained by PCR amplification and subcloned into HA- and myc-prk5 vector. The LIR motif mutant of ATG13 was made by using the site-directed mutagenesis kit (Stratagene) using the oligonucleotides: FWD: 5’GACTTTGTTATGGCGGCGTTTAAACCAGCT3’ REV:

5’AGCTGGTTTAAACGCCGCCATAACAAAGTC3’ for Ser24A mutant of P62: FWD: 5’

CGCCGCTTCGCCTTCTGCTGC 3’ REV: 5’ GCAGCAGAAGGCGAAGCGGCG 3’ SER

342/343A mutant of P62: Fwd: 5’ GGACCCATCTGGCTTCAAAAGAAGTGG 3’ Rev: 5’

CCACTTCTTTTGAAGCCAGATGGGTCC 3’ S224Afwd 5’ GGC CCC ACG GCA GAA GCA

GCT TCT GGT CCA TCG 3’ S224A rev 3’ CGA TGG ACC AGA AGC TGC TTC TGC CGT

GGG GCC 5’ S275Afwd 5’ CCC GTC TCT CCA GAG GCT TCC AGC ACA GAG GAG 3’

S275Arev 3’ CTC CTC TGT GCT GGA AGC CTC TGG AGA GAC GGG 5’

Cell culture and transfection. HeLa and MEF cells HEK293T, cells were cultured in DMEM

(Invitrogen) supplemented with 10 % fetal bovine serum, penicillin and streptomycin at 37oC in 5

% CO2. For transient expression, cells were transfected with recombinant DNA by using

FuGENETM 6 (Roche diagnostics) or Lipofectamine 2000 (Life Technologies; Carlsbad, CA)

91 following the manufacturer’s protocol. Cells were harvested 2 day post-transfection for all transient expression experiments..

Co-immunoprecipitation and western blotting. For co-immunprecpititation studies, whole-cell extracts were prepared in buffer containing 40 mM Hepes, pH 7.4, 120 mM NaCl, 1 mM EDTA,

50 mM NaF, 1.5 mM Na3VO4, 10 mM b-glycerophosphate, and 1% Triton X-100 supplemented by protease inhibitors (Roche). Immunoprecipitated proteins were washed four times using lysis buffer, loaded onto either 12% or 8% Tris-glycine gels (Life Technologies), transferred onto immunoblot polyvinylidene difluoride (PVDF) membranes (Bio-Rad; Hercules, CA) and detected with Western blotting detection reagents (Perkin-Elmer; Wellesley, MA).

Protein Purification. The DNA constructs for GST-tagged p62 wild type, and S24A, S224A,

S275A, and S342/343A were cloned into the E. coli expression plasmid pGEX-6P-2 (GE

Healthcare) and introduced into BL21 (DE3) cells (EMD Biosciences). The GST fusion proteins were expressed by induction with 0.1 mM isopropyl-1-thio-b-galatopyranoside for 16 h and purified with glutathione-Sepharose 4B beads according to the manufacturer’s protocol.

Removing the GST tag was achieved with overnight incubation with precision protease (GE

Healthcare).

Microscope Analysis. MEF cells were fixed with 4 % formaldehyde in PBS (phosphate buffered saline) for 15 min, and permeabilized with 0.3 % Triton X-100 for 15 min at room temperature.

Permeabilized cells were incubated in PBS containing 1 % BSA for 30 min and incubated with antibodies for overnight at 4°C. Nuclei were stained with DAPI (4'-6-Diamidino-2-phenylindole,

Invitrogen, D-1306). For immunostaining, myc- or HA-tagged proteins were monitored by use of anti-myc antibody conjugated to Alexa647 fluorescence dye (Cell Signaling, cat# 2233) and anti- 92

HA antibody (Covance, AFC-101P). After the primary antibody binding, cells were incubated with Alexa Flour 488-conjugated anti-muose IgG (Invitrogen, A-11001) and/or Alexa Flour 647- conjugated anti-rabbit IgG (Invitrogen, A-21443). Images from stained cells were obtained using a Deltavision PersonelDV microscope (Applied Precision).

Assay of polyubiquitinated aggregate clearance. MEFs were treated with puromycin

(10ug/mL) for 4h, and then allowed to recover in regular media for 10h. Samples were taken for each time point and immunostained for polyubiquitinated structures. Quantitative analysis on the number of cells containing polyubiquitinated structures relative to the total number of cells (mean

+/- S.D.) was quantitated for 30 cell images.

ULK1 in-vitro kinase assay. In vitro kinase activity of ULK1 toward p62 was preformed by using p62 purified from E. coli. Active ULK1 was purchased for Promega (#U01-11G-10). The in vitro kinase was preformed according to the manufacturers protocol from SignalChem

(Richmond, BC, Canada). As substrates; p62 purified from E. coli was used at 400 ng for each reaction. 32P-labeled p62 and ULK1 were analyzed on SDS-PAGE followed by autoradiogram.

Mutant Huntingtin clearance. In order to assess the clearance of Htt aggregates, cells were co- transfected with Htt-(Q)103-GFP and either empty-mCherry, p62 wild type mCherry, p62

342/343 mCherry. MEFs were fixed after 48 h of rapamycin treatment. 24h following transfection, cells were treated with or without 200nm rapamycin for an additional 48 h. Treated cells were fixed, permeabilized, and stained briefly with DAPI to reveal cell nuclei. The levels and distribution of Htt-GFP and DsRed-LC3 were observed by confocal microscopy. Numbers of cells containing Htt aggregates (green puncta) in Htt-GFP/mCherry double-transfected cells were counted. The percentage of transfected cells with huntingtin aggregates (green) was calculated to 93 denote the efficiency of clearance of Htt in each experimental group. Data are shown as the mean percentage (±S.D.) of Htt aggregate-containing cells from more than 10 viewing areas.

In-gel trypsinization and mass spectrometry. In order to determine the site of phosphorylation by ULK1, we used in-gel trypsinization coupled with mass spectrometry. For this, we co- expressed either wild type ULK1 or ULK1 kinase dead mutant together with p62 in 293T cells and performed a co-immunoprecipitation. Gel slices containing the protein of interest were then subjected to in-gel tryptic digestion, and resulting peptides were extracted. In-gel trypsininaztion was preformed as previously described (Shevchenko, Tomas, Olsen, & Mann, 2007). Following in-gel trypsinization, peptides were subjected to stage tip clean up as previously described

(Rappsilber, Ishihama, & Mann, 2003). The peptide mixtures were then submitted to nLC-MS-

MS, and the resulting mass/charge data were searched against the appropriate NCBI human database. From this analysis, several serine residues in p62 were found to be phosphorylated in samples isolated from cells expressing wild-type ULK1 that were absent in samples isolated from cells expressing kinase dead ULK1.

CHAPTER 4

DISCUSSION

This dissertation study has mainly focused on protein-protein interactions and phosphorylations mediated by the ULK1 complex. I summarized the study into two chapters. The first chapter describes the interaction between the ULK1 complex and GABARAPs. The second chapter describes the study on the interaction between the ULK1 complex and p62 and on the phosphorylations of p62 by ULK1. Our knowledge of the steps in autophagosome formation is still growing. Although it is early, we can hypothesize a working model to explain the mechanisms of autophagy based on the findings from my studies from chapter 2 and chapter 3.

The underlying mechanism behind the ULK1 complex-Atg8 interaction in autophagy is not fully clear at this point. In contribution to this issue, we observed that the Atg13-Atg8 interaction is important for Atg13 puncta formation. It is possible that the Atg8-Atg13 interaction plays a role in tethering Atg13 to the autophagosome. This notion is also supported by the role of the ULK1-

Atg8 interaction in forming ULK1 puncta and its association with autophagosome markers

(Alemu et al., 2012). The purpose for securing the ULK1 complex to the autophagosome surface may ensure the phosphorylation of downstream proteins involved in autophagosome formation.

In support of this idea, I found that the Atg13-Atg8 interaction was important for the phosphorylation of Beclin-1 and Atg14L by ULK1 (Chapter 2, Fig. 13A and B). By enabling

ULK1 to phosphorylate downstream effectors, such as Beclin-1 and Atg14L, the Atg13-Atg8 interaction may contribute to the formation of autophagosomes. Beclin-1 and Atg14L are components of the PIK3C3 lipid kinase, which when activated generates phosphatidyl-inositol-3- phosphate (PI3P) resulting in the recruitment of other autophagy proteins. This process is called nucleation. A recent study reveled that ULK1-mediated phosphorylation of Beclin-1 increases the activity of the PIK3C3 complex (Russell et al., 2013). It is possible that the Atg13-Atg8

95 interaction is crucial for PIK3C3 activity and subsequent generation of PI3P in the nucleation step of autophagosome formation (Fig. 21). It is interesting to speculate whether the ULK1 complex-

Atg8 interaction plays a role in other steps of autophagosome formation. Atg8 proteins are conjugated to growing autophagosomes up until fusion with lysosomes, where Atg8 proteins are removed or degraded (Kabeya et al., 2004; Nakatogawa et al., 2007; Tanida et al., 2004). Given this, it is probable that the ULK1 complex, when secured to the autophagosome surface via LIR interactions, directs autophagosome formation and closure as well (Fig. 21). At this point, there is not enough information to determine when ULK1 complex-Atg8 interactions occur during autophagosome formation. More work has to be done to define the step or steps in which the

Atg13 LIR mutation blocks autophagosome formation. In addition, investigating which ULK1 phosphorylations are LIR mediated also has to be explored to dissect other functions of the ULK1 complex on the autophagosome surface. Another possibility is that the ULK1 complex-Atg8 interaction stimulates the phosphorylation of ULK1. When ULK1 is activated, it autophosphorylates and phosphorylates Atg13 and FIP200 to promote autophagy (Ganley et al.,

2009; Hara et al., 2008; Hosokawa, Hara, et al., 2009a; Jung et al., 2009). Atg8 proteins may aggregate ULK1 complexes to the surface of the autophagosome, resulting in a chain of ULK1 complex phosphorylations that stimulate autophagosome formation. Overall, discovering that the

LIR motif of ATG13 is important for anchoring the ULK complex, and subsequent phosphorylation of downstream targets leads us to look for additional events regulated by the

ULK complex on the growing autophagosome.

Figure 21. Securing the ULK complex to the autophagosome surface may direct autophagosome development. Activated ULK complexes are anchored to the autophagosome through LIR interactions. Beclin-1 and Atg14L (part of PIK3C3) are involved in autophagosome nucleation, and are phosphorylated by ULK1 in a LIR-dependent manner. The anchored ULK1 complex may promote elongation/closure of the autophagosome through phosphorylation of unknown targets. Image modified from (Kijanska & Peter, 2013).

There are several questions that remain to be answered from my study in Chapter 2. My study could not clearly address the functional consequence of the differential binding of Atg13 towards

GABARAPs/GATE-16 and LC3s. Although disruption of the Atg13-GABARAP interaction hindered autophagosome formation and kinase activity of the ULK1 complex, we do not clearly understand how this occurs. Insight could be gained from previous findings of

GABARAP/GATE-16 involvement in autophagosome biogenesis. Previous knockdown studies reveal that the LC3 family is involved in autophagosome elongation, where as the

GABARAP/GATE-16 family is involved in autophagosome sealing (Weidberg et al., 2010). We found that disruption of the Atg13-GABARAP/GATE-16 interaction hinders ULK1-mediated phosphorylation of Beclin-1, an earlier event in autophagy that precedes autophagosome closure

(Russell et al., 2013). This implies that there are unknown functions of the GABARAP/GATE-16 subfamily in autophagosome biogenesis. Another line of evidence shows that the

GABARAP/GATE-16 family members are colocalized to autophagosomes together with LC3

(Kabeya et al., 2004). This suggests that the GABARAP/GATE-16 proteins might be localized to the autophagosome prior to the membrane sealing. Therefore, it is conceivable that

GABARAP/GATE-16 proteins might participate in early steps of the autophagosome formation via interacting with the ULK1 complex. Understanding the differential functions of

GABARAP/GATE-16 family members and the LC3 family members may be important for our comprehensive knowledge on the mechanism of the autophagosome formation.

The GABARAP/GATE-16 subfamily consists of GABARAP, GABARAPL1, GATE16 and

GABARAPL3. Whether they have specific or redundant functions in autophagy processes is poorly understood. My thesis work provides a hint on their specific functions. We found that the interaction of GABARAP, but not GATE-16, with Atg13 is up-regulated by cellular stress 98 causing protein aggregation or mitochondrial damages (Chapter 2, Fig. 7B and C). This result suggests that GABARAP might have a specific function related to the clearance of polyubiquitinated protein aggregates or damaged mitochondria. Supportive of this notion,

GABARAP, but not other family members, have been implicated, to play an important role for mitophagy (Schwarten et al., 2009). The different members of the GABARAP/GATE-16 family might play specific roles in directing different degradation-destined targets to the core autophagy machinery. Exploration of this possible system will lend great insights into the mechanisms governing selective autophagy.

In contribution to our understanding of selective autophagy, this study has opened up many possible roles for the interaction between the ULK1 complex and autophagy adaptor p62. p62 is an important interface between cargo and autophagy machinery. Prior to this study, the only known autophagy proteins p62 interacted with were Atg8s. This interaction is part of a widely accepted model, where p62 and its cargo are recruited to the autophagosome for degradation through Atg8 interactions (N. N. Noda et al., 2008; Pankiv et al., 2007; Tung et al., 2010). The

ULK1 complex-p62 interaction suggests that autophagy adaptor proteins may communicate with additional autophagy machinery and is involved in other steps of autophagy. Our study shows that Atg13 and P62 interact only under conditions where autophagy is induced. In agreement with this, another study has shown that p62 localizes with ULK1 upon amino acid starvation (Itakura

& Mizushima, 2011). This suggests that autophagy induction promotes underlying mechanisms that bring the ULK1-complex and p62 together. The ULK1 complex and p62 contain LIRs; it is possible that under stimulation of autophagy, Atg8 proteins mediate the interaction. Under amino acid starvation, ULK1 kinase is activated, and Atg8 proteins are conjugated to lipids. Whether either of these activities leads to the increase of the ULK1 complex-p62 interaction remains to be studied.

Our study revealed that the through the ULK1 complex-p62 association, p62 is directly phosphorylated by ULK1. Mass Spectrometry revealed several phosphorylation sites in functional domains of p62. Through these various domains, p62 participates in the selective removal of cargo, and in mTORC1 signaling that directly opposes autophagy (Duran et al., 2011;

Kirkin, Lamark, Johansen, & Dikic, 2009a; Nakamura et al., 2010). As discussed in Chapter 3,

ULK1 phosphorylation of p62 could be involved in selective autophagy (Chapter 3, Fig. 18), or in regulation that promotes autophagy (Chapter 3, Fig. 20). Recent studies show that P62 can act as a negative regulator of autophagy (Duran et al., 2011; Ichimura et al., 2013; Linares et al.,

2013). During initial autophagy induction, P62 association and phosphorylation by ULK1 may be to amplify the autophagy signal. Through p62, ULK1 kinase activity could have additional routes in promoting autophagy. Phosphorylation of p62’s TRAF6 binding domain could interrupt the interaction p62-TRAF6 binding, resulting in relief of autophagy inhibition. In support of this notion we found that overexpression of wild type ULK1 inhibits the p62-TRAF6 interaction.

(Chapter 3, Fig. 20). Also, phosphorylation of p62 could increase p62 affinity towards Atg8 proteins (Chapter 3, Fig. 18), which leads to p62 degradation. This would result in smaller protein levels of p62, thus relieving the cell of mTORC1 signaling that inhibits autophagy.

Another aspect to be looked into is where the phosphorylation events occur. ULK1, p62, and

Atg8 proteins are recruited to the autophagosome upon autophagy induction (Alemu et al., 2012;

Kabeya et al., 2004; Pankiv et al., 2007; Weidberg et al., 2010). Both ULK1 and P62’s recruitment to the autophagosome depends on the interaction with p62. It is conceivable that

Atg8s may also mediate the phosphorylation of p62. As we found in Chapter 2, the LIR motif of

Atg13 is important for directing ULK1 to its phosphorylation targets (Chapter 2, Fig. 13). Atg8 proteins may also mediate ULK1 phosphorylation of p62. p62 is an important interface between cargo and autophagy machinery. Understanding how

100 autophagy machinery and p62 communicate could lend great insight into the pathophysiology of neurodegenerative diseases. Discovering the link between ULK complex and p62 is great contribution toward this topic. Dissecting the p62 phosphorylation events mediated by ULK1 will yield understanding of p62 function, and ultimately clearance of disease associated proteins and damaged organelles.

Over the years, a growing number of studies revealed the significance of autophagy in human health (English, Chemali, Duron, & Rondeau, 2009; Gozuacik & Kimchi, 2004; Narendra et al.,

2008; Orvedahl, MacPherson, Sumpter, & Tallóczy, 2010; Sarkar & Rubinsztein, 2008; Thurston et al., 2009; Yuk et al., 2012). Despite the recent progress in the field, we still need more detailed information on the mechanism and regulation of autophagy, the fundamentally important cellular process. Adding to this body of knowledge, the culmination of my work portrays the ULK1 complex as a crucial mediator of autophagy at multiple steps through its various interacting partners. Overall, my study has established multiple key regulatory points in the autophagy pathway, thereby lending important insight to the mechanisms that govern the autophagy processes. Such regulatory points might serve as markers for autophagy assays or as targets for manipulation of autophagy pathways.

101

Bibliography

Alemu, E. A., Lamark, T., Torgersen, K. M., Birgisdottir, A. B., Larsen, K. B., Jain, A., et al. (2012). ATG8 family proteins act as scaffolds for assembly of the ULK complex: sequence requirements for LC3-interacting region (LIR) motifs. The Journal of biological chemistry, 287(47), 39275–39290. doi:10.1074/jbc.M112.378109 Alers, S., Löffler, A. S., Paasch, F., Dieterle, A. M., Keppeler, H., Lauber, K., et al. (2011). Atg13 and FIP200 act independently of Ulk1 and Ulk2 in autophagy induction. Autophagy, 7(12), 1423–1433. Alers, S., Löffler, A. S., Wesselborg, S., & Stork, B. (2012). The incredible ULKs. Cell communication and signaling : CCS, 10(1), 7. doi:10.1186/1478-811X-10-7 Axe, E. L., Walker, S. A., Manifava, M., Chandra, P., Roderick, H. L., Habermann, A., et al. (2008). Autophagosome formation from membrane compartments enriched in phosphatidylinositol 3-phosphate and dynamically connected to the endoplasmic reticulum. The Journal of cell biology, 182(4), 685–701. doi:10.1083/jcb.200803137 Babu, J. R., & Seibenhener, M. L. (2008). Genetic inactivation of p62 leads to accumulation of hyperphosphorylated tau and neurodegeneration. Journal of …. Bellot, G., Garcia-Medina, R., & Gounon, P. (2009). Hypoxia-induced autophagy is mediated through hypoxia-inducible factor induction of BNIP3 and BNIP3L via their BH3 domains. … and Cellular Biology. Birgisdottir, Å. B., Lamark, T., & Johansen, T. (2013). The LIR motif–crucial for selective autophagy. Journal of cell science. Bjørkøy, G., Lamark, T., Brech, A., Outzen, H., Perander, M., Øvervatn, A., et al. (2005). p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. The Journal of cell biology, 171(4), 603–614. doi:10.1083/jcb.200507002 Cermak, T., Doyle, E. L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., et al. (2011). Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic acids research, 39(12), e82. doi:10.1093/nar/gkr218 Chan, E. Y. W., Longatti, A., McKnight, N. C., & Tooze, S. A. (2009). Kinase-inactivated ULK proteins inhibit autophagy via their conserved C-terminal domains using an Atg13- independent mechanism. Molecular and Cellular Biology, 29(1), 157–171. doi:10.1128/MCB.01082-08 Chang, Y.-Y., & Neufeld, T. P. (2009). An Atg1/Atg13 complex with multiple roles in TOR- mediated autophagy regulation. Molecular biology of the cell, 20(7), 2004–2014. doi:10.1091/mbc.E08-12-1250 Chen, C., Li, J.-G., Chen, Y., Huang, P., Wang, Y., & Liu-Chen, L.-Y. (2006). GEC1 interacts with the kappa opioid receptor and enhances expression of the receptor. The Journal of biological chemistry, 281(12), 7983–7993. doi:10.1074/jbc.M509805200 Cheong, H., Lindsten, T., Wu, J., Lu, C., & Thompson, C. B. (2011). Ammonia-induced autophagy is independent of ULK1/ULK2 kinases. Proceedings of the National Academy of Sciences of the United States of America, 108(27), 11121–11126. doi:10.1073/pnas.1107969108 Clausen, T. H., Lamark, T., Isakson, P., & Finley, K. D. (2010). p62/SQSTM1 and ALFY interact to facilitate the formation of p62 bodies/ALIS and their degradation by autophagy. …. Coyle, J. E., Qamar, S., Rajashankar, K. R., & Nikolov, D. B. (2002). Structure of GABARAP in two conformations: implications for GABA(A) receptor localization and tubulin binding. Neuron, 33(1), 63–74. 102

DE DUVE, C. (1963). The lysosome. Scientific American, 208, 64–72. Deosaran, E., Larsen, K. B., Hua, R., & Sargent, G. (2013). NBR1 acts as an autophagy receptor for peroxisomes. Journal of cell …. Di Bartolomeo, S., Corazzari, M., Nazio, F., Oliverio, S., Lisi, G., Antonioli, M., et al. (2010). The dynamic interaction of AMBRA1 with the dynein motor complex regulates mammalian autophagy. The Journal of cell biology, 191(1), 155–168. doi:10.1083/jcb.201002100 Dunlop, E. A., Hunt, D. K., Acosta-Jaquez, H. A., Fingar, D. C., & Tee, A. R. (2011). ULK1 inhibits mTORC1 signaling, promotes multisite Raptor phosphorylation and hinders substrate binding. Autophagy, 7(7), 737–747. Dunn, W. A. (1990). Studies on the mechanisms of autophagy: formation of the autophagic vacuole. The Journal of cell biology, 110(6), 1923–1933. Duran, A., Amanchy, R., Linares, J. F., Joshi, J., & Abu-Baker, S. (2011). p62 is a key regulator of nutrient sensing in the mTORC1 pathway. Molecular cell. Egan, D. F., Shackelford, D. B., Mihaylova, M. M., Gelino, S., Kohnz, R. A., Mair, W., et al. (2011). Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science (New York, N.Y.), 331(6016), 456–461. doi:10.1126/science.1196371 English, L., Chemali, M., Duron, J., & Rondeau, C. (2009). Autophagy enhances the presentation of endogenous viral antigens on MHC class I molecules during HSV-1 infection. Nature. Fan, W., Tang, Z., Chen, D., Moughon, D., & Ding, X. (2010). Keap1 facilitates p62-mediated ubiquitin aggregate clearance via autophagy. …. Fields, S., & Song, O. (1989). A novel genetic system to detect protein-protein interactions. Nature, 340(6230), 245–246. doi:10.1038/340245a0 Filimonenko, M., Isakson, P., Finley, K. D., Anderson, M., Jeong, H., Melia, T. J., et al. (2010). The selective macroautophagic degradation of aggregated proteins requires the PI3P-binding protein Alfy. Molecular cell, 38(2), 265–279. doi:10.1016/j.molcel.2010.04.007 Fogel, A. I., Dlouhy, B. J., Wang, C., Ryu, S. W., Neutzner, A., Hasson, S. A., et al. (2013). Role of Membrane Association and Atg14-Dependent Phosphorylation in Beclin-1-Mediated Autophagy. Molecular and Cellular Biology, 33(18), 3675–3688. doi:10.1128/MCB.00079- 13 Frank, M., Duvezin-Caubet, S., Koob, S., Occhipinti, A., Jagasia, R., Petcherski, A., et al. (2012). Mitophagy is triggered by mild oxidative stress in a mitochondrial fission dependent manner. Biochimica et Biophysica Acta ( …, 1823(12), 2297–2310. doi:10.1016/j.bbamcr.2012.08.007 Fujita, N., Itoh, T., Omori, H., Fukuda, M., Noda, T., & Yoshimori, T. (2008). The Atg16L complex specifies the site of LC3 lipidation for membrane biogenesis in autophagy. Molecular biology of the cell, 19(5), 2092–2100. doi:10.1091/mbc.E07-12-1257 Funderburk, S. F., Wang, Q. J., & Yue, Z. (2010). The Beclin 1-VPS34 complex--at the crossroads of autophagy and beyond. Trends in cell biology, 20(6), 355–362. doi:10.1016/j.tcb.2010.03.002 Gammoh, N., Florey, O., Overholtzer, M., & Jiang, X. (2013). Interaction between FIP200 and ATG16L1 distinguishes ULK1 complex-dependent and -independent autophagy. Nature structural & molecular biology, 20(2), 144–149. doi:10.1038/nsmb.2475 Ganley, I. G., Lam, D. H., Wang, J., Ding, X., Chen, S., & Jiang, X. (2009). ULK1.ATG13.FIP200 complex mediates mTOR signaling and is essential for autophagy. The Journal of biological chemistry, 284(18), 12297–12305. doi:10.1074/jbc.M900573200 Ganley, I. G., Wong, P.-M., Gammoh, N., & Jiang, X. (2011). Distinct autophagosomal- lysosomal fusion mechanism revealed by thapsigargin-induced autophagy arrest. Molecular cell, 42(6), 731–743. doi:10.1016/j.molcel.2011.04.024 103

Ganote, C. E., & Armstrong, S. C. (2003). Effects of CCCP-induced mitochondrial uncoupling and cyclosporin A on cell volume, cell injury and preconditioning protection of isolated rabbit cardiomyocytes. Journal of molecular and cellular cardiology, 35(7), 749–759. Gao, Z., Gammoh, N., Wong, P.-M., Erdjument-Bromage, H., Tempst, P., & Jiang, X. (2010). Processing of autophagic protein LC3 by the 20S proteasome. Autophagy, 6(1), 126–137. Geisler, S., Holmström, K. M., Skujat, D., & Fiesel, F. C. (2010). PINK1/Parkin-mediated mitophagy is dependent on VDAC1 and p62/SQSTM1. Nature cell …. Goold, R., McKinnon, C., Rabbanian, S., Collinge, J., Schiavo, G., & Tabrizi, S. (2013). Alternative fates of newly formed PrPSc upon prion conversion on the plasma membrane. Journal of cell science. doi:10.1242/jcs.126128 Gozuacik, D., & Kimchi, A. (2004). Autophagy as a cell death and tumor suppressor mechanism. Oncogene. Hailey, D. W., Rambold, A. S., Satpute-Krishnan, P., Mitra, K., Sougrat, R., Kim, P. K., & Lippincott-Schwartz, J. (2010). Mitochondria supply membranes for autophagosome biogenesis during starvation. Cell, 141(4), 656–667. doi:10.1016/j.cell.2010.04.009 Hanada, T., Noda, N. N., Satomi, Y., Ichimura, Y., Fujioka, Y., Takao, T., et al. (2007). The Atg12-Atg5 conjugate has a novel E3-like activity for protein lipidation in autophagy. The Journal of biological chemistry, 282(52), 37298–37302. doi:10.1074/jbc.C700195200 Hanna, R. A., Quinsay, M. N., Orogo, A. M., Giang, K., Rikka, S., & Gustafsson, Å. B. (2012). Microtubule-associated protein 1 light chain 3 (LC3) interacts with Bnip3 protein to selectively remove endoplasmic reticulum and mitochondria via autophagy. The Journal of biological chemistry, 287(23), 19094–19104. doi:10.1074/jbc.M111.322933 Hara, T., Takamura, A., Kishi, C., Iemura, S.-I., Natsume, T., Guan, J.-L., & Mizushima, N. (2008). FIP200, a ULK-interacting protein, is required for autophagosome formation in mammalian cells. The Journal of cell biology, 181(3), 497–510. doi:10.1083/jcb.200712064 He, C., & Klionsky, D. J. (2009). Regulation Mechanisms and Signaling Pathways of Autophagy. Annual Review of Genetics, 43(1), 67–93. doi:10.1146/annurev-genet-102808-114910 He, C., & Levine, B. (2010). The Beclin 1 interactome. Current Opinion in Cell Biology, 22(2), 140–149. doi:10.1016/j.ceb.2010.01.001 Hosokawa, N., Hara, T., Kaizuka, T., Kishi, C., Takamura, A., Miura, Y., et al. (2009a). Nutrient- dependent mTORC1 association with the ULK1-Atg13-FIP200 complex required for autophagy. Molecular biology of the cell, 20(7), 1981–1991. doi:10.1091/mbc.E08-12-1248 Hosokawa, N., Sasaki, T., Iemura, S.-I., Natsume, T., Hara, T., & Mizushima, N. (2009b). Atg101, a novel mammalian autophagy protein interacting with Atg13. Autophagy, 5(7), 973–979. Ichimura, Y., Kominami, E., Tanaka, K., & Komatsu, M. (2008a). Selective turnover of p62/A170/SQSTM1 by autophagy. Autophagy, 4(8), 1063–1066. Ichimura, Y., Kumanomidou, T., Sou, Y.-S., Mizushima, T., Ezaki, J., Ueno, T., et al. (2008b). Structural basis for sorting mechanism of p62 in selective autophagy. The Journal of biological chemistry, 283(33), 22847–22857. doi:10.1074/jbc.M802182200 Ichimura, Y., Waguri, S., Sou, Y., & Kageyama, S. (2013). Phosphorylation of p62 activates the Keap1-Nrf2 pathway during selective autophagy. Molecular cell. Itakura, E., & Mizushima, N. (2010). Characterization of autophagosome formation site by a hierarchical analysis of mammalian Atg proteins. Autophagy, 6(6), 764–776. Itakura, E., & Mizushima, N. (2011). p62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding. The Journal of cell biology. Itakura, E., Kishi, C., Inoue, K., & Mizushima, N. (2008). Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Molecular biology of the cell, 19(12), 5360–5372. doi:10.1091/mbc.E08-01-0080 104

Itakura, E., Kishi-Itakura, C., Koyama-Honda, I., & Mizushima, N. (2012). Structures containing Atg9A and the ULK1 complex independently target depolarized mitochondria at initial stages of Parkin-mediated mitophagy. Journal of cell science, 125(Pt 6), 1488–1499. doi:10.1242/jcs.094110 Jin, S. M., & Youle, R. J. (2013). The accumulation of misfolded proteins in the mitochondrial matrix is sensed by PINK1 to induce PARK2/Parkin-mediated mitophagy of polarized mitochondria. Autophagy, 9(11), 1750–1757. doi:10.4161/auto.26122 Joo, J. H., Dorsey, F. C., Joshi, A., Hennessy-Walters, K. M., Rose, K. L., McCastlain, K., et al. (2011). Hsp90-Cdc37 chaperone complex regulates Ulk1- and Atg13-mediated mitophagy. Molecular cell, 43(4), 572–585. doi:10.1016/j.molcel.2011.06.018 Jung, C. H., Jun, C. B., Ro, S.-H., Kim, Y.-M., Otto, N. M., Cao, J., et al. (2009). ULK-Atg13- FIP200 complexes mediate mTOR signaling to the autophagy machinery. Molecular biology of the cell, 20(7), 1992–2003. doi:10.1091/mbc.E08-12-1249 Jung, C. H., Ro, S.-H., Cao, J., Otto, N. M., & Kim, D.-H. (2010). mTOR regulation of autophagy. FEBS letters, 584(7), 1287–1295. doi:10.1016/j.febslet.2010.01.017 Jung, C. H., Seo, M., Otto, N. M., & Kim, D.-H. (2011). ULK1 inhibits the kinase activity of mTORC1 and cell proliferation. Autophagy, 7(10), 1212–1221. doi:10.4161/auto.7.10.16660 Kabeya, Y., Mizushima, N., Yamamoto, A., Oshitani-Okamoto, S., Ohsumi, Y., & Yoshimori, T. (2004). LC3, GABARAP and GATE16 localize to autophagosomal membrane depending on form-II formation. Journal of cell science, 117(Pt 13), 2805–2812. doi:10.1242/jcs.01131 Kalchman, M. A., Graham, R. K., Xia, G., & Koide, H. B. (1996). Huntingtin is ubiquitinated and interacts with a specific ubiquitin-conjugating enzyme. Journal of Biological …. Karanasios, E., Stapleton, E., Manifava, M., Kaizuka, T., Mizushima, N., Walker, S. A., & Ktistakis, N. T. (2013). Dynamic association of the ULK1 complex with omegasomes during autophagy induction. Journal of cell science, 126(Pt 22), 5224–5238. doi:10.1242/jcs.132415 Kijanska, M., & Peter, M. (2013). Atg1 kinase regulates early and late steps during autophagy. Autophagy. Kim, J., Kundu, M., Viollet, B., & Guan, K. L. (2011a). AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nature cell biology. Kim, J., Kundu, M., Viollet, B., & Guan, K.-L. (2011b). AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nature cell biology, 13(2), 132–141. doi:10.1038/ncb2152 Kirisako, T., Ichimura, Y., Okada, H., Kabeya, Y., Mizushima, N., Yoshimori, T., et al. (2000). The reversible modification regulates the membrane-binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to vacuole targeting pathway. The Journal of cell biology, 151(2), 263–276. Kirkin, V., Lamark, T., Johansen, T., & Dikic, I. (2009a). NBR1 co-operates with p62 in selective autophagy of ubiquitinated targets. Autophagy. Kirkin, V., Lamark, T., Sou, Y.-S., Bjørkøy, G., Nunn, J. L., Bruun, J.-A., et al. (2009b). A role for NBR1 in autophagosomal degradation of ubiquitinated substrates. Molecular cell, 33(4), 505–516. doi:10.1016/j.molcel.2009.01.020 Kittler, J. T., Rostaing, P., Schiavo, G., Fritschy, J. M., Olsen, R., Triller, A., & Moss, S. J. (2001). The subcellular distribution of GABARAP and its ability to interact with NSF suggest a role for this protein in the intracellular transport of GABA(A) receptors. Molecular and cellular neurosciences, 18(1), 13–25. doi:10.1006/mcne.2001.1005 Klionsky, D. J. (2005). The molecular machinery of autophagy: unanswered questions. Journal of cell science, 118(Pt 1), 7–18. doi:10.1242/jcs.01620 Komatsu, M., Kominami, E., & Tanaka, K. (2006). Autophagy and neurodegeneration. Autophagy. 105

Korolchuk, V. I., Mansilla, A., Menzies, F. M., & Rubinsztein, D. C. (2009a). Autophagy inhibition compromises degradation of ubiquitin-proteasome pathway substrates. Molecular cell, 33(4), 517–527. doi:10.1016/j.molcel.2009.01.021 Korolchuk, V. I., Menzies, F. M., & Rubinsztein, D. C. (2009b). A novel link between autophagy and the ubiquitin-proteasome system. Autophagy, 5(6), 862–863. Korolchuk, V. I., Menzies, F. M., & Rubinsztein, D. C. (2010). Mechanisms of cross-talk between the ubiquitin-proteasome and autophagy-lysosome systems. FEBS letters, 584(7), 1393–1398. doi:10.1016/j.febslet.2009.12.047 Kouno, T., Mizuguchi, M., Tanida, I., Ueno, T., Kanematsu, T., Mori, Y., et al. (2005). Solution structure of microtubule-associated protein light chain 3 and identification of its functional subdomains. The Journal of biological chemistry, 280(26), 24610–24617. doi:10.1074/jbc.M413565200 Köchl, R., Hu, X. W., Chan, E. Y. W., & Tooze, S. A. (2006). Microtubules facilitate autophagosome formation and fusion of autophagosomes with endosomes. Traffic (Copenhagen, Denmark), 7(2), 129–145. doi:10.1111/j.1600-0854.2005.00368.x Kraft, C., Kijanska, M., Kalie, E., Siergiejuk, E., Lee, S. S., Semplicio, G., et al. (2012). Binding of the Atg1/ULK1 kinase to the ubiquitin-like protein Atg8 regulates autophagy. The EMBO journal, 31(18), 3691–3703. doi:10.1038/emboj.2012.225 Kuma, A., Mizushima, N., Ishihara, N., & Ohsumi, Y. (2002). Formation of the approximately 350-kDa Apg12-Apg5.Apg16 multimeric complex, mediated by Apg16 oligomerization, is essential for autophagy in yeast. The Journal of biological chemistry, 277(21), 18619–18625. doi:10.1074/jbc.M111889200 Kundu, M., Lindsten, T., Yang, C.-Y., Wu, J., Zhao, F., Zhang, J., et al. (2008). Ulk1 plays a critical role in the autophagic clearance of mitochondria and ribosomes during reticulocyte maturation. Blood, 112(4), 1493–1502. doi:10.1182/blood-2008-02-137398 Kuo, T.-C., Chen, C.-T., Baron, D., Onder, T. T., Loewer, S., Almeida, S., et al. (2011). Midbody accumulation through evasion of autophagy contributes to cellular reprogramming and tumorigenicity. Nature cell biology, 13(10), 1214–1223. doi:10.1038/ncb2332 Kuusisto, E., Salminen, A., & Alafuzoff, I. (2001). Ubiquitin-binding protein p62 is present in neuronal and glial inclusions in human tauopathies and synucleinopathies. Neuroreport, 12(10), 2085–2090. Kuznetsov, S. A., & Gelfand, V. I. (1987). 18 kDa microtubule-associated protein: identification as a new light chain (LC-3) of microtubule-associated protein 1 (MAP-1). FEBS letters, 212(1), 145–148. Kwon, K.-Y., Viollet, B., & Yoo, O. J. (2011). CCCP induces autophagy in an AMPK- independent manner. Biochemical and biophysical research communications, 416(3-4), 343– 348. doi:10.1016/j.bbrc.2011.11.038 Lamark, T., & Johansen, T. (2012). Aggrephagy: selective disposal of protein aggregates by macroautophagy. International journal of cell biology, 2012, 736905. doi:10.1155/2012/736905 Lamark, T., Kirkin, V., Dikic, I., & Johansen, T. (2009). NBR1 and p62 as cargo receptors for selective autophagy of ubiquitinated targets. Cell Cycle. Lamark, T., Perander, M., Outzen, H., Kristiansen, K., Øvervatn, A., Michaelsen, E., et al. (2003). Interaction codes within the family of mammalian Phox and Bem1p domain- containing proteins. The Journal of biological chemistry, 278(36), 34568–34581. doi:10.1074/jbc.M303221200 Lang, T., Schaeffeler, E., Bernreuther, D., Bredschneider, M., Wolf, D. H., & Thumm, M. (1998). Aut2p and Aut7p, two novel microtubule-associated proteins are essential for delivery of autophagic vesicles to the vacuole. The EMBO journal, 17(13), 3597–3607. 106

doi:10.1093/emboj/17.13.3597 Lee, J. W., Park, S., Takahashi, Y., & Wang, H.-G. (2010). The association of AMPK with ULK1 regulates autophagy. PloS one, 5(11), e15394. doi:10.1371/journal.pone.0015394 Legesse-Miller, A., Sagiv, Y., Porat, A., & Elazar, Z. (1998). Isolation and characterization of a novel low molecular weight protein involved in intra-Golgi traffic. The Journal of biological chemistry, 273(5), 3105–3109. Lemasters, J. J. (2005). Selective mitochondrial autophagy, or mitophagy, as a targeted defense against oxidative stress, mitochondrial dysfunction, and aging. Rejuvenation research. Levine, B., & Kroemer, G. (2008). Autophagy in the pathogenesis of disease. Cell, 132(1), 27– 42. doi:10.1016/j.cell.2007.12.018 Lin, S.-Y., Li, T. Y., Liu, Q., Zhang, C., Li, X., Chen, Y., et al. (2012). GSK3-TIP60-ULK1 signaling pathway links growth factor deprivation to autophagy. Science (New York, N.Y.), 336(6080), 477–481. doi:10.1126/science.1217032 Linares, J. F., Amanchy, R., & Diaz-Meco, M. T. (2011). Phosphorylation of p62 by cdk1 controls the timely transit of cells through mitosis and tumor cell proliferation. Molecular and cellular …. Linares, J. F., Duran, A., Yajima, T., Pasparakis, M., & Moscat, J. (2013). K63 polyubiquitination and activation of mTOR by the p62-TRAF6 complex in nutrient-activated cells. Molecular cell. Liu, Lei, Feng, D., Chen, G., Chen, M., Zheng, Q., Song, P., et al. (2012). Mitochondrial outer- membrane protein FUNDC1 mediates hypoxia-induced mitophagy in mammalian cells. Nature cell biology, 14(2), 177–185. doi:10.1038/ncb2422 Loos, B., Engelbrecht, A.-M., Lockshin, R. A., Klionsky, D. J., & Zakeri, Z. (2013). The variability of autophagy and cell death susceptibility: Unanswered questions. Autophagy, 9(9), 1270–1285. doi:10.4161/auto.25560 Löffler, A. S., Alers, S., Dieterle, A. M., Keppeler, H., Franz-Wachtel, M., Kundu, M., et al. (2011). Ulk1-mediated phosphorylation of AMPK constitutes a negative regulatory feedback loop. Autophagy, 7(7), 696–706. Mack, H. I. D., Zheng, B., Asara, J. M., & Thomas, S. M. (2012). AMPK-dependent phosphorylation of ULK1 regulates ATG9 localization. Autophagy, 8(8), 1197–1214. doi:10.4161/auto.20586 Mann, S. S., & Hammarback, J. A. (1994). Molecular characterization of light chain 3. A microtubule binding subunit of MAP1A and MAP1B. The Journal of biological chemistry, 269(15), 11492–11497. Matsumoto, G., Wada, K., Okuno, M., & Kurosawa, M. (2011). Serine 403 phosphorylation of p62/SQSTM1 regulates selective autophagic clearance of ubiquitinated proteins. Molecular cell. McEwan, D. G., & Dikic, I. (2011). The Three Musketeers of Autophagy: phosphorylation, ubiquitylation and acetylation. Trends in cell biology, 21(4), 195–201. doi:10.1016/j.tcb.2010.12.006 Meijer, W. H., van der Klei, I. J., Veenhuis, M., & Kiel, J. A. K. W. (2007). ATG genes involved in non-selective autophagy are conserved from yeast to man, but the selective Cvt and pexophagy pathways also require organism-specific genes. Autophagy, 3(2), 106–116. Mercer, C. A., Kaliappan, A., & Dennis, P. B. (2009). A novel, human Atg13 binding protein, Atg101, interacts with ULK1 and is essential for macroautophagy. Autophagy, 5(5), 649– 662. Mizushima, N., Kuma, A., Kobayashi, Y., Yamamoto, A., Matsubae, M., Takao, T., et al. (2003). Mouse Apg16L, a novel WD-repeat protein, targets to the autophagic isolation membrane with the Apg12-Apg5 conjugate. Journal of cell science, 116(Pt 9), 1679–1688. 107

Mizushima, N., Levine, B., Cuervo, A. M., & Klionsky, D. J. (2008). Autophagy fights disease through cellular self-digestion. Nature, 451(7182), 1069–1075. doi:10.1038/nature06639 Mizushima, N., Noda, T., & Ohsumi, Y. (1999). Apg16p is required for the function of the Apg12p-Apg5p conjugate in the yeast autophagy pathway. The EMBO journal, 18(14), 3888–3896. doi:10.1093/emboj/18.14.3888 Moreau, K., Ravikumar, B., Renna, M., Puri, C., & Rubinsztein, D. C. (2011). Autophagosome precursor maturation requires homotypic fusion. Cell, 146(2), 303–317. doi:10.1016/j.cell.2011.06.023 Mori, F., Tanji, K., Odagiri, S., Toyoshima, Y., Yoshida, M., Kakita, A., et al. (2012). Autophagy-related proteins (p62, NBR1 and LC3) in intranuclear inclusions in neurodegenerative diseases. Neuroscience letters, 522(2), 134–138. doi:10.1016/j.neulet.2012.06.026 Nair, U., Cao, Y., Xie, Z., & Klionsky, D. J. (2010). Roles of the lipid-binding motifs of Atg18 and Atg21 in the cytoplasm to vacuole targeting pathway and autophagy. The Journal of biological chemistry, 285(15), 11476–11488. doi:10.1074/jbc.M109.080374 Nair, U., Jotwani, A., Geng, J., Gammoh, N., Richerson, D., Yen, W.-L., et al. (2011). SNARE proteins are required for macroautophagy. Cell, 146(2), 290–302. doi:10.1016/j.cell.2011.06.022 Nakamura, K., Kimple, A. J., Siderovski, D. P., & Johnson, G. L. (2010). PB1 domain interaction of p62/sequestosome 1 and MEKK3 regulates NF-kappaB activation. The Journal of biological chemistry, 285(3), 2077–2089. doi:10.1074/jbc.M109.065102 Nakatogawa, H., Ichimura, Y., & Ohsumi, Y. (2007). Atg8, a ubiquitin-like protein required for autophagosome formation, mediates membrane tethering and hemifusion. Cell, 130(1), 165– 178. doi:10.1016/j.cell.2007.05.021 Nakatogawa, H., Ohbayashi, S., Sakoh-Nakatogawa, M., Kakuta, S., Suzuki, S. W., Kirisako, H., et al. (2012). The Autophagy-related Protein Kinase Atg1 Interacts with the Ubiquitin-like Protein Atg8 via the Atg8 Family Interacting Motif to Facilitate Autophagosome Formation. The Journal of biological chemistry, 287(34), 28503–28507. doi:10.1074/jbc.C112.387514 Nakatogawa, H., Suzuki, K., Kamada, Y., & Ohsumi, Y. (2009). Dynamics and diversity in autophagy mechanisms: lessons from yeast. Nature reviews. Molecular cell biology, 10(7), 458–467. doi:10.1038/nrm2708 Narendra, D., Kane, L. A., Hauser, D. N., Fearnley, I. M., & Youle, R. J. (2010). p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not mitophagy; VDAC1 is dispensable for both. Autophagy, 6(8), 1090–1106. doi:10.4161/auto.6.8.13426 Narendra, D., Tanaka, A., Suen, D.-F., & Youle, R. J. (2008). Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. The Journal of cell biology, 183(5), 795–803. doi:10.1083/jcb.200809125 Nazio, F., Strappazzon, F., Antonioli, M., Bielli, P., Cianfanelli, V., Bordi, M., et al. (2013). mTOR inhibits autophagy by controlling ULK1 ubiquitylation, self-association and function through AMBRA1 and TRAF6. Nature cell biology, 15(4), 406–416. doi:10.1038/ncb2708 Noda, N. N., Kumeta, H., Nakatogawa, H., Satoo, K., Adachi, W., Ishii, J., et al. (2008). Structural basis of target recognition by Atg8/LC3 during selective autophagy. Genes to Cells, 13(12), 1211–1218. doi:10.1111/j.1365-2443.2008.01238.x Novak, I., Kirkin, V., McEwan, D. G., Zhang, J., Wild, P., Rozenknop, A., et al. (2010). Nix is a selective autophagy receptor for mitochondrial clearance. EMBO reports, 11(1), 45–51. doi:10.1038/embor.2009.256 O'Sullivan, G. A., Kneussel, M., Elazar, Z., & Betz, H. (2005). GABARAP is not essential for GABA receptor targeting to the synapse. The European journal of neuroscience, 22(10), 2644–2648. doi:10.1111/j.1460-9568.2005.04448.x 108

Okazaki, N., Yan, J., Yuasa, S., Ueno, T., Kominami, E., Masuho, Y., et al. (2000). Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain research. Molecular brain research, 85(1-2), 1–12. Orsi, A., Razi, M., Dooley, H. C., Robinson, D., Weston, A. E., Collinson, L. M., & Tooze, S. A. (2012). Dynamic and transient interactions of Atg9 with autophagosomes, but not membrane integration, are required for autophagy. Molecular biology of the cell, 23(10), 1860–1873. doi:10.1091/mbc.E11-09-0746 Orvedahl, A., MacPherson, S., Sumpter, R., Jr, & Tallóczy, Z. (2010). Autophagy protects against Sindbis virus infection of the central nervous system. Cell host & …. Pankiv, S., Alemu, E. A., Brech, A., Bruun, J.-A., Lamark, T., Øvervatn, A., et al. (2010). FYCO1 is a Rab7 effector that binds to LC3 and PI3P to mediate microtubule plus end- directed vesicle transport. The Journal of cell biology, 188(2), 253–269. doi:10.1083/jcb.200907015 Pankiv, S., Clausen, T. H., Lamark, T., & Brech, A. (2007). p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. Journal of Biological …. Pereira, C. (2013). Crosstalk between Endoplasmic Reticulum Stress and Protein Misfolding in Neurodegenerative Diseases. ISRN Cell Biology. Pohl, C., & Jentsch, S. (2008). Midbody ring disposal by autophagy is a post-abscission event of cytokinesis. Nature cell biology. Polson, H. E. J., de Lartigue, J., Rigden, D. J., Reedijk, M., Urbé, S., Clague, M. J., & Tooze, S. A. (2010). Mammalian Atg18 (WIPI2) localizes to omegasome-anchored phagophores and positively regulates LC3 lipidation. Autophagy, 6(4), 506–522. doi:10.4161/auto.6.4.11863 Rabinowitz, J. D., & White, E. (2010). Autophagy and metabolism. Science (New York, N.Y.). Rahrmann, E. P., Watson, A. L., Keng, V. W., Choi, K., Moriarity, B. S., Beckmann, D. A., et al. (2013). Forward genetic screen for malignant peripheral nerve sheath tumor formation identifies new genes and pathways driving tumorigenesis. Nature genetics, 45(7), 756–766. doi:10.1038/ng.2641 Rappsilber, J., Ishihama, Y., & Mann, M. (2003). Stop and go extraction tips for matrix-assisted laser desorption/ionization, nanoelectrospray, and LC/MS sample pretreatment in proteomics. Analytical chemistry. Ravikumar, B., Moreau, K., Jahreiss, L., Puri, C., & Rubinsztein, D. C. (2010). Plasma membrane contributes to the formation of pre-autophagosomal structures. Nature cell biology, 12(8), 747–757. doi:10.1038/ncb2078 Roach, P. J. (2011). AMPK→ ULK1→ Autophagy. Molecular and Cellular Biology. Russell, R. C., Tian, Y., Yuan, H., Park, H. W., Chang, Y.-Y., Kim, J., et al. (2013). ULK1 induces autophagy by phosphorylating Beclin-1 and activating VPS34 lipid kinase. Nature cell biology, 15(7), 741–750. doi:10.1038/ncb2757 Sagiv, Y., Legesse-Miller, A., Porat, A., & Elazar, Z. (2000). GATE-16, a membrane transport modulator, interacts with NSF and the Golgi v-SNARE GOS-28. The EMBO journal, 19(7), 1494–1504. doi:10.1093/emboj/19.7.1494 Sarkar, S., & Rubinsztein, D. C. (2008). Huntington's disease: degradation of mutant huntingtin by autophagy. FEBS Journal. Schwarten, M., Mohrlüder, J., Ma, P., Stoldt, M., Thielmann, Y., Stangler, T., et al. (2009). Nix directly binds to GABARAP: a possible crosstalk between apoptosis and autophagy. Autophagy, 5(5), 690–698. Seibenhener, M. L., Babu, J. R., & Geetha, T. (2004). Sequestosome 1/p62 is a polyubiquitin chain binding protein involved in ubiquitin proteasome degradation. … and Cellular Biology. 109

Shaid, S., Brandts, C. H., Serve, H., & Dikic, I. (2012). Ubiquitination and selective autophagy. Cell death and differentiation. Shang, L., Chen, S., Du, F., Li, S., Zhao, L., & Wang, X. (2011). Nutrient starvation elicits an acute autophagic response mediated by Ulk1 dephosphorylation and its subsequent dissociation from AMPK. Proceedings of the National Academy of Sciences of the United States of America, 108(12), 4788–4793. doi:10.1073/pnas.1100844108 Shevchenko, A., Tomas, J. H., Olsen, J. V., & Mann, M. (2007). In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nature protocols. Shin, Y., Klucken, J., Patterson, C., Hyman, B. T., & McLean, P. J. (2005). The co-chaperone carboxyl terminus of Hsp70-interacting protein (CHIP) mediates alpha-synuclein degradation decisions between proteasomal and lysosomal pathways. The Journal of biological chemistry, 280(25), 23727–23734. doi:10.1074/jbc.M503326200 Shpilka, T., Weidberg, H., Pietrokovski, S., & Elazar, Z. (2011). Atg8: an autophagy-related ubiquitin-like protein family. Genome biology, 12(7), 226. doi:10.1186/gb-2011-12-7-226 Shvets, E., Abada, A., Weidberg, H., & Elazar, Z. (2011). Dissecting the involvement of LC3B and GATE-16 in p62 recruitment into autophagosomes. Autophagy, 7(7), 683–688. doi:10.4161/auto.7.7.15279 Sieradzan, K. A., Mechan, A. O., Jones, L., & Wanker, E. E. (1999). Huntington's disease intranuclear inclusions contain truncated, ubiquitinated huntingtin protein. Experimental …. Stumptner, C., Fuchsbichler, A., Heid, H., Zatloukal, K., & Denk, H. (2002). Mallory body--a disease-associated type of sequestosome. Hepatology (Baltimore, Md.), 35(5), 1053–1062. doi:10.1053/jhep.2002.32674 Suttangkakul, A., Li, F., Chung, T., & Vierstra, R. D. (2011). The ATG1/ATG13 protein kinase complex is both a regulator and a target of autophagic recycling in Arabidopsis. The Plant cell, 23(10), 3761–3779. doi:10.1105/tpc.111.090993 Suzuki, K., Kubota, Y., Sekito, T., & Ohsumi, Y. (2007). Hierarchy of Atg proteins in pre- autophagosomal structure organization. Genes to Cells, 12(2), 209–218. doi:10.1111/j.1365- 2443.2007.01050.x Tanida, I., Sou, Y.-S., Ezaki, J., Minematsu-Ikeguchi, N., Ueno, T., & Kominami, E. (2004). HsAtg4B/HsApg4B/autophagin-1 cleaves the carboxyl termini of three human Atg8 homologues and delipidates microtubule-associated protein light chain 3- and GABAA receptor-associated protein-phospholipid conjugates. The Journal of biological chemistry, 279(35), 36268–36276. doi:10.1074/jbc.M401461200 Taylor, J. P. (2002). Targeting abnormal proteins in neurodegeneration. Inpharma. Taylor, J. P., Hardy, J., & Fischbeck, K. H. (2002). Toxic proteins in neurodegenerative disease. Science (New York, N.Y.), 296(5575), 1991–1995. doi:10.1126/science.1067122 Thurston, T. L. M., Ryzhakov, G., Bloor, S., Muhlinen, von, N., & Randow, F. (2009). The TBK1 adaptor and autophagy receptor NDP52 restricts the proliferation of ubiquitin-coated bacteria. Nature immunology, 10(11), 1215–1221. doi:10.1038/ni.1800 Till, A., Lakhani, R., Burnett, S. F., & Subramani, S. (2012). Pexophagy: the selective degradation of peroxisomes. International journal of cell biology, 2012, 512721. doi:10.1155/2012/512721 Tong, J., Yan, X., & Yu, L. (2010). The late stage of autophagy: cellular events and molecular regulation. Protein & cell, 1(10), 907–915. doi:10.1007/s13238-010-0121-z Tung, Y.-T., Hsu, W.-M., Lee, H., Huang, W.-P., & Liao, Y.-F. (2010). The Evolutionarily Conserved Interaction Between LC3 and p62 Selectively Mediates Autophagy-Dependent Degradation of Mutant Huntingtin. Cellular and Molecular Neurobiology, 30(5), 795–806. doi:10.1007/s10571-010-9507-y Vadlamudi, R. K., Joung, I., Strominger, J. L., & Shin, J. (1996). p62, a phosphotyrosine- 110

independent ligand of the SH2 domain of p56lck, belongs to a new class of ubiquitin-binding proteins. The Journal of biological chemistry, 271(34), 20235–20237. Waelter, S., Boeddrich, A., & Lurz, R. (2001). Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of insufficient protein degradation. Molecular biology of …. Wang, H.-G. (2013). Autophagy and Cancer. Springer. Webb, J. L., Ravikumar, B., & Rubinsztein, D. C. (2004). Microtubule disruption inhibits autophagosome-lysosome fusion: implications for studying the roles of aggresomes in polyglutamine diseases. The international journal of biochemistry & cell biology, 36(12), 2541–2550. doi:10.1016/j.biocel.2004.02.003 Weidberg, H., Shpilka, T., Shvets, E., Abada, A., Shimron, F., & Elazar, Z. (2011). LC3 and GATE-16 N termini mediate membrane fusion processes required for autophagosome biogenesis. Developmental cell, 20(4), 444–454. doi:10.1016/j.devcel.2011.02.006 Weidberg, H., Shvets, E., Shpilka, T., Shimron, F., Shinder, V., & Elazar, Z. (2010). LC3 and GATE-16/GABARAP subfamilies are both essential yet act differently in autophagosome biogenesis. The EMBO journal, 29(11), 1792–1802. doi:10.1038/emboj.2010.74 Weiergräber, O. H., Mohrlüder, J., & Willbold, D. (2013). Atg8 Family Proteins—Autophagy and Beyond. Wild, P., Farhan, H., McEwan, D. G., Wagner, S., Rogov, V. V., Brady, N. R., et al. (2011). Phosphorylation of the autophagy receptor optineurin restricts Salmonella growth. Science (New York, N.Y.), 333(6039), 228–233. doi:10.1126/science.1205405 Wilson, M. I., Gill, D. J., Perisic, O., Quinn, M. T., & Williams, R. L. (2003). PB1 domain- mediated heterodimerization in NADPH oxidase and signaling complexes of atypical protein kinase C with Par6 and p62. Molecular cell, 12(1), 39–50. Wirawan, E., Vanden Berghe, T., Lippens, S., Agostinis, P., & Vandenabeele, P. (2012). Autophagy: for better or for worse. Cell research, 22(1), 43–61. doi:10.1038/cr.2011.152 Wong, P. M., & Jiang, X. (2013). Signal Transduction Regulation of Autophagy. Autophagy and Cancer. Xie, R., Nguyen, S., McKeehan, W. L., & Liu, L. (2010). Acetylated microtubules are required for fusion of autophagosomes with lysosomes. BMC cell biology, 11, 89. doi:10.1186/1471- 2121-11-89 Yang, Z., Huang, J., Geng, J., Nair, U., & Klionsky, D. J. (2006). Atg22 recycles amino acids to link the degradative and recycling functions of autophagy. Molecular biology of the cell, 17(12), 5094–5104. doi:10.1091/mbc.E06-06-0479 Yi, C., Ma, M., Ran, L., Zheng, J., Tong, J., Zhu, J., et al. (2012). Function and molecular mechanism of acetylation in autophagy regulation. Science (New York, N.Y.), 336(6080), 474–477. doi:10.1126/science.1216990 Yorimitsu, T., Nair, U., Yang, Z., & Klionsky, D. J. (2006). Endoplasmic reticulum stress triggers autophagy. The Journal of biological chemistry, 281(40), 30299–30304. doi:10.1074/jbc.M607007200 Young, A. R. J., Chan, E. Y. W., Hu, X. W., Köchl, R., Crawshaw, S. G., High, S., et al. (2006). Starvation and ULK1-dependent cycling of mammalian Atg9 between the TGN and endosomes. Journal of cell science, 119(Pt 18), 3888–3900. doi:10.1242/jcs.03172 Yuan, H.-X., Russell, R. C., & Guan, K.-L. (2013). Regulation of PIK3C3/VPS34 complexes by MTOR in nutrient stress-induced autophagy. Autophagy, 9(12), 1983–1995. doi:10.4161/auto.26058 Yuk, J. M., Yoshimori, T., & Jo, E. K. (2012). Autophagy and bacterial infectious diseases. Experimental & molecular medicine, 44(2), 99–108. doi:10.3858/emm.2012.44.2.032 Zhang, H., Bosch-Marce, M., Shimoda, L. A., Tan, Y. S., Baek, J. H., Wesley, J. B., et al. (2008). 111

Mitochondrial autophagy is an HIF-1-dependent adaptive metabolic response to hypoxia. The Journal of biological chemistry, 283(16), 10892–10903. doi:10.1074/jbc.M800102200 Zhang, J., & Ney, P. A. (2009). Role of BNIP3 and NIX in cell death, autophagy, and mitophagy. Cell death and differentiation, 16(7), 939–946. doi:10.1038/cdd.2009.16 Zhou, X., Babu, J. R., da Silva, S., Shu, Q., Graef, I. A., Oliver, T., et al. (2007). Unc-51-like kinase 1/2-mediated endocytic processes regulate filopodia extension and branching of sensory axons. Proceedings of the National Academy of Sciences of the United States of America, 104(14), 5842–5847. doi:10.1073/pnas.0701402104

112