Participation of Autophagy in the Cytotoxicity Against Breast Cancer Cells by Cisplatin

Participation of Autophagy in the Cytotoxicity Against Breast Cancer Cells by Cisplatin

ONCOLOGY REPORTS 34: 359-367, 2015 Participation of autophagy in the cytotoxicity against breast cancer cells by cisplatin MENG SHEN1*, WEI-MING DUAN1*, MENG-YAO WU1, WEN-JIE WANG1, LU LIU1, MENG-DAN XU1, JIE ZHU1, DAO-MING LI1, QI GUI1, LIAN LIAN1,2, FEI-RAN GONG3, KAI CHEN1, WEI LI1 and MIN TAO1,4 1Department of Oncology, The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu 215006; 2Department of Oncology, Suzhou Xiangcheng People's Hospital, Suzhou, Jiangsu 215131; 3Department of Hematology, The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu 215006; 4Jiangsu Institute of Clinical Immunology, Suzhou, Jiangsu 215006, P.R. China Received February 11, 2015; Accepted April 30, 2015 DOI: 10.3892/or.2015.4005 Abstract. Breast cancer is one of the most common cancers and ULK1, indicating that cisplatin induced autophagy affecting women worldwide. Conventional chemotherapy is through a multiple mechanism involved manner. still one of the major approaches to the treatment of breast cancer. Autophagy, also termed as type II programmed cell Introduction death (PCD), exhibits either a protumorigenic or antitumori- genic function. In the present study, we investigated whether Breast cancer is one of the most common cancers affecting autophagy could be involved in the effect of chemotherapy women worldwide, accounting for almost 23% of all cancers against breast cancer. Epirubicin, docetaxel, methotrexate, diagnosed in women (1-2). Although early detection, precise cyclophosphamide, fluorouracil (5-FU) and cisplatin were resection using wide margins and systematic adjuvant therapy applied in the present investigation. All of these chemo- have improved survival, breast cancer remains one of the therapeutics presented cytotoxicity against breast cancer cells. leading causes of death among women (3). Conventional DsRed-LC3 reporter assay revealed that only docetaxel and chemotherapy is still one of the major approaches to the cisplatin induced autophagy. Autophagy inhibitor 3-methylad- treatment of breast cancer, particularly for cases of breast enine (3-MA) strengthened the cytotoxicity of docetaxel, yet cancer in stages 2-4, and is particularly beneficial in estrogen impaired the cytotoxicity of cisplatin, suggesting that docetaxel receptor-negative (ER-) disease (4). Most chemotherapy medi- stimulates protumorigenic autophagy, while cisplatin-induced cations work by destroying fast-growing and/or fast-replicating autophagy could be antitumorigenic. Real-time PCR revealed cancer cells, either by causing DNA damage upon replication that cisplatin upregulated multiple autophagy-related genes, or by other mechanisms. including AMBRA1, ATG3, ATG4C, ATG4D, ATG5, ATG7, Autophagy, also termed as type II programmed cell death ATG13, ATG14, ATG16L2, Beclin1, DRAM1, GABARAP, (PCD), is a genetically programmed, evolutionarily conserved GABARAPL1, GABARAPL2, HDAC6, IRGM, MAP1LC3B process that degrades long-living cellular proteins and organ- elles, including the endoplasmic reticulum, Golgi apparatus and mitochondria (5). Autophagy is important in the normal development and cellular response to environmental stimuli. Correspondence to: Dr Wei Li or Dr Kai Chen, Department of In addition, autophagy participates in numerous diseases, Oncology, The First Affiliated Hospital of Soochow University, including bacterial and viral infections, neurodegenerative Suzhou, Jiangsu 215006, P.R. China disorders, cardiovascular diseases and cancers (5). Autophagy E-mail: [email protected] exhibits either a protumorigenic or antitumorigenic function, E-mail: [email protected] depending on the cell type, developmental stage of cancer and stimulator. Mechanistically, autophagy begins with seques- * Contributed equally tering cytoplasmic proteins or organelles in a membrane vacuole to form an autophagosome. Autophagosome Abbreviations: PCD, programmed cell death; DOC, docetaxel; formation is mediated by a set of evolutionarily conserved MTX, methotrexate; CTX, cyclophosphamide; 5-FU, fluorouracil; DDP, cisplatin; ER, estrogen receptor; ATG protein, autophagy- autophagy-related proteins (ATG proteins) (6). Previously, we related protein; 3-MA, 3-methyladenine; MTT, methyl thiazolyl demonstrated that stimulation of autophagy could be a poten- tetrazolium; DMSO, dimethyl sulfoxide; PI, propidium iodide; SD, tial strategy for the treatment of breast cancer (5). standard deviation; PI3P, phosphatidylinositol-3-phosphate; PE, In the present study, we investigated whether autophagy phosphatidylethanolamine could be involved in chemotherapy against breast cancer and whether this participation could be protumorigenic or antitu- Key words: autophagy, chemotherapy, cisplatin, breast cancer morigenic. Moreover, mechanisms involved in this autophagic cell death by chemotherapeutics were also investigated. 360 shen et al: Cisplatin induces autophagic cell death Table I. Primers. Product size Genes Sense (5'-3') Antisense (3'-5') (bp) AMBRA1 TCGGCAACAACATCATCGTC CTGGGAAGGGAAACAGGAAT 253 ATG3 ACTGATGCTGGCGGTGAAG GTGGCAGATGAGGGTGATTTT 208 ATG4A GGGATGTATGCTACGCTGTGG CACCCATTTGTGCCATTTGAT 182 ATG4B TAGGCCGAGATTGGAGGTG GCGCTATCTGGTGAATGGAGT 114 ATG4C TTTCCCTCTTGAGACATTCCAC GGTGATTTCTTCAGAAGCTCGTTT 130 ATG4D AGCCGAGTGGAAGTCTGTGGT AGCAGGAAGTCATCTTGGTAGCC 177 ATG5 ATCAGGTTTGGTGGAGGCA GGTTTAATGATGGCAGTGGAGG 140 ATG7 CCAAGGTCAAAGGACGAAGAT GTACGGTCACGGAAGCAAAC 156 ATG9A CCTTACCTCACCCGCAGTTC GGCAGCAAAGTATTTCCATCC 241 ATG9B CAGCCGAACACCAAAGTCAT GCTTCCCTTCCCTCTGTAAATC 239 ATG10 ACACTATTACGCAACAGGAACATC CTCAGAGGTAGATTCAGCCCAAC 184 ATG12 ACCCATTGCTCCTACTTGTTACTAT TTTCTGCCTGGTGGACTGC 256 ATG13 TGTCATTGCTGCTGAAGTCCC CCCACTGTCCCAACACGAACT 169 ATG14 GTGAGCCGAGATTGTGCCAT GGTAATAATGCCTGTTAGGACTCTTTC 267 ATG16L1 GGGATTTCTGAAGATTTGACTGAG ACCGACTTTGGAAGGACGAG 248 ATG16L2 ACCGGACAGTGAAGGAGTGG GGATCTTCTGGTCATTGTGGC 129 Beclin1 GCTGGATGATGAGCTGAAGAGT GTGCCAGATGTGGAAGGTTG 109 DRAM1 TCGTCAGCCGCCTTCATTAT CGAAACATCCCACCAATCC 262 GABARAP TCAAACACCACCTCCCTTATTC TGCCAACTCCACCATTACCC 94 GABARAPL1 GCCTGATCTGGACAAGAGGAAGT ATGGTAGCACTGGTGGGAGG 150 GABARAPL2 GTTGACATTGACAAACGGAAGTAC CATAGTTAGGCTGGACTGTGGG 150 HDAC6 CATCCGAACTCATACTCCTGTGC TAAGACTGTGCTGGGCGTGAT 136 IRGM CTTGCTGCTGCTCATTCTTTG CGAGTCTGGAGTTGTTCGTTTC 133 LAMP1 ACAACACGACGGTGACAAGG TTCATCCCGAACTGGAAGAGC 136 MAP1LC3B CGCATTTGCCATCACAGTTG TAGGAGTCAGGGACCTTCAGC 94 RAB24 CAGAAAGTGGCAGAGGATTACG TGACTACCCAAGCCCAGAAAG 199 RGS19 ATCTACACGCTCATGCACCG GACAACAACACCTGAAGGGAAC 175 ULK1 CAGCAAAGGCATCATCCACC GAAGCCGAAGTCAGCGATC 115 WIPI1 CTACCAACTACCTCCCTACCCAG TGTCCACTGGATGACGCAAC 154 Materials and methods Nanjing Pharmaceutical Factory Co., Ltd. (Nanjing, Jiangsu, China). Cell line and cultures. The human breast cancer cell lines MDA-MB-231 and MDA-MB-453 were purchased from the MTT assay. Cellular growth was evaluated by methyl thiazolyl American Type Culture Collection (ATCC; Manassas, VA, tetrazolium (MTT) assay (7). Cells were seeded into 24-well USA). Cells were maintained in RPMI-1640 medium, supple- tissue culture plates at 5x104 cells/well. After treatment, MTT mented with 10% fetal calf serum (both from Gibco, Grand (Sigma, St. Louis, MO, USA) was added to each well to a Island, NY, USA), 100 U/ml penicillin and 100 mg/ml strep- final concentration of 0.5 mg/ml, followed by incubation at tomycin. The cultures were incubated at 37˚C in a humidified 37˚C for 4 h. The medium was then removed, and 800 µl of atmosphere with 5% CO2. Cells were passaged every 2-3 days dimethylsulfoxide (DMSO) was added/well. The absorbance to obtain exponential growth. in each well was measured at 490 nm using a microplate ELISA reader (Bio-Rad Laboratories, Hercules, CA, USA). Reagents. 3-Methyladenine (3-MA) was purchased from The inhibition rate was calculated as follows: Inhibition Sigma (St. Louis, MO, USA). Epirubicin was purchased rate = [(mean control absorbance - mean experimental absor- from Pfizer (Shanghai, China). Docetaxel and methotrexate bance)/mean control absorbance] x 100 (%). The concentration (MTX) were purchased from Jiangsu Hengrui Medicine Co., that caused 50% growth inhibition (IC50) was calculated by Ltd. (Liangyungang, Jiangsu, China). Cyclophosphamide the modified Kärber's method (7) according to the formula: -1 (CTX) was purchased from Baxter Oncology GmbH IC50 = lg [Xk-i (Σp - 0.5)], in which Xk represents the loga- (Kantstrasse, Halle, Germany). Fluorouracil (5-FU) was rithm of the highest drug concentration; i, is that of the ratio of purchased from Shanghai Xudong Haipu Pharmaceutical the adjacent concentration; and Σp, is the sum of the percentage Co., Ltd. (Shanghai, China). Cisplatin was purchased from of growth inhibition at various concentrations. ONCOLOGY REPORTS 34: 359-367, 2015 361 Figure 1. Cytotoxicity of epirubicin (EPI), docetaxel (DOC), methotrexate (MTX), cyclophosphamide (CTX), fluorouracil (5-FU) and cisplatin (DDP) on (A) MDA-MB-231 and (B) MDA-MB-453 breast cancer cells. *P<0.05, **P<0.01 indicate significant difference from the respective control group. Autophagy assay using the DsRed-LC3 reporter. Autophagy manufacturer's protocol. After spectrophotometric quantifica- is dependent on the presence of autophagosomes and autoly- tion, 1 µg total RNA in a final volume of 20 µl was used for sosomes (8). LC3, the mammalian ontology of ATG8, is a reverse transcription with PrimeScript RT reagent kit (Takara, credible marker for autophagosomes (9). During the formation Otsu, Shiga, Japan) according to the manufacturer's protocol. of autophagosomes, LC3 will form punctate structures within Aliquots

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    9 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us