The PCPH Oncoprotein Antagonizes the Proapoptotic Role of the Mammalian Target of Rapamycin in the Response of Normal Fibroblasts to Ionizing Radiation1

[CANCER RESEARCH 63, 6290–6298, October 1, 2003] The PCPH Oncoprotein Antagonizes the Proapoptotic Role of the Mammalian Target of Rapamycin in the Response of Normal Fibroblasts to Ionizing Radiation1

Oscar M. Tirado, Silvia Mateo-Lozano, Sean Sanders, Luis E. Dettin, and Vicente Notario2 Laboratory of Experimental Carcinogenesis, Department of Radiation Medicine [O. M. T., S. M-L., S. S., V. N.], and Department of Cell Biology [L. E. D.], Georgetown University Medical Center, Washington, DC 20057-1482

ABSTRACT gene with cells expressing the CD4/CXCR4 receptor complex (8, 9). In this system, apoptosis occurs after nuclear translocation of mTOR Exposure of normal mouse fibroblasts (MEF3T3) to ionizing radiation and mTOR-mediated phosphorylation of p53 on Ser15 (p53Ser15), a (IR) resulted in a dose-dependent increase of mTOR mRNA and protein levels and the shuttling of the mTOR protein from its normal, predomi- residue known to be phosphorylated also in response to DNA- nantly mitochondrial location to the cell nucleus. The same IR doses that damaging agents (10, 11). Evidence for the direct involvement of activated mTOR induced the phosphorylation of p53 on Ser18 (mouse mTOR in apoptosis through p53Ser15 phosphorylation was based on equivalent to human Ser15) and the subsequent transcriptional activation the observations that: (a) compared with unfused cells, mTOR was the of PUMA, a known proapoptotic p53-target gene, and promoted apoptosis only kinase out of a large panel of proteins analyzed whose expression involving increased overall caspase activity, caspase-3 activation, cleavage was up-regulated on syncytia formation; (b) mTOR coprecipitated of poly(ADP-ribose) polymerase (PARP) and classic protein kinase C with p53; and (c) rapamycin, a mTOR-specific inhibitor, prevented (PKC) isoforms, and DNA fragmentation. The proapoptotic role of mTOR 15 in this process was demonstrated by the fact that rapamycin, a mTOR phosphorylation of p53Ser and the execution of the apoptotic inhibitor, blocked p53 Ser18 phosphorylation, the induction of PUMA, and process (8). all other apoptosis events. Furthermore, the proapoptotic function of A universal proapoptotic role of mTOR, however, has not been mTOR was also antagonized by the expression in MEF3T3 cells of the conclusively established to date. An independent line of evidence PCPH oncoprotein, known to enhance cell survival by causing partial suggests that the mTOR pathway may be in fact inactivated by ATP depletion. Tetracyclin (Tet)-regulated expression of oncogenic DNA-damaging agents before the commitment stages of apoptosis, in PCPH, or overexpression of normal PCPH, blocked both phosphorylation a caspase-independent manner (12). Treatment of Swiss 3T3 and and nuclear shuttling of mTOR in response to IR. These results indicate that alterations in PCPH expression may render tumor cells resistant to Rat-1 cells with etoposide, cisplatin, or mitomycin-C resulted in the IR, and perhaps other DNA-damaging agents, by preventing mTOR dephosphorylation of two known mTOR substrates involved in the activation and signaling. regulation of translation: the p70S6 kinase and the eukaryotic initiation factor 4E-binding protein 1 (4E-BP1). Although formal demon- stration of mTOR inactivation is lacking, these findings suggest that INTRODUCTION mTOR may be a cellular context-dependent, pleiotropic regulator of Nuclear DNA damage is a well-known trigger of the so-called apoptosis (13). Indeed, an antiapoptotic role has also been described intrinsic pathway of cellular apoptosis, which involves mitochondrial for mTOR (14). Consistent with this notion, the inhibition of mTOR membrane permeabilization, cytochrome c release, and the activation has been shown to sensitize human tumor cells to fractionated radi- of the proteolytic caspase cascade (1, 2). Several enzymes (ATM, ation therapy in nude mouse xenografts (15). ATR, DNA-PK) involved in sensing DNA damage, double-strand The PCPH gene was first identified as an oncogene activated in breaks in particular, are members of the PIKK3 family (3). These primary Syrian hamster fetal cells initiated with 3-methylcholanthrene enzymes initiate signaling pathways that converge in the tumor sup- (16). The PCPH gene is conserved from yeast to human cells, being pressor p53 (4). Phosphorylation of specific p53 residues (5, 6) has expressed in a broad range of tissue types (17). However, expression been identified as a key determinant of the final cellular response (cell of the PCPH protein is limited to a few histological locations during cycle arrest or apoptosis) to DNA damage. mouse embryo development. Most recently, we showed that expres- Recent reports have shown that another member of the PIKK sion of PCPH is frequently altered in human tumor cells and solid family, the mTOR (also known as FRAP or RAFT; Ref. 7), likewise tumors (18, 19) and that the characteristic pattern of PCPH alterations plays an important role in a p53-dependent, mitochondria-mediated in human mammary tumor cells was reproducible in a rat model for apoptotic process that is initiated independently of DNA damage: the mammary carcinogenesis (20), strongly suggesting the possible in- formation of syncytia by the fusion of cells expressing the HIV-1 Env volvement of PCPH in human cancer development. Previous studies from our laboratory established that increasing cellular resistance to Received 4/2/03; revised 6/27/03; accepted 7/2/03. apoptosis is an important component of the transforming activity of The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with the PCPH oncogene (21, 22). This represents a major functional 18 U.S.C. Section 1734 solely to indicate this fact. difference between the PCPH proto-oncogene and the oncogene, 1 Supported by USPHS Grant RO1-CA64472 from the National Cancer Institute, NIH, and, in part, by the Microscopy and Imaging and the Macromolecular Analysis Shared because expression of the proto-oncogene provided only a marginal Resources of the Lombardi Cancer Center, funded through USPHS Grant 2P30-CA51008. protection to various apoptotic agents, including IR and chemothera- 2 To whom requests for reprints should be addressed, at Department of Radiation peutic drugs. We described recently (21) that mouse fibroblasts ec- Medicine, Research Building, Room E215, 3970 Reservoir Road, NW, Washington, DC 20057-1482. Phone: (202) 687-2102; Fax: (202) 687-2221; E-mail: notariov@ topically expressing the PCPH oncoprotein contained lower intracel- georgetown.edu. lular ATP concentrations than did control cells and that their 3 The abbreviations used are: PIKK, phosphatidylinositol kinase-related kinase; Dox, doxycycline; IR, ionizing radiation; PARP, poly(ADP-ribose) polymerase; PKC, protein resistance to apoptosis could be reversed by ATP replenishment. kinase C; ORF, open reading frame; Tet, tetracycline; TUNEL, terminal deoxynucleotidyl Because PCPH has intrinsic AMP diphosphohydrolase activity (23), transferase-mediated dUTP-X nick end labeling; mTOR, mammalian target of rapamycin; RT-PCR, reverse transcription-PCR; DAPI, 4Ј,6-diamidino-2-phenylindole; PLD, phos- our data indicated that partial ATP depletion mediated the stress- pholipase D; PA, phosphatidic acid. survival function of the PCPH oncoprotein, most likely by decreasing 6290

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2003 American Association for Cancer Research. PCPH AND mTOR IN RADIATION-INDUCED APOPTOSIS phosphate donor availability for stress-induced phosphorylation cas- and reverse transcription was performed at 42°C for 50 min. PCR primers for cades. mTOR, PUMA, and actin were designed using the Oligo 6.0 software from To evaluate the role of mTOR in the apoptotic response to DNA National Biosciences (Plymouth, MN), with GenBank published sequences as damage, we studied changes in mTOR expression, phosphorylation, templates. A 994-bp mTOR fragment was amplified with primers TGGGGTT- and localization in mouse embryo fibroblasts (MEF3T3) exposed to TAGGTCAGTGG (upper) and CACTCTCACTGTTGCTGCC (lower). A 282-bp fragment of PUMA was amplified with primers GGATGGCGGAC- increasing IR doses and correlated them with changes in molecular GACCTC (upper) and CGGGCAAGGCTGGCAGT (lower). The primer set determinants of the intrinsic apoptotic pathway. We used rapamycin CACTGTGCCCATCTACGAG (upper) and AGGGTGTAAAACGCAGC to inhibit mTOR-related parameters and Tet-regulated PCPH expres- (lower) was used to amplify mouse actin, as standard for semiquantitative sion to modulate the radiation susceptibility of MEF3T3 cells to RT-PCR determinations. Amplifications were carried out using a 2700 Perkin- apoptosis. Results demonstrated a proapoptotic role for mTOR and Elmer thermocycler (Applied Biosystems, Foster City, CA) and consisted of showed that this mTOR function was antagonized by the expression 35 amplification cycles. Denaturation was performed at 94°C for 20 s; anneal- of oncogenic PCPH or overexpression of normal PCPH, which ing was at 58°C for mTOR and 64°C for PUMA; and extension at 72°C for blocked mTOR phosphorylation and nuclear shuttling. These results 45 s. As a routine housekeeping reference, conditions for actin amplification demonstrate a key role for mTOR in the response to IR and indicate were always identical to those used for the transcript under investigation. PCR that alterations in PCPH expression may increase the resistance of products were resolved on 1.5% agarose gels and quantified using the Molec- tumor cells to IR, and perhaps other DNA-damaging agents, by ular Analyst Macintosh data analysis software and a Bio-Rad (Hercules, CA) Image Analysis System. Amplification products were purified using the preventing mTOR activation and signaling. QIAquick PCR Purification kit (Qiagen) according to the manufacturer’s instructions, and sequenced using an ABI Prism 310 system (Perkin-Elmer). MATERIALS AND METHODS Western Blot Analysis. Cells were lysed in radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitors (1 mM phenylmethylsulfo- Cell Lines, Culture Conditions, Antibodies, and General Reagents. nyl fluoride, 10 mg/ml aprotinin, and 10 mg/ml leupeptin) and the lysates were Mouse MEF3T3 cells, a line derived from Swiss 3T3 embryo fibroblasts, were centrifuged at 13,000 ϫ g at 4°C for 30 min. Protein content in the superna- purchased from BD Clontech (Palo Alto, CA) and maintained in DMEM tants was determined with the BCA Protein Assay system (Pierce, Rockford, (Biofluids, Rockville, MD) supplemented with 10% Life Technologies, Inc. IL). Proteins (30 ␮g) in cell extracts were resolved by 10% SDS-PAGE and donor calf serum (Invitrogen, Grand Island, NY), 100 ␮g/ml G418, and 1% were transferred to nitrocellulose membranes. After blocking with 5% nonfat Life Technologies, Inc. penicillin/streptomycin, at 37°C, in an atmosphere of dry milk in PBS containing 0.2% Tween 20, membranes were incubated at 4°C

5% CO2 and 95% air. Polyclonal antibodies against mTOR, phospho(Ser overnight with the different antibodies. Blots were then incubated for1hat 2448) mTOR, p53, phospho(Ser 6, 9, and 15) p53, Bax, caspase 9, caspase 3 room temperature with horseradish peroxidase-conjugated secondary antibody and PKC isoforms ␣ and ␤II were purchased from Cell Signaling Technology (1:2000) and the peroxidase activity was analyzed with the ECL chemilumi- (Beverly, MA). Polyclonal anti-PUMA was purchased from Abcam (Cam- niscence substrate system (Amersham Biosciences, Piscataway, NJ). bridge, United Kingdom). Oligonucleotide primers were from Bio-Synthesis Immunofluorescence. Cells grown on two-chamber slides were fixed in (Lewisville, TX). Rapamycin was purchased from Sigma (St. Louis, MO) and freshly prepared 4% paraformaldehyde in PBS for 30 min at room temperature Dox from BD Clontech. The polyclonal anti-PCPH antiserum (no. 1892) was and were rinsed and permeabilized with 0.4% Triton X-100 in PBS for 30 min. raised in rabbits (Bio-Synthesis) by immunization with a synthetic peptide Permeabilized cells were then incubated for 30 min at room temperature with corresponding to amino acid residues 109–122 of the mouse PCPH protein. 10% donkey serum in PBS to block nonspecific binding. After thorough The anti-PARP polyclonal antiserum, which recognizes intact PARP and its rinsing with PBS, cells were incubated for1hat37°C with anti-mTOR small (Mr 25,000) caspase cleavage product, was described previously (24). antibody, followed by 30 min at 37°C with FITC-coupled antirabbit antibody. The cell-permeable, pan-caspase inhibitor Z-VAD-FMK was purchased from Cells were rinsed again with PBS and twice with distilled water and were Promega Corp. (Madison, WI). mounted in Vectashield mounting medium for fluorescence with DAPI (Vector Irradiation and Apoptosis Assays. All of the irradiations were carried out Laboratories, Burlingame, CA), which provided nuclear fluorescent counter- using a J. L. Shepherd (San Fernando, CA) Mark I 137Cs irradiator, delivering staining, and were visualized with a Nikon E600 fluorescence microscope. total doses of 2.5, 5.0, or 10.0 Gy, at 1.93 Gy/min. Apoptosis was evaluated by Mitochondria were stained by incubating the cells with the MitoTracker red four methods: cell viability determinations, PARP cleavage, caspase process- dye (Molecular Probes, Eugene, OR), for 30 min at 37°C. Appropriate controls ing activity assays, and TUNEL assays. Cell viability was determined by the were maintained by substituting the primary antibody with normal donkey trypan blue exclusion method: cells were suspended in 0.04% trypan blue in and/or rabbit serum to check for nonspecific binding. PBS, placed on a hemocytometer, and counted under the microscope (25). Establishment of Tet-Regulated PCPH Expression Systems. The DNA PARP cleavage and caspase processing were studied by Western analyses with sequences encompassing the ORFs of the normal and oncogenic PCPH specific antibodies. Caspase activity was measured using the CaspACE Assay cDNAs (22) were amplified by PCR using primers that created an EcoRI site System (Promega) according to the manufacturer’s protocols. Briefly, after immediately upstream of the translation initiation codon and a BamHI site irradiation, cells were lysed with 50 ␮l of chilled lysis buffer, mixed with 40 immediately downstream from the translation termination TGA codon. The ␮l of DTT-containing reaction buffer plus 2 ␮l of the DEVD-pNA substrate, upper primer (CCGAATTCGCCATGGCCACTCCCTGGG) was the same in at a final concentration of 0.1 mM. The mixture was incubated at 37°Cfor4h, both cases, whereas the lower primer CTGGATCCAATCAGCTGGGGAT- and the absorbance was measured in a plate reader at 405 nm. TUNEL assays GCCCAGA was used to amplify the normal ORF and CTGGATCCAAT- were performed for the in situ detection of apoptotic cells using the TMR CAATCCAAATCCCAAGTAA was used to generate constructs with onco- red-based In Situ Death Detection kit from Roche Diagnostics (Indianapolis, genic PCPH. Amplified fragments were gel-purified using the Sephaglass IN). Cells were cultured in two-chamber slides (Nunc, Naperville, IL) to a BandPrep kit (BD PharMingen, San Diego, CA) and were directionally cloned density of 5 ϫ 104 cells/chamber. Twenty-four h after irradiation, cells were into the corresponding sites of pTRE (BD Clontech). This placed the PCPH washed with PBS and incubated with the TUNEL reaction mixture for 1 h, at ORFs under the translational control of the PhCMV*-1 promoter, which contains 37°C, in a humidified atmosphere in the dark. TUNEL-positive cells were the Tet-responsive element (TRE) immediately upstream of the minimal cy- visualized with a Nikon E600 fluorescence microscope. tomegalovirus (CMV) promoter. The pTRE-PCPH and pTRE-mt-PCPH plas- RT-PCR. RNA was extracted with the RNeasy Mini kit (Qiagen, Valencia, mids were then cotransfected into MEF3T3 Tet-Off cells with pTK-Hyg, a CA). Total RNA (3 ␮g) was reversed transcribed using 200 units of Super- plasmid that confers hygromycin resistance, to allow the selection of stable script II RNase H-Reverse Transcriptase (Invitrogen) in a 20-␮l reaction transfectants. MEF3T3 Tet-Off cells are Swiss 3T3 fibroblasts that constitu- volume, in the presence of 25 ␮g/ml Oligo(dT), first strand buffer (50 mM tively express the Tet-controlled transactivator tTA, which will interact with

Tris-HCl, 75 mM KCl, 3 mM MgCl2), 10 mM DTT, and 10 mM each dATP, and activate the PhCMV*-1 promoter on Dox removal from the culture medium. dGTP, dCTP, and dTTP. The mixture of RNA and Oligo(dT) was heated at Transfections were performed using the GenePORTER 2 reagent (GTS Inc., 70°C for 10 min and cooled to 4°C; then, all of the other reagents were added, San Diego, CA). A number of individual clones derived from each transfection 6291

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2003 American Association for Cancer Research. PCPH AND mTOR IN RADIATION-INDUCED APOPTOSIS were tested for possible promoter leakiness, the magnitude of PCPH or with an antiphospho mTOR antibody specific for the phosphorylated mt-PCPH induction on removal of doxycycline, and the dose-dependence of form at Ser2448, the position known to be phosphorylated when their expression. Clones p3A.1 and mt1A.1 were selected for characterization mTOR is activated in response to mitogenic stimulation (i.e., by of the inducible expression of normal and oncogenic PCPH, respectively. insulin) in certain cell types (33), clearly showed that phosphorylation Generation of Enzymatically Inactive PCPH Oncoprotein. The Quick- Change site-directed mutagenesis system (Stratagene, La Jolla, CA) was used at Ser2448 was also increased in IR-exposed cells (Fig. 1B, right to substitute the glutamic acid and the glycine residues at positions 172 and panel). These results demonstrate that IR up-regulated and activated 201 of the PCPH amino acid sequence (22) by alanine residues. The primers mTOR expression. GGATGGGTCCTATGAAGGCATATTAGCTTGGG and GACCCTTGAC- Mitochondria Are the Primary Subcellular Location of mTOR CTGGGGGGTGCCTCCAC were used as recommended by the manufactur- in MEF3T3 Cells. Stimulation of mTOR has been reported to result ers. The selection of the residues to be modified to generate a PCPH onco- in its translocation from the cytoplasm to the nucleus (34). We wanted protein devoid of enzymatic activity was based on results from comparative to investigate the possibility that IR stimulation of mTOR would analyses of the effects of mutations of closely related proteins such as CD39 and CD39L3 (26–31) on their ATP/ADP diphosphohydrolase activity. The cause a similar phenomenon. However, there are several contradictory presence of the expected base-pair substitutions was ascertained by nucleotide reports on the localization of mTOR. Some researchers reported a sequence analysis, and their effect on the biochemical activity of the PCPH cytoplasmic localization with a large portion of mTOR ascribed to oncoprotein was confirmed by enzyme assays with total extracts of transiently mitochondria (35), whereas others described a predominantly nuclear transfected HEK293 cells, performed as described previously (23). localization for mTOR (36). These differences cannot be explained Statistical Analysis. RT-PCR and Western blot analyses of mTOR expres- simply by the fact that different cell types were examined in each case, sion (Fig. 1) were repeated at least three times. Data from densitometric because both groups included mouse embryo fibroblasts in their analyses were expressed as means Ϯ SD, and an ANOVA test was used to assess the significance of differences between groups. P Յ 0.05 was regarded studies. Therefore, we first performed immunofluorescence experi- as significant. ments to ascertain the localization of mTOR in MEF3T3 cells. We compared the localization pattern of mTOR, visualized with a FITC- RESULTS conjugated secondary antibody, with the distribution of nuclear (DAPI) and mitochondrial Mitotracker (CMXRos) staining in unirra- IR Increases mTOR mRNA Levels in a Dose-Dependent Fash- diated, exponentially growing MEF3T3 cells. Merging of the three ion. To study whether mTOR played any role in the response to IR, staining patterns (Fig. 2) clearly demonstrated that mTOR is localized triplicate cultures of normal mouse embryo fibroblasts (MEF3T3) in the cytoplasm and absent from the cell nuclei. Results also showed containing identical cell numbers were exposed to increasing doses of that mTOR is predominantly associated with mitochondria, although ␥ -radiation. Mouse embryo fibroblasts are sensitive to IR, and the a small proportion of mTOR may be either soluble or associated, dose range used was selected because it would induce them to un- perhaps transiently, with other compartments in the cytoplasm. dergo apoptosis (32). Twenty-four h after IR exposure, unirradiated IR Induces Nuclear Translocation of mTOR. Similar localiza- controls and IR-treated cells were harvested and lysed, and total RNA tion studies were carried out on MEF3T3 cells after IR exposure. and protein extracts were prepared. RT-PCR amplification with Results showed that IR induced the shuttling of mTOR from the mouse mTOR-specific primers, followed by gel electrophoresis of the products, demonstrated (Fig. 1A) that IR exposure resulted in a cytoplasm to the nucleus (Fig. 3). Mock-irradiated MEF3T3 cells, dose-dependent increase of mTOR mRNA. When densitometric data which were TUNEL negative (Fig. 3B) and had no signs of nuclear were normalized to the actin controls for each sample, exposures to abnormalities (Fig. 3C), showed the typical cytoplasmic, preferen- 2.5, 5.0, and 10.0 Gy resulted in mTOR mRNA level increases of 2.2-, tially mitochondrial, localization (Fig. 3A). After 7-Gy irradiation (24 4.1-, and 5.2-fold, respectively, relative to unirradiated controls (Fig. h), mTOR staining was detectable only in the nuclei (Fig. 3D) of cells 1A, right panel). Although at this point it is not known whether the that were already weakly TUNEL positive (Fig. 3E) and showed signs observed elevated mRNA levels are attributable to transcription up- of nuclear condensation (Fig. 3F). At later times, overtly apoptotic, regulation or enhanced transcript stability, they were reflected in strongly TUNEL-positive cells, undergoing a complete disorganiza- increases (1.9-, 2.4-, and 2.4-fold, respectively) in the cellular content tion of their cytoplasmic and nuclear compartments, showed a wide- of mTOR protein (Fig. 1B). Western analyses of the same samples spread, diffuse staining for mTOR (data not shown). These results

Fig. 1. Effect of IR on the expression of mTOR in normal mouse fibroblasts. Exposure of MEF3T3 cells to IR resulted in (A) a dose-dependent increase in mTOR mRNA levels, as determined by semiquantitative RT-PCR, and (B) the concomitant rise in the levels of total and phosphorylated mTOR (phmTOR) protein, as determined by Western blot analyses with the antibodies indicated. The letter C, control unirradiated cells. Histograms (right panels), the densitometric eval- uation of results from RT-PCR and Western hybridization analyses. Data represent the mean from three sim- P Յ 0.05 for test group ,ء .ilar experiments; bars, ϮSD versus actin absorbance.

6292

Fig. 2. Mitochondria are the primary location of the mTOR protein in normal murine fibroblasts. Exponentially growing MEF3T3 cells were immu- nostained with anti-mTOR antibody using a FITC- conjugated secondary antibody (mTOR panel), or stained with DAPI or CMXRos to identify the nuclear and mitochondrial compartments. Merging of the three images (MERGE panel) identified mitochondria as the primary subcellular localization for the mTOR protein.

demonstrated that, similar to mitogenic stimulation (34), IR exposure MEF3T3 cells to IR exposure. Although the addition of rapamycin (10 results in the translocation of mTOR into the nucleus. ng/ml in DMSO) to mock-irradiated controls produced a slight de- Rapamycin Blocks IR-Induced Apoptosis. To determine crease in cellular viability (Fig. 4A, Control), rapamycin treatment whether mTOR activation was an effector in the apoptotic pathway or enhanced the survival of cells exposed to IR (Fig. 4A). The magnitude a consequence of the apoptotic process, we examined the effect of of this cell-survival-enhancing effect increased with the IR dose used. rapamycin, a mTOR-specific inhibitor (37, 38), on the response of The protective effect of rapamycin was also evidenced by its ability to

Fig. 3. IR induces mTOR nuclear translocation. In agreement with data shown in Fig. 2, immunofluorescence analyses showed a preferential cytoplasmic (mitochondrial) location for mTOR in unirradiated MEF3T3 cells (A) which were TUNEL negative (B) and contained intact nuclei (C). On the contrary, mTOR was detected exclusively in the nucleus (D) after exposure to IR (7 Gy) in cells that were clearly TUNEL positive (E) and showed signs of nuclear condensation (F). 6293

Fig. 4. Inhibition of mTOR protects MEF3T3 cells from IR-induced apoptosis. The protective effect of rapamycin (black bars) relative to cells maintained without the mTOR inhibitor (gray bars) was demonstrated by its ability to: increase cell survival after exposure to increasing IR doses (A), prevent caspase activation (B) as efficiently as the caspase-specific inhibitor Z-VAD-FMK (10ϩInh Lane in B), and block the cleavage of caspase 3, PARP, and PKC ␣/␤ (C). The arrow in panel C, the PARP cleavage product identified by the polyclonal antiserum used in this study. R, rapamycin; the letter C, control unirradiated cells. block the increase in caspase activity induced by IR exposure (Fig. nature of the response to DNA damage, by inducing or repressing 4B). Indeed, rapamycin was as efficient in blocking caspase activation several genes that regulate cell cycle arrest, DNA repair and/or ap- as the cell-permeable, pan-caspase inhibitor Z-VAD-FMK (Fig. 4B, optosis (43). In the apoptotic process, p53 up-regulates the transcrip- 10 Gy ϩ Inh Lane). In agreement with its inhibitory effect on tion of target genes encoding proapoptotic proteins. Several of these IR-induced caspase activation, rapamycin treatment prevented the downstream products have been identified (44–48). Accordingly, we proteolytic activation of caspase 3 and the apoptosis-induced cleavage tested the possibility that p53Ser18 phosphorylation may result in the of cellular proteins (39, 40) such as PARP and PKC ␣/␤ (Fig. 4C). induction of p53 target products such as Bax (49), Noxa (47), PUMA Overall, these results showed that the inhibition of mTOR blocked (44, 45, 48), or other proteins (50, 46) that may mediate the release of IR-induced apoptosis, thus demonstrating that mTOR is a positive cytochrome c from mitochondria and the activation of the caspase 9/3 effector in the process. cascade (51). RT-PCR and Western hybridization analyses demon- mTOR Mediates p53 Phosphorylation and the Subsequent strated that the levels of Bax, which is expressed in MEF3T3 cells, Transcriptional Activation of the BH3-Only, Proapoptotic Pro- were not increased and that the expression of Noxa was not induced tein PUMA. Results from studies in other experimental systems by IR treatment (data not shown). However, IR exposure caused the suggested that mTOR may exert its proapoptotic activity by mediating, or even directly carrying out, the phosphorylation of p53 on Ser15 (8, 9). Because this is a residue known to be phosphorylated in response to DNA damage (5, 6) and because our data showed that mTOR is a positive effector of IR-induced apoptosis, we examined the possibility that mTOR may mediate p53 phosphorylation at Ser18, the equivalent amino acid residue in murine p53 (41), in the response of MEF3T3 cells to IR. Western blot analyses of total extracts from mock-irradiated cells and cells exposed to various IR doses with antibodies anti-p53 and antiphospho(Ser15) p53 (which also recognizes the equivalent modification in mouse p53) showed that, even though IR exposure did not remarkably modify the total content of p53 in the cells, there was a significant increase in the level of p53 phosphorylated at the Ser18 residue (Fig. 5A) on IR treatment. The direct dependence of this phosphorylation event on mTOR was demonstrated by the fact that it was abrogated by inhibiting mTOR with rapamycin. The extent of the inhibition of p53 phosphorylation on Ser18 caused by rapamycin correlated with its survival enhancing effect relative to the IR doses (Fig. 4A): the higher the IR dose, the more stringent the inhibitory effect of rapamycin on p53 Ser18 phosphorylation (Fig. 5A). Fig. 5. mTOR mediates p53 phosphorylation (php53) and expression of PUMA. The It is well established that, in response to DNA damage, p53 con- inhibitory effect observed in the presence of rapamycin demonstrated that mTOR medi- tributes to cell survival by regulating cell cycle progression and ated (A) the IR-induced phosphorylation of p53 on Ser18, as demonstrated by Western blot (WB) analyses with the indicated antibodies and (B) the subsequent transcriptional apoptosis (42). Phosphorylation events at various amino acid residues activation (RT-PCR) and increased protein levels (WB) of the proapoptotic p53 target within the NH2-terminal transactivation domain of p53 determine the PUMA. C, control unirradiated cells. 6294

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2003 American Association for Cancer Research. PCPH AND mTOR IN RADIATION-INDUCED APOPTOSIS transcriptional up-regulation of PUMA and the subsequent increase in the cellular content of its protein product (Fig. 5B). That this phenomenon was also dependent on mTOR activation was evidenced by the fact that it was inhibited by treatment with rapamycin (Fig. 5B). Overall, these results demonstrate that mTOR exerts its proapoptotic role in response to IR-induced DNA damage by mediating the phosphorylation of p53 at Ser18 and the subsequent transcriptional activation of a gene product such as PUMA, recently described as essential for p53-mediated apoptosis (52). Expression of the PCPH Oncoprotein Prevents IR-Induced mTOR Phosphorylation and Nuclear Translocation and Protects from IR-Induced Apoptosis. Because it was previously reported that mTOR is an ATP sensor and that mTOR signaling is influenced by the intracellular concentration of ATP (53), we examined whether the cellular ATP content could modulate the proapoptotic role of mTOR in response to IR. To accomplish that, we established MEF3T3 cells that expressed the PCPH oncoprotein (22), the cell survival function of which is determined by its ability to significantly decrease cellular ATP levels because of its intrinsic ATP diphosphohydrolase activity (21, 23). Taking into consideration that normal MEF3T3 cells do not express the PCPH gene, and to prevent unwanted toxicity effects, we used a Tet-regulated promoter to control the PCPH oncoprotein expression in MEF3T3 cells (54). The use of a Tet-off system allowed us to control the levels of PCPH expression by modifying the Dox concentration in the culture medium. As a control, the same system was used for the expression of normal PCPH, known to have only minor effects on the cellular ATP content and marginal cell survival consequences (21, 22). MEF3T3 cells expressing an enzymatically inactive form of the PCPH oncoprotein obtained by site-directed mutagenesis within its ATP-binding region were used as a second control for these experiments. A number of clones transfected with either normal or oncogenic PCPH were characterized for promoter Fig. 6. Effect of expression of the PCPH oncoprotein on the response of murine fibroblasts to IR and mTOR status. Clonal Tet-off lines were developed for the conditional leakiness and the extent of transcriptional stimulation on induction. expression of normal (pA3.1) or mutant (mt1A.1) PCPH proteins on removal of Dox from For unknown reasons, all of the clones derived from normal PCPH the culture medium (A). Compared with uninduced (ϩDox) controls, Western analyses with the indicated antibodies revealed that induction of mutant PCPH expression (mt1A.1 showed some level of leakiness, even in the presence of high Dox cells, ϪDox), completely prevented mTOR phosphorylation (B, ϪDox panel) and ren- concentrations, whereas all of the clones derived from oncogenic dered the cells more resistant to IR (C). The letter C, control unirradiated cells. PCPH were tightly regulated. Two clearly inducible clones (Fig. 6A) expressing normal (p3A.1 clone) or oncogenic (mt1A.1 clone) PCPH were selected for further characterization. the complete blockade of the translocation of mTOR into the nucleus Exposure to IR of cells induced to express the PCPH oncoprotein in induced, irradiated mt1A.1 cells (Fig. 7A). When the same type of (Fig. 6C, mt1A.1-Dox) resulted, as expected, in levels of apoptosis experiments were performed with cells maintained in the presence markedly lower than those observed in uninduced controls (Fig. 6C, of Dox concentrations that would induce the expression of levels of mt1A.1ϩDox) or in untransfected MEF3T3 cells (Fig. 6C, Control). normal PCPH similar to those achieved for the PCPH oncoprotein in This was particularly evident at the highest IR dose used (10 Gy). the absence of Dox, the effects of the expression of normal PCPH on Total extracts of uninduced and induced, unirradiated or irradiated, both mTOR phosphorylation and nuclear translocation were only mt1A.1 cells were prepared 24 h after irradiation. Western analyses of these samples with anti-mTOR and antiphospho-mTOR showed that, marginal (data not shown). Even when the removal of Dox resulted in although expression of the PCPH oncoprotein did not seem to affect levels of normal PCPH about 20-fold greater than those of the PCPH the total amount of mTOR protein, it had a dramatic inhibitory effect oncoprotein (Fig. 6A), the effects of this overexpression on mTOR on mTOR phosphorylation (Fig. 6B, ϪDox panels), which was ren- phosphorylation and nuclear translocation were lower in magnitude dered undetectable even in unirradiated controls (Fig. 6B, ϪDox, Lane than those caused by induction of the PCPH oncoprotein (Figs. 6B and C). Furthermore, expression of the PCPH oncoprotein completely 7A): overexpression of normal PCPH did not cause a complete block- prevented the translocation of mTOR into the nucleus on irradiation ade of mTOR phosphorylation (data not shown) and, consistent with (Fig. 7A). To explore the possibility that this behavior may be attrib- its effect on mTOR phosphorylation, overexpression of normal PCPH utable to the clonal origin of the mt1A.1 cells rather than being an allowed only a partial translocation of mTOR into the nucleus (Fig. effect of the expression of the PCPH oncoprotein, we tested whether 7D). The fact that expression of enzymatically inactive PCPH onco- mTOR translocated into the nucleus in uninduced mt1A.1 cells, which protein had no detectable effect on the normal role of mTOR in the do not express the PCPH oncoprotein (Fig. 6A). Results showed that, response to IR exposure (data not shown) demonstrated that the although uninduced mt1A.1 cells were less efficient than the original inhibitory effect of the expression of the PCPH oncoprotein (or MEF3T3 cell population in translocating mTOR to the nucleus on the overexpression of the normal PCPH protein) on mTOR phospho- irradiation, most of the mTOR signal was still detectable in the rylation and nuclear translocation was indeed mediated by its ATP nucleus of irradiated mt1A.1 cells (Fig. 7G). These results confirmed diphosphohydrolase activity, and strongly suggested that phosphoryl- that expression of the PCPH oncoprotein was indeed responsible for ation is a requirement for the shuttling of mTOR to the nucleus. 6295

Fig. 7. Expression of the PCPH oncoprotein blocks mTOR nuclear translocation after IR exposure. Tet-off mt1A.1 cells were induced by Dox removal (A) or maintained in the presence of Dox (G), and the location of the mTOR protein was visualized by immunofluorescence after IR exposure (7 Gy). Induction of high levels of expression of normal PCPH (D) resulted in a partial blockade of mTOR translocation. Nuclei were visualized by DAPI staining (B, E, H). Phase-contrast images of the cells are also shown (C, F, I).

DISCUSSION exposure of Rat-1 and, especially, Swiss 3T3 cells to other DNA damaging agents (i.e., etoposide, mitomycin C, and cisplatin) caused Overall, results described above identified mTOR as an IR-respon- the inactivation of translational regulators linked to mTOR signaling sive gene, the expression of which is up-regulated on IR treatment (12). Interestingly, it remains unclear why the inhibition of mTOR (Fig. 1). In fact, in our experimental system, the mTOR gene product with rapamycin in these two cell types still delayed caspase-3 activa- closely fulfills the requirements described (55) for a DNA damage tion and etoposide-induced apoptosis (12). Although clonal heteroge- sensor: to be located near DNA and to react to DNA damage. Our neity between cell lines kept in different laboratories may be a cause results show that, on exposure to a DNA damaging agent, mTOR of the apparent disparity with our cellular system, it is also possible mRNA, protein, and phosphorylation levels are up-regulated (Fig. 1) that activation of mTOR and stimulation of its proapoptotic activity and that the mTOR protein moves from its normal mitochondrial may be an effect specific to the type of damage caused by IR. This position in the cytoplasm (Fig. 2) to a location near the DNA in the nucleus (Fig. 3), in which it exerts its reaction by performing a possibility is currently under investigation. prominent role in the apoptotic response of normal fibroblasts to IR. Our finding that, in response to IR, mTOR mediates the transcrip- Rapamycin inhibition of the downstream cascade of IR-induced ap- tional activation of p53 agrees with published reports (8, 9), although optotic events (phosphorylation of p53Ser18, PUMA expression, there are specific mechanistic differences with other experimental caspase activation, cleavage of PARP, and PKC) conclusively dem- systems. IR exposure of normal fibroblasts resulted in the exclusive 18 onstrated their dependence on mTOR activity (Figs. 4 and 5). It is phosphorylation of p53 at Ser , whereas additional residues (i.e., 6 9 possible that, similar to its role in controlling cell size (56), mTOR mouse equivalent to human Ser and Ser ) are simultaneously phos- may be influenced by and react to changes taking place in the cell phorylated in response to IR in other cell types (5). Moreover, in nucleus as a whole, rather than on the DNA itself. For instance, contrast to other systems in which mTOR also plays a proapoptotic mTOR-mediated p53Ser15 phosphorylation during HIV-induced syn- role (8, 13) and Bax is reported to be the main downstream target of cytial apoptosis has been shown not to take place until a dramatic phosphorylated p53Ser15/18 (8, 9, 13, 57), mTOR-mediated p53 trans- event such as nuclear fusion (karyogamy) has been completed (9). activation resulted in the exclusive up-regulation of PUMA in IR- Further investigation is required to explore a possible role of mTOR exposed MEF3T3 cells. This result also contrasts with reports that in this context. PUMA is induced along with Bax in response to IR in primary murine Our results demonstrating that mTOR is activated by IR in normal, thymocytes (44). Whether the exclusive induction of PUMA is an Swiss 3T3-derived, murine MEF3T3 fibroblasts, and that it mediates IR-specific response of murine fibroblasts remains to be elucidated. IR-induced apoptosis, contrast with previous reports describing that Similarly, additional experiments are required to conclusively dem- 6296

Fig. 8. Scheme summarizing data on the mechanism of mTOR participation in the response to IR of normal murine fibroblasts and the antagonistic effect of the PCPH oncoprotein (mtPCPH). PARP cleav, PARP cleavage; DNA frag., DNA fragmentation. onstrate whether mTOR directly carries out the phosphorylation of However, the fact that the generation of PA by PLD is not sensitive p53 at Ser18. Nevertheless, our results on the inhibitory effect of to ATP depletion (62), whereas mTOR phosphorylation is, suggests rapamycin (Fig. 5A) and the localization of mTOR neighboring p53 in that an alternative kinase must be responsible for mTOR activation. the nucleus (Fig. 3), together with published reports of coprecipitation Nevertheless, treatment with the phosphatidylinositol 3-kinase (PI3K) of mTOR with p53 (8), strongly support the notion that mTOR, or a inhibitor LY294002 did not prevent IR-induced apoptosis (data not closely associated kinase, phosphorylates p53. shown), indicating that the highly conserved upstream PI3K-AKT The fact that expression of the PCPH oncoprotein, or overexpres- activators (33) do not play a role in mTOR activation in this system. sion of normal PCPH, antagonizes the effect of IR exposure on mTOR It is important to emphasize that, although our results demonstrate phosphorylation (Fig. 6) and nuclear translocation (Fig. 7) is consist- that rapamycin prevented IR-induced apoptosis in normal mouse cells, ent with reports indicating that mTOR function is influenced by the inhibition of mTOR with rapamycin has been reported to sensitize intracellular ATP content (53). Furthermore, our results strongly human tumor xenografts in nude mice to fractionated radiation ther- support the notion that phosphorylation is a key determinant for the apy (15). Our results conceptually agree with recently proposed ther- nuclear translocation of mTOR. It is also noteworthy that the extent of apeutic uses of kinase inhibitors (63, 64) and provide the basis for the inhibitory effect elicited by PCPH is comparable with that of additional studies to determine whether this differential effect of rapamycin. This and the complete blockade of mTOR phosphoryla- rapamycin on the IR response of normal and tumor cells may be tion observed in cells expressing oncogenic PCPH indicate that the clinically useful; the integration of mTOR inhibition with apoptosis- PCPH oncoprotein has a greater specificity for the mTOR kinase than inducing radiotherapy and, perhaps, chemotherapy protocols may for other stress-related kinases such as JNK and p38, previously enhance the killing of cancer cells and spare normal cells at the same reported to be inhibited only partially, or not inhibited at all, by the time. PCPH oncoprotein in murine fibroblasts and other cell types (21, 58). Fig. 8 depicts a scheme of the antagonistic interaction between mTOR and PCPH in the response of MEF3T3 cells to IR. This antagonism REFERENCES may have clinical implications for tumor management, more specifi- 1. Green, D. R., and Reed, J. C. Mitochondria and apoptosis. Science (Wash. DC), 281: cally, for the outcome of radiotherapeutic treatments. Results from our 1309–1312, 1998. 2. Rich., T., Allen, R. L., and Wyllie, A. H. Defying death after DNA damage. Nature laboratory have shown that PCPH expression is frequently deregu- (Lond.), 407: 777–783, 2000. lated in tumor cell lines (19) and in animal (20) and human (18) tumor 3. Abraham, R. T. Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes Dev., 15: 2177–2196, 2001. development. It is possible that alterations in PCPH expression may 4. Ashcroft, M., Taya, Y., and Vousden, K. H. Stress signals utilize multiple pathways render tumor cells resistant to IR, and perhaps other DNA-damaging to stabilize p53. Mol. Cell. Biol., 20: 3224–3233, 2000. agents, by preventing mTOR activation and signaling. 5. Higashimoto, Y., Saito, S., Tong, X-H., Hong, A., Sakaguchi, K., Appella, E., and Anderson, C. W. Human p53 is phosphorylated on serines 6 and 9 in response to The nature of the mechanism by which the increased mTOR protein DNA damage-inducing agents. J. Biol. Chem., 275: 23199–23203, 2000. content induced by IR is maintained in a phosphorylated state remains 6. Saito, S., Goodarzi, A. A., Higashimoto, Y., Noda, Y., Lees-Miller, S. P., Appella, E., unknown at this time. A novel pathway in which the mitogenic and Anderson, C. W. ATM mediates phosphorylation at multiple p53 sites, including Ser46, in response to ionizing radiation. J. Biol. Chem., 277: 12491–12494, 2002. activation of mTOR is mediated by PA has been reported recently (59, 7. Abraham, R. T. Mammalian target of rapamycin: immunosuppressive drugs uncover 60). Interestingly, PA is the main product of PLD, and our laboratory a novel pathway of cytokine receptor signaling. Curr. Opin. Immunol., 10: 330–336, 1998. reported earlier that IR exposure activates PLD (61). Therefore, it is 8. Castedo, M., Ferri, K. F., Blanco, J., Roumier, T., Larochette, N., Barretina, J., possible that IR-induced PA may activate mTOR in our system. Amendola, A., Nardacci, R., Me`tivier, D., Este, J. A., Piacentini, M., and Kroemer, 6297

G. Human immunodeficiency virus 1 envelope glycoprotein complex-induced apo- 35. Desai, B. N., Myers, B. R., and Schreiber, S. L. FKBP12-rapamycin-associated ptosis involves mammalian target of rapamycin/FKBP12-rapamycin-associated protein associates with mitochondria and senses osmotic stress via mitochondrial protein-mediated p53 phosphorylation. J. Exp. Med., 194: 1097–1110, 2001. dysfunction. Proc. Natl. Acad. Sci.USA,99: 4319–4324, 2002. 9. Castedo, M., Roumier, T., Blanco, J., Ferri, K. F., Barretina, J., Tintignac, L. A., 36. Zhang, X., Shu, L., Hosoi, H., Murti, K. G., and Houghton, P. J. Predominant nuclear Andreau, K., Perfettini, J. L., Amendola, A., Nardacci, R., Leduc, P., Ingber, D. E., localization of mammalian target of rapamycin in normal and malignant cells in Druillennec, S., Roques, B., Leibovitch, S. A., Vilella-Bach, M., Chen, J., Este, J. A., culture. J. Biol. Chem., 277: 28127–28134, 2002. Modjtahedi, N., Piacentini, M., and Kroemer, G. Sequential involvement of Cdk1, 37. Abraham, R. T., and Wiederrecht, G. J. Immunopharmacology of rapamycin. Annu. mTOR and p53 in apoptosis induced by the HIV-1 envelope. EMBO J., 21: 4070– Rev. Immunol., 14: 483–510, 1996. 4080, 2002. 38. Dumont, F. J., and Su, Q. Mechanism of action of the immunosuppressant rapamycin. 10. Banin, S., Moyal, L., Shieh, S., Taya, Y., Anderson, C. W., Chessa, L., Smorodinsky, Life Sci., 58: 373–395, 1996. N. I., Prives, C., Reiss, Y., Shiloh, Y., and Ziv, Y. Enhanced phosphorylation of p53 39. Duriez, P. J., and Shah, G. M. Cleavage of poly(ADP-ribose) polymerase: a sensitive by ATM in response to DNA damage. Science (Wash. DC), 281: 1674–1677, 1998. parameter to study cell death. Biochem. Cell Biol., 75: 337–349, 1997. 11. Canman, C. E., Lim, D. S., Cimprich, K. A., Taya, Y., Tamai, K., Sakaguchi, K., 40. Yamakawa, H., Banno, Y., Nakashima, S., Yoshimura, S., Sawada, M., Nishimura, Appella, E., Kastan, M. B., and Siliciano, J. D. Activation of the ATM kinase by Y., Nozawa, Y., and Sakai, N. Crucial role of calpain in hypoxic PC12 cell death: ionizing radiation and phosphorylation of p53. Science (Wash. DC), 281: 1677–1679, calpain, but not caspases, mediates degradation of cytoskeletal proteins and protein 1998. kinase C-␣ 32 and -␦. Neurol. Res., 23: 522–530, 2001. 12. Tee, A. R., and Proud, C. G. DNA-damaging agents cause inactivation of translational 41. Chao, C., Saito, S., Anderson, C. W., Appella, E., and Xu, Y. Phosphorylation of regulators linked to mTOR signalling. Oncogene, 19: 3021–3031, 2000. murine p53 at ser-18 regulates the p53 responses to DNA damage. Proc. Natl. Acad. 13. Castedo, M., Ferri, K. F., and Kroemer, G. Mammalian target of rapamycin (mTOR): Sci. USA, 97: 11936–11941, 2000. pro- and anti-apoptotic. Cell Death Differ., 9: 99–100, 2002. 42. Lohrun, M. A. E., and Vousden, K. H. Regulation and activation of p53 and its family 14. Harada, H., Andersen, J. S., Mann, M., Terada, N., and Korsmeyer, S. J. p70S6 kinase members. Cell Death Differ., 6: 1162–1168, 1999. signals cell survival as well as growth, inactivating the pro-apoptotic molecule BAD. 43. Chao, C., Saito, S., Kang, J., Anderson, C. W., Appella, E., and Xu, Y. p53 Proc. Natl. Acad. Sci. USA, 98: 9666–9670, 2001. transcriptional activity is essential for p53-dependent apoptosis following DNA 15. Eshleman, J. S., Carlson, B. L., Mladek, A. C., Kastner, B. D., Shide, K. L., and damage. EMBO J., 19: 4967–4975, 2000. Sarkaria, J. N. Inhibition of the mammalian target of rapamycin sensitizes U87 44. Han, J., Flemington, C., Houghton, A. B., Gu, Z., Zambetti, G. P., Lutz, R. J., Zhu, xenografts to fractionated radiation therapy. Cancer Res., 62: 7291–7297, 2002. L., and Chittenden, T. Expression of bbc3, a pro-apoptotic BH3-only gene, is 16. Velasco, J. A., Castro, R., Avila, M. A., Laborda, J., DiPaolo, J. A., Cansado, J., and regulated by diverse cell death and survival signals. Proc. Natl. Acad. Sci. USA, 98: Notario, V. cph, a novel oncogene which cooperates with H-ras in the transformation 11318–11323, 2001. of NIH/3T3 fibroblasts. Oncogene, 9: 2065–2069, 1994. 45. Nakano, K., and Vousden, K. H. PUMA, a novel proapoptotic gene, is induced by 17. Velasco, J. A., Zimonjic, D. B., Popescu, N. C., Cansado, J., DiPaolo, J. A., Albor, p53. Mol. Cell, 7: 683–694, 2001. A., and Notario, V. Tissue-specific expression, evolutionary conservation and local- 46. Oda, K., Arakawa, H., Tanaka, T., Matsuda, K., Tanikawa, C., Mori, T., Nishimori, ization of the cph proto-oncogene on Syrian hamster chromosome X. Oncogene, 12: H., Tamai, K., Tokino, T., Nakamura, Y., and Taya, Y. p53AIP1, a potential mediator 2713–2717, 1996. of p53-dependent apoptosis, and its regulation by Ser-46-phosphorylated p53. Cell, 18. Blańquez, M. J., Regadera, J., Marinõ, J., Newman, R. E., and Notario, V. Gradual 102: 849–862, 2000. deregulation and loss of PCPH expression in the progression of human laryngeal 47. Oda, E., Ohki, R., Murasawa, H., Nemoto, J., Shibue, T., Yamashita, T., Tokino, T., neoplasia. Mol. Carcinog., 35: 186–195, 2002. Taniguchi, T., and Tanaka, N. Noxa, a BH3-only member of the Bcl-2 family and 19. Rouzaut, A., Recio, J. A., and Notario, V. Expression of the protein product of the candidate mediator of p53-induced apoptosis. Science (Wash. DC), 288: 1053–1058, PCPH proto-oncogene in human tumor cell lines. Radiat. Res., 155: 181–187, 2001. 2000. 20. Solanas, M., Escrich, E., Rouzaut, A., Costa, I., and Notario, V. Deregulated expres- 48. Yu, J., Zhang, L., Hwang, P. M., Kinzler, K. W., and Vogelstein, B. PUMA induces sion of the PCPH proto-oncogene in rat mammary tumors induced with 7,12- the rapid apoptosis of colorectal cancer cells. Mol. Cell., 7: 673–682, 2001. dimethylbenz(a)anthracene. Mol. Carcinog., 33: 219–227, 2002. 49. Miyashita, T., and Reed, J. C. Tumor suppressor p53 is a direct transcriptional 21. Recio, J. A., Paéz, J. G., Sanders, S., Kawakami, T., and Notario, V. Partial depletion activator of the human bax gene. Cell, 80: 293–299, 1995. of intracellular ATP mediates the stress-survival function of the PCPH oncoprotein. 50. Huang, D. C. S., and Strasser, A. BH3-only proteins—essential initiators of apoptotic Cancer Res., 62: 2690–2694, 2002. cell death. Cell, 103: 839–842, 2000. 22. Velasco, J. A., Avila, M. A., and Notario, V. The product of the cph oncogene is a 51. Schuler, M., Bossy-Wetzel, E., Goldstein, J. C., Fitzgerald, P., and Green, D. R. p53 truncated, nucleotide binding protein that enhances cellular survival to stress. Onco- induces apoptosis by caspase activation through mitochondrial cytochrome c release. gene, 18: 689–701, 1999. J. Biol. Chem., 275: 7337–7342, 2000. 23. Paéz, J. G., Recio, J. A., Rouzaut, A., and Notario, V. Identity between the PCPH 52. Yu, J., Wang, Z., Kinzler, K. W., Vogelstein, B., and Zhang, L. PUMA mediates the proto-oncogene and the CD39L4 (ENTPD5) ectonucleoside triphosphate diphospho- apoptotic response to p53 in colorectal cancer cells. Proc. Natl. Acad. Sci. USA, 100: hydrolase gene. Int. J. Oncol., 19: 1249–1254, 2001. 1931–1936, 2003. 24. Prasad, S., Notario, V., Sharareh, S., and Dritschilo, A. Poly(ADP-ribose) polymerase 53. Dennis, P. B., Jaeschke, A., Saitoh, M., Fowler, B., Kozma, S. C., and Thomas, G. in HeLa cells—a high resolution two-dimensional gel analysis. Appl. Theor. Elec- Mammalian TOR: a homeostatic ATP sensor. Science (Wash. DC), 294: 1102–1105, trophoresis, 4: 3–10, 1994. 2001. 25. Phillips, H. J. Dye exclusion tests for cell viability. In: P. F. Kruse and M. K. 54. Gossen, M., and Bujard, H. Tight control of gene expression in mammalian cells by Patterson (eds.), Tissue Culture. Methods and Applications, pp. 406–408. New York: tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA, 89: 5547–5551, 1992. Academic Press, 1973. 55. Yarosh, D. B., Cruz, P. D., Dougherty, I., Bizios, N., Kibitel, J., Goodtzova, K., Both, 26. Grinthal, A., and Guidotti, G. Substitution of His59 converts CD39 apyrase into an D., Goldfarb, S., Green, B., and Brown, D. FRAP DNA-dependent protein kinase ADPase in a quaternary structure dependent manner. Biochemistry, 39: 9–16, 2000. mediates a late signal transduced from ultraviolet-induced DNA damage. J. Investig. 27. Hicks-Berger, C. A., Yang, F., Smith, T. M., and Kirley, T. L. The importance of Dermatol., 114: 1005–1010, 2000. histidine residues in human ecto-nucleoside triphosphate diphosphohydrolase-3 as 56. Fingar, D. C., Salama, S., Tsou, C., Harlow, E., and Blenis, J. Mammalian cell size determined by site-directed mutagenesis. Biochim. Biophys. Acta, 1547: 72–81, is controlled by mTOR and its downstream targets S6K1 and 4EBP1/eIF4E. Genes 2001. Dev., 16: 1472–1487, 2002. 28. Schulte am Esch, J., II, Sevigny, J., Kaczmarek, E., Siegel, J. B., Imai, M., Koziak, 57. Ferri, K. F., Jacotot, E., Blanco, J., Este, J. A., Zamzami, N., Susin, S. A., Xie, Z., K., Beaudoin, A. R., and Robson, S. C. Structural elements and limited proteolysis of Brothers, G., Reed, J. C., Penninger, J. M., and Kroemer, G. Apoptosis control in CD39 influence ATP diphosphohydrolase activity. Biochemistry, 38: 2248–2258, syncytia induced by the HIV type 1-envelope glycoprotein complex: role of mito- 1999. chondria and caspases. J. Exp. Med., 192: 1081–1092, 2000. 29. Smith, T. M., Lewis Carl, S. A., and Kirley, T. L. Mutagenesis of two conserved 58. Recio, J. A., Paéz, J. G., Maskeri, B., Loveland, M., Velasco, J. A., and Notario, V. tryptophan residues of the E-type ATPases: inactivation and conversion of an ecto- Both normal and transforming PCPH proteins have guanosine diphosphatase activity, apyrase to an ecto-NTPase. Biochemistry, 38: 5849–5857, 1999. but only the oncoprotein co-operates with Ras in activating extracellular signal- 30. Smith, T. M., and Kirley, T. L. Site-directed mutagenesis of a human brain ecto- regulated kinase ERK1. Cancer Res., 60: 1720–1728, 2000. apyrase: evidence that the E-type ATPases are related to the actin/heat shock 70/sugar 59. Chen, J., and Fang, Y. A novel pathway regulating the mammalian target of rapa- kinase superfamily. Biochemistry, 38: 321–328, 1999. mycin (mTOR) signaling. Biochem. Pharmacol., 64: 1071–1077, 2002. 31. Yang, F., Hicks-Berger, C. A., Smith, T. M., and Kirley, T. L. Site-directed mutagen- 60. Fang, Y., Vilella-Bach, M., Bachmann, R., Flanigan, A., and Chen, J. Phosphatidic esis of human nucleoside triphosphate diphosphohydrolase 3: the importance of acid-mediated mitogenic activation of mTOR signaling. Science (Wash. DC), 294: residues in the apyrase conserved regions. Biochemistry, 40: 3943–3950, 2001. 1942–1945, 2001. 32. Miura, M., Watanabe, H., Okochi, K., Sasaki, T., and Shibuya, H. Biological response 61. Avila, M. A., Otero, G., Cansado, J., Dritschilo, A., Velasco, J. A., and Notario, V. to ionizing radiation in mouse embryo fibroblasts with a targeted disruption of the Activation of phospholipase D: alternative signal transduction pathway responsive to DNA polymerase ␤ gene. Radiat. Res., 153: 773–780, 2000. ␥-radiation. Cancer Res., 53: 4474–4476, 1993. 33. Sekuliƒ, A., Hudson, C. C., Homme, J. L., Yin, P., Otterness, D. M., Karnitz, L. M., 62. Dunkirk, S. G., Wallert, M. A., Baumgartner, M. L., and Provost, J. J. Isolation and and Abraham, R. T. A direct linkage between the phosphoinositide 3-kinase-AKT characterization of a 66-kDa protein from rat liver plasma membrane with RhoA- signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and stimulated phospholipase D activity. Protein Expr. Purif., 24: 1–12, 2002. transformed cells. Cancer Res., 60: 3504–3513, 2000. 63. Blagosklonny, M. V., and Darzynkiewicz, Z. Cyclotherapy: protection of normal cells 34. Kim, J. E., and Chen, J. Cytoplasmic-nuclear shuttling of FKBP12-rapamycin- and unshielding of cancer cells. Cell Cycle, 1: 375–382, 2002. associated protein is involved in rapamycin-sensitive signaling and translation initi- 64. Hidalgo, M., and Rowinsky, E. K. The rapamycin-sensitive signal transduction ation. Proc. Natl. Acad. Sci. USA, 97: 14340–14345, 2000. pathway as a target for cancer therapy. Oncogene, 19: 6680–6686, 2000.

6298

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2003 American Association for Cancer Research. The PCPH Oncoprotein Antagonizes the Proapoptotic Role of the Mammalian Target of Rapamycin in the Response of Normal Fibroblasts to Ionizing Radiation

Oscar M. Tirado, Silvia Mateo-Lozano, Sean Sanders, et al.

Cancer Res 2003;63:6290-6298.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/63/19/6290

Cited articles This article cites 62 articles, 29 of which you can access for free at: http://cancerres.aacrjournals.org/content/63/19/6290.full#ref-list-1

Citing articles This article has been cited by 8 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/63/19/6290.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/63/19/6290. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.