EXPRESSION AND ACTIONS OF CONNECTIVE TISSUE GROWTH FACTOR
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Amy Wilson Rachfal
*****
The Ohio State University 2003
Dissertation Committee: Approved by Professor David R. Brigstock, Advisor
Professor K. Reed Clark ______Professor Nick Flavahan Advisor Molecular, Cellular Developmental Biology Program Professor Tom Sferra
ABSTRACT
Connective tissue growth factor (CTGF/CCN2) is an extracellular matrix-associated
matricellular protein that regulates diverse cellular activities including adhesion,
migration, mitogenesis, differentiation and survival. The broad biological properties of
CTGF/CCN2 in many cell types likely reflect its ability to bind to a variety of cell surface
molecules (integrins, low density lipoprotein receptor-related protein, heparin sulfate
proteoglycans) as well as to other bioactive molecules. CTGF/CCN2 synthesis can be
stimulated by a variety of molecules including transforming growth factor β1 (TGF-β1)
which appears to play a major role in the transcriptional activation of the CTGF/CCN2
gene in matrigenic and fibrogenic pathways.
This dissertation encompasses the relationship between CTGF/CCN2 and organ
fibrosis, TGF-β1 action, gene regulation, pediatric desmoplastic tumors as well as its role in uterine function. Recombinant adeno-associated virus delivery of the CTGF/CCN2 gene was attempted to determine whether CTGF/CCN2 was directly linked to the progression of organ fibrosis. However, since little or no protein was generated in vivo using this system, it could not be deduced whether over-expression of CTGF/CCN2 alone could drive fibrosis. In vitro studies with fibroblasts and hepatic stellate cells (HSCs) demonstrated that TGF-β1, alcohol or CTGF/CCN2 itself could up-regulate CTGF/CCN2
ii transcription. Additionally, after heparin- or EDTA-dependent HSC adhesion to
CTGF/CCN2, preliminary gene array experiments demonstrated a series of genes that
were transcriptionally up-regulated including, collagen α-1-type I, fibronectin, GRO
oncogene, secreted acidic cysteine rich glycoprotein, tenasin C and tissue inhibitor of matrix metalloproteinase. Further, RT-PCR analysis of similar experiments showed that hepatocyte growth factor, a potent mitogen that accelerates recovery from hepatic fibrosis, was down regulated. In addition, two pediatric fibrotic diseases, congenital hepatic fibrosis and desmoplastic small round cell tumor, were shown to produce elevated levels of CTGF/CCN2, consistent with its pro-fibrogenic properties. Finally, studies demonstrated that uterine CTGF/CCN2 gene transcription is regulated by maternal sex steroids and TGF-β1-dependent and –independent mechanisms. Further data indicated that the epithelium is a key source of CTGF/CCN2 in the mammalian uterus and that CTGF/CCN2 likely plays a role in regulating stromal cell function and placental neovascularization.
iii
Dedicated to my family and husband
iv
ACKNOWLEDGMENTS
I wish to offer my heartfelt thanks to my advisor, David R. Brigstock, Ph.D. His
encouragement, intellectual guidance and enthusiasm made this degree possible and for
that, I am tremendously grateful and deeply honored.
I am also thankful to my committee, K. Reed Clark, Ph.D., Nicholas Flavahan,
Ph.D. and Thomas Sferra, M.D. for their support, scientific discussions and guidance.
I also wish to thank the Viral Vector Core and Microarray Core staff for help with
large-scale viral production, technical assistance and microarray hybridization.
I am grateful to Essam Moussad, Ph.D. and Mona Rageh, Ph.D. for their work
with porcine and murine uteri, Ruping Gao, Ph.D., M.D. for isolation of rat hepatic stellate cells, DeAnna Ball, Ph.D. and Sherri Kemper for generating recombinant
CTGF/CCN2, Kris Backstrom, M.S. for assistance with viral delivery to the liver,
Guliang Xia, Ph.D., M.D. for assistance with viral delivery to the muscle, as well as Mark
Luquette, M.D. for pathology samples, scientific discussions and microscope assistance.
This research was supported by grants from the USDA (grant 9803693), NIH
(grant AA12817-02) and Children’s Research Institute.
v
VITA
Born: November 6, 1972 Columbus, OH, USA
Education
1998-2003 Ph.D., Molecular, Cellular and Developmental Biology (MCDB) The Ohio State University, Columbus, OH Principal Investigator: David R. Brigstock Ph.D.
1994-1997 M.S., Molecular Genetics, The Ohio State University, Columbus, OH
1990-1994 B.A., Ohio Wesleyan University, Delaware, OH Major: Zoology, Minor: Chemistry
Employment History
2000 Preparing Future Faculty fellowship recipient Developed a mentoring relationship with Dr. Simon Lawrence at Otterbein College for the spring semester. Designed and taught multiple labs as well as prepared and gave a lecture to a molecular genetics class.
1998-2003 Graduate Research Assistant, David Brigstock, Ph.D. Children’s Hospital, Columbus, OH Project: Research toward Ph.D
1998 Graduate Teaching Assistant, The Ohio State University, Columbus, OH General Biology (101), Autumn quarter Professor: Dr. Michael Mangino
1997-1998 Research Associate, David Brigstock, Ph.D. Children’s Hospital, Columbus, OH Project: Recombinant production and signal transduction of CTGF
vi 1994-1997 Graduate Research Assistant, Ellen Gottlieb, Ph.D. The Ohio State University, Columbus, OH Project: Research toward M.S.
1995 Graduate Teaching Assistant, The Ohio State University, Columbus, OH General Biology (113), spring quarter Professor: Dr. Johnson
1993 Research Assistant, The Ohio State University through Ohio Wesleyan University, funded by Howard Hughes Summer Research Fellowship Project: The detection of conserved microsattellite regions in the 21-OH region of domesticated species.
1993 Independent Study, Ohio Wesleyan University, Delaware, OH Project: Comparing ancient enterobacter from a mastodon gut to the modern day equivalent.
PUBLICATIONS
Published Papers
Rachfal A. W., Brigstock, D. R., (2003) Connective tissue growth factor in hepatic fibrosis. Hepatology Research 26(1) 1-9
Xia, G., Rachfal, A. W., Besner, G. E., (2003) Upregulation of endogenous heparin- binding EGF-like growth factor (HB-EGF) expression after intestinal ischemia/reperfusion injury. J Invest Surg 16(2) 57-63
Ball, D. A., Rachfal, A. W., Kemper S. A., Brigstock D. R., (2003) The heparin-binding 10 kDa fragment of connective tissue growth factor (CTGF) containing module 4 alone stimulates cell adhesion. J. Endocrinology 176 R1-R7
Park, H.O., Kang, P. J., Rachfal, A. W. (2002) Localization of the Rsr1/Bud1 GTPase involved in selection of proper growth site in yeast. J. Biol Chem, 277(30) 26721-4
Moussad, E.E.A., Rageh, M.A.E., Wilson, A.K., Geisert, R.D., Brigstock, D.R. (2002) Temporal and spatial expression of connective tissue growth factor (CTGF/CCN2) and transforming growth factor beta type 1 (TGF-β1) at the utero-placental interface during early pregnancy in the pig. Mol Pathol, 55 186-192
Rageh, M.A.E., Moussad E., Wilson, A.K., Brigstock, D.R. (2001) Steroidal regulation of connective tissue growth factor (CCN2; CTGF) synthesis in the mouse uterus. Mol Pathol 54(5) 338-346
vii Surveyor, G.A. Wilson, A.K., and Brigstock, D.R. (1998) Localization of connective tissue growth factor during the period of embryo implantation in the mouse. Biol Reprod 59 1207-1213
Published Abstracts
Rachfal A.W., Clark, KR, Luquette, M. Brigstock DR. (2003) rAAV-mediated CTGF gene overexpression in skeletal muscle in vivo is associated with muscle fiber atrophy. Mol Pathol 56 P08.
Wilson, A.K., Clarke, K.R. and Brigstock, D.R. (2001) Novel models of CTGF transgenesis in vivo: Recombinant adeno-associated viral (rAAV) mediated delivery of the CTGF gene. J Clin Pathol: Mol Pathol 54, P5.
Wilson, A.K., Clark K.R., Sferra T.J. and Brigstock D.R. (2001) Gene transfer to hepatic stellate cells using recombinant adeno-associated virus. Hepatology 34 No.4 Pt 2 Abstract #1303.
FIELDS OF STUDY
Major Field: Molecular, Cellular and Developmental Biology
viii
TABLE OF CONTENTS
P a g e
Abstract...... ii
Dedication...... iv
Acknowledgments ...... v
Vita ...... vi
List of Tables...... xiii
List of Figures ...... xiv
List of Abbreviations...... xvi
Chapters:
1. A general review of the connective tissue growth factor (CTGF/CCN2). . . 1 molecule
1.1 Discovery...... 1 1.2 CCN gene family...... 1 1.3 CCN family modular structure...... 5 1.4 CTGF/CCN2 and heparin interactions...... 8 1.5 CTGF/CCN2 and intracellular signaling...... 8 1.6 The link between TGF-β and CTGF/CCN2...... 10 1.7 CTGF/CCN2 action in normal processes...... 12 1.7.1 CTGF/CCN2 in development...... 13 1.7.2 CTGF/CCN2 in uterine biology...... 13 1.7.3 CTGF/CCN2 and bone development...... 15 1.7.4 CTGF/CCN2 in limb regeneration...... 15 1.7.5 CTGF/CCN2 in wound healing...... 16 1.7.6 CTGF/CCN2 in apoptosis and cell survival...... 17 1.7.7 CTGF/CCN2 in angiogenesis...... 18
ix 1.8 CTGF/CCN2 action in pathological disease processes...... 20 1.8.1 CTGF/CCN2 and tumorigenesis...... 20 1.8.2 CTGF/CCN2 in fibrotic skin disorders...... 23 1.8.3 CTGF/CCN2 in atherosclerosis...... 23 1.8.4 CTGF/CCN2 in organ fibrosis...... 24
2. rAAV mediated CTGF/CCN2 gene delivery...... 31
2.1 Introduction...... 31 2.1.1 CTGF/CCN2 in muscle fibrosis...... 31 2.1.2 CTGF/CCN2 in liver fibrosis...... 32 2.1.3 In vivo CTGF/CCN2 delivery...... 34 2.1.4 Viral delivery of CTGF/CCN2...... 36 2.2 Materials and methods...... 39 2.2.1 Materials...... 39 2.2.2 Infection of HSC-T6 cells with rAAV-CMV-β-gal, rAAV-CMV-GUS, rAAV-EF1α-GUS...... 41 2.2.3 Cloning strategy...... 42 2.2.4 Verification of CTGF/CCN2 protein production...... 43 2.2.5 Passage assay...... 44 2.2.6 Verification of correct replication intermediates...... 44 2.2.7 Selection of rAAV-CTGF/CCN2 producer cell lines...... 45 2.2.8 Characterization of final producer cell lines...... 47 2.2.9 rAAV-CMV-CTGF and rAAV-EF1α-CTGF infection of HSC-T6 cells...... 48 2.2.10 rAAV-CTGF/CCN2 delivery to mouse muscles and liver. . . 51 2.3 Results...... 53 2.3.1 Verification of CTGF/CCN2 protein production from triple-play vectors...... 53 2.3.2 Verification of production of viable virus from rAAV-CMV-CTGF and rAAV-EF1α-CTGF clones...... 54 2.3.3 Selection of rAAV-CTGF/CCN2 producer cell lines...... 55 2.3.4 Characterization of final producer cell lines...... 55 2.3.5 In vitro infection of HSC-T6 cells by rAAV virus...... 56 2.3.6 rAAV-CMV-CTGF delivery to the muscle...... 57 2.3.7 rAAV-EF1α-CTGF delivery to the liver...... 59 2.4 Discussion...... 61 2.4.1 Performance of rAAV-CTGF viruses in vitro...... 61 2.4.2 Performance of rAAV-CTGF viruses in vivo...... 62 2.4.3 Summary...... 66
3. CTGF/CCN2 action in vitro...... 80
3.1 Introduction...... 80 3.1.1 CTGF/CCN2 action in various cell types...... 80 x 3.1.2 Mechanisms of action...... 81 3.2 Materials and methods...... 84 3.2.1 Materials...... 84 3.2.2 Primary HSC isolation...... 85 3.2.3 Treatment of cells with exogenous stimulants in vitro...... 86 3.2.4 RNA isolation from cells...... 87 3.2.5 RT-PCR...... 87 3.2.6 Cell adhesion...... 88 3.2.7 Immunocytochemistry...... 89 3.2.8 Microarray and gene array analysis...... 90 3.3 Results...... 91 3.3.1 CTGF/CCN2 gene transcription is increased in response to TGF-β1, acetaldehyde and EtOH in Balb/c 3T3 fibroblasts...... 91 3.3.2 CTGF/CCN2 and TGF-β1 induce changes in a hepatic stellate cell line...... 92 3.3.3 Exogenous treatment of primary activated hepatic stellate cells with CTGF/CCN2...... 92 3.3.4 CTGF/CCN2 promotes cell adhesion to multiple cell types...... 93 3.3.5 Hepatocyte growth factor (HGF) mRNA is down- regulated following adhesion of HSCs to CTGF/CCN2. . . . . 94 3.3.6 HSC adhesion to CTGF/CCN2 causes the up-regulation of genes involved in angiogenesis and adhesion...... 95 3.4 Discussion...... 95 3.4.1 TGF-β1, alcohol and CTGF/CCN2 up-regulate CTGF/CCN2 mRNA transcription...... 95 3.4.2 Cell adhesion to CTGF/CCN2...... 97 3.4.3 Cell adhesion to CTGF/CCN2 up-regulates mRNA expression...... 98 3.4.4 Summary...... 102
4. CTGF/CCN2 is expressed in two pediatric diseases associated with fibrosis: congenital hepatic fibrosis (CHF) and desmoplastic small round cell tumor (DSRCT)...... 113
4.1 Introduction...... 113 4.1.1 CTGF/CCN2 and fibrosis...... 113 4.1.2 Congenital hepatic fibrosis...... 114 4.1.3 Desmoplastic small round cell tumor...... 115 4.2 Materials and methods...... 117 4.2.1 Materials...... 117 4.2.2 mRNA probe synthesis...... 118 4.2.3 In situ hybridization for CTGF/CCN2...... 118 4.2.4 Immunohistochemistry for CTGF/CCN2...... 119
xi 4.2.5 RT-PCR for DSRCT translocation...... 120 4.3 Results...... 120 4.3.1 CHF in situ hybridization and immunohistochemistry results...... 120 4.3.2 DSRCT in situ hybridization and immunohistochemistry results...... 121 4.4 Discussion...... 122 4.4.1 CTGF/CCN2 in CHF...... 122 4.4.2 CTGF/CCN2 in DSRCT...... 123 4.4.3 Summary...... 126
5. CTGF/CCN2 in uterine biology...... 131
5.1 Introduction...... 131 5.1.1 CTGF/CCN2 in uterine luminal fluid...... 131 5.1.2 CTGF/CCN2 in uterine tissue...... 132 5.1.3 Conserved function...... 133 5.2 Materials and methods...... 134 5.2.1 Materials...... 134 5.2.2 Animals...... 135 5.2.2.1 Pigs...... 135 5.2.2.2 Mice...... 136 5.2.3 RT-PCR...... 137 5.2.4 mRNA probe synthesis...... 138 5.2.5 In situ hybridization for CTGF/CCN2 and TGF-β1...... 139 5.2.6 Immunohistochemistry for CTGF/CCN2 and TGF-β1...... 139 5.3 Results...... 140 5.3.1 In vitro CTGF/CCN2 production and regulation...... 140 5.3.2 CTGF/CCN2 and TGF-β1 production during the estrous cycle of the pig...... 140 5.3.3 CTGF/CCN2 and TGF-β1 production during early pig pregnancy...... 141 5.3.4 CTGF/CCN2 and TGF-β1 expression in mouse pseudopregnancy...... 143 5.3.5 Steroid hormone effects in the mouse uterus...... 144 5.4 Discussion...... 146 5.4.1 CTGF/CCN2 expression and localization in the pig and mouse uterus...... 146 5.4.2 Summary...... 151
List of references...... 159
xii
LIST OF TABLES
Table Page
2.1 Vectors used for CTGF/CCN2 studies ...... 68
2.2 Viral vector copies per cell of infected muscle or liver...... 69
3.1 Primer sequences used in Chapter 3 ...... 103
3.2 Genes up-regulated with 24 hours of exogenous CTGF/CCN2 stimulation of primary activated HSCs ...... 104
3.3 Genes up-regulated with primary activated HSC adhesion to CTGF/CCN2 for 8 hours...... 105
4.1 Clinical features of 3 patients with DSRCT...... 127
xiii
LIST OF FIGURES
Figure Page
1.1 Modular structure of the CCN proteins...... 29
1.2 Pathways of CTGF/CCN2 production and action in hepatic fibrosis . . . 30
2.1 Cloning strategy for rAAV-CMV-CTGF and rAAV-EF1α-CTGF . . . . 70
2.2 CTGF/CCN2 production by rAAV-CMV-CTGF and rAAV-EF1α-CTGF triple play vectors...... 71
2.3 rAAV-CTGF passage assay; viable virus can be made from rAAV-CTGF vectors...... 72
2.4 Southern blot for rAAV replication intermediates...... 73
2.5 Producer cell line selection and production...... 74
2.6 Southern blot of rAAV-CTGF capsid DNA...... 75
2.7 rAAV can infect HSC-T6 cells...... 76
2.8 rAAV-CMV-CTGF can infect HSC-T6 cells in vitro...... 77
2.9 rAAV-CMV-CTGF injection into mouse quadriceps...... 78
2.10 rAAV-EF1a-CTGF injection into mouse livers...... 79
3.1 CTGF/CCN2 is transcriptionally up-regulated in response to TGF-β1, acetaldehyde and EtOH...... 106
3.2 HSC-T6 cells respond to CTGF/CCN2 and TGF-β1...... 107
xiv 3.3 Heparin and EDTA dependence of 10 kDa CTGF/CCN2-mediated adhesion in multiple cell types...... 108
3.4 Heparin and EDTA dependence of 20-38 kDa CTGF/CCN2-mediated adhesion in multiple cell type...... 109
3.5 HGF is down-regulated in HSCs after adherence to CTGF/CCN2 for 8 hours...... 110
3.6 Time course of HGF mRNA expression in HSC-T6 cells adhered to CTGF/CCN2...... 111
3.7 Genes up-or down-regulated following adhesion of primary activated HSCs to CTGF/CCN2...... 112
4.1 CTGF/CCN2 mRNA and protein expression in CHF...... 128
4.2 CTGF/CCN2 mRNA and protein expression in DSRCT...... 129
4.3 Cellular localization of CTGF/CCN2 protein and mRNA in DSRCT. .130
5.1 In vitro CTGF/CCN2 expression and regulation in pig uterine cells. . .152
5.2 CTGF/CCN2 and TGF-β1 localization in the pig uterine tract during the estrous cycle...... 153
5.3 CTGF/CCN2 and TGF-β1 localization in the pig uterus during early pregnancy...... 154
5.4 Uterine CTGF/CCN2 and TGF-β1 in pseudopregnant mice...... 155
5.5 Steroidal regulation of uterine CTGF/CCN2 and TGF-β1...... 156
5.6 Steroidal regulation of uterine CTGF/CC2 and TGF-β1 (summary). . .158
xv
LIST OF ABBREVIATIONS
α−SMA α-smooth muscle actin
AAV adeno-associated virus
Ad adenovirus
ALD alcoholic liver disease
BAEC bovine aortic endothelial cells
BCIP 5-bromo-4-chloro-3-indolyl phosphate
BDL bile duct ligation bFGF basic fibroblast growth factor
BMD Becker muscular dystrophy
BMP bone morphogenic protein bp base pairs
C-terminal carboxy-terminal
CEASAR cis-acting element of structure-anchored repression
CHF congenital hepatic fibrosis
CHO Chinese hamster ovary
CMD congenital muscular dystrophy
CMV cytomegalovirus
xvi CPE cytopathic effect
CTGF connective tissue growth factor
CYR61 cysteine rich dH2O distilled water
DIG digoxigenin
DMD Duchenne muscular dystrophy
DMEM Dulbecco’s modification of Eagle’s medium
DMF dimethyl formamide
DMSO dimethylsulfoxide
DNA deoxynucleic acid
DRP DNase resistant particle
DSRCT desmoplastic small round cell tumor
E2 estradiol –17 β
ECM extracellular matrix
EEM extra embryonic membrane
EF1α elongation factor 1-α
EtOH ethanol
EST expressed sequence tag
FAK focal adhesion kinase
FBS fetal bovine serum
GAPDH glyceraldehyde-3-phosphate dehydrogenase
GEC glandular epithelial cell xvii GMCSF granulocyte macrophage colony stimulatory factor
GRMD golden retriever muscular dystrophy
GST glutathione-S-transferase
HGF hepatocyte growth factor
HMVEC human microvascular endothelial cells
HRP horse radish peroxidase
HSC hepatic stellate cells
HSPG heparan sulfate proteoglycan
HUVEC human umbilical endothelial cells
IEC intestinal epithelial cell
IGFBP insulin growth factor binding protein
IHC immunohistochemistry
ISH in situ hybridization
ITR inverted terminal repeat
IU infectious unit
LDHA lactate dehydrogenase A
LEC luminal epithelial cell
LRP low density lipoprotein receptor-related protein
MAPK mitogen activated protein kinase
MCP monocyte chemo-attractant protein
MMP matrix metalloproteinase
MOI multiplicity of infection
MRLC myosin regulatory light chain
xviii mRNA messenger ribonucleic acid
NASH non-alcoholic steatohepatitis
NBT nitro blue tetrazolium
NOV nephroblastoma overexpressed
NRK normal rat kidney
OVX ovariectized
P4 progesterone
PAI-1 plasminogen activator inhibitor -1
PBC primary biliary cirrhosis
PCR polymerase chain reaction
PDGF platelet derived growth factor
PSC primary sclerosing cholangitis rAAV recombinant adeno-associated virus
RIPA radio-immunoprecipitation assay
RNA ribonucleaic acid
RT reverse transcriptase rtTA reverse transactivator s.d. standard deviation
SPARC secreted protein, acidic and rich in cysteine
SSC saline sodium citrate stat6 signal transducer and activation of transcription
TGF-β transforming growth factor-β
TIMP tissue inhibitor of matrix metalloproteinase
xix TSP thrombospondin repeat
TRE Tetracycline responsive element
ULF uterine luminal fluid
VEGF vascular endothelial growth factor
VSMC vascular smooth muscle cell
VWC von Willebrand type IC repeat
WISP Wnt-induced secreted protein
xx
CHAPTER 1
A GENERAL REVIEW OF THE CONNECTIVE TISSUE GROWTH FACTOR
(CTGF/CCN2) MOLECULE
1.1 Discovery
Human CTGF/CCN2 was first discovered in 1991 in the conditioned medium of human umbilical vein endothelial cells (HUVECs) and identified as a mitogen and chemotactic factor for fibroblasts [1]. The molecule was found through its immunoreactivity with platelet derived growth factor (PDGF) polyclonal antibodies although CTGF/CCN2 does not contain any amino acid sequence homology to PDGF [1]. At about the same time, the mouse CTGF/CCN2 homolog was independently isolated from serum -stimulated mouse NIH 3T3 fibroblasts and transforming growth factor (TGF)-β-stimulated mouse
AKR-2B cells by using differential cloning techniques [2-4].
1.2 CCN gene family
CTGF/CCN2 was originally grouped with two other structurally related proteins; cysteine-rich (CYR61/CCN1) and nephroblastoma overexpressed (NOV/CCN3). The
1 acronym CCN (CTGF/CYR1/NOV) was coined by Peter Bork in 1993 to describe these
structurally related genes containing 38 conserved cysteines [5]. CTGF/CCN2 has been
independently identified and given a variety of names since its discovery, but a recent
recommendation for a unified nomenclature of the CCN family of proteins has been
suggested [6]. The CTGF nomenclature will transition to CCN2, but for the purposes of
this manuscript it will be referred to as CTGF/CCN2. Since discovery of the 3 founding
CCN members, 3 other members of the CCN gene family have been identified. The
CCN proteins share ~40-60% sequence similarity and ~30-50% overall amino acid
sequence identity with each other [7]. In general, CCN proteins are modular, secreted,
extracellular matrix (ECM)-associated proteins that regulate diverse cellular activities
such as adhesion, migration, mitogenesis, differentiation and survival.
CYR61/CCN1 was originally identified as a growth factor-inducible immediate-early
gene by differential hybridization screening of a cDNA library from serum-stimulated
mouse fibroblasts [8]. Since that time, CYR61/CCN1 has been found to have myriad
biological properties including supporting cell adhesion, induction of cell migration,
enhancement of growth factor-induced mitogenesis and promotion of cell survival [9,
10]. These activities can, in part, be attributed to the ability of CYR61/CCN1 to interact
with integrins (discussed further in Chapter 3.1.2). Five integrins have been identified
that act as CYR61/CCN1 receptors in various cell types; α6β1, αvβ3, αvβ5, αIIbβ3, and
αMβ2 [11-15]. Additionally, CYR61/CCN1 promotes cell adhesion to a variety of cell types including; vascular endothelial cells, fibroblasts, mink lung epithelial cells, human platelets, peripheral blood monocytes and HUVECs [9-13, 16]. CYR61/CCN1 can also 2 stimulate directional cell migration in human microvascular endothelial cells (HMVECs)
[17]. Further, CYR61/CCN1 may be involved in neovascularization of the hypertrophic
cartilage, where vessel invasion produces channels for osteoblasts to settle, leading to
endochondral ossification [17]. Finally, action of the CYR61/CCN1 protein has been
implicated in angiogenesis [7]. CYR61/CCN1 is expressed in developing vessels in
mouse embryos [18], is a ligand of two integrins (αvβ3 and α6β1) that are involved in
angiogenesis [9, 12], induces neovascularization in the rat corneal micropocket assay
[17], and promotes tubule formation of HUVECs in a collagen gel assay [9]. In addition,
the activity of basic fibroblast growth factor (bFGF), an angiogenic molecule, is
enhanced by CYR61/CCN1 through displacement of bFGF from the ECM [16].
NOV/CCN3 was identified as an over-expressed gene in chicken nephroblastomas
induced by myeloblastosis-associated virus [19]. Overexpression of full-length chicken
NOV/CCN3 was shown to inhibit cell growth of chicken embryo fibroblasts (CEFs) [19], while expression of N-terminally truncated NOV/CCN3 was able to transform CEFs [19]
and rat embryo fibroblasts [20]. It is hypothesized that full-length NOV/CCN3 is a growth suppresser gene, while its truncated form acts as an oncogene [21]. Recent data demonstrated that NOV/CCN3 supported endothelial cell adhesion through integrins
αvβ3, α5β1, α6β1 and heparan sulfate proteoglycans (HSPGs) and induced directed cell
migration using integrins αvβ3 and α5β1 [22]. Further, NOV/CCN3 induced neovascularization in a rat corneal assay [22].
3 WISP-1/CCN4 was independently identified by researchers screening low metastatic K-
1735 melanoma cells [23] and as a gene upregulated by Wnt-1 in mammary epithelial
cells [24]. WISP-1/CCN4 has demonstrated growth-suppressive properties. For example, WISP-1/CCN4 transfected cells grew more slowly than control cells and WISP-
1/CCN4 transfection into tumorigenic and metastatic K-1735 cells resulted in a reduction of lung metastatic colonies and lead to decreased tumor growth [25]. The growth
suppressive properties of WISP-1/CCN4 have been hypothesized to be linked to module
3 (see Section 1.3) of the molecule [25].
WISP-2/CCN5 was identified as a gene down-regulated in rat embryo fibroblasts
transformed by H-ras and the inactivated p53 tumor suppresser gene [26]. Independent
studies also resulted in the identification of this gene in heparin-treated vascular smooth
muscle cells (VSMC) [27]. Expression of WISP-2/CCN5 is high in heparin-arrested cells
and low in proliferating cells [27] and has been linked to senescence [26]. WISP-
2/CCN5 may also have tumor-suppressive properties as shown by the low expression of
WISP-2/CCN5 found in human colon tumors [24]. This protein lacks the C-terminal
domain (see Section 1.3) that is common to others in the CCN gene family [7, 21].
WISP-3/CCN6 was found from screening an expressed sequence tag (EST) database with
WISP-1/CCN4. WISP-3/CCN6 only contains 34 of the 38 total conserved cysteine residues in the CCN proteins family and these 4 missing cysteines are located in module
2 (see Section 1.3) [7, 21]. While WISP-3/CCN6 has not been studied extensively, it was found to be over-expressed in human colon tumors [24].
4
In addition to these 6 CCN genes, the CCN gene family is distantly and weakly related to
2 Drosophila genes and 1 human gene. The Drosophila genes twisted gastrulation (tsg)
[28] and short gastrulation (sog) [29] are involved in dorsal-ventral pattering. Tsg has
sequence similarity to module 1 while sog has similarity to module 2 (see Section 1.3) [7,
21]. The human gene, small CCN-like growth factor (SCGF), was isolated from a human
embryo library and has limited structural similarity to the C-terminal region of the CCN
gene family (Hastings GA, Adams MD, 1998, Human CCN-like growth factor, US patent
5,780,263).
1.3 CCN family modular structure
CCN proteins are organized into evolutionarily conserved structural domains (Figure
1.1). A conserved intron-exon structure exists in the CCN gene family such that each
exon encodes a modular domain [21], suggesting that the family arose by exon shuffling
through evolution [5, 10]. CCN peptides all contain an N-terminal signal peptide
sequence followed by 4 structural modules that are generally conserved among members
of the CCN family, except for WISP-2/CCN5 which lacks module 4 (C-terminal domain).
Module 1 shares 32% sequence homology with the N-terminal region of the low- molecular-weight-insulin-like growth factor binding proteins 1-6 (IGFBPs) [5] and it was
proposed that CCN proteins may exert some of their actions through IGF binding.
5 However, binding affinity of CCN proteins to IGFs was 2 to 3 orders of magnitude less
than the classic IGFBPs [30]. Additionally, while IGF binding has been reported for
CTGF/CCN2, NOV/CCN3 and WISP-3/CCN6 in vitro [30-32], this interaction has not been conclusively linked to module 1 and IGF ligand blots with NOV/CCN3 have not proved this interaction [33]. The biological significance of this structural relationship between IGFBPs and CCN proteins is still controversial and will remain so until more definitive experiments are completed [34]. Interestingly, CTGF/CCN2 isoforms lacking module 1 are active. This, however, does not rule out the possibility that IGF binding may not be required for activities related to N-terminally truncated CTGF/CCN2 or that
CCN proteins may utilize IGF interactions. Finally, WISP-3/CCN6 acts as a tumor suppresser in inflammatory breast cancer [35] and the IGF-binding property of WISP-
3/CCN6 has been linked to IGF signaling [32].
Module 2 includes a von Willebrand factor type C repeat (VWC) [5]. This VWC repeat
is conserved in all CCN molecules except for WISP-3/CCN6, which lacks 4 of the 10
cysteines in this region [24]. Many proteins that contain VWC modules participate in
oligomerization [5]. Additionally, the Von Willebrand factor molecule itself first
dimerizes and then forms an oligomer, though this first step is not dependent on the VWC
domain [5]. A highly charged, variable region devoid of cysteines follows the VWC [7].
This region is longer in CYR61/CCN1 than in other CCN members and secondary
structure predictions show marked differences in this region among the members of the
CCN family [36].
6 Module 3 contains a thrombospondin type 1 repeat (TSP-1) homology. TSP-1
homologies have been found in other extracellular proteins and are thought to be
involved in binding to both soluble and matrix sulfated glycoconjugates [5, 37]. In addition, cell attachment sites within this module have been identified [38]. For example, a 17 amino acid T1 sequence in module 3 of CYR61/CCN1 was found to bind integrin
α6β1. Further, a subset of this T1 sequence was found, through alanine substitution, to be
the critical determinant for mediating integrin α6β1-dependent fibroblast adhesion.
Additionally, CTGF/CCN2 - low-density lipoprotein receptor-associated protein (LRP)
interactions were found to be likely mediated through module 3 [39]. Additional
information about LRP binding can be found in Sections 1.4 and 3.1.2.
Finally, module 4, the C-terminal domain, is present in several structurally and
functionally different extracellular proteins [5]. This module contains 10 conserved cysteines, 6 of which are hypothesized to form a cysteine knot that may be involved in dimerization [5]. This cysteine arrangement is found in other growth factors such as
TGF-β, PDGF and nerve growth factor [5]. Since some of the receptor binding properties of these growth factors are found within cysteine knots, it is possible that CCN
molecules have receptor binding domains in this region as well [5, 21]. Dimerization of
CCN proteins has not been reported, but bioactive forms of CTGF/CCN2 representing
modules 3-4 or 4 have been found [40-43]. Finally, heparin-binding motifs and integrin
binding has been demonstrated for module 4 of CTGF/CCN2 and CYR61/CCN1 [42, 44,
45].
7 1.4 CTGF/CCN2 and heparin interactions
CTGF/CCN2 and CYR61/CCN1 are both heparin-binding proteins. The heparin binding
characteristics of CTGF/CCN2 have been exploited in its purification [41, 42, 46] and the
biological activity of CTGF/CCN2 is modulated by heparin [42, 47]. This heparin
affinity allows both CTGF/CCN2 and CYR61/CCN1 to utilize HSPGs as co-receptors on
the surface of target cells [15, 39, 44, 48, 49] or to be localized to the ECM or cell surface
[16]. Cell surface HSPGs act as co-receptors that are essential for CTGF/CCN2 and
CYR61/CCN1-integrin α6β1 mediated fibroblast and smooth muscle cell adhesion [15,
48, 50]. Additionally, co-incubation of CTGF/CCN2 with heparin or disruption of cell
surface HSPGs with heparinase or sodium chlorate completely blocked adhesion of
activated hepatic stellate cells (HSCs) to immobilized CTGF/CCN2 [39]. Further, HSC
adhesion to CTGF/CTGF2 is, in part, mediated through binding to LRP (further
discussed in Section 3.1.2), a process that is heparin-dependent [39].
1.5 CTGF/CCN2 and intracellular signaling
Since its discovery, researchers have been searching for the signal transducing receptor
for CTGF/CCN2 (a review of the possible receptors found to date can be found in
Section 3.1.2). Though it is not certain if there are one or many signal transducing receptors for CTGF/CCN2, the molecule is able to elicit clear cellular responses in many cell types. The adhesion of fibroblasts to CTGF/CCN2 and CYR61/CCN1 is sufficient to induce distinct responses consistent with the activities of both proteins and different from
8 those induced by other matrix ligands such as fibronectin, laminin or type I collagen [48].
Fibroblast adhesion to CTGF/CCN2 and CYR61/CCN1 is mediated through integrin
α6β1 and cell surface HSPGs, leading to formation of integrin α6β1-containing focal
complexes, cytoskeleton reorganization and cell spreading with the formation of
lamellipodia and filopdia [48]. These morphological changes are accompanied by
signaling events including the activation of focal adhesion kinase (FAK), a tyrosine
kinase that plays a central role in integrin signaling, as well as paxcillin (a substrate for
FAK) and p42/p44 mitogen activated protein kinases (MAPKs) [48]. Another study
demonstrated that both CTGF/CCN2 and NOV/CCN3 were able to cause a pronounced
but transient increase of intracellular calcium in glioblastoma and neuroblastoma cells
[51]. In this same study, a yeast 2 hybrid system identified a calcium binding protein
(S100A4 mts1) as a partner for NOV/CCN3 [51]. In addition, treatment of osteoblast
cultures with CTGF/CCN2 caused an increase in calcium deposition [52]. Additionally,
prolonged expression of ECM degrading matrix metalloproteinases (MMP)-1 and-3 is
induced by fibroblast adhesion to CTGF/CCN2 or CYR61/CCN1 [48]. Further,
CTGF/CCN2 has been shown to stimulate the production of MMP-2 in VSMCs through
the AP-2 transcription factor [53]. Although CTGF/CCN2 expression is associated with
fibrosis [47, 54, 55], induction of MMPs are consistent with a role for both CTGF/CCN2
and CYR61/CCN1 in the matrix remodeling process as a whole.
9 1.6 The link between TGF-β and CTGF/CCN2
CTGF/CCN2 and TGF-β have been linked in numerous studies. Additionally, several other CCN family members were also studied with respect to TGF-β stimulation. TGF-
β1 induced CYR61/CCN1 mRNA expression in cultured podocytes [56]. In contrast to
CTGF/CCN2 and CYR61/CCN1, NOV/CCN3 is down regulated in adrenocortical cells by TGF-β1 [57]. Finally, TGF-β1 was not able to induce WISP-2/CCN5 expression in
VSMCs [27].
Early studies using fibroblasts established that CTGF/CCN2 is a TGF-β1 induced immediate early gene [3, 58]. Expression of CTGF/CCN2 mRNA following TGF-β stimulation occurs within minutes in the absence of de novo protein synthesis, an effect that was initially attributed to a TGF-β response element in the CTGF/CCN2 promoter
[59]. However, more recent studies have shown that while this element may be important for basal CTGF/CCN2 expression, TGF-β induced CTGF/CCN2 expression requires
Smad-binding sequences and a novel promoter sequence which is preferentially activated in fibroblasts as compared to epithelial cells [60-62].
The intimate relationship between TGF-β action and CTGF/CCN2 expression has been the basis for examining the role played by CTGF/CCN2 in mediating the biological activities of TGF-β [54]. While in the long run, this may prove to be a somewhat narrow view of the role of CTGF/CCN2, the outcome of these studies has been the
10 demonstration that TGF-β and CTGF/CCN2 share pro-fibrogenic properties whereas anti-inflammatory and immunosupressive properties are unique to TGF-β. TGF-β1 and
CTGF/CCN2 are both over-expressed in many fibrotic diseases and are fibrogenic in vitro and in vivo [63]. TGF-β induced collagen production is antagonized by
CTGF/CCN2 antibodies or antisense oligonucleotides in normal rat kidney cells (NRK) and human fibroblasts [64]. TGF-β is able to support anchorage-independent growth of
NRK cells, a process that is antagonized by CTGF/CCN2 antibodies or antisense oligonucleotides [65]. Additionally, subcutaneous injection of TGF-β into neonatal mice, which caused a rapid increase in the amount of granulation tissue comprising connective tissue cells and abundant ECM, resulted in enhanced levels of CTGF/CCN2 mRNA in connective tissue fibroblasts but not in epithelial cells or endothelial cells [47, 66].
Finally, injection of CTGF/CCN2 causes a very similar fibrotic reaction as TGF-β and is not mimicked by other growth factors [47, 49, 66, 67]. Collectively, these data support a role for CTGF/CCN2 as a downstream mediator of some of the fibrogenic actions of
TGF-β1, particularly the promotion of fibroblast proliferation and ECM production.
Despite the strong relationship between CTGF/CCN2 and TGF-β action, several
CTGF/CCN2 effects that are independent of TGF-β have been noted in fibroblasts. For example, TGF-β1 suppressed the expression of MMP-1 and MMP-3 in fibroblasts [68,
69] whereas, both were induced by CTGF/CCN2 and CYR61/CCN1 [48]. In addition, dexamethasone treated Balb/c 3T3 fibroblasts showed a large increase in CTGF/CCN2 expression at the same time down-regulation of TGF-β levels was noted [70]. Further,
11 CTGF/CCN2, but not TGF-β, transcripts were found in lung cancer associated pseudoscleroderma [71]. Also, TGF-β stimulation of collagen in gingival cells was not blocked by CTGF/CCN2 neutralizing antibodies [72]. In mesangial cells, CTGF/CCN2 gene expression was induced by CTGF/CCN2 in the absence of high TGF-β levels [73] and only partial inhibition of CTGF/CCN2 production was seen with addition of anti-
TGF-β antibody to cells after prolonged exposure to high glucose [74]. CTGF/CCN2 up- regulation was also independent of TGF-β secreted into the growth media of human bronchial epithelial cells expressing the adenoviral E1A gene [75]. Additionally, mechanical stretch induced CTGF/CCN2 mRNA within several hours but elevated TGF-
β levels were not seen for several days [73]. Finally, many factors in addition to TGF-β have been shown to induce CTGF/CCN2 expression such as bone morphogenic protein
(BMP)-2 [76], PDGF [55, 58, 77], epidermal growth factor (EGF) [58, 78], FGF [58], plasma clotting factor VIIa [79, 80], thrombin [80, 81], vascular endothelial growth factor
(VEGF) [77], lipid peroxidation products [77], acetaldehyde [77] and CTGF/CCN2 itself
[82, 83]. Thus, despite the close biological relationship between CTGF/CCN2 and TGF-
β, TGF-β-independent pathways of CTGF/CCN2 transcriptional activation do exist.
1.7 CTGF/CCN2 action in normal biological processes
The presence of four conserved structural modules in CTGF/CCN2 is consistent with its ability to regulate multiple cell functions such as cell adhesion, mitogenesis, chemotaxis, proliferation, differentiation, neovascularization, apoptosis and cell survival [83]. Thus far, CTGF/CCN2 has been implicated in many normal physiological processes, including 12 those related to development, uterine biology, skeletal growth, limb regeneration, wound healing, apoptosis/cell survival and angiogenesis [83]. In contrast, CTGF/CCN2 over- expression is also linked to many pathological processes as well (discussed in Section
1.8).
1.7.1 CTGF/CCN2 in development
CTGF/CCN2 is important in embryonic development. Immunohistochemical studies have shown that CTGF/CCN2 is present in the mouse as early as embryonic days 4.5-6.5
[43]. During early development, the protein is most abundant in the endoderm and mesoderm [43], but at later stages of gestation (days 14-18), CTGF/CCN2 and
CYR61/CCN1 are present in various tissues and organs including the cardiovascular and pulmonary systems as well as the skin and placenta [16]. Additionally, kidney tubules and salivary, mucous, and sebaceous glands were positive for CTGF/CCN2. During embryonic development, CTGF/CCN2 expression is also associated with the formation of a branching vascular network [16, 84] as well as the development of the embryonic skeleton during endochondral ossification [76, 85].
1.7.2 CTGF/CCN2 in uterine biology
CTGF/CCN2 action has been implicated in uterine biology, placental and follicular development. CTGF/CCN2 is produced by the mouse, human and pig uterus, where it is localized primarily to the luminal epithelial cells, glandular epithelial cells and
13 stromal/decidual cells [43, 86, 87]. On the day of implantation in mice, staining for
CTGF/CCN2 in the luminal epithelial cells was strongly reduced before its expression
was increased in the decidua [43]. Similarly, the reduction in the expression of
CTGF/CCN2 by pig luminal epithelial cells was highly correlated with the processes of maternal stromal extracellular matrix (ECM) reorganization and the onset of neovascularization [87]. In addition, CTGF/CCN2 isoforms and protease levels in uterine luminal fluid showed cyclic variations during the estrous cycle and early pregnancy [40-42]. In the mouse placenta, both CTGF/CCN2 and CYR61/CCN1 are produced by trophoblastic giant cells and trophoblasts of the ectoplacental cone and likely facilitate placental neovascularization by stimulating capillary outgrowth from pre- existing maternal vessels [16, 18, 43, 88]. Finally, during follicular development,
CTGF/CCN2 is increased in the endothelial cells in the thecal compartment and in granulosa cells which show rapid growth and division at this stage [89]. After ovulation,
CTGF/CCN2 mRNA expression was high in endothelial cells that migrated from the
theca into the luteal tissue [89]. Later CTGF/CCN2 was down-regulated in endothelial
cells while it was up-regulated in the granulosa luteins in conjunction with endothelial
cells proliferation in the corpus luteum [89]. Further, another group linked CTGF/CCN2
expression to follicular development and the formation of the corpus luteum after
ovulation [90]. The pattern of CTGF/CCN2 expression during folliculogenesis and
luteogenesis is consistent with a role for this factor in regulating endothelial cell migration and proliferation.
1.7.3 CTGF/CCN2 and bone development
14
Studies have also shown a role for CTGF/CCN2 in endochondral ossification.
CTGF/CCN2 is highly expressed in hypertrophic chondrocytes [76, 91] and promotes the process of endochondral ossification by acting on chondrocytes, endothelial cells and osteoblasts as a paracrine factor (reviewed in [76, 91, 92]). The stimulatory effects of
CTGF/CCN2 on the proliferation, maturation and hypertrophy of cultured chondrocytes suggest that hypertrophic chondrocyte-derived CTGF/CCN2 guides chondrocytes toward endochondral ossification [93]. In addition, CTGF/CCN2 may induce angiogenesis as a prelude to the replacement of cartilage with bone [92]. Finally, CTGF/CCN2 knockout mice demonstrate multiple skeletal defects including expanded hypertrophic zones of long bones which may be caused by impaired chondrocyte proliferation and ECM composition within the hypertrophic zone [94].
1.7.4 CTGF/CCN2 in limb regeneration
CTGF/CCN2 was found to be regulated by retinoic acid and expressed in the limb blastema of the regenerating newt limbs [95]. Additional studies followed CTGF/CCN2 expression throughout newt limb regeneration [96]. CTGF/CCN2 was localized to the white blood cells, Schwann’s cells and stump skeletal muscles in the early healing phase
[96]. At the pre-blastemic and blastemic phases, positive CTGF/CCN2 expression was seen in the basal layer of the wound epithelium, blastema cells, osteoclasts and skeletal muscle fibers [96]. During redifferentiation and the morphogenetic phase, CTGF/CCN2 was confined to the wound epithelium at regions of indentation between future digits and
15 in redifferentiated hypertrophied cartilage [96]. Following denervation, CTGF/CCN2
was over-expressed in the nerve stump, periosteum and atrophied skeletal muscle fibers
[96]. Meanwhile, CTGF expression was suppressed in osteoclasts in the nerve-dependent
phase of regeneration [96]. These data support a role for CTGF/CCN2 in the normal
processes of inflammatory responses, ECM remodeling, cellular proliferation and
endochondral ossification during the newt regeneration cascade [96].
1.7.5 CTGF/CCN2 in wound healing
In wound healing, a network of growth factors and cytokines influence the inflammatory
response, angiogenesis, re-epithelialization, ECM deposition and remodeling of the scar
[82]. Both TGF-β and CTGF/CCN2 as well as CYR61/CCN1 have been implicated in
this process. CYR61/CCN1 is highly induced in dermal fibroblasts of granulation tissue
during cutaneous wound repair and induces genes known to participate in would healing
such as VEGF, interleukin-1β, MMP-1, MMP-3, TIMP-1, PAI-1, collagen 1-α1,α2 and
integrins α3 and α5 [97]. Similarly, CTGF/CCN2 has also been shown to induce genes
involved in wound healing such as MMP-1, -2, -3, -7, -9 [48, 53], TIMP-1, -2, -3, -4 [82]
and collagen 1 [98]. CTGF/CCN2 expression peaked on day nine of injury following the
peak of TGF-β expression at day three in a wound healing model using subcutaneously
implanted stainless steel mesh wound chambers [58]. CTGF/CCN2 levels were also
elevated after TGF-β up-regulation in excisional wounds in skeletally immature pigs [99,
100]. In addition, both CTGF/CCN2 and TGF-β genes exhibited peak expression at 12-
24 hours after full thickness injuries [70, 101]. In contrast, in a scrape wound study, 16 elevated CTGF/CCN2 gene expression was not paralleled by increased TGF-β production [102]. In general, these data suggest that TGF-β and CTGF/CCN2 are coordinately regulated as part of a growth factor cascade during the wound healing process.
1.7.6 CTGF/CCN2 in apoptosis and cell survival
CTGF/CCN2 has been implicated in promoting apoptosis in smooth muscle cells [103,
104] and breast cancer cells [105], yet it appears to support cell survival in endothelial cells [106]. Over-expression of CTGF/CCN2 in human aortic VSMCs led to reduced cellular proliferation and induction of apoptosis as assessed by caspase 3 activity which increases DNA fragmentation [103, 104]. Similarly, transient overexpression of
CTGF/CCN2 in epithelial breast cancer cells reduced cell viability and increased DNA fragmentation [105]. Further, TGF-β treatment resulted in increased CTGF/CCN2 expression and apoptosis which could be antagonized by anti-sense CTGF/CCN2 oligonucleotides [105]. In contrast, human dermal microvascular endothelial cells coated on laminin demonstrated a dose dependent, higher rate of cell survival in the presence of soluble CTGF/CCN2. This effect could be negated with CTGF/CCN2 antibodies and was independent of cell proliferation. CYR61/CCN1 promoted integrin αvβ3-mediated cell survival in HUVECs which were treated with phorbol ester or VEGF to activate integrins [9]. Finally, NOV/CCN3 was shown to promote cell survival in endothelial cells plated on laminin and maintained in serum free medium [107].
17 1.7.7 CTGF/CCN2 in angiogenesis
Angiogenesis, the formation of blood vessels from the existing vasculature, is another important normal physiological process that involves CTGF/CCN2 action. In fact, there is strong evidence suggesting a role for CTGF/CCN2, CYR61/CCN1 and NOV/CCN3 in endothelial cell function and angiogenesis. Angiogenesis requires the coordinated implementation of multiple activities including the breakdown of the basement membrane, migration, proliferation of the endothelial cells and subsequent organization and alignment of the cell to form circulating tubes that supply blood [7].
First, in cultured HUVECs, CTGF/CCN2 was shown to enhance production of the ECM- degrading MMPs-1, -2, -3, -7, -9, and membrane type (MT) 1-MMP transcripts as well as to down-regulate expression of tissue inhibitors of MMPs (TIMP)-1 and -2.
CTGF/CCN2 and CYR61/CCN1 have also been shown to stimulate expression of MMP-
1 and -3 in human skin fibroblasts [48]. MMPs and TIMPs are involved in matrix remodeling. Further, degradation of the ECM can promote the migration of endothelial cells in angiogenesis by providing greater potential for cells to migrate and proliferate towards an angiogenic target [7, 108]. Thus, both CTGF/CCN2 and CYR61/CCN1 are able to regulate expression of a set of molecules involved in local degradation of the
ECM during angiogenesis. Second, CTGF/CCN2, CYR61/CCN1 and NOV/CCN3 are involved in endothelial cell adhesion and migration. CTGF/CCN2 can support adhesion of human dermal microvascular endothelial cells [106] and bovine aortic epithelial cells
(BAECs) [44, 109] in a does-dependent fashion. This cell adhesion is mediated via
18 integrins and can be blocked by anti-CTGF/CCN2 antibodies [106, 109]. CYR61/CCN1
also promotes integrin dependent cell adhesion to multiple cell types [7]. Additionally,
CTGF/CCN2 can promote directed migration of endothelial cells [106, 109] and
CYR61/CCN1 or αvβ3 antibodies can block migration of breast cancer cells in vitro
[110]. Further, NOV/CCN3 was shown to support endothelial cell adhesion and migration through integrins and HSPGs [22]. Third, CTGF/CCN2 and CYR61/CCN1 promote endothelial cell proliferation. CTGF/CCN2 and CYR61/CCN1 have both been shown to promote mitogenic activity by enhancing classic growth factors (i.e. bFGF), although they are not thought to be intrinsically mitogenic themselves [10, 16]. It is hypothesized that these molecules augment bFGF induced DNA synthesis by displacing
ECM-bound bFGF through their heparin binding ability (see [108]). This would effectively increase the concentration of bFGF to stimulate target cells (see [108]).
Interestingly, CTGF/CCN2 alone has also been shown to stimulate mitosis in BAECs
[109] and fibroblasts [1, 42, 47]. However, the CTGF/CCN2 in these systems might still act in coordination with other growth factors already bound to the cell membrane to exert its mitogenic effect. Fourth, the ability of CTGF/CCN2 to promote collagen synthesis may facilitate the production of an ECM which can support the structure of newly formed blood vessels [47, 77, 87]. It is likely that CTGF/CCN2-regulated ECM metabolism is influenced by many factors to control either its induction of ECM degrading enzymes or synthesis of ECM components. Finally, CTGF/CCN2, CYR61/CCN1 and NOV/CCN3 are angiogenic in vivo. CTGF/CCN2, CYR61/CCN1 and NOV/CCN3 caused a strong angiogenic response in chick chorioallantoic membrane (CAM) assays, when injected subcutaneously into the backs of mice or when delivered by hydron pellets to rat corneas
19 [17, 22, 106, 109]. Additionally, CTGF/CCN2 and CYR61/CCN1 can influence
angiogenesis by acting on other angiogenic regulators. Not only can CTGF/CCN2
release bFGF from the ECM, VEGF (a highly angiogenic molecule) binds directly to
CTGF/CCN2 thereby impairing its own ability to promote capillary tube formation and
promote angiogenesis [111]. It is thought that this loss of angiogenic activity is caused
by the inability of the VEGF/CTGF complex to bind to the VEGF receptor [111].
Finally, recent data have demonstrated that the CTGF/CCN2 in the CTGF/VEGF165 (one of the VEGF isoforms) complex is selectively degraded by MMPs [112]. This degradation restores the angiogenic activity of VEGF165 [112].
1.8 CTGF/CCN2 action in pathological disease processes
While CTGF/CCN2 plays a part in many normal physiological processes, the over-
expression of CTGF/CCN2 is associated with many pathological diseases. CTGF/CCN2
has been implicated in such pathologic processes as tumor growth, fibrotic skin disorders,
atherosclerosis and organ fibrosis. Some of these pathological processes are described
below.
1.8.1 CTGF/CCN2 and tumorigenesis
An increasing amount of evidence demonstrates that abnormal expression of the CCN
proteins is linked to tumorigenesis. The importance of angiogenesis in tumor growth
highlights the possible role of both CTGF/CCN2 and CYR61/CCN1 in tumorigenesis.
20 The expression of CTGF/CCN2 has been demonstrated in such vascular tumors as
pyogenic granuloma, angiopiloma, angioleiomyoma [113], mammary tumors [114], and
pancreatic cells [78]. CTGF/CCN2 can directly promote collagen synthesis, as well [47,
64, 77]. This ability may contribute to the fibrous nature of some desmoplastic tumors or, on the other hand, it may facilitate the production of an ECM that can support the
structure of newly formed vasculature found in tumors. CTGF/CCN2 has been found in
several desmoplastic tumors including the fibroblasts of dermatofibromas [113] and the
tumor cells and vascular endothelial cells of infantile myofibromatosis and malignant
fibrohistiocytic tumors [115]. Finally, in glioblastoma, CTGF/CCN2 expression was
noted in both the tumor cells and the surrounding proliferation endothelial cells [116].
Several lines of evidence point to CYR61/CCN1 having a role in tumor growth.
Transfection of CYR61/CCN1 into a gastric adenocarcinoma cell line increased the
tumorigenicity of these cells [17]. These tumor were larger and more vascularized than
tumors formed by non-CYR61/CCN1 expressing cells [17]. Additionally, elevated
CYR61/CCN1 levels were detected in pancreatic cancers, invasive breast carcinomas
[110], and several types of pediatric tumors such as angiofibroma, malignant fibrous
histiocytoma, infantile myofibromatosis, and malignant hemangiopericytoma [117]. In
contrast, CYR61/CCN1 was observed to be down regulated in 7 of 13 prostate cancer
samples examined [118] as well as in uterine leiomyomas [119], rhabdomyosarcomas
[120] and non-small lung cancer [121].
21 While expression of full-length NOV/CCN3 has a growth inhibitory effect in chicken embryo fibroblasts, expression of an N-terminally truncated form of NOV/CCN3 can transform these same cells [19]. The expression of NOV/CCN3 was correlated to increased proliferative index in the case of prostate and renal cell carcinoma [122, 123] and higher metastatic potential of Ewing’s carcinoma cells [124]. In contrast, in some tumors (neuroblastomas, chondrosarcomas, rhabdomyosarcomas and Wilm’s tumors), high expression of NOV/CCN3 was associated with tumor differentiation and cell growth arrest [33, 117, 122].
WISP-1/CCN4 appears to be able to suppress tumor growth in the case of WISP-1/CCN4 transfected melanoma cells that demonstrated decreased tumorigenicity [25]. On the other hand, WISP-1/CCN2 expression was increased in most colon adenocarcinomas
[24]. The overexpression of WISP-2/CCN5 in transformed rat embryo fibroblasts reduced tumorigenicity of these cells compared to the parent cell line [26]. Further,
WISP-2/CCN5 was also found to be decreased in human colon adenocarcinomas [24].
Finally, WISP-3/CCN6 was found to be over-expressed in the majority of colon tumors tested [24] but decreased in most inflammatory breast cancers (see[125]).
Collectively, it seems that the expression of CCN proteins is altered in various types of tumors. In some cases they appeared to be acting to increase the tumorigenicity while in others they were associated with lower tumor growth potential. To date, there is no unifying hypothesis for linking the CCN gene family to tumor growth but perhaps the
22 answer might come with more study of the individual modules of this family and their involvement in diverse biological processes.
1.8.2 CTGF/CCN2 in fibrotic skin disorders
CTGF/CCN2 was shown to be present and frequently over-expressed and co-expressed with TGF-β in a variety of fibrotic skin diseases such as systemic sclerosis, localized skin sclerosis, keloids, scar tissue, eosinic fasciitis, nodular fasciitis, and Dupuytren’s contracture [71, 126-129]. The process of normal wound repair after tissue injury follows a closely regulated pathway. However, in pathological fibrosis, the normal process is abrogated and fibroblast activity continues unabated causing excessive accumulation of ECM and scarring. CTGF/CCN2 may be necessary for normal wound repair in the skin (see Section 1.7.5) yet overexpression of CTGF/CCN2 in skin fibroblasts is a typical finding in patients suffering from systemic sclerosis [127].
Systemic sclerosis is a connective tissue disease characterized by excessive fibrosis in the skin and many internal organs [127]. In this disease, strong CTGF/CCN2 mRNA signals were observed in the fibroblasts of sclerotic lesions whereas no expression was seen in normal skin controls [127].
1.8.3 CTGF/CCN2 in atherosclerosis
CTGF/CCN2 protein over-expression has also been associated with atherosclerotic lesions. CTGF/CCN2 mRNA is expressed in atherosclerotic vessels at 50- to 100- fold
23 the level of normal arteries [130]. CTGF/CCN2 was localized to VSMCs and endothelial cells primarily at sites of ECM accumulation and fibrosis in advanced atherosclerotic lesions [130]. This localization suggested that CTGF/CCN2 might regulate ECM production in these cells and induce intimal thickening. On the other hand, CTGF/CCN2 may also stabilize the fibrous cap by increasing the ECM production in this area [55].
1.8.4 CTGF/CCN2 in organ fibrosis
Additionally, CTGF/CCN2 mRNA and/or protein are over-expressed in many fibrotic lesions of major organs. Organs that contain higher levels of CTGF/CCN2 mRNA or protein in their fibrotic states include kidney [73, 74, 131-137], lung [128, 138-140], cardiovascular system [55, 130, 141], pancreas [116, 142, 143], bowel [144], eye [145-
148], gingiva [72, 149] and liver [77, 150-156]. In organ injury, a proper balance between synthesis and degradation of ECM molecules is very important in the repair process. CTGF/CCN2 over-expression in organ fibrosis may represent the shift toward synthesis of ECM that could lead to chronic fibrosis.
Fibrosis is the final result of renal diseases of diverse origin. CTGF/CCN2 mRNA was strongly upregulated in extracapillary and severe mesangial proliferative lesions of the crescentic glomerulonephritis, IgA nephropathy, focal and segmental glomerulosclerosis and diabetic nephropathy [137]. In contrast, CTGF/CCN2 expression was not upregulated in glomerular diseases characterized by non-inflammatory lesions and proteinuria or in acute exsudative post-infectious glomerulonephritis, which tends to heal
24 without excessive scarring [137]. At sites of chronic tubulointerstitial damage, expression of CTGF/CCN2 mRNA was correlated with the degree of injury [137]. In addition, in an acute inflammatory renal wound repair model, CTGF/CCN2 was up- regulated in the mesangial cells and podocytes before α-smooth muscle actin (α-SMA) appeared [157]. Expression peaked at day 7 when the damage was maximal and then returned to background levels when tissue repair was completed at day 14 [157]. In a chronic hypertension renal wound repair model, significant up-regulation of
CTGF/CCN2 mRNA was seen in damaged glomeruli undergoing sclerosis and in the fibrotic interstitium and epithelial cells lining atrophic tubuli expressed CTGF/CCN2 mRNA [137]. Additionally, CTGF/CCN2 expression was greatly increased in glomeruli of obese rats suffering from diabetic glomerulopathy [133]. Thus, it seems that
CTGF/CCN2 up-regulation in damaged glomeruli and interstitial areas is a common phenomenon in diseases that lead to renal scarring.
In a lung fibrosis model of bleomycin-induced fibroproliferative lung disease, a 2- to 3- fold increase in lung CTGF/CCN2 mRNA levels was seen [138]. CTGF/CCN2 is also present in bronchoalveolar lavage fluid from patients with fibrosing alveolitis as compared with normal individuals [158]. Additionally, lung fibroblasts from patients with scleroderma-associated fibrotic lung produce more CTGF/CCN2 in response to
TGF-β than control cells [158]. Finally, CTGF/CCN2 mRNA is expressed in murine lung [2] and in cultures of human or mouse lung mesenchymal cells in which it is rapidly induced by TGF-β [138].
25 CTGF/CCN2 expression is also up regulated in pancreatic fibrosis. Northern blot analysis showed that chronic pancreatitis (CP) tissue samples demonstrated concomitant enhanced mRNA expression of TGF-β1, TGFβR-II, CTGF/CCN2 and collagen type I
[142]. CTGF/CCN2 was localized to the degenerating acinar cells and principally in fibroblasts surrounding those areas [142]. Moreover, CTGF/CCN mRNA expression levels correlated positively with the degree of fibrosis in CP tissues [142]. Similarly,
CTGF/CCN2 and TGF-β1 mRNAs were enhanced in acute necrotizing pancreatitis
(ANP) tissue samples [143]. CTGF/CCN2 was localized in acinar, ductal cells and fibroblasts [143]. These data indicate that CTGF/CCN2 participates in tissue remodeling in ANP.
Crohn’s disease and ulcerative colitis, two forms of inflammatory bowel disease (IBD), demonstrate strikingly increased expression of CTGF/CCN2 mRNA expression [144]. In general, levels of CTGF/CCN2 mRNA correlated with the degree of inflammation, however, areas of little inflammation which were characterized by severe fibrosis also revealed high levels of CTGF/CCN2 mRNA [144]. In addition, TGF-β1, collagen I α1, fibronectin and integrin α5 were strongly correlated with CTGF/CCN2 expression [144].
These data suggest a prominent role for CTGF/CCN2 in the repair of mucosal injury in
IBD and in the aberrant deposition of ECM. CTGF/CCN2 expression was also increased in radiation enteritis compared with a healthy bowel [159]. This CTGF/CCN2 expression was co-localized with collagen deposition and was found in the ECM and subtypes of activated mesenchymal cells with a fibroblast phenotype [159].
26 Corneal cells express CTGF/CCN2 after stimulation by TGF-β, which has previously
been implicated in corneal scarring [160]. In addition, CTGF/CCN2 expression was found to be increased significantly during corneal wound healing [161]. These data support the hypothesis that CTGF/CCN2 promotes corneal scar formation. Conjuctival fibrosis due to excessive accumulation of collagens is an important histological feature in ocular cicatricial pemphigoid (OCP) [160]. CTGF/CCN2 mRNA was found to be increased in stromal and fibroblast cells from biopsies of OCP [160]. Further, TGF-β1
induced a 9-fold increase in CTGF/CCN2 mRNA in conjunctival fibroblasts [160].
These data imply that CTGF/CCN2 may be one of the molecules involved in the
pathogenesis of conjunctival fibrosis in patients with OCP.
CTGF/CCN2 also appears to be upregulated in gingival fibrosis as well. Gingival
overgrowth is characterized by excess ECM and elevated levels of cytokines, including
TGF-β1 [72]. CTGF/CCN2 was strongly induced by TGF-β1 in human gingival
fibroblasts and exogenous addition of CTGF/CCN2 to these same cells stimulated
collagen accumulation 4-18 days after treatment [72]. TGF-β1 treatment also increased
collagen levels but CTGF/CCN2 antibodies could not block this increase [72].
Therefore, although CTGF/CCN2 itself contributes to collagen accumulation, it does not
mediate all of the stimulatory effects of TGF-β1 on collagen production. In addition,
CTGF/CCN2 content was significantly higher in drug-induced gingival overgrowth than
in control tissues [149]. These higher levels of CTGF/CCN2 protein was accompanied
27 by an increased abundance of fibroblasts and connective tissue fibers [149].
Interestingly, a strong association between CTGF/CCN2 and TGF-β1 staining was not found [149].
Finally, CTGF/CCN2 expression has been demonstrated to be increased in fibrotic livers
(reviewed in [156]). In the fibrotic liver, CTGF/CCN2 mRNA and protein are produced by fibroblasts, myofibroblasts, HSCs, endothelial cells, and bile duct epithelial cells (see
Figure 1.2). CTGF/CCN2 is also produced at high levels in hepatocytes during cytochrome P-4502E1-mediated ethanol oxidation [162, 163]. CTGF/CCN2 expression in cultured HSCs is enhanced following their activation or stimulation by TGF-β while exogenous CTGF/CCN2 is able to promote HSC adhesion, proliferation, migration and collagen and α-SMA production [77, 156]. Collectively, these data suggest that during initiating or downstream fibrogenic events in the liver, production of CTGF/CCN2 is regulated primarily by TGF-β in one or more cell types and that CTGF/CCN2 plays important roles in HSC activation and progression of fibrosis. Further data discussing
CTGF/CCN2 and liver fibrosis is discussed in Section 2.1.2.
28
Module 1 Module 2 Module 3 Module 4
SP IGFB VWC variable TSP1 CT CYR61/CCN
CTGF/CCN2
NOV/CCN3
onc NOV
WISP-1/CCN4
WISP-2/CCN5
WISP-3/CCN6
Figure 1.1: Modular structure of the CCN proteins
SP, signal peptide; IGFBP, insulin-like growth factor binding -like module; VWC, Von Willebrand Factor- like module; TSP1, thrombospondin-like module; CT, carboxy-terminal module containing cysteine knot
29
Figure 1.2: Pathways of CTGF/CCN2 production and action in hepatic fibrosis
30
CHAPTER 2
rAAV MEDIATED CTGF/CCN2 GENE DELIVERY
2.1 INTRODUCTION
2.1.1 CTGF/CCN2 in muscle fibrosis
Both TGF-β and CTGF/CCN2 have been implicated in skeletal muscle disorders. One of
the most studied muscle disorders is muscular dystrophy. Muscular weakness, wasting, myofiber degeneration and fibrosis substituting for muscle tissue characterize human
Duchenne muscular dystrophy (DMD) [164]. Fibrosis is significantly more prominent in
DMD than human Becker muscular dystrophy (BMD) [164]. High levels of TGF-β1
were found in muscle fibers and extracellular space in DMD and, to a lesser degree, in
BMD [164, 165]. TGF-β1 levels peaked at 2-6 years of age but the proportion of
connective tissue in muscle biopsies increased progressively with age, implying that
TGF-β1 may help initiate muscle fibrosis but is not as important in long-term
maintenance [164]. In a golden retriever muscular dystrophy (GRMD) dog model, TGF-
β1 levels were high up to 60 days of age but returned to normal by adulthood also suggesting that TGF-β1 may be involved in the early stages of fibrosis [166]. Another study in humans, found TGF-β1 levels were lower than DMD in congenital muscular
31 dystrophy (CMD) but fibrosis was greater in CMD [167]. This suggested that TGF-β1 was involved in CMD muscle fibrosis but not in the same way as DMD fibrosis [167].
Alternatively, since CMD muscle fibrosis is evident early in infancy, in contrast to DMD which requires more time for the build-up of connective tissue, TGF-β1 expression may have already stabilized by the time levels were examined [167]. Further, when decorin, a proteoglycan that inactivates the effects of TGF-β, was injected into injured mouse muscle, it efficiently prevented fibrosis [168].
There is not a great deal of information known about the involvement of CTGF/CCN2 in skeletal muscle fibrosis, although one can infer it may have a role, as TGF-β1 is involved in this process. In the GRMD dog model, significantly greater expression of
CTGF/CCN2 was found in dystrophic muscle than normal muscle at 30 days of age
[166]. CTGF/CCN2 mRNA levels, however, were always higher in GRMD than control muscles up to and including adulthood [166]. CTGF/CCN2 may act as a long-term mediator of the effects of TGF-β and cooperation between the two molecules may act as a molecular cascade that induces and sustains connective tissue proliferation in GRMD
[166].
2.1.2 CTGF/CCN2 in liver fibrosis
Recent data have provided strong evidence that CTGF/CCN2 mRNA and protein levels are correlated with the degree of hepatic fibrosis, irrespective of the type of disease.
Ribonuclease protection assay analysis of cirrhotic livers from patients with primary 32 biliary cirrhosis (PBC), primary sclerosing cholangitis (PSC) or biliary atresia demonstrated that CTGF/CCN2 mRNA in fibrotic livers was elevated 3-5 fold as
compared with their normal counterparts [153]. Likewise, Northern blot analysis showed
that, as compared with normal livers, CTGF/CCN2 and TGF-β1 mRNA expression was 6
to 8 fold higher in cirrhotic livers from patients with chronic viral hepatitis, PBC, PSC,
cryptogenic and alcoholic liver disease (ALD) [152]. Elevated levels of CTGF/CCN2
mRNA were also present in livers from patients with non-alcoholic steatohepatitis
(NASH) and the degree of fibrosis was correlated with CTGF/CCN2 protein levels in the
ECM [169]. Immunohistochemical staining of normal and hepatitis C livers showed that
increased CTGF/CCN2 protein levels were associated with a higher score of fibrosis
[154].
In situ hybridization of cirrhotic livers resulting from chronic viral hepatitis, PBC, PSC,
cryptogenic, and ALD contained marked CTGF/CCN2 staining in fibroblast and
myofibroblast-like cells within the fibrotic portal tracts and fibrous septa [150, 152, 162].
CTGF/CCN2 mRNA was also observed in HSCs, myofibroblast-like spindle cells around
proliferating ductules, a few duct and ductular epithelial cells, inflammatory cells, and
sinusoidal and vascular endothelial cells [150, 152, 154, 162]. CTGF/CCN2 protein
staining was present in portal tracts, the ECM of the fibrous septa, sinusoidal lining and
in the proliferating bile ducts in hepatitis C diseased livers [150, 154]. Additionally,
many cells in fibrotic liver that stained for α−SMA were also shown to contain
CTGF/CCN2 protein [154]. In congenital hepatic fibrosis, which is marked by profound
hyperplasia of the bile ducts, CTGF/CCN2 mRNA and protein are strongly expressed by 33 bile duct epithelial cells [156]. In ALD, hepatocytes may be an important source of
CTGF/CCN2 since it is produced in cultured HepG2 cells downstream of cytochrome P-
450E1-mediated ethanol oxidation [162, 163]. In livers from patients suffering from idiopathic portal hypertension, periductal mononuclear cells demonstrate enhanced
CTGF/CCN2 expression and this was correlated with collagen and elastin deposition and the presence of activated HSCs and pericellular fibrosis [170]. Thus, while its timing of production and mode of action may vary according to the initial hepatic insult and type of damage, CTGF/CCN2 has the potential of being produced by virtually all major cell types in the liver. Moreover, high intra-hepatic levels of CTGF/CCN2 are associated with its entry into the circulation since, as compared with control subjects, serum
CTGF/CCN2 levels were higher in patients with biliary atresia and were correlated with the progression of liver fibrosis [155].
2.1.3 In vivo CTGF/CCN2 delivery
There have been attempts to ascertain the function of CTGF/CCN2 by either knocking out the gene, creating transgenic mice or by simply injecting the protein directly into mice. A CTGF/CCN2 knockout mouse demonstrated that CTGF/CCN2 is an important regulator linking extracellular matrix remodeling to angiogenesis at the growth plate [94].
Impaired chondrocyte proliferation and extracellular matrix (ECM) composition within the hypertrophic zone led to skeletal dysmorphisms in mice lacking CTGF/CCN2 [94].
Additionally, the expanded hypertrophic zones and impaired endochondral ossification in the CTGF/CCN2-deficient mice was linked to decreased expression of VEGF, a molecule
34 required for growth plate angiogenesis [94]. These knockout studies demonstrated that
CTGF/CCN2 is involved in chondrocyte proliferation, ECM synthesis and angiogenesis at the growth plate.
Nakanishi et., al. (2001) created a transgenic mouse that overproduced CTGF/CCN2 driven by the type XI collagen promoter [171]. The over-expression of CTGF/CCN2 was expected to be localized to the chondrocytes, where the type XI collagen promoter is also primarily localized [172]. These mice developed normally until a few months after birth when they showed dwarfism [171]. Bone density was decreased as compared to normal mice and indicated that overexpression of CTGF/CCN2 influences certain steps of endochondral ossification [171]. The authors speculated that since CTGF/CCN2 can promote angiogenesis, overexpression of CTGF/CCN2 may trigger vigorous angiogenesis which may cause bone to be formed from cartilage earlier than in normal mice resulting in dwarfism [171]. Additionally, testes of CTGF/CCN2 transgenic mice were smaller than normal and fertility was affected [171].
Injection of CTGF/CCN2 into the subcutaneous tissue of newborn mice caused short- term, increased ECM accumulation [67, 83]. However, when it was injected either concurrently with or following TGF-β, long-term fibrosis was observed, thus implying that persistent fibrosis requires TGF-β as an inducer and CTGF/CCN2 for maintenance
[67]. Furthermore, systemic administration of both CTGF/CCN2 and TGF-β proteins to neonatal mice caused massive fibrosis of many diverse organ systems, which could result
35 in death (see [125]). These effects were dose dependent and treatment with
CTGF/CCN2 monoclonal antibody antagonized the fibrosis and caused collagen deposition to be significantly reduced (see [125]).
2.1.4 Viral delivery of CTGF/CCN2
The use of viruses has become a powerful tool for the delivery of foreign genes to specific cell types and organs. The transfer of these genes is accomplished by using a variety of vehicles including retrovirus, herpes simplex virus, adenovirus (Ad), and adeno-associated virus (AAV). These assorted viruses all have advantages and disadvantages associated with their use. Retroviral vectors require mitotic cell division for transduction but can permanently integrate into the genome of the infected cell [173].
Herpes simplex virus has cytotoxicity issues as well difficulty maintaining transgene expression, yet can deliver large amounts of DNA [173]. Adenoviral vectors can infect and deliver genes to a wide variety of dividing and non-dividing cells but prompts a large host immune response that causes the elimination of many of the infected cells [173].
Finally, AAV can infect dividing and non-dividing cells, has a broad host and cell range, persistent expression of the transgene, does not illicit cell-mediated immunity and is non- pathogenic but has a limited DNA capacity [173-175].
Three studies have been previously completed using Ad to deliver CTGF/CCN2 to cells or organs. CTGF/CCN2 was delivered to a chondrocytic cell line using Ad-CTGF/CCN2
[176]. Infected cells proliferated more rapidly and contained more aggrecan, a marker
36 for chondrocyte maturation, and type X collagen, a marker of chondrocyte hypertrophy,
than control cells [176]. These results indicated that CTGF/CCN2 promoted the
proliferation and differentiation of chondrocytes in vitro [176].
In a second study, a gene array was performed with mRNA derived from Ad-
CTGF/CCN2 and Ad-TGF-β1 infected mouse livers. Many genes showed similar altered expression for both CTGF/CCN2 and TGF-β1 infected livers, including; serine protease
inhibitor 2 and 2.4, glutathione-S-transferase (GST) Mu1, interferon inducible protein 1,
urokinase receptor (u-PAR1), follistatin, laminin receptor 1, BMP-1 [177]. Ad-
CTGF/CCN2 infected liver additionally had unique genes that were altered including;
signal transducer and activation of transcription 6 (stat6) and granulocyte macrophage
colony stimulating factor (GMCSF) receptor [177]. Increases in expression of u-PAR1,
laminin receptor and BMP-1 are consistent with the importance of CTGF/CCN2 and
TGF-β1 in tissue repair and remodeling [177]. In addition, the up-regulation of serine
protease inhibitors may reflect the role both CTGF/CCN2 and TGF-β1 have in fibrosis as
serine protease inhibitors hinder ECM degradation [177].
Finally, Ad was used to transfer the CTGF/CCN2 gene into rat lungs and induce transient
fibrosis. High CTGF/CCN2 expression for 6 - 10 days induced moderate, reversible
fibrosis and lead to the increase of fibronectin, procollagen 1α2 and CTGF/CCN2
expression [178]. In addition, TIMP-1 was transiently and weakly up regulated after Ad-
CTGF/CCN2 infection [178]. Fibronectin, procollagen 1a2, CTGF/CCN2 and TIMP-1
were all persistently and strongly stimulated when Ad-TGF-β1 was used to infect rat 37 lungs [178]. The authors speculated that CTGF/CCN2 may act as a co-factor for TGF-β1 rather than a direct fibrogenic factor and that CTGF/CCN2 can initiate fibrogenic activity but may require the presence of additional factors to cause progression of fibrosis [178].
This chapter describes the use of rAAV to deliver the CTGF/CCN2 gene to mouse tissues. AAV is a single-stranded parvovirus that is defective in replication without a helper virus [175]. In the absence of helper virus, AAV can integrate into the host genome but cannot produce a lytic infection [179]. Wild type AAV has been shown to integrate into the human genome on chromosome 19q13.4 [180, 181], but recombinant
AAV in muscle has been shown to exist as transcriptionally active monomeric and concatameric double-stranded episomes [182]. When utilizing AAV for gene therapy vectors, the entire genome of the parent virus can be replaced with the transgene of interest except for the 145 bp inverted terminal repeats (ITRs) flanking the genome [175].
Signals for viral genome packaging and integration are contained within these cis-acting sequences [175].
rAAV vectors have been shown to transduce a broad range of tissue types resulting in gene expression in muscle [183], liver [184], brain [185, 186], lung [187], eye [188], gut
[189] and hematopoietic progenitors [190]. Skeletal muscle has demonstrated efficient, long-term stable rAAV mediated transgene expression. In fact, lacZ reporter gene expression was observed for more than 1.5 years with no reduction in expression levels using the CMV promoter [191]. Additionally, efficient rAAV-mediated transduction of hepatocytes was demonstrated using the EF-1α promoter to drive expression of factor IX
38 [184]. This chapter describes the generation of rAAV viruses to deliver the CTGF/CCN2 to mouse tissues. Fortunately, rAAV gene delivery was a feasible approach, as the
CTGF/CCN2 gene is small enough to be packaged into the rAAV capsid. A CMV promoter was used to drive CTGF/CCN2 expression in the skeletal muscle and an EF-1α promoter was used to drive CTGF/CCN2 expression in the liver.
2.2 MATERIALS AND METHODS
2.2.1 Materials
C57Bl/6 mice were obtained from Harlan Sera-lab (Indianapolis, IN) and were used with approval by the Institutional Animal Care and Use Committee. A HeLa cell line was obtained from ATCC (Manassas, VA), C12 cells (Hela cells stably transfected with a plasmid containing AAV2 replication and capsid genes), Adenovirus 5, pAAV-D6∆Not
and pAAV-βgal-∆PNeoTK/RC cl 17 triple play vectors were kindly obtained from K.
Reed Clark (Columbus Research Institute, Columbus OH), while a HSC-T6 cell line
(SV40 immortalized rat hepatic stellate cell line which demonstrates a myofibroblastic or
activated phenotype [192] was generously donated by Scott Friedman, MD (Mount Sinai
Hospital, New York NY).
Restriction digestion enzymes were obtained from New England Biolabs (Beverly, MA).
Rapid DNA ligation kits were acquired from Roche (Indianapolis, IN) and Qiaquick Gel
Isolation kits and Superfect were bought from Qiagen (Valencia, CA). Benzonase was 39 purchased from EMD Chemicals. pCRII vector (Table 2.1), pEF/myc/cyto vector (Table
2.1), X-gal, X-gluc, DMEM, Waymouth’s media, FBS, penicillin/streptomycin, G418,
Hank’s Balanced Salt solution, agarose and Rad-prime labeling kits were obtained
through Invitrogen/GibcoBRL (Carlsbad, CA). Recombinant adeno-associated viruses
rAAV-CMV-β-gal, rAAV-CMV-GUS and rAAV-EF1α-GUS were obtained from K.
Reed Clark and Thomas Sferra (Children’s Research Institute, Columbus OH). Real-
rime PCR reagents were purchased from Perkin Elmer (Wellesley, MA). A POROS
HE/M column (1.7 ml bed volume) was purchased from PerSeptive Biosystems
(Framingham, MA). Heparin sepharose was obtained from Amersham Pharmacia
(Piscataway, NJ). Aquamount was bought from Biomedia (Foster City, CA), while protein A beads, BCA Protein Assay Kit and anti-mouse IgG - HRP antibody were obtained through Pierce (Rockford, IL). Anti-β-Galactosidase antibody was obtained through Rockland Chemicals (Gilbertsville, PA), alkaline phosphatase-conjugated goat anti-rabbit IgG antibody were from Vector Laboratories (Burlingame, CA). Rabbit anti-
CTGF/CCN2[247-260] was designed against a heparin binding region of pig
CTGF/CCN2 that is conserved among species and was used for Western blots [42].
Anti-CTGF/CCN2[81-94] was selected for it absolute conservation between human,
mouse and porcine CTGF/CCN2 and lack of homology with other CCN proteins and was
used for immunohistochemistry [193]. An anti-CTGF/CCN2 antibody raised against
recombinant full-length CTGF/CCN2 raised in baculovirus was used for
immunoprecipitation and was provided by Fibrogen (San Francisco, CA). Antigen
retrieval Citra system, Power Block and Concentrated StrAviGen MultiLink kit were
obtained through BioGenex (San Ramon, CA). Anti mouse- AAV intact capsid 40 monoclonal antibody, clone A20 (specifically binds to assembled AAV2 capsids - Grimm
D, 1999, Wistuba A, 1997) was obtained from Maine Biotechnologies (Portland, ME).
Nitro blue tetrazolium(NBT)/5-bromo-4-chloro-3-indolyl phosphate(BCIP) and RQ1-
RNase Free DNase were purchased from Promega (Madison, WI). The Corning Cell
Cube was purchased from Corning Life Sciences (Acton, MA). ( Radio-labels including
[35S]Trans label (a mixture of [35S]Cys and [35S]Met) and α-dATP [32P] were obtained
through New England Nuclear/Perkin Elmer (Wellesley, MA). Primers were made
through Operon (Alameda, CA) or Invitrogen (Carlsbad, CA) and gluteraldehyde and
paraformaldehyde were purchased through Fisher Scientific (Pittsburgh, PA), while
Histochoice was obtained from Amresco (Solon, OH). All other chemicals were
purchased from Sigma (St. Louis, MO).
2.2.2 Infection of HSC-T6 cells with rAAV-CMV-β-gal, rAAV-CMV-GUS, rAAV-
EF1α-GUS
HSCs are the principal effector cells of the fibrotic response in the liver, although other
cells in the liver influence the state of HSC activation. While AAV infects hepatocytes
with great efficiency in vivo, in vitro transduction experiments are described in this
chapter using an HSC cell line given the importance of HSCs in the fibrotic response
[184]. To verify that HSCs could be successfully transduced by rAAV, control
experiments were performed as follows. HSC-T6 cells were plated in chamber slides at a
density of 1 x 104 per well in Waymouth’s media supplemented with 10% FBS, L-
glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin one day before they were 41 used. The following day the cells were infected with nothing, 1.5 x 1011 DNase resistant particles (DRPs) (MOI = 1.5 x 107) of rAAV-CMV-β-gal, 1.6 x 1011 DRPs (MOI = 1.6 x
107) of rAAV-CMV-GUS, or 7.5 x 1010 DRPs (MOI = 7.5 x 106) of rAAV-EF1α-GUS.
Forty eight hours later, the infected cells were washed in PBS and fixed in 2%
o paraformaldehyde/50 mM NaPO4 buffer (pH 7.5)/0.4%glutaraldehyde at 4 C. After the fixative was completely removed X-gal ( 0.5M Na2HPO4/1M NaH2PO4/0.5M
MgCl2/200mM K3Fe(CN)6/200mM K4Fe(CN)6/1mg/ml X-gal in dimethyl formamide(DMF)) or X-glu (0.1M sodium acetate (pH 4.8)/150 mM NaCl/1M
MgCl2/200mM K3Fe(CN)6/200mM K4Fe(CN)6/1mg/ml X-glu in DMF) stain was added
and incubated at 37o C until color developed. Slides were then cover-slipped with
Aquamount.
2.2.3 Cloning strategy
The source of full length CTGF/CCN2 for the rAAV triple play vector was from a
previously created vector pcDNA3.1 - H1 (Table 2.1) or pEF-CTGF (Table 2.1). pEF-
CTGF was created by digesting the vector pEF/myc/cyto (Table 2.1) with Nco I then treating the linearized plasmid with Mung bean exonuclease to create blunt ends. The
CTGF/CCN2 sequence was cut out of pcDNA3.1-H1 (Table 2.1) with EcoRI then
blunted in the same way. The insert and vector were then ligated using a Rapid DNA
ligation kit per the manufacturer’s protocol to create pEF-CTGF. Cassettes containing
CMV-CTGF/CCN2-BGH pA or EF-1α-CTGF/CCN2-BGH pA were cut out of their
vectors using Xmn I or Eco RI and Ase I, respectively. These cassettes were ligated in 42 between the inverted terminal repeats (ITRs) of a Xba I cut and blunted pAAV-βgal-
∆PNeoTK/RC cl 17 triple play vector using the Rapid DNA ligation kit. The triple play vector contained AAV-2 rep and cap genes and a neomycin gene for G418 selection, additionally, the Xba I cut removed the β-gal cassette originally in the plasmid. These
plasmids were then transformed into DH5α competent cells and colonies were screened
with diagnostic restriction digestions to verify the presence and correct orientation of the insert. Three clones were produced for rAAV-CMV-CTGF (termed “HI-3”, “11” and
“13”) and two clones were produced for rAAV-EF1α-CTGF (termed “28” and “35”).
(Table 2.1 and Figure 2.2)
2.2.4 Verification of CTGF/CCN2 protein production
HeLa cells were transiently transfected with 2 µg rAAV-CTGF triple play vectors, control pcDNA3.1-H1 vector, or nothing using Superfect according to the manufacturer’s protocol. HeLa cells were concurrently infected with Ad 5 (multiplicity of infection
(MOI) = 20) for 2 hours in 2% FBS containing DMEM. Transfection medium was then replaced with growth medium (10% FBS/DMEM) and the cells were incubated at 37o C.
Six hours prior to reaching maximum cytopathic effect (CPE), [35S]Trans label was
added to the medium. At maximum CPE, the medium was collected and cells were lysed
with 1ml RIPA buffer (150 mM NaCl, 1% NP-40, 0.5% deoxycholic acid, 0.1% SDS and
50 mM Tris, pH 8). Samples from each well were individually immunoprecipitated using
anti-CTGF/CCN2 antibody, incubated with protein A beads, and eluted from the beads
by boiling with SDS-PAGE loading buffer. Immunoprecipitated proteins were 43 electrophoresed on a 15% SDS-PAGE polyacrylamide gel in reducing conditions and
exposed to film.
2.2.5 Passage Assay
To determine if the rAAV-CTGF/CCN2 clones yielded a viable virus that could infect
cells and drive protein expression, a passage assay was performed. HeLa cells were
transiently transfected as in Section 2.2.4 except that [35S]Trans label was not added to
the cells. Cells were incubated until maximum CPE was reached. Next, crude viral
lysates were made by 3 freeze-thaw cycles of the combined cells and medium, centrifugation to remove cell debris and heating the supernatant at 56o C for 1 hour to kill
Ad5. Crude rAAV lysate (1:2 or 1:10 dilutions) was then added to C12 cells (HeLa cells stably transfected with rep and cap) with Ad5 at a MOI of 20. Six hours prior to
maximum CPE, cells were metabolically labeled and processed for CTGF/CCN2
immunoprecipitation as in Section 2.2.4.
2.2.6 Verification of correct replication intermediates
This experiment was designed to show that the characteristic Hirt DNA intermediates of
the rAAV genome (monomeric, dimeric, trimeric, etc.) were produced during the passage
assay. The passage assay was performed as described in Section 2.2.5 with a 1:5 dilution
of crude rAAV-CTGF/CCN2 lysate. At maximum CPE, cells were pelleted and washed
twice with HBSS, and then resuspended in 50 ml HBSS. Hirt DNA was extracted by
44 incubating with Hirt DNA extraction buffer (0.6% SDS, 10 mM Tris pH 7.6, 10 mM
EDTA) then NaCl (1M final concentration) and mixing. After refrigerating more than 6
hours the solution was centrifuged for 30 minutes and the supernatant was
phenol/chloroform extracted. The DNA was pelleted with EtOH, resuspended in TE, run
on a 1% TAE gel, and transferred to a nylon membrane. A Southern blot was then
performed using a [32P]-randomly labeled probe designed to hybridize to the CMV or
EF1α promoter.
2.2.7 Selection of rAAV-CTGF/CCN2 producer cell lines
One clone of each rAAV-CMV-CTGF and rAAV-EF1α-CTGF was stably transfected into HeLa cells using Superfect according to the manufacturer’s instructions. Stably transfected cells were sparsely plated in 15 cm plates and incubated at 37o C until
colonies of cells were formed. Each colony was picked and moved into an individual
well of a 96 well plate. These individual cell lines were tested for rAAV production with
a heparin ELISA. Briefly, cells were infected with Ad5 and then harvested at maximum
CPE with TMN buffer (20mM Tris, 1mM MgCl2, 150 mM NaCl) containing 0.5%
deoxycholine (DOC) and 50 U/ml benzonase. Cell lysate (100 µl) was then added to a
neutravidin plate coated with biotinylated heparin. The plate was then incubated at 37o
C for 1 hour with shaking, washed with PBS/0.5% Tween/0.1% BSA, and A20 mouse antibody (which specifically binds to assembled AAV2 capsids) was added and incubated at 37o C for 1 hour. A secondary anti-mouse IgG - horse radish peroxidase (HRP)-
conjugated antibody was then incubated on the plate for 30 minutes at 37o C. The plate 45 was developed with Sigma TMB substrate for 10 minutes at room temperature, stopped
with the addition of 1 N H2SO4 and read at 450 nm.
Five of the highest rAAV producing cell lines for each virus were chosen for expansion.
rAAV was isolated from each of these producer cells lines using a “micro-batch heparin”
method. Briefly, producer cell lines were plated and infected with Ad5 (MOI = 20). At
maximum CPE, the cells were harvested by pipeting up and down and transferred to a
siliconized microcentrifuge tube. Five hundred µl lysis/binding buffer (TMN/0.5% deoxycholate/50U/ml benzonase) and 5 µl heparin POROS resin was used to resuspend the cell pellet at 37oC for 15 minutes. This mixture was rotated overnight at 4o C and
then washed and eluted with TMN/450mM NaCl. The resin and virus was pelleted and
the eluted virus was stored at -20o C.
Virus titer was tested with real time PCR. The virus was diluted in 1x PCR II buffer, 5
mM MgCl2 and treated with Proteinase K (0.2 µg/µl) for 1 hour. 2.5 µl of this treated cell lysate or plasmid control or H2O was added to a standard Taqman master mix
containing CMV primers and probe or EF1-α primers and probe. The primers and probes
were as follows: CMVfor 5’ - TGGAAATCCCCGTGAGTCAA - 3’, CMVrev 5’ -
CATGGTGATGCGGTTTTGG - 3’, CMV probe 5’ - {6-
FAM}CCGCTATCCACGCCCATTGATG{TAMARA}, EF1αfor 5’ -
GGTGAGTCACCCACACAAGG - 3’, EF1αrev 5’ -
GGTACTCCGTGGAGTCACATGAA - 3’, EF1α probe 5’ - {6-
FAM}TCCACGCCCCTGGCTGCA{TAMARA} The PCR reaction was performed (50o 46 C for 2 minutes, 95o C for 10 minutes, and 40 cycles of 95o C for 15 seconds-60o C for 1 minute) and copy numbers per reaction were extrapolated from the CMV or EF1-α plasmid controls. In this way viral titers for each producer cell line were determined and the highest producer cell line for each rAAV-CMV-CTGF and rAAV-CTGF-EF1α were chosen for large-scale cell cube production.
109 producer cells were seeded into a 25-layer Corning cell cube and allowed to grow to
confluency. Cells were then infected with Ad5 and incubated until maximum CPE was
achieved. The cell debris was pelleted, heated to 56oC to destroy contaminating Ad5
while preserving rAAV integrity, solublized and subjected to affinity chromatography. A
POROS heparin column was equilibrated in buffer (20 mM Tris, pH 8/100mM NaCl) and
the clarified cell lysate containing the rAAV was applied at a flow rate of 5 ml/minute at
room temperature. The column was washed with equilibration buffer until the A280 reading returned to baseline. Bound material was eluted by application of a linear NaCl gradient (0.1-1.0M) and 1 ml fractions were collected. rAAV was eluted with ~0.4M
NaCl.
2.2.8 Characterization of final producer cell lines
The DRP titer was determined with Real Time PCR as described in section 2.2.7.
Infectious titer was determined with a C12 assay. Briefly, cells were seeded into plates and infected with serial dilutions (10-8 to 10-12) of both rAAV-CTGF viruses with and
without Ad5 co-infection. Forty eight hours later (before maximum CPE) DNA was 47 isolated from the cells using the QIAamp DNA Blood mini kit per the manufacturer’s
instructions. The DNA was then amplified with Real Time PCR as described in section
2.2.7 and an infectious yield was calculated. A cycle threshold (Ct) difference of 3 or
greater between Ad5+ and Ad5- samples is indicative of a (+) viral amplification.
To insure that the viral DNA in the capsid was full length, a Southern blot of single
stranded viral capsid DNA was performed. 9 x1010 DRPs of both viruses were diluted in
200 µl with PBS then 200 µl buffer AL (from Qiagen DNeasy kit) were added.
Proteinase K was added to a final concentration of 1.8 µg/µl at 56o C to remove the
capsids. Two hundred µl EtOH were then added and the whole mixture was placed on a
Qiaspin column and the DNeasy protocol was followed. 100ng of rAAV-CMV-CTGF
and rAAV-EF1α-CTGF DNA were denatured in alkaline loading buffer (6x - 300 mN
NaOH, 6 mM EDTA, 18% Ficol) and loaded onto an 0.8% alkaline gel (50 mMNaOH, 1
mM EDTA, 0.8% agarose). The DNA was transferred to a nylon membrane, probed with
a [32P]-randomly labeled (1 - 1049bp) CTGF/CCN2 probe and exposed to film.
2.2.9 rAAV-CMV-CTGF and rAAV-EFα1-CTGF infection of HSC-T6 cells
HSC-T6 cells were plated in 6 well plates at a density of 1 x 106 cells per well in
Waymouth’s media supplemented with 10%FBS, L-glutamine, penicillin and
streptomycin one day before they were used. The next day they were infected with
nothing, Ad5 alone (MOI = 20), Ad5 plus rAAV-CMV-CTGF or rAAV-EF1α-CTGF
(MOI = 1 x 106), or rAAV-CTGF alone in 2% media overnight. The next day media was 48 replaced with 10% media (for DNA and RNA extraction wells) or 0.2% media (for
protein extraction wells). When maximum CPE was reached, DNA and RNA was
harvested from the cells and protein was collected from the medium.
Both RNA and DNA were collected using Trizol per the manufacturer’s protocol.
Briefly, each well of cells was lysed with 1 ml Trizol, incubated at room temperature,
mixed with chloroform and centrifuged. The aqueous layer was precipitated with isopropanol to collect total RNA while the interphase and phenol was taken for DNA isolation per the manufacturer’s instructions. RNA was further treated with RQ1-RNase
free DNase to remove any residual genomic DNA.
Total RNA (1 µg) was reverse transcribed to produce cDNA using Oligo dT primers and
Superscript RT II per the manufacturer’s protocol. The final product was incubated with
RNase H to remove residual RNA from the cDNA. 10% of the RT reaction and 1 µl of
DNA were used for polymerase chain reaction (PCR). Platinum Taq was used per the
manufacturer’s instructions except 10% DMSO was added to each reaction to facilitate
strand separation and amplification of CTGF transcripts [194]. The primers used for
PCR were designed on exon 4 and exon 5 to distinguish between native CTGF/CCN2
(includes intron) and recombinant CTGF/CCN2 (no intron) for PCR amplification of
CTGF/CCN2 DNA. RT-PCR band results were expected to be the same size for both
native and recombinant mRNA. Primers were also designed on highly conserved
sections of exons 4 and 5 that would amplify CTGF/CCN2 from human, mouse and rat
tissues. The primers sequences were hmCTGF(Exon4)F 5’ –ACCACAGCGTGGAG 49 CGCCTG - 3’, hmCTGF(Exon5) 3’ - GGCAGGCACAGGTCTTGATG - 3’. The
primers were designed across CTGF/CCN2 intron 4 so that a native CTGF/CCN2
amplification product was 741 bp while a recombinant CTGF/CCN2 amplification
product was 371 bp. Glyceraldehyde-3-phosphate dehydrogenase primers were also
designed for a positive house-keeping control. The primers sequences were mGAPDHF
5’ - TGGCAAAGTGGAGATTGTTGCC - 3’, mGAPDHR 5’ – TTGTCATGGATGA
CCTTGGCC - 3’ and had an expected size of 425 bp. 10% of the final reaction was
analyzed on a 1%TAE gel.
Media from each well was passed through 25 µl beds of heparin sepharose to concentrate
CTGF/CCN2 protein taking advantage of the ability of CTGF/CCN2 to bind heparin. [40,
42, 44, 49, 193, 195] Proteins that bound to the beads were extracted by boiling in SDS-
PAGE loading buffer. Samples were subjected to SDS-PAGE electrophoresis under
reducing conditions on a 15% polyacrylamide gel at 200 V, transferred to nitrocellulose
and incubated with a 1:1000 dilution of rabbit anti-CTGF/CCN2[247-260] antibody or
rabbit pre-immune serum. Immunoreactive bands were visualized using alkaline
phosphatase-conjugated goat anti-rabbit IgG followed by NBT/BCIP chromogenic
substrates.
50 2.2.10 rAAV-CTGF/CCN2 delivery to mouse muscles and liver
C57Bl/6 4 week old female mice were anesthetized with 0.1ml/10g
KeTaset/xylazaine(7:3) intraperitonealy. TMN buffer (50 µl) alone or 5 x 1011 DRPs of rAAV-CMV-CTGF or rAAV-CMV-βGal was injected into the right quadriceps muscle.
Muscle tissue was harvested for DNA, RNA and protein analysis at 1, 2 and 4 months.
Blood was also collected into lithium heparin tubes for plasma preparation at these time
points. The control TMN group contained 2 mice for each time point, the rAAV-CMV-
βGal group contained 2 mice for the 1 month time point and 4 mice for the 2 and 4 month time points, the rAAV-CMV-CTGF group contained 2 mice for the 1 month time point
and 6 mice for the 2 and 4 month time points.
C57/black six 7-8 week old female mice were anesthetized with 2.5% Avertin
intraperitonealy. 100 µl TMN buffer containing 4.2 x 1011 DRPs of rAAV-EF1α -CTGF
or rAAV empty particles were directly injected into the liver at multiple sites. Liver
tissue and plasma were collected at 1 and 2 months post injection for DNA, RNA, and
protein analysis. The control empty particle group contained 2 mice for each time point
while the rAAV-EF1α-CTGF group contained 4 mice for each time point.
DNA isolation was completed with a DNeasy kit per the manufacturer’s instructions and
RNA isolation was achieved with a RNeasy kit per the manufacturer’s instructions or
with Trizol as in Section 2.2.9. Tissue for immunohistochemistry was fixed in
Histochoice overnight then dehydrated with graded EtOH, embedded in paraffin and 51 sectioned onto Superfrost slides. Tissue for β-Gal staining was frozen in OCT, sectioned
on a cryostat and stained as in Section 2.2.2. Tissue protein was extracted by
homogenization with 5 mM Tris-HCl, 0.75 M NaCl and 5 mM PMSF and quantified
using a BCA protein assay per the manufacturer’s instructions. Briefly, the samples were clarified by centrifugation and 25 µl of a 1:10 or 1:100 dilution of the tissue protein was added to individual wells of a 96-well plate. A series of BSA standard dilutions (0.125 mg/ml - 2 mg/ml) were also applied to the plate. Two hundred µl of the working reagent was added to the wells, mixed and then incubated for 30 minutes at 37oC. The plate was
then cooled and the absorbance was measured at 562nm. Protein concentrations were
calculated by using the curve generated by the BSA standards. Total protein, plasma and
heparin-purified protein were analyzed by Western blot as described in Section 2.2.9.
PCR and RT-PCR for CTGF/CCN2 and GAPDH was completed as in Section 2.2.9 for all time points. Additionally, immunohistochemistry was performed for CTGF/CCN2 at all time points. Briefly, slides were heated at 60o C for 1 hour, dewaxed in 2 washes of xylene and then hydrated through a series of graded EtOH washes to dH20. Endogenous
peroxidase activity was blocked by placing slides in 3% H2O2 for 15 minutes, after which
they were rinsed in dH20 followed by PBS. Slides were then incubated in Power Block
for 10 minutes to block non-specific binding sites and then rinsed with PBS. Sections
were incubated for 1 hour at room temperature in PBS/2% BSA containing either 10
µg/ml rabbit anti-CTGF/CCN2 [81-94] IgG or 10 µg/ml non-immune rabbit IgG. Slides were then rinsed in PBS and incubated with a 1/50 dilution of goat Multilink biotinylated secondary anti-rabbit IgG in PBS/2% BSA for 20 minutes. Slides were rinsed again in 52 PBS then incubated with a 1/50 dilution of concentrated strepatividin conjugated
peroxidase for 20 minutes, washed with PBS and developed with diaminobenzidine for 3
minutes. The chromogenic reaction was stopped with dH2O. Slides were counterstained
using hematoxylin and mounted in Aquamount.
2.3 RESULTS
2.3.1 Verification of CTGF/CCN2 protein production from triple-play vectors
Three clones were produced for rAAV-CMV-CTGF (termed “HI-3”, “-11”, “-13”) and two clones were produced for rAAV-EF1α-CTGF (termed “28” and “35”). To determine if CTGF/CCN2 protein could be translated from the triple play vectors rAAV-CMV-
CTGF and rAAV-EF1α-CTGF, these plasmids were transiently transfected into HeLa cells with infection of Ad5. As shown in Figure 2.2, CTGF/CCN2 protein was detected by immunoprecipitation in both the media and cell lysate of the transfected cells for all triple play rAAV-CTGF clones tested, as well as a positive pcDNA3.1-HI control.
However, CTGF/CCN2 protein was more prominent in rAAV-CMV-CTGF transfected cells than in rAAV-EF1α-CTGF transfected cells. No CTGF/CCN2 protein was detected in Ad5 only infected cells. This demonstrated that the constructs were capable of protein production.
53 2.3.2 Verification of production of viable virus from rAAV-CMV-CTGF and rAAV-
EF1α-CTGF clones
To determine if the rAAV-CTGF clones could yield a viable virus that could infect cells,
drive protein expression and yield correct replication intermediates, a passage assay and
Hirt Southern blot were performed. The passage assay demonstrated that all rAAV-
CTGF clones could produce a viable virus that could then infect C12 cells and drive
CTGF/CCN2 protein production. As shown in Figure 2.3, CTGF/CCN2 protein was detected by immunoprecipitation of media or cell lysate of C12 cells that had been infected with rAAV-CMV-CTGF or rAAV-EF1α-CTGF crude virus but not in cells that had been infected with nothing or Ad5 alone.
Similarly, a Southern blot of Hirt viral DNA from C12 cells infected with rAAV-CMV-
CTGF (Figure 2.4.A) or rAAV-EF1α-CTGF (Figure 2.4.B) crude viral lysate demonstrated that AAV correct replication intermediates were produced. Monomeric, dimeric and trimeric replication intermediates of 3553, 7106 and 10659 bp, respectively, were seen for rAAV-CMV-CTGF infected C12 cells (Figure 2.4.A). In addition, monomeric, dimeric and trimeric replication intermediates of 3545, 7090 and 10635 bp, respectively, were detected for rAAV-EF1α-CTGF infected C12 cells (Figure 2.4.B) No replication intermediates were found in non-infected or Ad5 only infected C12 cells.
54 2.3.3 Selection of rAAV-CTGF/CCN2 producer cell lines
Stably transfected cell lines containing rAAV-CMV-CTGF-clone 13 or rAAV-EF1α-
CTGF-clone 28 were tested for AAV production with an ELISA (data not shown). Five of the highest AAV producing cell lines for each virus were chosen for expansion into flasks and rAAV was isolated from these producer cell lines using the micro-batch heparin method (Section 2.2.7). Viral titer was tested with real-time PCR and the producer cell line with the highest viral titer (Figure 2.5.A) was chosen for large-scale cell cube production (Figure 2.5.B). The highest viral titer for rAAV-CMV CTGF was
42,851 DRPs/cell, while the highest viral titer for rAAV-EF1α-CTGF was 2,636
DRPs/cell. These two producer cell lines were grown in a small scale adherent cell cube bioreactor (Corning Cell Cube) and rAAV virus was isolated.
2.3.4 Characterization of final producer cell lines
The DRP titer of viruses produced in the cell cube was found to be 1.7 x 1013 DRP/ml for
rAAV-CMV-CTGF virus and 4.2 x 1012 DRP/ml for rAAV-EF1α-CTGF virus (Figure
2.5.B). Infectious titer, as determined by a C12 assay (Section 2.2.8), was 1 infectious
units (IU)/ 18.5 DRPs for rAAV-CMV-CTGF virus and 1 IU/105 DRPs for rAAV-EF1α-
CTGF virus (Figure 2.5.B). To ensure the viral DNA in the capsid was full length, a
Southern blot of capsid DNA was performed. Full-length (3553 bp - rAAV-CMV-CTGF and 3545 bp - rAAV-EF1α-CTGF) viral capsid DNA was detected for both rAAV-CTGF viruses. However, some lower size DNA was seen as well (Figure 2.6). 55
2.3.5 In vitro infection of HSC-T6 cells by rAAV virus
rAAV-CMV-βGal (Figure 2.7.A), rAAV-CMV-GUS (Figure 2.7.B) and rAAV-EF1α-
GUS (Figure 2.7.C) reporter viruses were all able to successfully transduce HSC-T6 in culture with MOIs of 1.5 x 107, 1.6 x 107, 7.5 x 106, respectively, when Ad5 was concurrently added. Approximately 10% of cells were infected by rAAV-CMV-βGal,
while 90% were infected with rAAV-CMV-GUS and rAAV-EF1α-GUS when compared
Ad5 only controls.
Additionally, rAAV-CMV-CTGF and rAAV-EF1α-CTGF viruses were used to transduce
HSC-T6 cells in vitro. Recombinant CTGF/CCN2 DNA was found in HSC-T6 cells infected with rAAV-CTGF alone or co-infected with Ad5, but not in cells infected with
nothing or Ad 5 alone (Figure 2.8.A). Recombinant and native CTGF/CCN2 DNA were
distinguished by the size of the transcript generated by PCR. The primers were designed
across CTGF intron 4 so that a native CTGF/CCN2 amplification product was 741 bp
while a recombinant CTGF/CCN2 amplification product was 371 bp. Although the size
of recombinant and native CTGF/CCN2 mRNA is the same, relatively more
CTGF/CCN2 transcript was noted in cells infected with rAAV-CTGF alone or co- infected with Ad5, than in cells infected with nothing or Ad5 alone (Figure 2.8.B).
CTGF/CCN2 protein was detected by Western blots only in HSC-T6 cells infected with
both rAAV-CMV-CTGF and Ad5 together (Figure 2.8.C). Characteristic CTGF/CCN2 56 isoforms (16-20 kDa, 10 kDa) were detected along with full length (38 kDa)
CTGF/CCN2 protein suggesting that the HSC-T6 cell environment is suitable for
CTGF/CCN2 processing similar to that which occurs in other systems. [40, 42, 43, 49,
196-198]. CTGF/CCN2 protein was not detected in HSC-T6 cells infected with rAAV-
EF1α-CTGF either alone or with Ad5 (Figure 2.8.D).
2.3.6 rAAV-CMV-CTGF delivery to the muscle
Virus injected into the right quadriceps was detected via PCR for CTGF/CCN2 at 1, 2 and 4 months post injection. Recombinant CTGF was detected only in the right
(injected) quadriceps and not in the left quadriceps of the same animal or in either quadriceps of control TMN injected animals (Figure 2.9.A).
RNA from both right (injected) and left quadriceps was also collected and subjected to
RT-PCR analysis for CTGF/CCN2 at the same time points. Relatively more
CTGF/CCN2 mRNA was detected in the right quadriceps of injected mice than in the left quadriceps of the same mice or both quadriceps of control TMN injected mice (Figure
2.9.B). The increase in transcript amount most probably was due to transcription of both native and rCTGF/CCN2 DNA.
Muscles injected with a control β-Gal virus (rAAV-D6∆Not - Table 2.1) were stained for
β-Gal expression as described in Section 2.2.2. At 1 month post injection, 1 of 2 quadriceps injected with β-Gal virus demonstrated β-Gal staining (data not shown) that 57 covered ~20% of the section. At 2 months post injection, 2 of 2 β-Gal virus-injected quadriceps exhibited β-Gal staining over ~40% of the section (data not shown). Finally,
4 months post injection, 2 of 2 β-Gal virus-injected quadriceps exhibited β-Gal staining over ~90% of the section (data not shown). These data proved that the injection technique was sound and confirmed that rAAV was able to transduce muscle.
CTGF/CCN2 protein over-expression in the muscle was tested by immunohistochemistry using an anti-CTGF antibody. While normal muscle did not contain a detectable amount of CTGF/CCN2 protein, CTGF/CCN2 over-expression was found in 1 of 6 CTGF virus- injected quadriceps over ~10% of the section 2 months post injection (Figure 2.9.C).
Morphological changes were observed by H & E staining and histological examination of the right quadriceps showed groups of abnormal fibers many of which were atrophic
(Figure 2.9.C). Both atrophic fibers and adjacent non-atrophic fibers showed over- expression of CTGF/CCN2 protein. CTGF/CCN2 over-expression was also noted in 1 of
6 CTGF virus injected quadriceps over ~1% of the section 4 months post injection, although no atrophy was noted in this region (data not shown). No CTGF/CCN2 over- expression was found in 1 month quadriceps (data not shown).
To determine if elevated circulating levels of CTGF/CCN2 protein existed, plasma collected 2 and 4 months post rAAV-CMV-CTGF injection was tested for CTGF/CCN2 protein by Western blot analysis. No CTGF/CCN2 protein was detected when plasma was tested directly or after purification and concentration using heparin-sepharose (as in
Section 2.2.9) (data not shown). The plasma from 2 month animals was also tested for 58 the possible presence of anti-CTGF antibodies generated by the host mice. Plasma
samples from the 2 month control and CTGF mice were used as antibody for a Western blot that was designed to detect recombinant CTGF/CCN2. No difference was seen between control plasma and plasma collected from CTGF virus-injected animals (data not shown). It was concluded that the host animals did not produce antibodies to the
recombinant CTGF/CCN2.
To ensure the lack of protein over-expression in virally infected muscles was not due to
poor DNA integration into the muscle, total DNA isolated from injected quadriceps was
tested via real-time PCR. 100 ng of DNA was tested and vector copies per cell was
determined. On average, one nucleus has approximately 6 pg DNA and using that
assumption, there are 16,667 nuclei in 100 ng DNA. The results of viral integration for
rAAV-CMV-CTGF were within the same range of rAAV-CMV-βGal despite the fact
that the there was more total staining for βGal than for CTGF/CCN2. The results are
listed in Table 2.2.A.
2.3.7 rAAV-EF1α-CTGF delivery to the liver
rAAV-EF1α-CTGF virus injected into the liver was detected via PCR for CTGF/CCN2
at 1 and 2 months post injection. Recombinant CTGF/CCN2 DNA was detected only in
livers injected with CTGF/CCN2 virus and not in livers injected with empty rAAV virus
(Figure 2.10.A).
59 RNA from livers was also collected and subjected to RT-PCR analysis for CTGF/CCN2
at the same time points. Relatively more CTGF/CCN2 mRNA was detected in the livers
of rAAV-EF1α-CTGF injected mice than in livers of empty rAAV virus injected mice
(Figure 2.10.B). The increase in transcript amount was most likely due to transcription of
both native and rCTGF/CCN2 DNA.
CTGF/CCN2 protein over-expression in the liver was tested by immunohistochemistry
using an anti-CTGF antibody. However, no CTGF/CCN2 protein expression was noted
at any time point in injected livers (data not shown). Total liver protein was also tested
for CTGF/CCN2 protein, but Western blots for both the negative controls and livers
injected with rAAV-CTGF virus showed similar banding patterns indicating that no over-
expression of CTGF/CCN2 was present (Figure 2.10.C). Plasma was also tested using
Western blot analysis to determine if there was any CTGF/CCN2 in the circulation of the infected mice. Plasma from both mice injected with empty rAAV virus or rAAV-EF1α-
CTGF contained no CTGF/CCN2 protein (Figure 2.10.D). Additionally, the plasma from
1 and 2 month animals was analyzed for the possible presence of anti-CTGF antibodies generated by the host mice. Plasma isolated from mice injected with either the control or
CTGF virus was used as antibody for Western blot analysis designed to detect recombinant CTGF/CCN2. No difference was seen between control and CTGF viral injected plasma (data not shown). It was concluded that the host animals did not produce antibodies to the recombinant CTGF/CCN2.
60 To determine if the viral DNA had integrated into the liver, total DNA isolated from
injected livers was tested by real-time PCR. 100 ng of DNA was tested and vector copies
per cell was determined. The results were comparable to positive control DNA from
tissue that had previously proven to have viral integration (personal communication - K.
Backstrom, CRI, Columbus, OH). The results are listed in Table 2.2.B.
2.4 DISCUSSION
2.4.1 Performance of rAAV-CTGF viruses in vitro
All reporter gene viruses that were tested on HSC-T6 cells successfully transduced their
hosts and produced protein when co-infected with Ad5. Similarly, rAAV-CMV-CTGF
was able to successfully transduce HSC-T6 cells and produce CTGF/CCN2 protein with
co-infection of Ad5. This protein was additionally proteolyticly processed to previously seen CTGF/CCN2 isoforms [40, 42, 43, 49, 196-198]. In addition, both rAAV-CMV-
CTGF and rAAV-EF1α-CTGF viruses were able to transduce C12 cells and produce
protein. In contrast, rAAV-EF1α-CTGF transduced HSC-T6 cells did not yield
CTGF/CCN2 protein when co-infected with Ad5. Although rAAV-EF1α-CTGF virus
was able to transduce C12 cells and produce CTGF/CCN2 protein, this protein was only
detectable with immunoprecipitation and not by Western blot analysis. Similarly, protein
produced from rAAV-CMV-CTGF virally transduced C12 cells was more easily seen by
61 immunoprecipitation, although it was detected by Western blot. With hindsight, the fact that such a sensitive measure of detection was needed may indicate a quantitative issue may have been a problem.
2.4.2 Performance of rAAV-CTGF viruses in vivo
Only the rAAV-CMV-CTGF virus was able to deliver the gene to a target organ such that an over-expression of CTGF/CCN2 protein was seen. Even this expression, however, was not as wide spread and was at a lower frequency than what was seen with similar experiments utilizing rAAV gene delivery to skeletal muscle [183]. Additionally, in our hands the rAAV-CMV-βGal virus was able to transduce a large amount of muscle tissue while the rAAV-CMV-CTGF could not. In the mouse muscle that showed the greatest level of CTGF/CCN2 overexpression, CTGF/CCN2 was overproduced in distinct muscle cells and accumulated at high intracellular levels, a phenomenon that was associated with muscle fiber atrophy. Whether this atrophy was directly due to CTGF/CCN2 or from the overproduction of any protein in a cell is hard to deduce. As CTGF/CCN2 is known to be involved in ECM synthesis as well as angiogenesis, it was hypothesized that some change would be seen in the amount of collagen or blood vessels in virally infected organs [83, 108]. As determined by staining with Masson’s Trichrome stain or Factor
VIII antibodies, no increase in either collagen or blood vessels, respectively, were noted in virus-infected muscle or liver (data not shown). However, it is possible that if
CTGF/CCN2 expression was more wide-spread, increased collagen and numbers of blood vessels might have been observed.
62
Why are these rAAV-CTGF viruses yielding little or no CTGF/CCN2 over-expression in
vivo? In retrospect, the need for RIPA analysis, as opposed to the less sensitive Western
blot, to analyze the transient transfection and passage assays may have been an indication that a large amount of protein was not being produced from these transcripts. rAAV-
CMV-CTGF produced protein that could be seen by Western blot for the passage assay but not for the transient transfection (data not shown). Neither transient transfection nor passage assays could be successfully analyzed by Western blot for rAAV-EF1α-CTGF
virus (data not shown). Since the CTGF/CCN2 transcript for the rAAV construct was
taken from the pcDNA3.1-HI plasmid which had been successfully used to produce
recombinant CTGF/CCN2 protein [49] it is unlikely that the CTGF/CCN2 construct and
its surrounding sequences would be problematic. Additionally, the CTGF/CCN2
transcript was excised from the pcDNA3.1-HI and ligated into the commercial gene
expression vector pEF/myc/cyto to create pEF-CTGF that theoretically should have
produced CTGF/CCN2 protein. This, however, was not demonstrated until it was cloned
into the rAAV triple play plasmid and tested by RIPA with the transient transfection and passage assays.
To ensure that the reason for little or no protein expression was not because of a packaging defect, a Southern blot of viral capsid DNA was performed. This assay was to make sure that full-length DNA was successfully packaged into the capsid as expected.
Both viruses had full-length DNA in the capsid but there were also partial encapsidation products within the capsid as well. This was not deemed to be problematic as the rAAV-
63 CMV-βGal virus also has many partial encapsidation products in its capsid (data not shown) and still functions successfully as a virus [183]. Nonetheless, it cannot be formally eliminated as a possible cause, at least in part, for the negative transduction data.
Recombinant CTGF/CCN2 DNA was also detected by PCR in muscle and liver DNA.
Since standard PCR did not give an indication of how much DNA was in the muscle and liver, real-time PCR was employed to determine how many vector copies/cell existed in the tissue. There have been reports that, in several cases, foreign DNA inserted into an
AAV vector inhibited AAV DNA replication [199]. It has been suggested that some sequences (poison sequences) are incompatible with AAV DNA replication and inhibit replication in cis [199]. However, the nature of these inhibitory sequences is not known
[199]. This does not appear to be the case, at least in terms of replication, for the
CTGF/CCN2 sequence. DNA from rAAV-CMV-CTGF infected muscle had similar amounts of vector copies/cell as rAAV-CMV-βGal infected muscle. Also, DNA from rAAV-EF1α-CTGF infected liver had comparable amounts of vector copies/cell as previously tested positive liver viruses. Thus, it was concluded that both rAAV-CTGF viruses were, indeed, infecting the muscle efficiently.
CTGF/CCN2 mRNA levels for infected muscle and liver were increased when compared to uninfected tissue. However, this determination was semi-quantitative and did not reveal the actual amount of mRNA being transcribed. In situ hybridization would have
64 demonstrated how wide-spread the translation was in the muscle and liver. However, only immunohistochemistry was performed as the ultimate goal of the infection was over-expression of CTGF/CCN2 protein.
Two out of 18 infected muscles exhibited CTGF/CCN2 immunostaining while 0 out of 8 infected livers showed CTGF/CCN2 protein expression by immunostaining. Other methods for detecting protein were also used. The plasma of animals injected with rAAV-CMV-CTGF in the muscle and rAAV-EF1α-CTGF in the liver was analyzed for circulating levels of CTGF/CCN2 but it was not detected in either case. Additionally, liver homogenate was tested for increased CTGF/CCN2 protein by Western blot analysis but no increase in protein was found. Human CTGF/CCN2 and mouse CTGF/CCN2
DNA are highly conserved (~90% identity) so an antibody response was not expected.
Nevertheless, to insure the lack of protein production was not from an immune response that generated antibodies to the human CTGF/CCN2 gene, the plasma was also checked for CTGF/CCN2 antibodies. No antibodies to CTGF/CCN2, however, were found in the plasma.
Recently, there have been reports of cis acting elements in mRNA that negatively regulate gene expression. One such element is found in the 3’untranslated region (UTR) of CTGF/CCN2. There is a small conserved segment in the CTGF/CCN2 3’UTR that acts as a strong negative regulator of gene expression [200, 201]. This cis-acting element of structure-anchored repression (CAESAR) forms a stable secondary structure in vitro that acts as a post-transcriptional negative regulatory element [201]. The 3’UTR of
65 CTGF/CCN2 was not included in the rAAV viral clones, however, it may be possible that
a negative regulatory sequence exists in sequence surrounding the CTGF/CCN2 cDNA in
the triple play vector and viral DNA that affects its gene expression.
2.4.3 Summary
Since little or no protein was generated by infecting the muscle and liver with rAAV-
CTGF, it cannot be deduced whether over-expression of CTGF/CCN2 alone could drive
fibrosis in an organ system or whether TGF-β1 may be needed as an initial stimulus. It
seems that although the rAAV virus could package, deliver DNA and transcribe RNA, protein translation was severely hampered. The exact reason for this is not known,
although perhaps it is similar to the ‘poison sequences’ that proved detrimental to the
replication of certain genes packaged in rAAV [199]. Possibly after being packaged by
rAAV in cis with the ITRs, CTGF/CCN2 cannot be translated efficiently because of
negative regulatory sequences surrounding the CTGF/CCN2 cDNA. Researchers have successfully delivered CTGF/CCN2 via Ad. The nature of this system, however, is that only short-term effects can be studied using Ad because of the immune response that accompanies Ad infection. Perhaps rAAV will not be the means for studying
CTGF/CCN2 long-term over-expression in organs in the future, but whether there is a direct link between CTGF/CCN2 expression and the onset and progression of fibrosis in organs is still an interesting and important question to ask.
66 An alternate method that could be used to study the effect of CTGF/CCN2 over-
expression in the liver is the generation of a conditional liver-specific CTGF/CCN2
transgenic mouse. By using a Tet On system that takes advantage of the intrinsic
properties of the E.coli tetracycline resistance operon, a transgenic mouse could be generated with tightly regulated gene expression in response to tetracylcine. Briefly, 2
sets of transgenic mice would be generated and then mated together. The first transgenic
mouse would contain a transgene containing the transactivator, rtTA, expressed from the
liver specific promoter, mouse albumin. The second transgenic mouse would contain a
transgene containing the CTGF/CCN2 gene fused to a silent promoter with Tet response
elements (TRE). After breeding these 2 mice together the CTGF/CCN2 gene would be
silent until the mice were given tetracycline. The rtTA product would complex with the
tetracycline and bind to the TRE in the silent promoter thereby activating transcription of
the CTGF/CCN2 gene. A similar strategy was successfully used for liver-specific
expression of Simian Virus 40 T antigen in mice [202].
The ultimate line of thought for these experiments was to one day determine if rAAV
delivering anti-sense CTGF/CCN2 could prevent fibrosis. Perhaps someday, similar
studies could be done in fibrotic mouse models to determine if liver fibrosis can be
reversed with anti-sense CTGF/CCN2 mRNA. If this proves to be true, it may be
possible to employ this knowledge to help combat different fibrotic diseases through anti-
sense technology, gene therapy, neutralizing antibodies or antagonists of CTGF/CCN2
receptors.
67 BGH CMV MCS pA Sp6 CTGF T7
pcDNA 3.1 CTGF pCTGF/pCR II 726-1050 bp Amp ColE1 Neo pUCoriAmp Kan f1 ori Sp6 T7 Sp6 TGFβ1 T7 MCS pCR II TGF-β1 mTGF-β/pCR II 158-604 bp pUCori Amp Kan f1 ori pUCoriAmp Kan f1 ori BGH EF1α MCS pA Sp6 TGFβ1 T7
pEF/myc/cyto TGF-β1 pTGF-β/pCR II -278-606 bp
Amp ColE1 Neo pUCoriAmp Kan f1 ori BGH CMV CTGF pA Sp6 β-gal T7 CTGF pcDNA 3.1 - HI β-Gal/pcRII 1-1050 bp
Amp ColE1 Neo pUCoriAmp Kan f1 ori
BGH ITR EF1α CTGF pA ITR CMV β-gal CTGF pEF-CTGF pAAV-D6∆Not 1-1050 bp Amp ColE1 Neo NeoTK rep/cap
Sp6 CTGF T7 ITR β-gal ITR CTGF hCTGF/pCR II pAAV-β-gal∆PNeoTK/RC 738-1050 bp cl 17 pUCori Amp Kan f1 ori rep/cap NeoTK CMV Sp6 CTGF T7 ITR CTGFBGH ITR EF1α pA CTGF mCTGF/pCR II CTGF rAAV-CMV-CTGF 1-1046 bp or 1-1050 bp rAAV-EF1α-CTGF pUCori Amp Kan f1 ori rep/cap NeoTK
Table 2.1: Vectors used for CTGF/CCN2 studies
68
month post tissue stained Vectors/cell A injection positive
TMN control 1 no 0
rAAV-CMV-CTGF 1 no 5.5 rAAV-CMV-CTGF 1 no 0.4 rAAV-CMV-CTGF 2 no 0 rAAV-CMV-CTGF 2 yes 5.4 rAAV-CMV-CTGF 4 yes 23 rAAV-CMV-CTGF 4 no 36
rAAV-CMV-βGal 1 yes 4.9 rAAV-CMV-βGal 1 no 0.5 rAAV-CMV-βGal 2 yes 26 rAAV-CMV-βGal 2 yes 0 rAAV-CMV-βGal 4 yes 3.7 rAAV-CMV-βGal 4 yes 5.8
month post tissue stained Vectors/cell B injection positive
empty rAAV control 1 no 0 empty rAAV control 2 no 0
positive control 1 (KB) yes 37 positive control 2 (KB) yes 0.8
rAAV-EF1α-CTGF 1 no 2.5 rAAV-EF1α-CTGF 1 no 4.4 rAAV-EF1α-CTGF 1 no 2 rAAV-EF1α-CTGF 1 no 5.6 rAAV-EF1α-CTGF 2 no 4.1 rAAV-EF1α-CTGF 2 no 0.6 rAAV-EF1α-CTGF 2 no 0.4
Table 2.2: Viral vector copies per cell of infected muscle or liver
Real-time PCR was used to determine viral vectors/cell for infected muscle (A) and liver (B). Positive control 1,2 were obtained through Kris Backstrom (KB) and represented DNA from tissue that had previously been shown to exhibit viral integration.
69 Xmn I Xmn I Xba I Xba I
CMV CTGF BGH pA ITR β-gal ITR pcDNA 3.1 - HI pAAV-β-gal∆PNeoTK/RC cl 17 Amp ColE1 Neo rep/cap NeoTK
Eco RI Ase I
EF1α BGH CTGF pA pEF-CTGF
Amp ColE1 Neo
BGH CMV CTGF pA ITR ITR
BGH EF1α CTGF pA rep/cap NeoTK
ligate
CMV ITR CTGF BGH ITR EF1α pA rAAV-CMV-CTGF or rAAV-EF1 α-CTGF
rep/cap NeoTK
Figure 2.1: Cloning strategy for rAAV-CMV-CTGF and rAAV-EF1-α-CTGF
70
kDa A 46 CTGF/CCN2
30
1 2 3 4 5 6 7 8 9 10
B kDa 43 CTGF/CCN2 29
1 2 3 4 5 6
Figure 2.2: CTGF/CCN2 production by rAAV-CMV-CTGF and rAAV-EF1α-CTGF triple play vectors
A, Clones “H1-3”, “11” and “13” of the rAAV-CMV-CTGF triple play vector (lanes 1-3, respectively and 6-8, respectively) or positive control, pcDNA3.1-H1 (lanes 4 and 9) or nothing (lanes 5 and 10) were transiently transfected into Hela cells. After maximum CPE, media (lanes 1-5) and cell lysate (lanes 6-10) were individually immunoprecipitated using anti-CTGF antibody. CTGF/CCN2 is present in samples from cells transfected with the rAAV-CMV-CTGF vectors or control plasmid but not in the non-transfected cells. B, Clones “28” and “35” of rAAV-EF1α-CTGF of the triple play vector (lanes 1-2, respectively and 4-5, respectively) or nothing (lanes 3 and 6) were transiently transfected into Hela cells. After maximum CPE, media (lanes 1-3) and cell lysate (lanes 4-6) were individually immunoprecipitated using anti-CTGF antibody. CTGF/CCN2 is weakly present in samples from cells transfected with the rAAV-EF1α-CTGF vectors but not in the non-transfected cells.
71
kDa A
46
CTGF/ 30 CCN2
1 2 3 4 5 6 7 8 9 10
B kDa 43 CTGF/CCN2 29
1 2 3 4 5 6
Figure 2.3: rAAV-CTGF passage assay; viable virus can be made from rAAV-CTGF vectors
A, HeLa cells were concurrently infected with Ad5 (MOI = 20) and transfected with clones “H1-3”, “11”, “13” of rAAV-CMV-CTGF (lanes 1-3, respectively and 6-7, respectively) or nothing (lanes 4-5, 9-10). At maximum CPE crude viral lysates were collected and heated to destroy the Ad5. 1:2 dilutions of the crude viral lysate was then added to C12 cells concurrently with Ad5 (MOI = 20). Media (lanes 1-5) and cell lysate (lanes 6-10) were individually immunoprecipitated using anti-CTGF antibody. CTGF/CCN2 is present in samples infected with rAAV-CMV-CTGF virus but not with Ad5 alone. B, HeLa cells were concurrently infected with Ad5 (MOI = 20) and transfected with clones “28” and “35” of rAAV-EF1α- CTGF (lanes 1-2, respectively and 4-5, respectively) or nothing (lanes 3 and 6). At maximum CPE crude viral lysates were collected and heated to destroy Ad5. 1:2 dilutions of the crude viral lysate was then added to C12 cells concurrently with Ad5 (MOI = 20). Media (lanes 1-3) and cell lysate (lanes 4-6) were individually immunoprecipitated using anti-CTGF anti-body. CTGF/CCN2 is present in samples infected with rAAV-EF1α-CTGF virus but no with Ad5 alone.
72
A
bp
10000
6000
4000 3000
1 2 3 4 5 6
B bp
10000
6000 4000 3000
1 2 3
Figure 2.4: Southern blot for rAAV replication intermediates
A passage assay performed as in Figure 2.3 except a 1:5 dilution of crude viral lysate was used to infect C12 cells. Hirt DNA was collected from the infected C12 cells and subjected to Southern blot analysis. A, Characteristic monomeric, dimeric and trimeric forms of Hirt DNA were detected with CMV probe for clones “H1-3”, “11”, “13” (lanes 1-3, respectively) and for a control rAAV-CMV-β-Gal vector (lane 4) but not for non-infected cells (lane 5-6). Expected sizes for rAAV-CMV-CTGF viral intermediates = monomeric - 3553 bp, dimeric - 7106 bp, trimeric - 10659 bp. B, Characteristic monomeric, dimeric and trimeric forms of Hirt DNA were detected with EF1α probe for clones “28” and “35” (lanes 1-2, respectively) but not for non-infected cells (lane 3). Expected sizes for rAAV-EF1-α-CTGF viral intermediates = monomeric - 3545 bp, dimeric - 7090 bp, trimeric - 10635 bp.
73
A Producer cell line chosen for large scale purification
Ct
B CMV ITR CTGFBGH ITR EF1α pA rAAV-CMV-CTGF or rAAV-EF1α-CTGF Ad 5 + rep/cap NeoTK
rAAV-CMV-CTGF CMV rAAV-EF1α-CTGF 13 ITR CTGF BGH ITR 12 1.7 x 10 DRP/ml, EF1α pA 4.2 x 10 DRP/ml, IU/DRP = 1/18.5 IU/DRP = 1/105
Figure 2.5: Producer cell line selection and production
Real-time PCR was utilized to select producer cells lines (A). The best producer cell lines (lowest Ct on the real-time PCR graph) were chosen for large scale cell cube production (B). Virus produced from the cell cube was titered with real-time PCR and infectious units (IU) were tested with a C12 assay (section 2.2.8).
74
bp 4000
3000
2000
12
Figure 2.6: Southern blot of rAAV-CTGF capsid DNA
DNA extracted from rAAV-CMV-CTGF (lane 1) or rAAV-EF1α-CTGF (lane 2) viral capsids was analyzed by Southern blot. DNA of the expected full-length size (rAAV-CMV-CTGF - 3553 bp, rAAV- EF1α-CTGF - 3545 bp) was detected for each virus along with some break-down products.
75
Figure 2.7: rAAV can infect HSC-T6 cells
HSC-T6 cells were infected with rAAV-CMV -βGal (A) or rAAV-CMV-GUS (B) or rAAV-EF1α-GUS (C) reporter viruses, fixed and stained for β-Gal or GUS (blue stain).
76
Ad 5 --++ rAAV-CTGF -++- CTGF/CCN2 A
rCTGF/CCN2
GAPDH
B
CTGF/CCN2
GAPDH
C kDa
39
CTGF/CCN2
21
15
D 37 26
21
Figure 2.8: rAAV-CMV-CTGF can infect HSC-T6 cells in vitro
HSC-T6 cells were infected with nothing, Ad 5 (MOI = 20) alone, Ad 5 plus rAAV-CTGF ( MOI = 1 x 106), or rAAV-CTGF alone. DNA, RNA and protein was collected and used for PCR (A), RT-PCR (B) and western blot analysis (C, D). CTGF/CCN2 DNA and mRNA were seen for the rAAV-CMV-CTGF and rAAV-EF1α-CTGF virus (A,B) and protein was seen for the rAAV-CMV-CTGF (C) but not for the rAAV-EF1α-CTGF virus (D). 77
CTGF/CCN2 A
rCTGF/CCN2
GAPDH
1 2 3 4 5 6 7 8
B CTGF/CCN2
GAPDH 1 2 3 4 5 6 7 8
C
1 2
3 4
Figure 2.9: rAAV-CMV-CTGF injection into mouse quadriceps rAAV-CMV-CTGF was injected into the right quadriceps muscle of mice. At 1, 2, and 4 months post injection, tissue was collected and subjected to PCR (A), RT-PCR (B), and immunohistochemistry (C) analysis. A, Recombinant CTGF/CCN2 DNA was found in the right quadriceps of mice injected with the rAAV-CMV-CTGF virus (lanes 5 and 7) and not in the left quadriceps of those same mice (lanes 6 and 8) or in mice injected with TMN buffer (1-4) at 1month. B, Recombinant CTGF/CCN2 and native CTGF/CCN2 mRNA cannot be distinguished by size with RT-PCR, however, at one month, relatively more CTGF/CCN2 transcript was seen in right quadriceps of mice injected with rAAV-CMV-CTGF (lanes 5 and 7) than in left quadriceps of those same mice (lanes 6 and 8) or in mice injected with TMN buffer (lanes 1-4). C, Two months post injection, morphological changes were observed by H & E staining in the left quadriceps (panel 1) and right quadriceps (panel 2) and CTGF/CCN2 protein production was confirmed with immunohistochemistry in the right quadriceps (panel 4) but not in the left quadriceps (panel 3). Histological examination of the right quadriceps showed groups of abnormal fibers many of which were atrophic. Both atrophic fibers and adjacent non-atrophic fibers showed over-expression of CTGF/CCN2 protein. 78
A CTGF/CCN2
rCTGF/CCN2
GAPDH 1 2 3 4 5 6
B CTGF/CCN2
GAPDH
1 2 3 4 5 C kDa 41 37 26 21 15
8
1 2 3 4 5
D 41 37
26 21
15 1 2 3 4 5
Figure 2.10: rAAV-EF1α-CTGF injection into mouse livers rAAV-EF1α-CTGF was injected into the livers of mice. At 1 and 2 months post injection, tissue was collected and subjected to PCR (A), RT-PCR (B), western blot (C) and immunohistochemistry (data not shown) analysis. A, At 1 month, recombinant CTGF/CCN2 DNA was found in livers of mice injected with the rAAV-EF1α-CTGF virus (lanes 3-6) and not in the livers of mice injected with empty virus (lanes 1-2). B, Recombinant CTGF and native CTGF mRNA cannot be distinguished by size with RT-PCR, however, relatively more CTGF transcript was seen in the rAAV-EF1α-CTGF injected livers of mice (lanes 3-5) than in livers that were injected with empty virus (lanes 1-2) at the 2 month time point. C, Two months post injection, total liver protein was analyzed by Western blot with anti-CTGF antibodies and no CTGF/CCN2 was detected. D, Similarly, no CTGF/CCN2 protein was found in the plasma at the 2 month time point. Additionally, no CTGF/CCN2 was found with immunohistochemistry (data not shown). 79
CHAPTER 3
CTGF/CCN2 ACTION IN VITRO
3.1 INRODUCTION
3.1.1 CTGF/CCN2 action in various cell types
A myriad of different cell types including fibroblasts, epithelial cells, endothelial cells,
vascular smooth muscle cells, glioblastoma cells and chondrocytes express CTGF/CCN2
[83]. Its synthesis can be stimulated by TGF-β1 [76, 203], TGF-β2 [196], BMP-2 [76],
platelet derived growth factor (PDGF) [55, 58, 77], epidermal growth factor (EGF) [58,
78], fibroblast growth factor (FGF) [58], plasma clotting factor VIIa [79, 80], thrombin
[80, 81], vascular endothelial growth factor (VEGF) [77], lipid peroxidation products
[77], acetaldehyde [77] and CTGF itself [82, 83]. Alternately, CTGF/CCN2 expression is suppressed by tumor necrosis factor α (TNF-α) [204], nitric oxide [205] and Wilms
tumor suppressor (WT1) (see Chapter 4) [206]. The assortment of stimulatory and
inhibitory agents that can regulate CTGF/CCN2 expression in a broad range of cell types
highlights the complexity of CTGF/CCN2 regulation and potential functions.
80 A broad repertoire of target cells has been identified for CTGF/CCN2 as well. In
fibroblasts, CTGF/CCN2 stimulates mitosis [42, 47], proliferation [42, 47], chemotaxis
[42, 47], adhesion [7, 16] and production of ECM components such as collagen type I,
III, V, fibronectin, and fibromodulin. [47, 72-74, 82]. Basic FGF and tissue inhibitors of
metalloproteinase-1, -2, -3 and 4 were also up-regulated in fibroblasts treated with
CTGF/CCN2 [82]. In response to CTGF/CCN2 stimulation, chondrocytes demonstrate
increased levels of aggrecan [176], collagen II and X [176], collagen I [98], osteopontin
[98] and alkaline phosphatase [98, 176]. Additionally, CTGF/CCN2 promotes
proliferation, migration, chemokinesis, chemotaxis and adhesion of endothelial cells
[106, 109]. On the other hand, addition of recombinant CTGF/CCN2 to smooth muscle
cells leads to reduced proliferation and induction of apoptosis [104]. In epithelial cells,
CTGF/CCN2 has been shown to promote cell adhesion [16] and to induce apoptosis
[105].
3.1.2 Mechanisms of action
Since CTGF/CCN2 was discovered in 1991, researchers have been searching for its
signal transducing receptor. Cross-linking and Scatchard analysis studies have shown
that CTGF/CCN2 binds to chondrocytes and osteoblasts in a time- and concentration-
dependent manner [98, 207]. Additionally, it appeared that both high and low affinity
binding sites were present on these cells and that a 280 kDa ligand-receptor complex existed [98, 207]. However, little more has been reported on this complex and no direct evidence proving that this complex was, in fact, a signal transducing receptor has been
81 demonstrated. In 2001, a large (~620 kDa) cell surface protein was discovered that
bound CTGF/CCN2 [208]. This protein was purified and identified as LRP [208]. This
receptor is believed to function in a range of different physiological processes, including
lipoprotein metabolism, protease regulation, tissue repair and remodeling and embryonic
development [209]. This report further demonstrated that CTGF/CCN2 was rapidly
internalized and degraded by cells in an LRP-dependent pathway [208]. Whether LRP
serves as a signaling receptor or co-receptor for CTGF/CCN2 remains to be seen,
although recent data has shown that a LRP binding site in module 3 of CTGF/CCN2
molecule promotes HSC adhesion [39].
Integrins are non-covalently associated αβ heterodimeric cell surface receptors that
recognize the ECM or other receptors on adjacent cells in a divalent cation-dependent
manner [210]. They play key roles in cell adhesion, migration, signaling, proliferation,
and cell survival by supplying transmembrane links between the extracellular matrix and
the cytoskeleton [7, 211]. Although neither CTGF/CCN2, CYR61/CCN1 nor
NOV/CCN3 contain a classic RGD integrin binding sequence, they can bind to integrins
in a unique way and this binding is an area of intense investigation [7, 22]. CTGF/CCN2
binds to integrins αvβ3 [12], αIIbβ3 [106], αΜβ2 [11] and up-regulates expression of
integrin αvβ1 [212] integrins. Cell surface HSPGs act as co-receptors that are essential
for both CTGF/CCN2 and CYR61/CCN1-integrin α6β1 mediated fibroblast and smooth
muscle cell adhesion [15, 48, 50]. Also, integrin αvβ3 has been implicated in metastasis and angiogenesis and integrin αIIbβ3 is involved in platelet adhesion [7]. Additionally,
integrin αΜβ2 is associated with monocyte adhesion and is important for atherosclerosis 82 [11]. Finally, CTGF/CCN2 can mediate TGF-β induced fibronectin deposition by up-
regulating integrin αvβ1 [212]. Similarly, CYR61/CCN1 has been shown to support cell
adhesion, induce cell migration, enhance growth-factor induced mitogenesis and promote
cell survival and angiogenesis [7, 9, 10]. These activities can, in part, be attributed to the
ability of CYR61/CCN2 to bind many different integrin receptors including integrins
α6β1, αvβ3, αvβ5, αIIbβ3, and αMβ2 [11-15]. For example, CYR61/CCN1 has been
directly linked to breast cancer through integrin αvβ3 as both anti-CYR61/CCN1 or anti-
αvβ3 antibodies can block migration of breast cancer cells in vitro [213]. Finally, recent
data demonstrated that NOV/CCN3 supported endothelial cell adhesion through integrins
αvβ3, α5β1, α6β1 and HSPGs and induced directed cell migration using integrins αvβ3 and
α5β1 [22]. Further, NOV/CCN3 induced neovascularization in a rat corneal assay [22].
In conclusion, because many of the properties associated with CTGF/CCN2 can be
attributed to its interaction with integrins, it is conceivable that there is no unique receptor for CTGF/CCN2 and that integrins are important binding partners that allow
CTGF/CCN2 to exhibit at least some of its complex biological actions. This chapter will include in vitro studies with fibroblasts and HSCs that address gene regulation after exogenous stimulation with CTGF/CCN2 and other stimulants, as well as after cell
adhesion to CTGF/CCN2. Since relatively few genes have been identified as
CTGF/CCN2-regulated molecules, it was the aim of these studies to identify a wider range of these molecules.
83 3.2 MATERIALS AND METHODS
3.2.1 Materials
Sprague-Dawley rats were obtained from Harlan Sera-lab (Indianapolis, IN) and were used in accordance with the Institutional Animal Care and Use Committee guidelines of
Children’s Research Institute, Columbus, OH. Chinese hamster ovary (CHO) cells,
Balb/c 3T3 cells, bovine aortic endothelial (BAE) cells, and intestinal epithelial cells
(IEC-6) were obtained from ATCC (Manassas, VA), while HSC-T6 cells (SV40 immortalized rat hepatic stellate cell line which demonstrates a myofibroblastic or activated phenotype [192] were generously donated by Scott Friedman, MD (Mt Sinai
Hospital, New York, NY).
Tissue culture and non-tissue culture plates were obtained from Falcon (Franklin Lakes,
NJ) and ELISA plates were bought from Corning (Reynoldsburg, OH). PBS,
Waymouth’s media, DMEM, Ham’s F12 media, FBS, penicillin/streptomycin, agarose,
Trizol, Superscript RT II, Platinum Taq, dNTP mix, and primers were obtained from
Invitrogen/GibcoBRL (Carlsbad, CA). Antigen retrieval Citra system, Power Block and
Concentrated StrAviGen MultiLink kit were obtained from BioGenex (San Ramon, CA).
Aquamount was from Biomedia (Foster City, CA). α-dCTP [32P] was obtained from
Amersham (Piscataway, NJ). Histochoice was obtained from Amresco (Solon, OH).
Cytoquant reagent was from Molecular Probes (Eugene, OR). Microarrays spotted with
Operon rat oligos (Valencia, CA) were obtained from the microarray core at the
84 University of Cincinnatti (OH). GEArray blots and probe synthesis kits were purchased
from SuperArray Bioscience Corp. (Frederick, MD). Recombinant CTGF/CCN2
(rCTGF/CCN2) was produced in this lab with a recombinant mammalian expression
system that allowed purification of rCTGF/CCN2 similar to all previously reported
CTGF/CCN2 isoforms [49]. Full-length CTGF/CCN2, containing modules 1-4, has a
molecular weight of 38 kDa. CTGF/CCN2 containing modules 3-4 has a molecular
weight of ~20 kDa. CTGF/CCN2 containing module 4 alone has a molecular weight of
10 kDa. Mouse αSMA antibody, heparin and all other chemicals were purchased from
Sigma (St. Louis, MO).
3.2.2 Primary HSC isolation
Primary HSCs were provided by Runping Gao, Ph.D (CRI, Columbus, OH). Briefly,
HSCs were isolated from normal male Sprague-Dowley rats by sequential perfusion with pronase/collagenase, purified by density gradient separation and resuspended in DMEM supplemented with 10% fetal calf serum, 100U/ml penicillin and 100 µg/ml streptomycin. Cells were allowed to grow in complete medium until they were activated between the first and third serial passage. Cells used for assays were grown in serum free media for 24 hours prior to their use.
85 3.2.3 Treatment of cells with exogenous stimulants in vitro
Balb/c 3T3 cells were maintained in DMEM, 10% CCS, 100U/ml penicillin and 100
µg/ml streptomycin. Quiescent Balb/c 3T3 cells were treated with nothing or 10 ng/ml
TGF-β1 for 2 hours at 37o C. Total RNA was collected and subjected to RT-PCR
analysis for expression of CTGF/CCN2 or GAPDH as described in Sections 3.2.4 and
3.2.5. Additionally, quiescent Balb/c 3T3 cells were treated with nothing, 60 ng/ml TGF-
β1, 200µM acetaldehyde, or 12 mM ethanol for 4 hours at 37oC. Total RNA was
collected and subjected to RT-PCR as described in Sections 3.2.4 and 3.2.5. PCR
products were then subjected to an additional round of 30-cycle PCR and analyzed on an
agarose gel for CTGF/CCN2 and GAPDH bands.
HSC-T6 cells were maintained in Waymouth’s media containing 10% FBS, 100 U/ml
penicillin and 100 µg/ml streptomycin. Cells were grown in serum-free media for 24 hours and then treated with nothing or 100 ng/ml 20 kDa CTGF/CCN2 for 48 hours at
37o C. Cells were then fixed and α-SMA was immunohistochemically detected (see
Section 3.2.7). Additionally, after 24 hours in serum free media, HSC-T6 cells were
treated with nothing, 2ng/ml TGF-β1, 50 ng/ml TNF-α, or 1 µg/ml 38 kDa CTGF/CCN2
for 4 hours at 37o C. Alternatively, HSC-T6 cells were treated exogenously with nothing
or 500 ng/ml 38 kDa CTGF/CCN2 for 24 hours. Total RNA was then collected and
subjected to RT-PCR analysis for CTGF/CCN2 and GAPDH as described in Sections
3.2.4 and 3.2.5.
86 Primary activated HSCs were maintained in DMEM containing 10% FBS, 100 U/ml
penicillin and 100 µg/ml streptomycin. Cells were grown for 24 hours in serum-free media and then treated with nothing or 600 ng/ml 38 kDa CTGF/CCN2 for 24 hours at
37o C. Total RNA was isolated as described in Section 3.2.4 and was labeled and used
for microarray analysis (see Section 3.2.8).
3.2.4 RNA Isolation from cells
RNA isolation was carried out according to the Trizol protocol. Briefly, each well or
plate of cells was lysed with Trizol, incubated at room temperature, mixed with chloroform and centrifuged. The aqueous layer was precipitated with isopropanol for
total RNA. RNA was quantitated by spectrophotometer measurements at 260 and 280
nm and RNA integrity was analyzed by agarose gel electrophoresis.
3.2.5 RT-PCR
One µg of total RNA was reverse transcribed to produce cDNA using Oligo dT primers
and Superscript RT II per the manufacturer’s protocol. The final product was incubated
with RNase H to remove residual RNA from the cDNA. Ten percent of the RT reaction
was then used for polymerase chain reaction (PCR). Platinum Taq was used per the
manufacturer’s instructions except 10% DMSO was added to each reaction to facilitate
strand separation and amplification of CTGF transcripts [194]. All PCR reactions were
28 cycles except for HGF and PAI-1 which were 35. Various primers were used for the 87 PCR reactions in this chapter. Primers were chosen from genes that (i) were found to be
up- or down-regulated in microarray experiments, (ii) have been reported in the literature
to be induced by CTGF/CCN2 and (iii) that are involved in fibrosis. They are
summarized in Table 3.1.
3.2.6 Cell adhesion
PBS containing CTGF/CCN2 samples were incubated overnight at 4o C in 96-well round
bottom ELISA plates. Alternatively, non-tissue culture 100mm plates were washed with
PBS and then coated with 0.01% poly-L-lysine control (a highly positively charged
amino acid chain commonly used as a coating agent to promote cell adhesion) or 3 µg/ml
38 kDa CTGF/CCN2 overnight at 4o C. Wells and plates were blocked with PBS containing 3% BSA and then incubated for 1 hour with 50 µl PBS containing approximately 5 x 104 CHO cells, Balb/c 3T3 cells, HSC-T6 cells, IEC-6 cells or BAECs.
Some incubations were done in the presence of 1-5 µg/ml heparin or 10 mM EDTA.
Alternatively, 6 ml serum-free medium containing 6 x 106 HSC-T6 or primary activated
HSC cells was added to the blocked 100 mm plates for 1-24 hours. At this time, cells
were fixed or RNA was collected (see Section 3.2.4) and subjected to RT-PCR (see
Section 3.2.5) or gene array analysis (see Section 3.2.8). For cells used in the cell
adhesion assay, cells were fixed for 15 minutes with 3.7% formaldehyde and non-
88 adherent cells were removed by washing with PBS. The remaining cells were measured
by fluorescent emission from the wells at 520 nm following addition of 100 µl Cytoquant
reagent in lysis buffer.
3.2.7 Immunocytochemistry
HSC-T6 cells that were treated with CTGF/CCN2 were stained for αSMA, a marker of
stellate cell differentiation and activation [214]. Cells grown on slides were fixed in
Histochoice overnight and then washed in 70% EtOH and PBS. Endogenous peroxidase
activity was blocked by placing slides in 3% H2O2 for 15 minutes, after which they were
rinsed in dH20 followed by PBS. Slides were then incubated in Power Block for 10
minutes to block non-specific binding sites and then rinsed with PBS. Slides were
incubated for 1 hour at room temperature in PBS/2% BSA containing either 1/50 dilution of mouse anti-αSMA IgG or equivalent concentrations of non-immune mouse IgG.
Slides were then rinsed in PBS and incubated with a 1/50 dilution of goat Multilink biotinylated secondary antibody in PBS/2% BSA for 20 minutes. Slides were rinsed again in PBS and then incubated with a 1/50 dilution of concentrated strepatividin conjugated peroxidase for 20 minutes. Slides were washed with PBS and developed with diaminobenzidine for 3 minutes. The chromogenic reaction was halted with dH2O and slides were mounted with Aquamount.
89 3.2.8 Microarray and gene array analysis
Primary activated HSCs treated exogenously with nothing or CTGF/CCN2 were used for
RNA isolation. Amplification, labeling and hybridization were performed by the staff of
the Children’s Research Institute (CRI) Microarray core facility. Glass microarray slides
spotted with 4,000 genes from the Operon rat library were used. Total RNA was
amplified and labeled with cyanine-3 or cyanine-5 dyes, hybridized to the slide and
analyzed using gene array software. Briefly, 2 µg total RNA from HSC cells treated with
nothing or CTGF/CCN2 was converted to cDNA using an oligo dT primer and reverse
transcriptase and a second strand was synthesized using dNTP mix and DNA polymerase.
The double stranded cDNA was then converted to amplified RNA by using NTPs and T7
RNase polymerase. The remaining DNA was digested with DNase I after the RNA
amplification was completed. The RNA was then labeled by coupling it to cy-3 or cy-5
dyes. The glass microarray slide was prehybridized and then the labeled RNA was hybridized to the slide for 14-18 hours in the GeneTac Hybridization Station. The slide was then washed and scanned to reveal the fluorescent dye patterns. The rat library was
matched to the slide and the data was analyzed with Microarray analysis software. Genes
that were up- or down-regulated more than 2 standard deviations (s.d.) from the line of
regression were recorded. The experiment was performed two times and only genes that
were consistently changed between the 2 sets of experiments are reported in Table 3.2.
90 RNA from primary activated HSC cells that adhered to poly-L-lys- or CTGF/CCN2- coated plates was used for gene array analysis. GEArray blots containing 96 genes known to be involved in angiogenesis or adhesion and ECM were used. 2 separate experiments were analyzed, each with a set of angiogenesis blots and ECM blots. The Superarray protocol was followed for this analysis. Briefly, 4 µg total RNA from both experimental conditions was labeled in a reverse transcription reaction with Oligo dT primer, α-[32P]- dCTP, and reverse transcriptase. Labeled RNA probes were then denatured and added to the prehybridized blots for hybridization overnight at 58o C. Blots were then washed and exposed to film. Spots were quantified and analyzed with ScanAlyze and GEArray analyzer software. Consistent differences in genes are reported in Table 3.3.
3.3 RESULTS
3.3.1 CTGF/CCN2 gene transcription is increased in response to TGF-β1, acetaldehyde and EtOH in Balb/c 3T3 fibroblasts
Evidence has shown a link between alcohol and CTGF/CCN2 in the process of hepatic fibrogenesis, therefore I treated fibroblast cells with alcohol to determine if the
CTGF/CCN2 mRNA expression was effected. Quiescent 3T3 cells produced negligible amounts of CTGF/CCN2 mRNA (Figure 3.1). However, when treated with TGF-β1,
91 acetaldehyde or EtOH, CTGF/CCN2 mRNA transcript was up-regulated (Figure 3.1).
The magnitude of the increase was TGF-β1 > EtOH > acetaldehyde. The effects of EtOH
or acetaldehyde were most evident with 60 rounds of PCR amplification, while TGF-β1-
induced increases were visible with 30 rounds of amplification.
3.3.2 CTGF/CCN2 and TGF-β1 induce changes in an hepatic stellate cell line
When HSC-T6 cells that had been grown in serum free media were treated with
exogenous recombinant 20 kDa CTGF/CCN2, increased amounts of αSMA were noted
when compared to cells treated with nothing (Figure 3.2.A). Additionally, when these cells were treated with TGF-β1 or 38 kDa CTGF/CCN2, increases in the amount of
CTGF/CCN2 mRNA transcript were seen (Figure 3.2.B). In contrast, HSC-T6 cells treated with TNF-α demonstrated no increase in gene expression compared to cells treated with nothing (Figure 3.2.B).
3.3.3 Exogenous treatment of primary activated hepatic stellate cells with CTGF/CCN2
Having demonstrated that HSCs were responsive to CTGF/CCN2, it was of interest to determine which genes were transcriptionally activated by CTGF/CCN2 using microarray analysis. RNA from primary activated HSCs treated with nothing or 38 kDa 92 CTGF/CCN2 was used for this analysis. Genes upregulated more than 2 standard deviations from the line of regression included: cystatin beta, glutathione - S - transferase, pi 2 (GST), lactate dehydrogenase A (LDHA), lysozyme, monocyte chemotactic protein 3 (MCP3), myosin regulatory light chain (MRLC) and ribosomal protein L39 (Table 3.2). These genes, as well as others listed in Section 3.2.5 were tested by RT-PCR analysis. However, the changes seen in the microarray were not consistent with multiple RT-PCR experiments. RT-PCR results for some of these genes are shown in Figure 3.5.A.
3.3.4 CTGF/CCN2 promotes cell adhesion to multiple cell types
Ten kDa and 20-38 kDa isoforms of CTGF/CCN2 promoted cell adhesion of CHO cells,
3T3 cells, HSC-T6 cells, BAECs and IEC-6 cells (Figures 3.3 and 3.4). The binding of each cell type to CTGF/CCN2 was inhibited by heparin, suggesting that cell surface
HSPGs act as adhesion receptors for CTGF/CCN2. Since CTGF/CCN2 can bind to cell surface integrins and this process is dependent on divalent cations [7], EDTA was used as a chelating agent in the adhesion assay. Binding of all cell types to CTGF/CCN2 was substantially reduced in the presence of EDTA, although addition of 3T3 cells to the 10 kDa or 20 kDa forms of CTGF/CCN2 was relatively insensitive to EDTA treatment
(Figures 3.3. and 3.4).
93 3.3.5 Hepatocyte growth factor (HGF) mRNA is down-regulated following adhesion of
HSCs to CTGF/CCN2
RT-PCR analysis was also performed for the genes listed in Table 3.1 using RNA
isolated from HSC-T6 cells or primary activated HSC cells that had adhered to poly-L-
lys or 38 kDa CTGF/CCN2. Of all the genes tested, transcript levels of only HGF were
significantly changed following adhesion of the cells to CTGF/CCN2. A subset of the
genes tested are shown in Figure 3.5.B. HGF gene expression was reproducibly
approximately 80% reduced in HSCs that were allowed to adhere to CTGF/CCN2 as
compared to those that adhered to poly-L-lys (Figure 3.5.C). Similarly, HGF gene
expression was reproducibly reduced by approximately 35% when primary activated
HSCs were adhered to CTGF/CCN2 compared to poly-L-lys, (Figure 3.5.D).
HGF expression was the lowest at 8 hours after adhesion of the cells to CTGF/CCN2
(Figure 3.6). Cells that adhered to CTGF/CCN2 for 4-20 hours all appeared to transcribe
less HGF than cells that adhered to poly-L-lys but HGF mRNA transcripts increased
following the 8 hour time point (Figure 3.6). This experiment confirmed that 8 hours was
an optimal time to collect RNA from adherent cells for gene array analysis.
94 3.3.6 HSC adhesion to CTGF/CCN2 causes the up-regulation of genes involved in angiogenesis and adhesion
RNA from primary activated HSCs that had adhered to CTGF/CCN2 was tested on angiogenesis and ECM/cell adhesion GEArrays (Figure 3.7). Genes that were up- regulated included: collagen pro-α-1-type 1, fibronectin, GRO oncogene, secreted acidic cysteine rich glycoprotein (SPARC), Tissue inhibitor of metalloproteinase 1 (TIMP-1)
and tenasin C (Table 3.3). Caspase 8 was down-regulated upon HSC adhesion to
CTGF/CCN2. These genes have not yet been confirmed with RT-PCR analysis.
3.4 DISCUSSION
3.4.1 TGF-β1, alcohol and CTGF/CCN2 up-regulate CTGF/CCN2 mRNA transcription
The up-regulation of CTGF/CCN2 mRNA expression by TGF-β1 in both Balb/c 3T3
fibroblasts as well as HSC-T6 cells is consistent with other reports showing CTGF/CCN2 as a TGF-β-inducible immediate early gene regulated at the transcriptional level [2, 58].
This stimulation by TGF-β was originally attributed to a TGF-β response element in the
CTGF/CCN2 promoter [59]. However, more recent studies have demonstrated that while this element may be important for basal CTGF/CCN2 expression, TGF-β induced
CTGF/CCN2 expression requires Smad-binding sequences and a novel promoter sequence which is preferentially activated in fibroblasts as compared with epithelial cells
[60-62]. 95
In the present study, CTGF/CCN2 was able to auto-induce itself in HSC-T6 cells. This
finding was comparable to recent studies in which CTGF/CCN2 up-regulated its own
expression in a time- and dose-dependent manner in human dermal fibroblasts [215] and porcine skin fibroblasts [82]. Additionally, CTGF/CCN2 has been implicated as an autocrine growth factor based on the ability of antisense CTGF/CCN2 oligos to block the growth of BAECs [85]. This auto-induction may, in part, contribute to overexpression
that causes wound healing or fibrosis.
Both ethanol and acetaldehyde, the major active metabolite of alcohol, were able to
increase the expression of CTGF/CCN2 mRNA transcript in Balb/c 3T3 cells, though
EtOH had a greater effect. Similarly, acetaldehyde has previously been shown to
increase CTGF/CCN2 in HSCs [77]. Acetaldehyde has also been shown to induce the
expression of collagen genes as has CTGF/CCN2 [82, 93, 176, 216]. Evidence has
indicated a link between alcohol and CTGF/CCN2 in the process of hepatic fibrogenesis
during hepatic injury. Northern blot analysis demonstrated that, as compared with
normal livers, CTGF/CCN2 expression was higher in cirrhotic livers from patients with
alcoholic liver disease [152]. Additionally, in situ hybridization revealed CTGF/CCN2
transcript in fibroblast and myofibroblast-like cells within the fibrotic portal tracts and
fibrous septa [150, 152]. Finally, CTGF/CCN2 is produced in cultured hepatocyte cells
downstream of cytochrome P-4502E1-mediated ethanol oxidation [162, 163].
96 A central event in liver fibrosis is the activation of HSCs which represents a transition from quiescent vitamin A-rich cells to vitamin A deficient, proliferative, fibrogenic and contractile myofibroblasts [214, 217-221]. These myofibroblast-like cells produce
αSMA and CTGF/CCN2 as a function of their activation [156, 214, 217]. Although
HSC-T6 cells have an activated phenotype, CTGF/CCN2 was able to increase the amount of αSMA in the cells compared to non- treated cells suggesting that CTGF/CCN2 may participate in pathways that lead to acquisition of a myofibroblastic phenotype during
HSC activation.
3.4.2 Cell adhesion to CTGF/CCN2
Both 10kDa and 20-38 kDa recombinant CTGF/CCN2 forms were able to promote cell adhesion that was both heparin- and EDTA-dependent. 10 kDa CTGF/CCN2 consists mainly of module 4 alone while 20-38 kDa CTGF/CCN2 comprises a mixture of isoforms containing modules 3-4 and 1-4. These data suggest that module 4 alone contains heparin and integrin binding sites. This does not negate the possibility that the other modules may contain additional cell binding motifs, though it does emphasize that module 4 is an important functional domain in the CTGF/CCN2 protein. The fact that adherence of 3T3 cells to CTGF/CCN2 was relatively insensitive to EDTA treatment suggests that these cells may have additional non-integrin cell binding sites that, if involved, are not EDTA dependent.
97 3.4.3 Cell adhesion to CTGF/CCN2 up-regulates mRNA expression
Following the adherence of primary activated HSCs to CTGF/CCN2, expression of several genes was stimulated as assessed by gene array analysis. For example, caspase 8 mRNA expression was down-regulated upon HSC adhesion to CTGF/CCN2. Caspase 8 is a cysteine protease implicated in apoptosis and is required for killing induced by the death receptors [222]. CTGF/CCN2 can induce apoptosis in smooth muscle cells and breast cancer cells [104, 105, 223] while it increases cell survival in endothelial cells
[106]. Perhaps by decreasing apoptosis in HSCs through adhesion to CTGF/CCN2, this fibrogenic cell type deposits more ECM than if it were removed from the liver by apoptosis.
Collagen α-1-type I was increased upon HSC adhesion to CTGF/CCN2. Fibrillar collagens type I, III and IV are up-regulated in hepatic fibrosis [217]. Collagen α-1-type
I is up-regulated in HSCs in early CCl4-induced fibrogenesis [224] and increased in periductular myofibroblasts in biliary atresia [225]. The rate of transcription of collagen
α-1-type I was induced 3-fold in activated HSCs and the half life was increased by 16- fold [226]. Finally, CTGF/CCN2 stimulation can also increase collagen expression in fibroblasts [47, 72-74, 82] and chondrocytes [98].
Fibronectin was also increased with adhesion to CTGF/CCN2 according to gene array analysis. Fibronectins are multifunctional ECM and plasma proteins that have been implicated in a wide variety of cellular functions including cell adhesion, morphology, 98 cytoskeletal organization, migration, differentiation, oncogenic transformation,
phagocytosis, and homeostasis [227]. Activation of HSCs has been shown to increase
mRNA levels of fibronectin and its receptor, integrin αvβ1 [228]. It is possible that adhesion to CTGF/CCN2 may further the activation process in HSCs and cause an increase in fibronectin.
A third molecule detected by gene array analysis that was upregulated following adhesion of HSCs to CTGF/CCN2 was GRO oncogene. GRO oncogene is a chemokine that is
induced by TNF-α in epithelial cells [229]. GRO oncogene also increased cellular
invasion of a uveal melanoma cell line [230] and plasma concentrations of GRO-a were
increased in patients with cryptogenic fibrosing alveolitis [231]. The peripheral blood
neutrophils in this disease undergo a greater motility response to GRO-a than in normal
lung [231]. There is no record of GRO oncogene expression in HSCs and the data are
somewhat contradictory with the observation that TNFα inhibits CTGF/CCN2 expression
in several cell types including fibroblasts [204], endothelial cells and VSMCs [232]. On
the other hand, a preliminary report claimed that TNFα was able to induce the expression
of CTGF/CCN2 in cultured HSCs [233]. Clearly, additional experiments are required to
clarify the relationship between TNFα, CTGF and GRO in HSCs.
SPARC (secreted protein, acidic and rich in cysteine) was additionally found to be
upregulated in HSCs that had adhered to CTGF/CCN2. SPARC is a glycoprotein which functions in tissue remodeling, adhesion, migration and proliferation [234, 235]. It has
been found to be highly expressed in HSCs in human liver fibrosis [234, 236]. Another 99 study showed that SPARC is expressed by activated HSCs in chronic hepatitis but less so
in liver cirrhosis suggesting SPARC is expressed by activated HSCs during active fibrogenesis before the completion of fibrotic reconstruction in cirrhotic livers [235].
This increased level of expression in activated HSCs suggests involvement of SPARC in hepatic fibrogenesis after chronic injuries. CTGF/CCN2 is also expressed by activated
HSCs and is expressed at higher levels in hepatic fibrosis (see [156]).
Gene array analysis also indicated that HSC adhesion to CTGF/CCN2 increased the amount of tenascin-C mRNA expression. Tenascin-C is an ECM protein thought to play an important role in tumor angiogenesis [237]. It promotes endothelial cell adhesion and migration [238] and also is detected in association with tumor neovessels [239].
CTGF/CCN2 can also stimulate the formation of new capillaries and has been implicated in playing a role in tumor angiogenesis by possibly up-regulating endothelial MMPs and down-regulating endothelial TIMPs, thereby supporting local ECM degradation and aiding endothelial cell migration (see [108]).
Finally, TIMP-1 was demonstrated to be upregulated after adhesion of HSCs to
CTGF/CCN2. TIMPs are the most important inhibitory family of molecules involved in regulating extracellular MMP activity [240]. TIMP-1 expression is not detected in quiescent HSCs, but once activated, TIMP-1 expression begins to rise [240]. This rise in
TIMPs inhibits collagen degradation by MMPs and if injury persists, progression of
fibrosis occurs [240]. TIMP-1 was also shown to strongly promote (but not cause) liver fibrosis in transgenic mice over-expressing TIMP-1 in the liver [241]. Additionally,
100 TIMP-1 was demonstrated to suppress apoptosis of HSCs [242]. By decreasing MMP
activity and suppressing apoptosis of HSCs, TIMP-1 is hypothesized to attenuate liver
fibrosis resolution [242]. CTGF/CCN2 was shown to weakly up-regulate TIMP-1
expression in lungs in an Ad delivery model [178], while it decreased TIMPs in vascular
endothelial cells [243]. CTGF/CCN2 may work with TIMPs in fibroblastic cells to
promote the accumulation of collagen in livers thereby promoting fibrosis.
Although HGF expression did not change according to the gene array, RT-PCR analysis
of RNA from primary activated HSCs that had adhered to CTGF/CCN2 showed that
HGF was, in fact, down-regulated. This was also shown in the HSC-T6 cell line. Since the data (Figure 3.5) represents the average of at least 4 separate experiments, it seems
likely that on the mRNA level, the HGF gene is, indeed, down-regulated after HSCs
adhere to CTGF/CCN2. The time course experiments showed that HGF down-
regulation was most prominent at 8 hours post adhesion. HGF was chosen to study
because it was known to be down-regulated by TGF-β1 [244], expressed in HSCs [244]
and able to suppress the onset of fibrosis/cirrhosis and accelerate recovery from liver
fibrosis/cirrhosis in rats [245, 246]. HGF is a potent mitogen for hepatocytes and plays
an essential part in the development and regeneration of the liver [247]. HGF is also able
to suppress expression of TGF-β1, an essential factor in liver fibrogenesis, (Ueki T,
1999) and to increase collagenase mRNA and protein levels [248]. HGF was also found
to increase CTGF/CCN2 expression in cultured proximal tubular cells [134] but, on the
other hand, attenuated CTGF/CCN2 expression in the kidneys of partially
nephrectomized mice [249]. A complex interaction of molecules is responsible for the 101 fibrogenic process and it is possible that HGF and CTGF/CCN2 could both be expressed in the liver at the same time, as the initial stages of fibrosis are reversible. The onset and extent of the disease process may, in part, reflect the balance in expression of CTGF and
HGF.
3.4.4 Summary
CTGF/CCN2 is a multifaceted protein that is not only expressed by many cell types, but also can act on a variety of cells. In terms of liver fibrosis, since many hepatic cell types have the potential for CTGF/CCN2 synthesis, complex paracrine networks of
CTGF/CCN2 action within the liver are likely. CTGF/CCN2 may bind these cells through cell surface heparin-like molecules, the LRP receptor, integrins or a combination of all three. This chapter lists a handful of genes that are potentially transcriptionally activated following HSC adhesion to CTGF/CCN2. These need to be investigated further to determine if the levels of their protein products are also affected in the same way.
Nevertheless, the genes found to be upregulated by gene array and RT-PCR analysis could each have a potential role in CTGF/CCN2 action on cells, especially in the process of fibrosis.
102 Gene forward primer reverse primer expected size
BMP-1 5’-caagacagcactggcaacttc-3’ 5’-actgtcgtgacgctcgatctc-3’ 483 bp
Collagen α1 type1 5’-cagaggtttcagtggttt-3’ 5’-attggcacctttagcacc-3’ 399 bp
CTGF 5’-gcagggatccatgctcgcctccgtcgca-3’ 5’-ccagcggccgcgaatcttacgccatgtctcc-3’ 1074 bp
Cystatin β 5’-gtgaagtctcaacttgaagag-3’ 5’-gaagtaggttagctcatcgtg-3’ 227 bp
GAPDH 5’-tggcaaagtggagattgttgcc-3’ 5’- ttgtcatggatgaccttggcc-3’ 425 bp
GST pi2 5’-aagtccacttgtctgtatggg-3’ 5’-gtttaccattgccgttgatggg-3’ 495 bp
HGF 5’-gcagatgagtgtgccaacagg-3’ 5’-gaacactgaggaatgtcacag-3’ 422 bp
LDHA 5’-atgaaggacttggctgatgag -3’ 5’-gaagatgttcacgtttcgctgg-3’ 230 bp
Lys 5’-ccagatctatgaacgatgtc-3’ 5’-agtgtctttgccatgccaccc-3’ 347 bp
MCP-1 5’-gttcacagttgccggctggag-3’ 5’-gcagtgcttgaggtggttgtgg-3’ 383 bp
MCP-2 5’-cctgctgctcatagctgtccc-3’ 5’-ccatgtactcactgacccacttc-3’ 229 bp
MCP-3 5’-tctgccacgcttctgtgcctgc-3’ 5’-cacttctgatgggcttcagcgc-3’ 229 bp
MRLC 5’-aacgtgttcgccatgtttgacc-3’ 5’-atctttgtctttcgctccgtgc-3’ 452 bp
PAI-1 5’-ggtgctggctatgctgcagatg-3’ 5’-gagggcattcaccagcaccagg-3’ 384 bp
TGF-β1 5’-ccggatcctgtccaaactaaggctcgc-3’ 5’-cctctagaccagtgacgtcaaaagacagcc-3’ 460 bp
TNF-α 5’-gcatgatccgagatgtggaactg-3’ 5’-ggctgactttctcctggtatgaag-3’ 497 bp
VEGF 5’-accctggctttactgctgtac-3’ 5’-ctttcgcgttctttaggcca-3’ 444 bp
Table 3.1: Primer sequences used in Chapter 3
103 A
B cystatin beta
glutathione - S - transferase, pi 2
lactate dehydrogenase A
lysozyme
monocyte chemotactic protein 3
myosin regulatory light chain
ribosomal protein L39
Table 3.2: Genes up-regulated with 24 hours of exogenous CTGF/CCN2 stimulation of primary activated HSCs.
A, Values for genes spotted on the microarray after hybridization with the labeled RNA were plotted for a single experiment. Data points above the line of regression represent genes that were potentially upregulated following HSC adhesion to CTGF/CCN2 while data points below the line of regression represent genes that were potentially down-regulated following HSC adhesion to CTGF/CCN2. B, This table represents genes that were consistently upregulated more than 2 s.d from the line of regression in 2 separate experiments on 2 different micro arrays. Glass slides spotted with 4,000 genes from the Operon rat library were used. Total RNA was amplified and labeled with cy-3 and cy-5, hybridized to the slide and analyzed using gene array software.
104
caspase 81 (-300%)
collagen pro-α-1-type 12 (+ 1200%)
fibronectin3 (+ 112%)
GRO oncogene4 (+ 308%)
secreted acidic cysteine rich glycoprotein5 (+ 718%)
tenasin C6 (+ 145%)
Tissue inhibitor of metalloproteinase 17 (+ 61%)
Table 3.3: Genes up-regulated with primary activated HSC adhesion to CTGF/CCN2 for 8 hours.
Gene array blots (Figure 3.7) were analyzed by the ScanAlyze program and genes with % changes of > than 50% different than the poly-L-lys control are listed. The numbers in the brackets following the gene names represent percent change from poly-L-lys controls. This table represents 2 separate experiments tested on 2 different gene arrays each (Angiogenesis and ECM/adhesion molecules blots). Superscript numbers refer to genes obtained from the gene array blots shown in Figure 3.7.
105
A CTGF/CCN2
GAPDH
1 2
B CTGF/CCN2
GAPDH 1 2 3 4
Figure 3.1: CTGF/CCN2 mRNA expression is up-regulated in response to TGF-β1, acetaldehyde, and EtOH.
A, Balb/c 3T3 cells were stimulated with nothing (lane 1) or 10 ng/ml TGF-β1 (lane 2) for 2 hours. Total RNA was collected and subjected to RT-PCR analysis for CTGF/CCN2 and GAPDH. B, Balb/c 3T3 cells were treated with nothing (lane 1), 60 ng/ml TGF-β1 (lane 2), 200µM acetaldehyde (lane 3), or 12 mM ethanol (lane 4) for 4 hours. Total RNA was collected subjected to RT-PCR. PCR products were then subjected to an additional round of 30 cycle PCR and analyzed on an agarose gel for CTGF/CCN2 and GAPDH bands.
106
A
1 2
B CTGF/CCN2
GAPDH 1 2 3 4
Figure 3.2: HSC-T6 cells respond to CTGF/CCN2 and TGF-β1
A, HSC-T6 cells were treated with nothing (panel 1) or 100 ng/ml 20 kDa CTGF/CCN2 (panel 2) for 48 hours. Cells were then fixed and αSMA was immunohistochemically detected. The brown stain represents αSMA protein. B, HSC-T6 cells were treated with nothing (lane 1), 2ng/ml TGF-β1 (lane 2), 50 ng/ml TNF-α, (lane 3) or 1 µg/ml 38 kDa CTGF/CCN2 (lane 4) for 4 hours. Total RNA was then collected and subjected to RT-PCR analysis for CTGF/CCN2 and GAPDH.
107
A 8000 7000 6000 5000 4000 3000
2000
relative cell adhesion 1000
0 N/A1 1ug/mlµg/ml heparin heparin 10 mM EDTA 1ug/ml1 µg/ml heparin heparin + + 10 mM EDTA 10 mM EDTA
B 12000 10000
8000
6000 4000
2000 relative cell adhesion 0 A rin T3 -T6 a AE arin 3 arin B DTA ep ep IEC-6 E l h M EDTAHSC M EDTA /m m /ml hep mM EDT /ml h g g 0 g 0 m g/ml heparin u u 1 1 u 10 mM 5 5 + 5 + + + + 6 3 - 3T3 + 10 T6 3T - AE + 5uBAE + EC B IEC-6 I HSC HSC-T6
Figure 3.3: Heparin and EDTA dependence of 10 kDa CTGF/CCN2-mediated adhesion in multiple cell types.
CHO (A) or various indicated cell lines (B) were incubated alone or in the presence of 1 - 5 µg/ml heparin or 10 mM EDTA in U-bottom non-tissue culture wells that had been pre-coated with 55 ng 10 kDa CTGF/CCN2. Values shown are a mean +/- standard deviation of duplicate determinations of the number of adherent cells.
108
A 8000
7000
6000 5000
4000
3000 2000
relative cell adhesion 1000
0 N/A1 1ug/mlµg/ml heparin 10 mM EDTA 1ug/ml1 µg/ml heparin heparin + + 1010 mM mM EDTA EDTA
B
12000 . 10000
8000 6000
4000 2000
relative cell adhesion 0 n A in A n A n A T3 ar ari ri 3 BAE p SC-T6 EDT EDT IEC-6 hepa EDT H l hep l m M M m m m 0 0 0 mM 10 mM EDT 1 5ug/ 1 + + 1 + 3 6 3T 3T3 + 5ug/ml hepari BAE + 5ug/mlBAE he+ SC-T6 + 5ug/ IEC-6 + IEC-6 HSC-T H
Figure 3.4: Heparin and EDTA dependence of 20-38 kDa CTGF/CCN2-mediated adhesion in multiple cell types.
CHO (A) or various indicated cell lines (B) were incubated alone or in the presence of 1 - 5 µg/ml heparin or 10 mM EDTA in U-bottom non-tissue culture wells that had been pre-coated with 55 ng 20-38 kDa CTGF/CCN2. Values shown are a mean +/- standard deviation of duplicate determinations of the number of adherent cells.
109
--++ A HGF B HGF MRLC MRLC LDHA LDHA
GST GST
GAPDH GAPDH
C 1.2
0.8
0.4
relative HGF expression 0 poly-L-lys CTGF
D 1.2
0.8
0.4
relative HGF expression . relative HGF expression
0 poly-L-lys CTGF
Figure 3.5: Hepatocyte growth factor (HGF) is down-regulated in HSCs after adherence to CTGF/CCN2 for 8 hours.
No difference in mRNA expression was noted for a panel of genes tested, including the subset shown (A), in HSC-T6 cells treated exogenously with nothing (-) or 500 ng/ml CTGF/CCN2(+) for 24 hours. Non- tissue culture 100mm plates were coated with .01% poly-L-lys control (-) or 3 µg/ml 38 kDa CTGF/CCN2 (+) (B-D). HGF mRNA was consistently down-regulated when HSC-T6 cells (B, C) or primary HSCs (D) adhered to CTGF/CCN2 for 8 hours compared with poly-L-lys control. RT-PCR bands were quantitated and normalized to GAPDH and poly-L-lys. The data represented in C represents 6 experiments while the data represented in D represents 4 separate experiments. 110
16
poly-L-lys CTGF/CCN2 12
8
4
relative HGF expression 0
1hr 4 hr 8 hr 20 hr 1hr 4 hr 8 hr 20 hr
Figure 3.6: Time course of HGF mRNA expression in HSC-T6 cells adhered to CTGF/CCN2.
Non-tissue culture 100mm plates were coated with .01% poly-L-lys (control) or 3 µg/ml 38 kDa CTGF/CCN2. Total RNA was collected at 1, 4, 8, and 20 hours and subjected to RT-PCR analysis for HGF transcript. Bands were quantitated and normalized to GAPDH and the 1 hr time point for each condition. This graph represents the average of 2 separate experiments.
111
A
3 4 3 4
5 5 7 6 7 6
Poly-L-lysine CTGF
B 1 1 2 2 3 3
5 5 7 7
Poly-L-lysine CTGF
Figure 3.7: Genes up- or down- regulated following adhesion of primary activated HSCs to CTGF/CCN2
Primary activated HSCs were plated on 100mm non-tissue culture plates that had been coated with 0.01% poly-L-lys (control) or 3 µg/ml 38 kDa CTGF/CCN2. 8 hours later, total RNA was collected and labeled with α-[32P]-dCTP and hybridized to a GEArray Q Series Mouse Angiogenesis Gene Array (A) or a GEArray Q Series Mouse Extracellular Matrix & Adhesion Molecules Gene Array (B). Developed blots were analyzed with the ScanAlyze program. This figure represents one of two experiments and is typical of the data obtained. Numbered circles refer to genes up- or down-regulated more than 50% from the control and are listed listed in Table 3.3.
112
CHAPTER 4
CTGF/CCN2 IS EXPRESSED IN TWO PEDIATRIC DISEASES ASSOCIATED WITH FIBROSIS: CONGENITAL HEPATIC FIBROSIS (CHF) AND DESMOPLASTIC SMALL ROUND CELL TUMOR (DSRCT)
4.1 INTRODUCTION
4.1.1 CTGF/CCN2 and fibrosis
Of the many functions that have been ascribed to CTGF/CCN2, its ability to promote fibrosis has attracted considerable attention. This area of focus arose following the demonstration that CTGF/CCN2 was induced by TGF-β (itself highly fibrogenic) and that fibroblasts were targets for CTGF/CCN2 action [2-4, 58]. CTGF/CCN2 regulates proliferation, migration, adhesion and production of ECM molecules in cultured fibroblasts, while subcutaneous injection of CTGF/CCN2 into neonatal mice causes a rapid increase in the amount of granulation tissue comprised of connective tissue cells and abundant ECM [16, 41, 47, 48, 58, 67]. Additionally, CTGF/CCN2 was shown to be present and frequently over-expressed and co-expressed with TGF-β in fibrotic skin disorders such as systemic sclerosis, localized skin sclerosis, keloids, scar tissue, eosin fasciitis, nodular fasciitis, and Dupuytren’s contracture [71, 126-129, 250]. Moreover,
113 CTGF/CCN2 has been implicated in many fibrotic disease processes and its mRNA and/or protein were found to be over-expressed in fibrotic lesions of major organs and tissues including the liver, kidney, lung, cardiovascular system, pancreas, bowel, eye, and gingiva [55, 72, 74, 77, 116, 128, 130, 131, 133-140, 142, 144, 145, 147-155].
CTGF/CCN2 is also over-expressed in the stromal compartment of melanoma as well as mammary, pancreatic and fibrohistiocytic tumors that are characterized as having significant connective tissue involvement [78, 113, 114, 251].
4.1.2 Congenital Hepatic Fibrosis
Hepatic fibrosis is characterized by the accumulation of ECM in response to a variety of chronic stimuli. If these stimuli are not terminated, fibrosis can progress to cirrhosis and may result in death [214]. Congenital hepatic fibrosis (CHF) is a rare non-inflammatory disease of intrahepatic bile ducts often associated with autosomal recessive polycystic kidney disease [252] that rarely progresses to cirrhosis [253]. The condition predominantly occurs in children and adolescents and the prognosis is favorable if the patient survives beyond the neonatal period [254]. Additionally, chances of survival continue to improve with advances in dialysis and transplantation [254]. Grossly, the liver is enlarged, firm and shows a fine reticular pattern of fibrosis [254].
Microscopically, CHF is characterized by bands of fibrous tissue of varying thickness, irregularly shaped islands of hepatic tissue, small bile ducts scattered in the fibrous tissue and biliary duct ectasia [253, 254]. In addition, TGF-β1, which is expressed in the ectatic biliary epithelium and the perisinusoidal space, is present at higher levels in CHF livers
114 than in normal livers [255]. Further, CHF-derived HSCs secreted TGF-β1, in vitro [255].
This data may indicate a role in the pathogenesis of CHF for TGF-β1 [255].
4.1.3 Desmoplastic Small Round Cell Tumor
Desmoplastic small round cell tumor (DSRCT) is a rare aggressive neoplasm that predominantly affects young males. DSRCT occurs on the peritoneal surfaces of the abdomen and is characterized by well-defined islands of small cells surrounded by prominent desmoplastic stroma. DSRCT has a very poor prognosis and despite surgery, radiation and chemotherapy, patients typically die within several months to a few years after diagnosis [256]. DSRCT is associated with a chromosomal translocation t(11;22)(p13;q12) that fuses the amino terminus of the Ewing sarcoma (EWS) gene to the carboxy-terminus of the Wilms tumor (WT1) gene and causes a loss of the typical repressive function of WT1 on gene transcription [257]. The EWS-WT1 fusion encodes a novel transcription factor comprised of a strong EWS transcriptional activation domain merged with a WT1 DNA-binding domain. This fusion creates an oncogenic chimera that may lead to a loss of the tumor suppresser effects of the WT1 gene as well as an increase in the EWS-driven expression of growth factors usually repressed by WT1 [258,
259].
WT1 represses activators that stimulate initiation and/or elongation steps in RNA polymerase II transcription [260]. Additionally, through a cis acting EGR1-binding site in their promoters, the transcription of insulin-like growth factor II (IGF II), platelet 115 derived growth factor A chain (PDGF A) and transforming growth factor-beta latency associated peptide (TGF-β -LAP) are repressed by WT1 [258]. WT1 may also play an important role in regulating TGF-β expression and indirectly controlling extracellular matrix production [258]. These same genes, as well as the PDGF-α and IGF I receptors, are also targets for the EWS-WT1 fusion protein. Instead of being repressed by WT1, these genes are up-regulated in DSRCT tumors [258, 261]. Further, WT1 was recently reported to regulate CTGF/CCN2 expression via novel elements in the promoter region of CTGF/CCN2 [206].
CTGF/CCN2 is a TGF-β-induced matricellular protein produced by diverse cell types that regulates many diverse cellular functions [21]. The intimate relationship between
TGF-β action and CTGF/CCN2 expression has been the basis of many studies that have examined the role played by CTGF/CCN2 in mediating the biological activities of TGF-
β, including its role in fibrosis. While there has been considerable focus on the role of
CTGF/CCN2 in fibrosis of vital organs, its production in the pediatric population has received relatively little attention. Given that CTGF/CCN2 mRNA and protein levels are correlated with the degree of fibrosis in other forms of hepatic fibrosis and that TGF-β is upregulated in CHF, we analyzed CTGF/CCN2 expression in CHF. Further, given its matrigenic properties and transcriptional regulation by WT1, we also analyzed
CTGF/CCN2 expression in DSRCT .
116 4.2 MATERIALS AND METHODS
4.2.1 Materials
Archival formalin-fixed, paraffin-embedded tissue from three cases of CHF and four cases of DSRCT were obtained from the Cooperative Human Tissue Network with approval of the Institutional Review Board of Children’s Research Institute. Restriction enzymes were obtained from New England Bioloabs (Beverly, MA). Spin columns for gel purification were purchased from Qiagen (Valencia, CA). Digoxegenin labeling kits were acquired from Roche (Indianapolis, IN). 5-bromo-4-chloro-3-indolyl-phosphate
(BCIP) and nitro blue tetrazoleum (NBT) were purchased from Promega (Madison, WI).
Hematoxylin, eosin and normal rabbit IgG were obtained through Dako (Glostrup,
Denmark), while Nuclear Fast Red, Green and Sigma Fast 3,3’-diaminobenzidine (DAB) tablet sets were purchased through Sigma-Aldrich (St. Louis, MO). Aquamount was obtained from Biomeda (Foster City, CA). Antigen retrieval Citra system, Power Block and Concentrated StrAviGen MultiLink kit were obtained through BioGenex (San
Ramon, CA) Sheep anti- DIG antibody was obtained though Roche (Indianapolis, IN) while affinity purified rabbit anti-CTGF/CCN2[81-94] IgG was produced as described
[193] and was selected for it absolute conservation between human, mouse and porcine
CTGF/CCN2 and lack of homology with other CCN proteins [193].
117 4.2.2 mRNA probe synthesis
Sense and anti-sense digoxegenin labeled probes were synthesized that corresponded to a
312bp region corresponding to residues 738-1050 of human CTGF/CCN2. Briefly, hCTGF/pCRII (see Table 2.1) was restriction digested with BamHI (for anti-sense probes) or XhoI (for sense probes). Linearized plasmid was run on a 1% agarose gel, the band was then excised and purified using a Qia-quick spin column. T7 (for anti-sense) or
SP6 (for sense) RNA polymerase from the Roche DIG RNA-labeling kit was used in conjunction with a NTP labeling mix containing DIG-11-UTP to produce mRNA probes for in situ hybridization .
4.2.3 In situ hybridization for CTGF/CCN2
In situ hybridization using digoxigenin-labeled probes was performed as described [262].
Briefly, sections were heated at 60oC for 2 hours then dewaxed in xylene for 5 minutes.
Sections were then hydrated through a series of graded ethanol washes (95%, 90%, 70% and 50% ethanol) and then placed in dH2O for a few minutes. Prehybridization was carried out by successive incubation in dH2O, PBS, PBS/100mM glycine, PBS/0.3%
Triton X-100, PBS, and Tris/EDTA (TE) buffer containing 2 µg/ml proteinase K. All solutions were treated with diethlpyrocarbonate. Sections were post-fixed in
PBS/4%paraformaldehyde at 4oC, washed with PBS, incubated with 0.1M triethanolamine buffer (pH 8) containing 0.25% (vol/vol) acetic acid, followed by prehybridization buffer (4x saline sodium citrate (SSC) containing 50% (vol/vol)
118 deionized formamide at 37oC. Slides were then incubated overnight at 42oC in a humid chamber with 700 ng/ml sense or antisense probe in hybridization buffer (4x SSC containing 10% dextran sulfate, 40% deionized formamide, 1x Denhardt’s, 10mM DTT,
1 mg/ml yeast tRNA and 1 mg/ml denatured and sheared salmon sperm DNA.
Posthybridization steps were 2x SSC for 10 minutes at room temperature, two 15 minute washes with 2x SSC at 37oC, two 15 minute washes with 1x SSC at 37oC, two 30 minute washes with 0.1x SSC at 37oC, two 10 minute washes with buffer 1 (100 mM Tris
HCl/150mM NaCl, pH 7.5), and a 30 minute incubation with blocking solution (buffer 1 containing 0.1% Triton X-100/2% sheep serum) at room temperature. Sections were then incubated for 2 hours at room temperature with PBS/0.1% Triton X-100/1% sheep serum containing a 1/500 dilution of Anti- DIG-alkaline phosphatase antibody. Sections were then washed with buffer 1 and buffer 2 (100mM Tris HCl/100mM NaCl/50mM MgCl2, pH 9.5) and developed with NBT/BCIP chromogenic substrate. The reaction was stopped using 10mM Tris HCl (pH 8.1) containing 1mM EDTA. Slides were washed in water then counter-stained with Nuclear Fast Red (CHF) or Nuclear Fast Green (DSRCT) and mounted with Aquamount.
4.2.4 Immunohistochemistry for CTGF/CCN2
Immunohistochemistry was performed as described in Section 2.2.10 using an affinity- purified rabbit anti-CTGF/CCN2[81-94]. Antigen retrieval was performed with Antigen
119 Retrieval Citra Solution per the manufacturer’s protocol. Slides were counterstained with hematoxylin and mounted with aquamount. Parallel sections were stained with hematoxylin and eosin.
4.2.5 RT-PCR for DSRCT translocation
RT-PCR was performed by staff of the Molecular Genetics Laboratory at Children’s
Hospital (Columbus, OH) on frozen tissue as described in [263]. Briefly, total RNA was isolated from the tumor and RT-PCR assays for the typical translocation found in
DPSRCT was performed. A fusion transcript product observed using primers specific for the t(11;22) translocation associated with DSRCT was considered a positive specimen.
The sequence of the fusion protein was also verified for EWS-WT1 fusion product.
4.3 RESULTS
4.3.1 CHF in situ hybridization and immunohistochemistry results
In 3 of 3 specimens, CTGF/CCN2 mRNA (purple staining) was detected using the anti- sense probe, whereas no hybridization signal was observed with the CTGF/CCN2 sense probe (Fig. 4.1). Parallel sections were stained with H & E and the characteristic fibrotic appearance of a CHF liver was observed (Figure 4.1). CTGF mRNA was localized primarily to bile duct epithelial cells.
120 The pattern of CTGF/CCN2 mRNA distribution was similar to that of the CTGF/CCN2 protein that was readily detected by anti-CTGF IgG (brown staining) but not by non- immune IgG (Figure 4.1). CTGF protein was primarily localized to bile duct epithelial cells but also was observed, with weaker staining, in hepatocytes in the islands of hepatic tissue.
4.3.2 DSRCT in situ hybridization and immunohistochemistry results
In 2 of 3 specimens, CTGF/CCN2 mRNA (purple staining) was detected using the anti- sense probe (Figure 4.2 B) whereas no hybridization signal was obtained with the
CTGF/CCN2 sense probe (Figure 4.2 A). H & E staining of parallel sections confirmed the presence of characteristic islands of rounded undifferentiated tumor cells within a collagen-rich stromal matrix (Figure 4.2 E).
The pattern of CTGF/CCN2 mRNA distribution was very comparable to that of the
CTGF/CCN2 protein that was readily detected by anti-CTGF IgG (Figure 4.2 D) but not by non-immune IgG (Figure 4.2 C). CTGF/CCN2 was localized to the tumor cells themselves (Figure 4.2 B,D, Figure 4.3 A), fibroblasts within the stromal compartment
(Figure 4.2 B,D, Figure 4.3, B) and endothelial cells of capillaries and arterioles (Figure
4.3 C, D).
121 In addition, 2 out of 3 tumors were positive for the EWS-WT1 fusion. The tumors positive for the DSRCT translocation were also positive for CTGF/CCN2 mRNA and protein expression. The clinical features, RT-PCR and IHC results are reported in Table
4.1.
4.4 DISCUSSION
4.4.1 CTGF in CHF
The pattern of CTGF mRNA and protein expression in the liver of CHF patients resembles the bile duct ligation (BDL) animal model of liver fibrosis. Similar to CHF livers, the main source of CTGF/CCN2 in the BDL liver appeared to be the proliferating bile duct epithelial cells, although CTGF staining was also observed in the fibrous septa
[151, 154]. In this model, real-time PCR showed an increase of CTGF/CCN2 and collagen in parallel to the degree of fibrosis [154]. Additionally, TGF-β and
CTGF/CCN2 mRNA levels were increased 4- and 7-fold , respectively, above those in normal liver [151]. This is in contrast to the CCl4 fibrosis animal model where the main source of CTGF/CCN2 is thought to be HSCs [151, 154]. Since many hepatic cell types can produce CTGF/CCN2 (see Figure 1.2), complex paracrine networks of CTGF/CCN action within the liver are likely in view of its broad interactions with target cells (see
Section 3.1.1) that express sell surface heparin-like molecules and/or integrins (see
Section 1.4 and 3.1.2). HSCs, the main fibrogenic cell type in the liver, may be a major target cell for both autocrine and paracrine action of CTGF/CCN2. In addition,
122 CTGF/CCN2 may not only act as promoter of fibrosis, but also act as a binding protein for other bioactive molecules that influence the progression of liver fibrosis.
CTGF/CCN2 has already been shown to bind a VEGF isoform [111] and in this way regulates angiogenesis. VEGF can stimulate CTGF/CCN2 expression in HSCs [77] and
CYR61/CCN1 is able to induce the expression of VEGF in fibroblasts [97]. Further,
VEGF was found to be increased during the development of liver fibrosis and could significantly stimulate the proliferation of activated HSCs [264]. In addition,
CTGF/CCN2 has also been shown to act cooperatively with TGF-β to promote fibrosis.
For example, it has been hypothesized, based on data from experiments using Ad to deliver CTGF/CCN2 to rat lungs, that CTGF/CCN2 may act as a co-factor for TGF-β1 to cause the progression of fibrosis [178]. Further, persistent fibrosis in a skin fibrosis model was hypothesized to require TGF-β as an inducer and CTGF/CCN2 for maintenance of the phenotype [67]. Perhaps CTGF/CCN2 may cooperate with TGF-β,
VEGF or other bioactive molecules to promote liver fibrogenesis. As further knowledge of CTGF/CCN2 protein-protein and protein-cell interaction within the liver is gained, its role and mechanisms of action in normal liver as well as in fibrosis will be clarified.
4.4.2 CTGF/CCN2 in DSRCT
These studies showed that DSRCT express CTGF/CCN2 in both the tumor cells and supporting stromal fibroblasts and vascular endothelial cells suggesting that CTGF/CCN2 is involved in autocrine and paracrine pathways of action. Interestingly, the one specimen that did not stain positively for CTGF/CCN2 expression also did not have the typical 123 DSRCT translocation. This may mean that this tumor was incorrectly identified (RT-
PCR was not performed until after the patients death) and CTGF/CCN2 is, in fact, a common feature of DSRCTs with the characteristic translocation. Alternatively, this may mean that, consistent with the pathological findings, this particular tumor was, in fact,
DSRCT but it did not have the typical translocation, although 96-97% of all DSRCTs are positive for the EWS-WT1 fusion [265]. CTGF/CCN2 may only be associated with
DSRCTs that have the EWS-WT1 fusion.
Studies of other tumor types have shown considerable variability in the cellular localization of CTGF/CCN2. For example, glioblastoma, infantile myofibromatosis, malignant fibrohistiocytic tumors, and malignant hemangiopericytomas have moderate to intense CTGF/CCN2 staining in the tumor cells with mild to moderate CTGF/CCN2 expression in the surrounding vascular endothelial cells [115, 116]. On the other hand,
CTGF/CCN2 is not expressed in the tumor cells of angiofibromas, squamous cell carcinoma associated with lung cancer or mammary ductal carcinomas yet it is present at high concentrations in the surrounding endothelial cells and stromal fibroblasts [71, 114-
116]. In desmoplastic tumors of the esophagus and pancreas, CTGF/CCN2 is expressed more prominently by stromal fibroblasts than by the tumor cells themselves [78, 266].
The production of CTGF/CCN2 by several cell types in DSRCT is consistent with its participation in autocrine and paracrine pathways that impact processes including tumor growth, angiogenesis, and desmoplasia. While the matrigenic, fibrogenic, and angiogenic properties of CTGF/CCN2 are well documented [21], its precise role in tumor cell
124 function has yet to be clarified. CTGF/CCN2 over-expression is correlated with increased survival in esophageal squamous cell carcinoma, oral squamous cell carcinoma and chondrosarcoma but negatively correlated in esophageal adenocarcinoma [266-268].
Except in these cases, there does not appear to be a correlation between the malignancy of a tumor and either the concentration or cellular localization of CTGF/CCN2. However, the ability of breast cancer cells to metastasize is associated with expression of both
CTGF/CCN2 and CYR61/CCN1 [269, 270].
WT1 plays important roles in development, tumorigenesis, RNA splicing, DNA replication and apoptosis but is best characterized as a tumor suppressing transcription factor [259]. Novel binding sites in the CTGF/CCN2 promoter are used by WT1 to suppress CTGF/CCN2 expression, both in its endogenous location and in a reporter construct [206]. The EWS-WT1 fusion is able to recognize and activate the same set of target genes that are usually negatively regulated by WT1. Taken together, these data suggest that in DSRCT, the inhibitory control of CTGF/CCN2 gene expression by WT1 may be overcome by the pathologic fusion of EWS1 to WT1 in DSRCT leading to localized CTGF/CCN2 over-expression and the concomitant formation of a desmoplastic stroma. Although this mechanism has yet to be proven, CTGF/CCN2 may be a useful target for developing novel therapeutic approaches for combating this disease.
125 4.4.3 Summary
CHF and DSRCT are both devastating pediatric fibrotic diseases in which CTGF/CCN2 is up-regulated. CTGF/CCN2 may act in both an autocrine and paracrine fashion to promote fibrosis in these conditions. Since CTGF/CCN2 is a downstream mediator of the fibrotic effects of TGF-β, many investigators have proposed it to be a novel target for controlling excess fibrogenesis. However, additional studies need to be undertaken to further understand CTGF/CCN2 gene expression regulation as well as receptor binding and signaling before intervention strategies for fibrosis can be proposed. Nevertheless, these data showing CTGF/CCN2 expression in CHF and DSRCT support the concept that
CTGF/CCN2 may be a useful target for developing novel therapeutic approaches for combating pediatric fibrosis.
126
Age at histologic t(11;22) CTGF/ Patient site status diagnosis subtyping (p13;q12) CCN2 positive- vimentin, lymph 1 15 deceased desmin, negative negative node NSE, keratin positive- desmin, keratin 2 10.5 abdomen deceased positive positive negative- NSE, actin positive- desmin peritoneal, alive, negative- 3 15 positive positive omentum NED CD45, CD 99, actin
Table 4.1: Clinical features of 3 patients with DSRCT
127
Figure 4.1: CTGF/CCN2 mRNA and protein expression in CHF
Sections of liver from a 9 year old patient with congenital hepatic fibrosis were treated with (A) sense CTGF/CCN2 mRNA probe, (B,F) anti-sense CTGF/CCN2 mRNA probe, (C) normal rabbit IgG, (D, G) affinity purified rabbit anti-CTGF/CCN2 [81-94] IgG or (E, H) hematoxylin and eosin. CTGF/CCN2 mRNA (purple staining) and protein (brown staining) was localized primarily to bile duct epithelial cells; this staining pattern was observed in 3/3 cases of the disease. A-E, 10x; F-H, 40x.
128
Figure 4.2: CTGF/CCN2 mRNA and protein expression in DSRCT
Tumor sections were incubated with (A) sense CTGF/CCN2 mRNA probe, (B) anti-sense CTGF/CCN2 mRNA probe, (C) normal rabbit IgG, (D) affinity purified rabbit anti-CTGF/CCN2 (81-94) IgG or (E) hematoxlyin and eosin. CTGF/CCN2 mRNA (purple) and CTGF/CCN protein (brown) was localized to the tumor cells, fibroblasts and blood vessels in 2of 3 cases.
129
Figure 4.3: Cellular localization of CTGF/CCN2 protein and mRNA in DSRCT
Tumor sections were treated with affinity purified anti-CTGF/CCN2 (81-94) IgG. CTGF/CCN2 protein was detected in (A) tumor cells, (B) fibroblasts, (C) capillary endothelial cells, and (D) arteriolar endothelial cells. CTGF/CCN2 mRNA was detected in tumor cells, (E) fibroblasts and (F) arteriolar endothelial cells. The location of blood vessels was confirmed by staining for Factor VIII (not shown).
130
CHAPTER 5
CTGF IN UTERINE BIOLOGY
5.1 INTRODUCTION
5.1.1 CTGF/CCN2 in uterine luminal fluid
Growth factors and cytokines are among a group of uterine proteins that are involved in uterine-embryo growth signaling pathways either through secretion into the uterine lumen or localization at the implantation site. The molecular mechanisms regulating uterine protein secretion are multifaceted and involve steroid hormonal and growth factor control of gene transcription and translation, as well as timing and localization of protein export and processing. CTGF/CCN2 and several different CTGF/CCN2 mass forms have been found in the uterine fluid of pigs and mice. In pregnant pigs, CTGF/CCN2 isoform concentrations in uterine luminal fluids (ULF) peak around the time of blastocyst elongation and estrogen production, the latter of which is the molecular cue for pregnancy recognition in this species [40, 42]. Higher CTGF/CCN2 protein isoform levels in the ULF were evident on day 12 of pregnancy than on day 12 of the cycle, while
131 peak levels of CTGF/CCN2 protein in ULF on day 16 of the cycle contrasted with the diminishing levels at the same stage of pregnancy [40]. In the cycling mouse uterus, similar bioactive mass forms of CTGF/CCN2 have been found in ULF [43].
5.1.2 CTGF/CCN2 in uterine tissue
Up to the time when research reported in this chapter was initiated, several studies had established that CTGF/CCN2 is present in the uteri of a number of mammalian species.
Pig CTGF/CCN2 mRNA and protein were found in uterine endometrium by Northern blotting and immunoprecipitation, respectively [271]. Additionally, CTGF/CCN2 protein was primarily localized to mouse uterine epithelial cells during days 1.5-3.5 of pregnancy
[43]. This pattern of expression diminished on day 4.5 (the time of implantation) and on days 5.5 and 6.5, CTGF/CCN2 protein was detected at high levels in uterine decidual cells where it was hypothesized to be involved with the differentiation of the stroma during decidualization. [43]. Finally, CTGF/CCN2 mRNA was detected in human uterus by Northern blotting and CTGF/CCN2 protein was found by immunohistochemistry [86].
In both the proliferative and secretory stages of the human menstrual cycle, CTGF/CCN2 protein was detected by IHC in the epithelial and vascular endothelial cells while stromal cells were only positive for CTGF/CCN2 in the edematous areas during early and mid- secretory endometrium and decidualized regions of the late secretory endometrium [86].
During pregnancy, CTGF/CCN2 protein was noted in decidual, epithelial and endothelial cells of the endometrium [86].
132 5.1.3 Conserved function
Even with the differences in uterine physiology of these species, certain aspects of the
CTGF/CCN2 biochemistry appear to be conserved. In all 3 species, CTGF/CCN2 mRNA and protein are localized to uterine epithelial cells as well as in the stroma or deciduas after blastocyst attachment or implantation. The epithelial cells are, most likely, the source of the CTGF/CCN2 found in ULF although various cell types within the uterus likely produce CTGF/CCN2 in response to steroid hormones or other stimuli (e.g. TGF-
β) thereby setting in motion a cascade of events that support tissue remodeling or repair during the estrous cycle or pregnancy. Collectively, these data suggest that in the uterus,
CTGF/CCN2 may be physiologically important in epithelial cells during the estrous cycle and in differentiating stromal cells during early pregnancy. CTGF/CCN2 may play diverse biological roles at different times throughout the estrous cycle or pregnancy that could be embryo-, steroid- or TGF-β1-regulated.
Although many studies have focused on CTGF/CCN2-related pathologies such as malignancy, wound healing and fibrosis, few have addressed its role in normal physiology. For this reason and the fact that CTGF/CCN2 was found in both ULF and endometrium, CTGF/CCN2 mRNA and protein and its transcriptional activator, TGF-β1 were analyzed at the utero-placental interface during early pregnancy in the pig.
Additionally, embryo and steroid effects on CTGF/CCN2 expression were studied in the mouse uterus.
133
5.2 MATERIALS AND METHODS
5.2.1 Materials
Crossbred or Large White gilts between 7.5 and 10 months old were bred on their second cycle by observing them daily for estrous behavior and mating them at 12 and 24 hours after the onset of estrus. Swiss Webster (Harlan Sprague Dawley) mice were used for all rodent experiments. All experiments were approved by the Institutional Animal Use and
Care Committee of Children’s Research Institute (Columbus, OH).
Histochoice was purchased from Amresco (Solon, OH) and Superfrost Plus slides, crystal mount and Permount were from Fisher Scientific (Pittsburgh, PA). PBS, DMEM, L- glutamine mix, penicillin and streptomycin, Trizol, dNTP mix, Superscript RT II,
Platinum Taq, and plasmid pCRII were all obtained through Invitrogen (Carlsbad, CA).
Colorado calf serum was purchased from Colorado Serum Company (Denver, CO).
Normal rabbit IgG was from Vector Laboratories (Burlingame, CA). Power Block and
StrAviGen Multilink kit were obtained through BioGenex (San Ramon, CA).
Hematoxylin was purchased from Newcomer Supply (Middleton, WI). BSA and other chemicals were purchased through Sigma (St. Louis, MO). Digoxygenin RNA labeling kit and sheep anti-digoxygenin alkaline phosphatase were from Roche (Indianapolis, IN).
NBT/BCIP chromogenic substrates were from Promega (Madison, WI). Affinity purified
CTGF/CCN2 antibody was raised in rabbits against a peptide containing residues 81-94
134 of human CTGF/CCN2 protein and in the porcine and murine CTGF/CCN2 molecule.
Affinity purified anti-TGF-β antiserum was obtained from Santa Cruz Biotechnology
(Santa Cruz, CA).
5.2.2 Animals
5.2.2.1 Pigs
Pregnant pigs were hysterectomized on days 10, 12, 14, 16, 17 and 21 of gestation, and cyclic gilts were hysterectomized on days 0, 5, 10, 12, 15, and 18 of the estrous cycle using previously described surgical procedures [272]. Uterine horns from cycling animals were opened along the antimesometrial border and the endometrium was removed from the overlying myometrium using sterile scissors. Sections of the endometrium from the mesometrial region of the uterine horn were fixed in 4% paraformaldehyde. Uterine horns from pregnant animals on days 12 and beyond were dissected free of myometrium, cut into sections, fixed in Histochoice and opened to locate embryonic material. All sections were placed in cassettes, processed through graded alcohol, cleared, and embedded in parablast [87].
One uterine horn from day 14-17 pregnant pigs was used for cell isolation. The horn was rinsed with PBS to dislodge the embryo and extra embryonic membranes (EEM). The ends of the horn were then tied off and filled with 4.8 mg/ml dispase in PBS and incubated for 20 minutes at room temperature. This solution was then transferred to a
135 conical tube and saved after which 4.8 mg/ml dispase in 5x pancreatin was added to the uterine horn. This was incubated for 1 hour at room temperature with gentle shaking.
This solution was also transferred to a conical. The horn was then washed twice with
PBS, saving the washes as well. The solutions from the two digestions and washes were then combined and centrifuged at 200 x g for 7 minutes. The pellet was washed by resuspending in PBS and centrifuged at 300 x g for 7 minutes. The pelleted cells were luminal epithelial cells. One fourth the remaining tissue was minced with scissors, then digested with 0.04% trypsin and 0.06% collagenase in PBS for 50 minutes at 37oC with gentle shaking at 10 minute intervals. Undigested tissue was removed and the remaining glandular epithelial cells and stromal cells were passed through a 38 µm sieve. Purified stromal cells and luminal epithelial cells were plated in 100 mm dishes in DMEM supplemented with 10% CCS, l-glutamine and pen/strep.
5.2.2.2 Mice
Swiss Webster male mice were vasectomized and kept for 35 days to clear all viable sperm and mating was then induced between these sterile males and fertile female mice.
The appearance of a vaginal plug was defined as day 0.5 of pseudopregnancy. The uteri of the females were harvested daily between days 0.5 and 5.5, the last time point being the probable day of return of estrus [262].
Swiss Webster virgin female mice were ovariectomized (OVX) and kept for two weeks to deplete them of circulating ovarian steroids. On day 15 post-ovariectomy, animals
136 were given a single subcutaneous injection of either sesame oil alone, 250 ng estradiol-
17β (E2), 2 mg progesterone (P4), or a combination of both hormones in 200 µl sesame oil. Uteri were collected at 1, 3, 6, 12 and 24 hours post injection [262].
All uteri were fixed in Histochoice, placed in cassettes, processed through graded alcohol, cleared, and embedded in parablast.
5.2.3 RT-PCR
RNA from day 14, 16 or 17 pig endometrium and blastocyst, as well as, from day 17 stromal cells that had been stimulated for 4 hours with 10ng/ml TGF-β1 or 2.5% calf serum was isolated using Trizol per the manufacturer’s protocol. Additionally, RNA was isolated from mouse Balb/c 3T3 cells that had been stimulated with 10 ng/ml TGF-β1 for
2 hours to generate cDNA used for probe plasmid generation (see Section 5.2.4). RNA was run on a gel to assess the quality. Reverse transcription was carried out with
Superscript RT II per manufacturer’s instructions. Briefly 1µg total RNA was reverse transcribed at 42oC for 50 minutes with an Oligo dT primer. One tenth of the cDNA product was added to the PCR reaction using Platinum Taq per manufacturer’s instructions with the exception of using 10% DMSO in the PCR reaction. Primers used for amplifying pig CTGF/CCN2 were pFOR247 5’ - gccgggatccatggaagagaacattaagaaggg
- 3’ and pCTGFREV 5’ - ccagcggccgcgaatttaggccatgtctcc - 3’ and a 339bp product was expected. Primers used for amplifying pig TGF-β1 were pTGFβ1F 5’ - tctcagacctgcctcagctttcc - 3’ and pTGFβ1R 5’ - tccggtgacatcaaaggacagcc - 3’ and a 884 bp product was expected. Primers used for amplifying pig GAPDH were pGAPDHF 5’ - 137 aactctggcaaagtggacattg - 3’ and pGAPDHR 5’ - aagttgtcatggatgaccttgg - 3’ and the expected product was 433 bp. Primers used for amplifying mouse CTGF/CCN2 were mPRECCTGF 5’ - gcagggatccatgctcgcctccgtcgca - 3’ and mREVCTGF 5’ - ccagcggccgcgaattcttacgccaatgtctcc -3’ and the expected product was 1074 bp. Primers used for amplifying mouse TGF-β1 were mTGFβ-1F 5’ - ccggatcctgtccaaactaaggctcgc -
3’ and mTGFβ-1R 5’ - cctctagaccagtgacgtcaaaagacagcc - 3’ and a 460 bp product was expected.
5.2.4 mRNA probe synthesis
The above PCR reactions generated a 339 bp porcine CTGF/CCN2 DNA corresponding to nucleotides 726 to 1065 of the full length pig CTGF/CCN2 mRNA, a 884 bp porcine
TGF-β1 cDNA corresponding to nucleotides -278 to 606 of TGF-β1 mRNA, a 1074 bp mouse CTGF/CCN2 DNA corresponding to nucleotides -1 to 1046 of CTGF mRNA, and a 460 bp mouse TGF-β1 DNA corresponding to nucleotides 158 to 604 of TGF-β1 mRNA. These fragments were individually cloned into the pCRII vector and the resulting pCRII-pCTGF/CCN2, pCRII-pTGFβ, pCRII-mCTGF/CCN2, or pCRII-mTGF-β1 plasmids were cut with diagnostic restriction enzymes to verify insert directionality.
Digoxygenin-UTP labeled RNA sense and anti-sense probes were made using a digoxygenin labeling kit, according to the manufacturer’s instructions. All plasmids were linearized with EcoRV for SP6 generation of the sense probe and with KpnI for T7 generation of the anti-sense probe.
138 5.2.5 In situ hybridization for CTGF/CCN2 and TGF-β1
In situ hybridization was performed as previously described (Section 4.2.3). Briefly, sections were de-parafinized, re-hydrated then washed, fixed and blocked before being incubated 20 hours at 42oC in a humid chamber with 300 ng/ml probe. Sections were then washed and incubated for 2 hours at room temperature with 1/750 dilution of anti-
DIG-alkaline phosphatase antibody. Finally, sections were developed using BCIP/NBT for 2 - 14 hours. Sections were then counter-stained with Nuclear Fast Red mounted with crystal mount.
5.2.6 Immunohistochemistry for CTGF/CCN2 and TGF-β1
Immunohistochemistry was performed as described (Section 2.2.10). Briefly, sections were de-parafinized, re-hydrated, blocked for endogenous peroxidase activity with H2O2.
Sections were then incubated with either 2 µg/ml anti-TGF-β1 IgG, 10µg/ml affinity purified anti-CTGF/CCN2[81-94] or equivalent concentrations of normal rabbit IgG for 1 hour at room temperature in a humid chamber. Next, biotinylated multi-linking IgG, then strepavidin peroxidase label were utilized at a 1/50 dilution (per the manufacturer’s protocol). Color was developed using Sigma Fast DAB tablet sets. Slides were counter- stained with hematoxylin, dehydrated and mounted. In these studies, the author performed cell isolation from the pig uterus, RNA isolation and RT-PCR from tissues and
139 cells, cloning mouse and pig CTGF/CCN2 and TGF-β1 transcripts into the pCRII vector, mRNA probe synthesis for in situ hybridization, TGF-β1 in situ hybridization and some
TGF-β1 immunohistochemistry. The author assisted in all other experiments.
5.3 RESULTS
5.3.1 In vitro CTGF/CCN2 production and regulation
Based on RT-PCR, CTGF/CCN2 mRNA was expressed in uterine endometrium on days
14, 16 and 17 of pregnancy in the pig (Figure 5.1). Day 16 and 17 blastocyst expressed
CTGF/CCN2 mRNA in lesser amounts. Additionally, stromal cells isolated from a day
17 pregnant pig uterus grown to quiescence showed increased CTGF/CCN2 mRNA expression when stimulated with TGF-β1 or calf serum when compared to no stimulation
(Figure 5.1).
5.3.2 CTGF/CCN2 and TGF-β1 production during the estrous cycle of the pig
The data are presented in both picture and tabular form in Figure 5.2. CTGF/CCN2 mRNA and protein were abundant in the luminal epithelial cells (LECs) on days 0 and 5 of the estrous cycle. By day 10 the morphology of the LECs changed from tall columnar to cuboidal in shape. This change corresponded to a decrease in amounts of
CTGF/CCN2 mRNA and protein in the LECs yet staining in the glandular epithelial cells
(GECs) remained intense at this time point. Over these time points, stromal cells and 140 endothelial cells produced only low amounts of or no CTGF/CCN2 mRNA and protein.
The flattening of the luminal epithelium was most apparent on days 12 and 15 and although LECs were still positive for CTGF/CCN2, the staining intensity for both the protein and the mRNA was lower than that seen in GECs. At these later time points,
CTGF/CCN2 mRNA began to be produced in stromal fibroblasts and, to a lesser extent, in the endothelial cells. CTGF/CCN2 production was similarly distributed when LEC height was restored (day 18).
The basic distribution of uterine TGF-β1 during the estrous cycle was similar to that of
CTGF/CCN2, particularly in terms of its relative abundance in the LECs and GECs as compared with other cell types (Figure 5.2). Beginning on day 12, TGF-β1 mRNA was reduced in LECs and GECs, a phenomenon that was most apparent on day 15. On day
18, there was an increased synthesis of TGF-β1 mRNA in the basal region of LECs.
TGF-β1 protein was present in high amounts in LECs and GECs on days 5-15 and in lower amounts on days 0 and 18. Finally, stromal cells and endothelial cells exhibited very weak or non-detectable staining for both TGF-β1 mRNA and protein.
5.3.3 CTGF/CCN2 and TGF-β1 production during early pig pregnancy
The results are presented in both picture and tabular form in Figure 5.3. Spherical non- elongated blastocysts recovered from uterine flushings on day 10 were strongly positive for CTGF/CCN2 and TGF-β1, which were co-localized to the extra-embryonic trophectoderm, endoderm and inner cell mass. On day 12 of pregnancy, regions of the 141 uterus that were not closely associated with the extra-embryonic membranes showed high amounts of CTGF/CCN2 or TGF-β in LECs, GECs, stroma and endothelium. In contrast to these areas of intense staining, there was a dramatic localized down-regulation in LECs for both CTGF/CCN2 and TGF-β1 when the luminal epithelial layer was in close proximity to or direct apposition with the extra embryonic membranes. These differences were apparent for the mRNA and protein for both growth factors and were characterized by a pronounced reduction or complete absence of signal in the LECs. On the maternal side, these regions of down-regulated CTGF/CCN2 or TGF-β1 expression were highly localized and correlated with marked ECM remodeling and collagen degradation in the underlying stroma, resulting in the development of a massive subepithelial capillary network. On the conceptus side, trophoblast cells of the elongated blastocyst exhibited a comparable down-regulation of TGF-β1 mRNA, with non-detectable amounts of TGF-β1 protein and CTGF/CCN2 mRNA or protein.
The altered expression and localization of CTGF/CCN2 and TGF-β1 in the LECs was also seen on day 14 and 17, by which time close apposition between the uterus and extra- embryonic membranes had been established (Figure 5.3). On day 17, CTGF/CCN2 and
TGF-β1 were produced at low or non-detectable amounts in LECs and at moderate to high amounts in the subepithelial stroma and endothelium. By this time, the EEMs stained partially or completely positive for both molecules. Additionally, the stromal regions underlying the feto-maternal junction showed profound reorganization of their extracellular and cellular elements, with new collagen architecture supporting an extensive subepithelial capillary network, the endothelial cells of which were positive for 142 both CTGF/CCN2 and TGF-β1. By day 21, with the establishment of a tight feto- maternal junction, the associated stromal reorganization and vascularization were largely complete. At this time, production of CTGF/CCN2 and TGF-β1 by LECs was higher and approached the amount seen during the pre-attachment period. CTGF/CCN2 and TGF-
β1 were also produced by cells of the vascular subepithelial stroma and placental membranes, the latter of which exhibited mRNA concentrations that exceeded those seen in LECs.
5.3.4 CTGF/CCN2 and TGF-β1 expression in mouse pseudopregnancy
The results are presented in both picture and tabular form in Figure 5.4. CTGF/CCN2 and TGF-β1 mRNA and protein were found in the uteri of pseudopregnant mice. On days 0.5 - 2.5 of pseudopregnancy, CTGF/CCN2 and TGF-β1 protein were strongly expressed in the cytoplasm of the columnar luminal and glandular cells, whereas in the condensed aggregates of the stromal fibroblasts and smooth muscle fibers of the myometrium moderate CTGF/CCN2 and TGF-β1 protein was observed. Similarly, large amounts of CTGF/CCN2 and TGF-β1 mRNA were also co-localized in luminal and glandular epithelial cells, and smaller amounts were found in the underlying stroma. On days 3.5 - 4.5, CTGF/CCN2 and TGF-β1 mRNA and protein were decreased in epithelial cells, but increased in stromal fibroblasts. This change corresponded to stromal ECM remodeling and massive invasion of capillaries, which were also positive for
CTGF/CCN2 expression. By day 5.5 (corresponding to the likely return of estrus), both
143 CTGF/CCN2 and TGF-β1 protein and mRNA expression increased in the luminal and glandular epithelial cells and was apically localized within the cells. Stromal staining for
CTGF/CCN2 and TGF-β1 mRNA was low, while their respective protein values were relatively high. These data, which are comparable to those of the preimplantation period
[43], suggest that CTGF/CCN2 expression is predominantly regulated by maternal factors and hormones prior to blastocyst implantation [262].
5.3.5 Steroid hormone effects in the mouse uterus
The results are presented in both picture and tabular form in Figure 5.4 and Figure 5.5, respectively. A massive reduction in the overall uterine size, a decrease in the height of the luminal and glandular epithelial cells, and invasion of capillaries perforating the stroma were seen 2 weeks post ovariectomy (Figure 5.4.A). This was associated with greatly reduced expression of CTGF/CCN2 mRNA, particularly in epithelial cells, which normally show a very strong CTGF/CCN2 mRNA signal in cycling animals [43]. In control OVX animals, the low basal level of CTGF/CCN2 was confined to the apical surface of the epithelial cells. In contrast, protein levels for both CTGF/CCN2 and TGF-
β1 were moderately high and distributed throughout the epithelial cells. The stromal cells showed no detectable CTGF/CCN2 mRNA and low amounts of CTGF/CCN2 and
TGF-β1 protein. Results were similar for all control time points.
Treatment of OVX animals with E2 resulted in a dramatic but transient increase in
CTGF/CCN2 mRNA and protein in uterine epithelial cells. This increase was evident 144 within 1 hour, had peaked by 6 hours and had subsided by 24 hours. During the induction, CTGF/CCN2 mRNA was localized throughout the epithelial cells, but during the attenuation phase was once again localized to the apical region of the epithelial cells.
CTGF/CCN2 and TGF-β1 protein expression in epithelial cells was increased 1-24 hours after E2 treatment. A slight increase in CTGF/CCN2 mRNA amounts was detected in a few scattered stromal cells at 6 hours post E2 treatment. CTGF/CCN2 and TGF-β1 protein levels in the stroma were moderately higher than in the OVX control.
Treatment of OVX animals with P4 resulted in a less robust stimulation of CTGF/CCN2 mRNA than with E2. This increase was evident by 1 hour and was distributed throughout the cytoplasm. By 6 to 24 hours CTGF/CCN2 mRNA expression had declined and localization was again confined to the apical regions of the epithelial cells. CTGF/CCN2 and TGF-β1 protein, however, remained at a constant moderate value that was comparable to OVX controls. P4 did not appear to stimulate CTGF/CCN2 mRNA expression in the stroma, although relatively high amounts of CTGF/CCN2 and TGF-β1 protein were present at all time points.
Treatment of OVX animals with a combination of E2 and P4 resulted in a slight increase of CTGF/CCN2 mRNA at 1 to 6 hours post treatment. The localization to the epithelial cells was mainly apical and its intensity declined by 24 hours. No stromal staining for
CTGF mRNA was present in animals receiving the combination treatment and the
CTGF/CCN2 and TGF-β1 protein levels were much reduced compared with each hormone treatment individually. 145
5.4 DISCUSSION
5.4.1 CTGF/CCN2 expression and localization in the pig and mouse uterus
Although the pig and mouse exhibit different modes of placentation, CTGF/CCN2 expression in the uterus does appear to follow a similar pattern. The porcine placenta is of the loose epithelio-chorial type and is characterized by simple apposition between the trophoblast and uterine epithelium, while invasive implantation is exhibited by blastocysts of the mouse and human species [273]. In pig, mouse and human species
LECs and GECs are a principal site of CTGF/CCN2 synthesis [43, 83, 84, 86].
In the pig, a clear down regulation in CTGF/CCN2 production by LECs was noted when trophoblastic cells were either in close proximity or undergoing apposition with endometrium. The down-regulation by LECs was highly correlated with the maternal stromal ECM reorganization and the onset of neovascularization. This may signify that the normally high concentrations of CTGF/CCN2 favor ECM production and stabilization within the stroma. When CTGF/CCN2 production is decreased, net degradation of the stroma would result, allowing the development of a subepithelial endometrial vascular network required to support a non-invasive placenta. The re- expression of CTGF after the maternal new blood supply has been established, may allow for net stromal ECM synthesis and stabilization of the new vascular elements.
146 Implantation in mice and humans follow a similar pattern. Implantation is preceded by a reduction in CTGF/CCN2 production by LECs followed by high CTGF production in the differentiating stroma [43, 86].
Another possible explanation for initial down-regulation of CTGF/CCN2 in the LECs, is that uterine receptivity may be thereby enhanced [274-276]. Re-expression of
CTGF/CCN2 after blastocyst attachment may improve the epithelial-epithelial interactions at the apposition site since CTGF/CCN2 is a well-characterized cell adhesion molecule [44, 48, 106]. Integrins are known to be involved in the epithelial-epithelial attachment process and are also functional receptors for CTGF/CCN2 [7, 9, 11, 13, 47,
48, 106, 212, 274, 275]. Although CTGF/CCN2 has been shown to be angiogenic in a variety of systems, the alterations of LEC CTGF/CCN2 in this system does not seem to be directly angiogenic [108]. Rather, the modulation of CTGF/CCN2 seems to allow the development of neovascularization by allowing a degradation of ECM at a time when extensive neovascularization of the stroma is required. However, it is possible that the increase of CTGF/CCN2 production in the stroma may, in fact, act as a stimulus for angiogenesis along with other factors. Whatever role CTGF/CCN2 does play in the attachment/implantation phase it is possibly conserved across species.
CTGF/CCN2 expression is highly correlated with that of TGF-β1 in endometrial epithelial cells, endothelial cells, and stromal fibroblasts during the estrous cycle and early pregnancy, suggesting that pathway of TGF-β1 action in the uterus and the utero- placental unit are CTGF/CCN2 dependent. This is consistent with our studies showing 147 that CTGF/CCN2 mRNA is induced in cultured pig endometrial stromal cells after treatment with TGF-β1. It has also been previously proposed that TGF-β1 plays a role in stromal differentiation at the time of implantation [277]. Similarly, the data presented in this chapter also shows TGF-β1 expression at the time of stromal differentiation.
To assess if the pregnancy related changes in CTGF/CCN2 were due to the blastocyst or the maternal uterus, a mouse pseudopregnancy model was utilized. Our data demonstrate that the early changes seen in pseudopregnancy mirror changes seen in early pregnancy prior to implantation. This clearly suggests, at least in early pregnancy, that modulations in uterine CTGF/CCN2 are blastocyst-independent and maternally driven.
Similar to results from the pig, at the time of implantation uterine epithelial CTGF/CCN2 levels in both pregnant and pseudopregnant mice drastically decreased [43, 262].
Extensive stromal remodeling and angiogenesis mark this time. Down-regulation of
CTGF/CCN2 may allow for a net degradation of ECM thereby allowing ECM remodeling and neovascularization. Also, CTGF/CCN2 production in the stroma and endothelial cells at the time of implantation may help stimulate angiogenesis.
In addition, CTGF/CCN2 production mirrored that of TGF-β1 and was principally epithelial over the first 3 days of pseudopregnancy. This is also in agreement with previous studies which have shown that uterine expression of TGF-β1, TGF-β2 and
TGF-β3 appear to be maternally regulated and similarly localized [277, 278]. In light of the ability of TGF-β1 to stimulate CTGF/CCN2 production in many cell types, 148 CTGF/CCN2 may, indeed, mediate at least some biological effects of TGF-β1 in the uterus. The similarity in localization and expression between CTGF/CCN2 and TGF-β are consistent with TGF-β mechanisms. Conversely, our data does have examples of high amounts of TGF-β protein in stromal cells but no detectable CTGF/CCN2 mRNA.
This may indicate that (i) TGF-β was in its inactive form; (ii) excess TGF-β may act in a negative regulatory loop with CTGF, or (iii) TGF-β only affects epithelial and not stromal cells though this is unlikely because TGF-β receptors have been found in stromal cells in early pregnancy [279].
The uterus is regulated primarily by steroid hormones. Our data establish that the maternal sex steroids, E2 and P4 are among the maternal factors that can regulate expression of CTGF/CCN2 in the mouse uterus. This implies that CTGF/CCN2 may mediate some of the growth and differentiation processes in uterine tissues that are steroid-dependent. Our data is consistent with a previous report showing that
CTGF/CCN2 was induced in OVX rat uteri after four hours of treatment with 17-α- ethynylestradiol [280]. However, CTGF/CCN2 mRNA, protein and TGF-β protein were not completely abolished 2 weeks post ovariectomy suggesting that regulation of these genes is, at least in part, steroid-independent.
Nevertheless, both CTGF/CCN2 and TGF-β are individually induced by E2 and P4 and the response to each hormone is quite different. As compared to P4, E2 treatment caused a greater induction of CTGF/CCN2 mRNA. Previous studies have shown TGF-β mRNA
149 is increased in the uterine epithelial cells after E2 treatment [278, 281]. Although the epithelial response of CTGF/CCN2 mRNA was transient, CTGF/CCN2 and TGF-β protein persisted in both epithelial and stromal cells. When given in combination, P4 appeared to antagonize the E2-induced increase in CTGF/CCN2 and TGF-β expression by epithelial cells in our studies. Similar opposing effects of these hormones have been reported for the regulation of several uterine growth factors including HB-EGF, amphiregulin and bFGF [282-285].
P4 is an important hormone in the establishment and maintenance of pregnancy and is required for stromal cells to differentiate in response to an embryonic stimulus [262].
Some growth factors, such as HB-EGF, IGF-1, VEGF and TNF-α appear to be P4 dependent [284]. In our studies, CTGF/CCN2 protein production is high only after P4 administration alone or during ECM remodeling during pseudopregnancy.
Decidualization in the normal mouse is dominated by P4 and therefore consistent with our findings of high levels of CTGF/CCN2 protein in the stroma of P4- treated uteri.
However, although the level of CTGF/CCN2 protein is high in these cases in the stroma, it is the epithelial cells that are the principal source of CTGF/CCN2 synthesis in cycling and pseudopregnant mice. This suggests that CTGF/CCN2 produced in the epithelial cells may act on the stromal cells in a paracrine manner or that the protein may be translocated to the stroma from the epithelial cells. This translocation has been hypothesized for TGF-β1 in the mouse uterus as well [277]. This is further supported by the fact that large amounts of CTGF/CCN2 protein is found in both the epithelial and stromal cells while only epithelial cells are making significant amounts of CTGF/CCN2 150 mRNA in both pseudopregnancy (day 0.5 - 2.5) and control and hormone treated OVX mice. Hence, CTGF/CCN2 may be one of the players in the epithelial-mesenchymal cell interactions that drive uterine differentiation and support the establishment and maintenance of pregnancy.
5.4.2 Summary
Basic mechanisms of CTGF/CCN2 regulation in the uterus seem to be conserved between pig, mouse and human species. CTGF/CCN2 gene transcription in the uterus is not only regulated by maternal sex steroids, but also by TGF-β1-dependent and - independent mechanisms. The expression of CTGF/CCN2 is highly correlated with that of TGF-β1 in endometrial epithelial cells, endothelial cells, and stromal fibroblasts during the estrous cycle and early pregnancy. Thus, it is likely that pathways of TGF-β1 action in the uterus and uterus-placental entity are CTGF/CCN2 dependent. Thus,
CTGF/CCN2 is likely to mediate at least some of the effects of steroid hormones and
TGF-β on endometrial function in cycling and pregnant animals. The pattern of
CTGF/CCN2 production during the initial attachment phase in the pig and peri- implantation period (or pseudopregnancy) in the mouse is consistent with a role for this factor in stromal remodeling and neovascularization. Taken together, these data establish that the epithelium is a key source of CTGF/CCN2 in the mammalian uterus and support a role for epithelial CTGF/CCN2 in regulating stromal cell function.
151
A
B
Figure 5.1: In vitro CTGF/CCN2 expression and regulation in pig uterine cells
(A) RNA from cells collected from the endometrium (E) or blastocyst (B) of pregnant pigs on days 14, 16, or 17 was used in RT-PCR reactions to amplify CTGF/CCN2, TGF-β1 or GAPDH. (B) Stromal cells isolated from the uterus of a day 17 pregnant pig were treated with nothing, 10 ng/ml TGF-β1 or 2.5% calf serum for 4 hours. RNA was then used in RT-PCR reactions to amplify CTGF/CCN2, TGF-β1 or GAPDH.
152
Estrous Cycle Day 0 Day 5 Day 10 Day 15 Day 18 LEC GEC S LEC GEC S LEC GEC S LEC GEC S En LEC GEC S En CTGF mRNA ++++ ++++ + ++++ ++++ + ++ ++++ + ++ +++ ++ + ++ +++ ++ + CTGF protein ++++ ++++ + ++++ ++++ + ++ ++++ + ++ +++ ++ + ++ +++ ++ + TGF-β mRNA ++++ ++++ + ++++ ++++ + +++ +++ + + ++ + ++ +++ + TGF-β protein +++ +++ + ++++ ++++ + ++++ ++++ + + ++ + ++ +++ +
Figure 5.2: CTGF/CCN2 and TGF-β1 localization in the pig uterine tract during the estrous cycle
Uteri from cycling gilts on days 0 (A-D), 5 (E-F), 10 (I-L), 15 (M-P), and 18 (Q-T) were analyzed for CTGF/CCN2 protein ((A,E,I,M,Q), CTGF/CCN2 mRNA (B,F,J,N,R), TGF-β1 protein (C,G,K,O,S), TGF-β1 mRNA (D,H,L,P,T). Brown stain represents protein while purple stain represents mRNA. e, luminal epithelium; g, glandular epithelium; s, stroma; v, blood vessel. The table represents picture above. LEC, luminal epithelial cells; GEC, glandular epithelial cells; S, stromal; En, endothelial cells.
153
Pregnancy Day 10 Uterus Day 12 Uterus Day 17 Uterus Day 21 Uterus LEC GEC S En LEC GEC S En LEC-B LEC GEC S En LEC-B LEC GEC S LEC-B CTGF mRNA ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ + ++++ ++++ ++++ ++++ + ++++ ++++ ++++ ++ CTGF protein ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ + ++++ ++++ ++++ ++++ + ++++ ++++ ++++ ++ TGF-β mRNA++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ + ++++ ++++ ++++ ++++ + ++++ ++++ ++++ ++ TGF-β protein ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ + ++++ ++++ ++++ ++++ + ++++ ++++ ++++ ++ Day 10 Blastocyst Day 12 Blastocyst Day 17 Blastocyst Day 21 Blastocyst EET En ICM EET EET EET CTGF mRNA +++ +++ +++ - ++ ++++ CTGF protein ++++ ++++ ++++ - ++ ++++ TGF-β mRNA +++ +++ +++ - ++ ++++ TGF-β protein ++++ ++++ ++++ - ++ ++++
Figure 5.3: CTGF/CCN2, TGF-β1 localization in the pig uterus during early pregnancy
Pre-elongation blastocysts on day 10 (A-D) and uterine samples from pregnant gilts on days 12 (E-L), 17 (M-T), and 21 (U-X) were analyzed for CTGF/CCN2 protein (A,E,I,M,Q,U) mRNA (B,F,J,N,R,V), TGF- β1 protein (C,G,K,O,S,W), or mRNA (D,H,L,P,T,X). Brown stain represents protein while purple stain represents mRNA. b, blastocyst; c, capillary; ch, chorioallantois; e, luminal epithelium; g, glandular epithelium; s, stroma; t, trophectoderm; v, blood vessel. The table represents the pictures above. LEC, luminal epithelial cells; GEC, glandular epithelial cells; S, stroma; En, endothelial cells; LEC-B, LECs close to blastocyst; EET, extra embryonic trophectoderm, En, endoderm; ICM, inner cells mass. 154
Pseudopregnancy Day 0.5 Day 1.5 Day 2.5 Day 3.5 Day 4.5 Day 5.5 EC SC EC SC EC SC EC SC EC SC EC SC CTGF mRNA ++++ + ++++ + ++++ + ++ +++ ++ +++ ++++ + CTGF protein ++++ + ++++ + ++++ + ++ +++ ++ +++ ++++ +++ TGF-β mRNA ++++ + ++++ + ++++ + ++ +++ ++ +++ ++++ + TGF-β protein ++++ + ++++ + ++++ + ++ +++ ++ +++ ++++ +++
Figure 5.4: Uterine CTGF/CCN2 and TGF-β1 in pseudopregnant mice.
Female Swiss Webster mice were mated with vasectomized males and uterine CTGF/CCN2 and TGF-β1 mRNA and protein were assessed on the indicated days of pseudopregnancy by in situ hybridization or immunohistochemistry, respectively. Brown stain represents protein while purple stain represents mRNA. The table represents the pictures above. EC, epithelial cells, SC, stromal cells
155
Figure 5.5: Steroidal regulation of uterine CTGF/CCN2 and TGF-β (continued)
Ovariectomized mice were treated with (A) sesame oil control or (B) estradiol-17 β for the indicated amount of time. Brown stain represents CTGF/CCN2 protein (panels 2,5,8) or TGF-β protein (panels 3,6,9) while purple stain represents CTGF/CCN2 mRNA (panels 1,4,7). Additionally, ovariectomized mice were treated with (C) progesterone or (D) estradiol-17 β and progesterone for the indicated amount of time. Brown stain represents CTGF/CCN2 protein (panels 2,5,8) or TGF-β protein (panels 3,6,9) while purple stain represents CTGF/CCN2 mRNA (panels 1,4,7).
156 Figure 5.5: Continued
157
Steroid Hormone Effect
Control E2 P4 E2 + P4 EC SC EC SC EC SC EC SC CTGF 1hr + - ++++ - +++ - ++ - mRNA 6hr + - +++++ ++ ++ - ++ - 24hr + - + - + - + -
CTGF 1hr ++ + +++ +++ ++ ++++ ++ ++ protein 6hr ++ + ++++ +++ ++ ++++ ++ ++ 24hr ++ - +++ ++++ ++ ++++ + ++
TGF-β1 1hr ++ + +++ +++ +++ ++++ ++ ++ protein 6hr ++ + ++++ +++ ++ ++++ ++ ++ 24hr ++ + +++ ++++ ++ ++++ + ++
Figure 5.6: Steroidal regulation of uterine CTGF/CCN2 and TGF-β1 (summary)
This table represents the results from Figure 5.5 (A-D). E2, estradiol, P4, progesterone, EC, epithelial cells, SC, stromal cells
158
LIST OF REFERENCES
1. Bradham, D.M., Igarashi, A., Potter, R.L. and Grotendorst, G.R. (1991) Connective tissue growth factor: a cysteine-rich mitogen secreted by human vascular endothelial cells is related to the SRC-induced immediate early gene product CEF-10. J Cell Biol, 114, 1285-94.
2. Ryseck, R.P., Macdonald-Bravo, H., Mattei, M.G. and Bravo, R. (1991) Structure, mapping, and expression of fisp-12, a growth factor- inducible gene encoding a secreted cysteine-rich protein. Cell Growth Differ, 2, 225-33.
3. Brunner, A., Chinn, J., Neubauer, M. and Purchio, A.F. (1991) Identification of a gene family regulated by transforming growth factor- beta. DNA Cell Biol, 10, 293-300.
4. Almendral, J.M., Sommer, D., Macdonald-Bravo, H., Burckhardt, J., Perera, J. and Bravo, R. (1988) Complexity of the early genetic response to growth factors in mouse fibroblasts. Mol Cell Biol, 8, 2140-8.
5. Bork, P. (1993) The modular architecture of a new family of growth regulators related to connective tissue growth factor. FEBS Lett, 327, 125-30.
6. Brigstock, D.R., Goldschmeding, R., Katsube, K.I., Lam, S.C., Lau, L.F., Lyons, K., Naus, C., Perbal, B., Riser, B., Takigawa, M. and Yeger, H. (2003) Proposal for a unified CCN nomenclature. Mol Pathol, 56, 127-128.
7. Lau, L.F. and Lam, S.C. (1999) The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res, 248, 44-57.
8. Lau, L.F. and Nathans, D. (1985) Identification of a set of genes expressed during the G0/G1 transition of cultured mouse cells. Embo J, 4, 3145-51.
9. Leu, S.J., Lam, S.C. and Lau, L.F. (2002) Pro-angiogenic activities of CYR61 (CCN1) mediated through integrins alphavbeta3 and alpha6beta1 in human umbilical vein endothelial cells. J Biol Chem, 277, 46248-55.
159 10. Kireeva, M.L., Mo, F.E., Yang, G.P. and Lau, L.F. (1996) Cyr61, a product of a growth factor-inducible immediate-early gene, promotes cell proliferation, migration, and adhesion. Mol Cell Biol, 16, 1326-34.
11. Schober, J.M., Chen, N., Grzeszkiewicz, T.M., Jovanovic, I., Emeson, E.E., Ugarova, T.P., Ye, R.D., Lau, L.F. and Lam, S.C. (2002) Identification of integrin alpha(M)beta(2) as an adhesion receptor on peripheral blood monocytes for Cyr61 (CCN1) and connective tissue growth factor (CCN2): immediate-early gene products expressed in atherosclerotic lesions. Blood, 99, 4457-4465.
12. Kireeva, M.L., Lam, S.C. and Lau, L.F. (1998) Adhesion of human umbilical vein endothelial cells to the immediate- early gene product Cyr61 is mediated through integrin alphavbeta3. J Biol Chem, 273, 3090-6.
13. Jedsadayanmata, A., Chen, C.C., Kireeva, M.L., Lau, L.F. and Lam, S.C. (1999) Activation-dependent adhesion of human platelets to Cyr61 and Fisp12/mouse connective tissue growth factor is mediated through integrin alpha(IIb)beta(3). J Biol Chem, 274, 24321-7.
14. Grzeszkiewicz, T.M., Kirschling, D.J., Chen, N. and Lau, L.F. (2001) CYR61 stimulates human skin fibroblast migration through Integrin alpha vbeta 5 and enhances mitogenesis through integrin alpha vbeta 3, independent of its carboxyl- terminal domain. J Biol Chem, 276, 21943-50.
15. Chen, N., Chen, C.C. and Lau, L.F. (2000) Adhesion of human skin fibroblasts to Cyr61 is mediated through integrin alpha 6beta 1 and cell surface heparan sulfate proteoglycans. J Biol Chem, 275, 24953-61.
16. Kireeva, M.L., Latinkic, B.V., Kolesnikova, T.V., Chen, C.C., Yang, G.P., Abler, A.S. and Lau, L.F. (1997) Cyr61 and Fisp12 are both ECM-associated signaling molecules: activities, metabolism, and localization during development. Exp Cell Res, 233, 63-77.
17. Babic, A.M., Kireeva, M.L., Kolesnikova, T.V. and Lau, L.F. (1998) CYR61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth. Proc Natl Acad Sci U S A, 95, 6355-60.
18. O'Brien, T.P. and Lau, L.F. (1992) Expression of the growth factor-inducible immediate early gene cyr61 correlates with chondrogenesis during mouse embryonic development. Cell Growth Differ, 3, 645-54.
19. Joliot, V., Martinerie, C., Dambrine, G., Plassiart, G., Brisac, M., Crochet, J. and Perbal, B. (1992) Proviral rearrangements and overexpression of a new cellular gene (nov) in myeloblastosis-associated virus type 1-induced nephroblastomas. Mol Cell Biol, 12, 10-21.
160
20. Martinerie, C., Huff, V., Joubert, I., Badzioch, M., Saunders, G., Strong, L. and Perbal, B. (1994) Structural analysis of the human nov proto-oncogene and expression in Wilms tumor. Oncogene, 9, 2729-32.
21. Brigstock, D.R. (1999) The connective tissue growth factor/cysteine-rich 61/nephroblastoma overexpressed (CCN) family. Endocr Rev, 20, 189-206.
22. Lin, C.G., Leu, S.J., Chen, N., Tebeau, C.M., Lin, S.X., Yeung, C.Y. and Lau, L.F. (2003) CCN3 (NOV) is a novel angiogenic regulator of the CCN protein family. J Biol Chem, 278, 24200-8.
23. Hashimoto, Y., Shindo-Okada, N., Tani, M., Takeuchi, K., Toma, H. and Yokota, J. (1996) Identification of genes differentially expressed in association with metastatic potential of K-1735 murine melanoma by messenger RNA differential display. Cancer Res, 56, 5266-71.
24. Pennica, D., Swanson, T.A., Welsh, J.W., Roy, M.A., Lawrence, D.A., Lee, J., Brush, J., Taneyhill, L.A., Deuel, B., Lew, M., Watanabe, C., Cohen, R.L., Melhem, M.F., Finley, G.G., Quirke, P., Goddard, A.D., Hillan, K.J., Gurney, A.L., Botstein, D. and Levine, A.J. (1998) WISP genes are members of the connective tissue growth factor family that are up-regulated in wnt-1-transformed cells and aberrantly expressed in human colon tumors. Proc Natl Acad Sci U S A, 95, 14717-22.
25. Hashimoto, Y., Shindo-Okada, N., Tani, M., Nagamachi, Y., Takeuchi, K., Shiroishi, T., Toma, H. and Yokota, J. (1998) Expression of the Elm1 gene, a novel gene of the CCN (connective tissue growth factor, Cyr61/Cef10, and neuroblastoma overexpressed gene) family, suppresses In vivo tumor growth and metastasis of K-1735 murine melanoma cells. J Exp Med, 187, 289-96.
26. Zhang, R., Averboukh, L., Zhu, W., Zhang, H., Jo, H., Dempsey, P.J., Coffey, R.J., Pardee, A.B. and Liang, P. (1998) Identification of rCop-1, a new member of the CCN protein family, as a negative regulator for cell transformation. Mol Cell Biol, 18, 6131-41.
27. Delmolino, L.M., Stearns, N.A. and Castellot, J.J., Jr. (2001) COP-1, a member of the CCN family, is a heparin-induced growth arrest specific gene in vascular smooth muscle cells. J Cell Physiol, 188, 45-55.
28. Mason, E.D., Konrad, K.D., Webb, C.D. and Marsh, J.L. (1994) Dorsal midline fate in Drosophila embryos requires twisted gastrulation, a gene encoding a secreted protein related to human connective tissue growth factor. Genes Dev, 8, 1489-501.
161 29. Francois, V., Solloway, M., O'Neill, J.W., Emery, J. and Bier, E. (1994) Dorsal- ventral patterning of the Drosophila embryo depends on a putative negative growth factor encoded by the short gastrulation gene. Genes Dev, 8, 2602-16.
30. Kim, H.S., Nagalla, S.R., Oh, Y., Wilson, E., Roberts, C.T., Jr. and Rosenfeld, R.G. (1997) Identification of a family of low-affinity insulin-like growth factor binding proteins (IGFBPs): characterization of connective tissue growth factor as a member of the IGFBP superfamily. Proc Natl Acad Sci U S A, 94, 12981-6.
31. Burren, C.P., Wilson, E.M., Hwa, V., Oh, Y. and Rosenfeld, R.G. (1999) Binding properties and distribution of insulin-like growth factor binding protein-related protein 3 (IGFBP-rP3/NovH), an additional member of the IGFBP Superfamily. J Clin Endocrinol Metab, 84, 1096-103.
32. Kleer, C.G., Zhang, Y., Pan, Q., Wu, Z.F. and Merajver, S.D. (2003) WISP3, A tumor suppressor gene of inflammatory breast cancer binds to IGF-I and may modulate IGF signalling. Mol Pathol, 56, 68.
33. Chevalier, G., Yeger, H., Martinerie, C., Laurent, M., Alami, J., Schofield, P.N. and Perbal, B. (1998) novH: differential expression in developing kidney and Wilm's tumors. Am J Pathol, 152, 1563-75.
34. Grotendorst, G.R., Lau, L.F. and Perbal, B. (2000) CCN proteins are distinct from and should not be considered members of the insulin-like growth factor-binding protein superfamily. Endocrinology, 141, 2254-6.
35. Kleer, C.G., Zhang, Y., Pan, Q., van Golen, K.L., Wu, Z.F., Livant, D. and Merajver, S.D. (2002) WISP3 is a novel tumor suppressor gene of inflammatory breast cancer. Oncogene, 21, 3172-80.
36. Planque, N. and Perbal, B. (2003) A structural approach to the role of CCN (CYR61/CTGF/NOV) proteins in tumourigenesis. Cancer Cell Int, 3, 15.
37. Holt, G.D., Pangburn, M.K. and Ginsburg, V. (1990) Properdin binds to sulfatide [Gal(3-SO4)beta 1-1 Cer] and has a sequence homology with other proteins that bind sulfated glycoconjugates. J Biol Chem, 265, 2852-5.
38. Leu, S.J., Liu, Y., Chen, N., Chen, C.C., Lam, S.C. and Lau, L.F. (2003) Identification of a novel integrin alpha 6 beta 1 binding site in the angiogenic inducer CCN1 (CYR61). J Biol Chem, 278, 33801-8.
39. Gao, R. and Brigstock, D. (in press - 2003) Low density lipoprotein receptor- related protein (LRP) is a heparin-dependent adhesion receptor for connective tissue growth factor (CTGF) in rat activated stellate cells. Hepatol Res.
162 40. Ball, D.K., Surveyor, G.A., Diehl, J.R., Steffen, C.L., Uzumcu, M., Mirando, M.A. and Brigstock, D.R. (1998) Characterization of 16- to 20-kilodalton (kDa) connective tissue growth factors (CTGFs) and demonstration of proteolytic activity for 38-kDa CTGF in pig uterine luminal flushings [published erratum appears in Biol Reprod 1998 Dec;59(6):1554]. Biol Reprod, 59, 828-35.
41. Brigstock, D.R. (1999) Purification and characterization of connective tissue growth factor (CTGF) using heparin-affinity chromatography. In Aboul-Enein, H.Y. (ed.), Analytical and Preparitive Separation Methods of Biomacromolecules. Marcel Dekker Inc., New York, pp. 397-414.
42. Brigstock, D.R., Steffen, C.L., Kim, G.Y., Vegunta, R.K., Diehl, J.R. and Harding, P.A. (1997) Purification and characterization of novel heparin-binding growth factors in uterine secretory fluids. Identification as heparin- regulated Mr 10,000 forms of connective tissue growth factor. J Biol Chem, 272, 20275-82.
43. Surveyor, G.A., Wilson, A.K. and Brigstock, D.R. (1998) Localization of connective tissue growth factor during the period of embryo implantation in the mouse. Biol Reprod, 59, 1207-13.
44. Ball, D.K., Rachfal, A.W., Kemper, S.A. and Brigstock, D.R. (2003) The heparin- binding 10 kDa fragment of connective tissue growth factor (CTGF) containing module 4 alone stimulates cell adhesion. J Endocrinol, 176, R1-7.
45. Schober, J.M., Lau, L.F., Ugarova, T.P. and Lam, S.C. (2003) Identification of a novel integrin alpha Mbeta 2 binding site in CCN1 (CYR61), a matricellular protein expressed in healing wounds and atherosclerotic lesions. J Biol Chem.
46. Brigstock, D.R., Kim, G.Y., Vegunta, R.K. and Steffen, C.L. (1996) Biological characterization of a new heparin-binding growth factor in pig uterine luminal flushings. Biol Reprod, 5, A523.
47. Frazier, K., Williams, S., Kothapalli, D., Klapper, H. and Grotendorst, G.R. (1996) Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J Invest Dermatol, 107, 404- 11.
48. Chen, C.C., Chen, N. and Lau, L.F. (2001) The Angiogenic Factors Cyr61 and Connective Tissue Growth Factor Induce Adhesive Signaling in Primary Human Skin Fibroblasts. J Biol Chem, 276, 10443-10452.
49. Ball, D.K., Moussad, E.E., Rageh, M.A., Kemper, S.A. and Brigstock, D.R. (2003) Establishment of a recombinant expression system for connective tissue growth factor (CTGF) that models CTGF processing in utero. Reproduction, 125, 271-84.
163
50. Grzeszkiewicz, T.M., Lindner, V., Chen, N., Lam, S.C. and Lau, L.F. (2002) The angiogenic factor cysteine-rich 61 (CYR61, CCN1) supports vascular smooth muscle cell adhesion and stimulates chemotaxis through integrin alpha(6)beta(1) and cell surface heparan sulfate proteoglycans. Endocrinology, 143, 1441-50.
51. Li, C.L., Martinez, V., He, B., Lombet, A. and Perbal, B. (2002) A role for CCN3 (NOV) in calcium signalling. Mol Pathol, 55, 250-261.
52. Safadi, F.F., Xu, J., Smock, S.L., Kanaan, R.A., Selim, A.H., Odgren, P.R., Marks, S.C., Jr., Owen, T.A. and Popoff, S.N. (2003) Expression of connective tissue growth factor in bone: Its role in osteoblast proliferation and differentiation in vitro and bone formation in vivo. J Cell Physiol, 196, 51-62.
53. Fan, W.H. and Karnovsky, M.J. (2002) Increased MMP-2 expression in connective tissue growth factor over- expression vascular smooth muscle cells. J Biol Chem, 277, 9800-5.
54. Ihn, H. (2002) Pathogenesis of fibrosis: role of TGF-beta and CTGF. Curr Opin Rheumatol, 14, 681-5.
55. Oemar, B.S. and Luscher, T.F. (1997) Connective tissue growth factor. Friend or foe? Arterioscler Thromb Vasc Biol, 17, 1483-9.
56. Sawai, K., Mori, K., Mukoyama, M., Sugawara, A., Suganami, T., Koshikawa, M., Yahata, K., Makino, H., Nagae, T., Fujinaga, Y., Yokoi, H., Yoshioka, T., Yoshimoto, A., Tanaka, I. and Nakao, K. (2003) Angiogenic protein Cyr61 is expressed by podocytes in anti-Thy-1 glomerulonephritis. J Am Soc Nephrol, 14, 1154-63.
57. Lafont, J., Laurent, M., Thibout, H., Lallemand, F., Le Bouc, Y., Atfi, A. and Martinerie, C. (2002) The Expression of novH in Adrenocortical Cells Is Down- regulated by TGFbeta 1 through c-Jun in a Smad-independent Manner. J Biol Chem, 277, 41220-9.
58. Igarashi, A., Okochi, H., Bradham, D.M. and Grotendorst, G.R. (1993) Regulation of connective tissue growth factor gene expression in human skin fibroblasts and during wound repair. Mol Biol Cell, 4, 637-45.
59. Grotendorst, G.R., Okochi, H. and Hayashi, N. (1996) A novel transforming growth factor beta response element controls the expression of the connective tissue growth factor gene. Cell Growth Differ, 7, 469-80.
164 60. Holmes, A., Abraham, D.J., Sa, S., Shiwen, X., Black, C.M. and Leask, A. (2001) CTGF and SMADs, maintenance of scleroderma phenotype is independent of SMAD signaling. J Biol Chem, 276, 10594-601.
61. Leask, A., Sa, S., Holmes, A., Shiwen, X., Black, C.M. and Abraham, D.J. (2001) The control of ccn2 (ctgf) gene expression in normal and scleroderma fibroblasts. Mol Pathol, 54, 180-3.
62. Leask, A., Holmes, A., Black, C.M. and Abraham, D.J. (2003) CTGF gene regulation: Requirements for its induction by TGFbeta 2 in fibroblasts. J Biol Chem, 5, 5.
63. Leask, A., Holmes, A. and Abraham, D.J. (2002) Connective tissue growth factor: a new and important player in the pathogenesis of fibrosis. Curr Rheumatol Rep, 4, 136-42.
64. Duncan, M.R., Frazier, K.S., Abramson, S., Williams, S., Klapper, H., Huang, X. and Grotendorst, G.R. (1999) Connective tissue growth factor mediates transforming growth factor beta-induced collagen synthesis: down-regulation by cAMP. Faseb J, 13, 1774-86.
65. Kothapalli, D., Frazier, K.S., Welply, A., Segarini, P.R. and Grotendorst, G.R. (1997) Transforming growth factor beta induces anchorage-independent growth of NRK fibroblasts via a connective tissue growth factor-dependent signaling pathway. Cell Growth Differ, 8, 61-8.
66. Shinozaki, M., Kawara, S., Hayashi, N., Kakinuma, T., Igarashi, A. and Takehara, K. (1997) Induction of subcutaneous tissue fibrosis in newborn mice by transforming growth factor beta--simultaneous application with basic fibroblast growth factor causes persistent fibrosis [corrected and republished article originally printed in Biochem Biophys Res Commun 1997 Aug 18;237(2):292-6]. Biochem Biophys Res Commun, 240, 292-7.
67. Mori, T., Kawara, S., Shinozaki, M., Hayashi, N., Kakinuma, T., Igarashi, A., Takigawa, M., Nakanishi, T. and Takehara, K. (1999) Role and interaction of connective tissue growth factor with transforming growth factor-beta in persistent fibrosis: A mouse fibrosis model. J Cell Physiol, 181, 153-9.
68. Edwards, D.R., Murphy, G., Reynolds, J.J., Whitham, S.E., Docherty, A.J., Angel, P. and Heath, J.K. (1987) Transforming growth factor beta modulates the expression of collagenase and metalloproteinase inhibitor. Embo J, 6, 1899-904.
69. Kerr, L.D., Miller, D.B. and Matrisian, L.M. (1990) TGF-beta 1 inhibition of transin/stromelysin gene expression is mediated through a Fos binding sequence. Cell, 61, 267-78.
165
70. Dammeier, J., Beer, H.D., Brauchle, M. and Werner, S. (1998) Dexamethasone is a novel potent inducer of connective tissue growth factor expression. Implications for glucocorticoid therapy. J Biol Chem, 273, 18185-90.
71. Querfeld, C., Sollberg, S., Huerkamp, C., Eckes, B. and Krieg, T. (2000) Pseudoscleroderma associated with lung cancer: correlation of collagen type I and connective tissue growth factor gene expression. Br J Dermatol, 142, 1228-33.
72. Hong, H.H., Uzel, M.I., Duan, C., Sheff, M.C. and Trackman, P.C. (1999) Regulation of lysyl oxidase, collagen, and connective tissue growth factor by TGF-beta1 and detection in human gingiva. Lab Invest, 79, 1655-67.
73. Riser, B.L., Denichilo, M., Cortes, P., Baker, C., Grondin, J.M., Yee, J. and Narins, R.G. (2000) Regulation of connective tissue growth factor activity in cultured rat mesangial cells and its expression in experimental diabetic glomerulosclerosis. J Am Soc Nephrol, 11, 25-38.
74. Murphy, M., Godson, C., Cannon, S., Kato, S., Mackenzie, H.S., Martin, F. and Brady, H.R. (1999) Suppression subtractive hybridization identifies high glucose levels as a stimulus for expression of connective tissue growth factor and other genes in human mesangial cells. J Biol Chem, 274, 5830-4.
75. Ogawa, E., Elliott, W.M., Hughes, F., Eichholtz, T.J., Hogg, J.C. and Hayashi, S. (2003) Latent adenoviral infection induces the production of growth factors relevant to airway remodeling in COPD. Am J Physiol Lung Cell Mol Physiol.
76. Nakanishi, T., Kimura, Y., Tamura, T., Ichikawa, H., Yamaai, Y., Sugimoto, T. and Takigawa, M. (1997) Cloning of a mRNA preferentially expressed in chondrocytes by differential display-PCR from a human chondrocytic cell line that is identical with connective tissue growth factor (CTGF) mRNA. Biochem Biophys Res Commun, 234, 206-10.
77. Paradis, V., Dargere, D., Bonvoust, F., Vidaud, M., Segarini, P. and Bedossa, P. (2002) Effects and regulation of connective tissue growth factor on hepatic stellate cells. Lab Invest, 82, 767-74.
78. Wenger, C., Ellenrieder, V., Alber, B., Lacher, U., Menke, A., Hameister, H., Wilda, M., Iwamura, T., Beger, H.G., Adler, G. and Gress, T.M. (1999) Expression and differential regulation of connective tissue growth factor in pancreatic cancer cells. Oncogene, 18, 1073-80.
79. Camerer, E., Gjernes, E., Wiiger, M., Pringle, S. and Prydz, H. (2000) Binding of factor VIIa to tissue factor on keratinocytes induces gene expression. J Biol Chem, 275, 6580-5.
166
80. Pendurthi, U.R., Allen, K.E., Ezban, M. and Rao, L.V. (2000) Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem, 275, 14632-41.
81. Chambers, R.C., Leoni, P., Blanc-Brude, O.P., Wembridge, D.E. and Laurent, G.J. (2000) Thrombin is a potent inducer of connective tissue growth factor production via proteolytic activation of protease-activated receptor-1. J Biol Chem, 275, 35584-91.
82. Wang, J.F., Olson, M.E., Ball, D.K., Brigstock, D.R. and Hart, D.A. (2003) Recombinant connective tissue growth factor modulates porcine skin fibroblast gene expression. Wound Repair Regen, 11, 220-9.
83. Moussad, E.E. and Brigstock, D.R. (2000) Connective tissue growth factor: what's in a name? Mol Genet Metab, 71, 276-92.
84. Surveyor, G.A. and Brigstock, D.R. (1999) Immunohistochemical localization of connective tissue growth factor (CTGF) in the mouse embryo between days 7.5 and 14.5 of gestation. Growth Factors, 17, 115-24.
85. Shimo, T., Nakanishi, T., Kimura, Y., Nishida, T., Ishizeki, K., Matsumura, T. and Takigawa, M. (1998) Inhibition of endogenous expression of connective tissue growth factor by its antisense oligonucleotide and antisense RNA suppresses proliferation and migration of vascular endothelial cells. J Biochem (Tokyo), 124, 130-40.
86. Uzumcu, M., Homsi, M.F., Ball, D.K., Coskun, S., Jaroudi, K., Hollanders, J.M. and Brigstock, D.R. (2000) Localization of connective tissue growth factor in human uterine tissues. Mol Hum Reprod, 6, 1093-8.
87. Moussad, E.E., Rageh, M.A., Wilson, A.K., Geisert, R.D. and Brigstock, D.R. (2002) Temporal and spatial expression of connective tissue growth factor (CCN2; CTGF) and transforming growth factor beta type 1 (TGF-beta1) at the utero-placental interface during early pregnancy in the pig. Mol Pathol, 55, 186- 92.
88. Latinkic, B.V., Mo, F.E., Greenspan, J.A., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., Ross, S.R. and Lau, L.F. (2001) Promoter function of the angiogenic inducer Cyr61gene in transgenic mice: tissue specificity, inducibility during wound healing, and role of the serum response element. Endocrinology, 142, 2549-57.
167 89. Wandji, S.A., Gadsby, J.E., Barber, J.A. and Hammond, J.M. (2000) Messenger ribonucleic acids for MAC25 and connective tissue growth factor (CTGF) are inversely regulated during folliculogenesis and early luteogenesis. Endocrinology, 141, 2648-57.
90. Harlow, C.R. and Hillier, S.G. (2002) Connective tissue growth factor in the ovarian paracrine system. Mol Cell Endocrinol, 187, 23-7.
91. Nakata, E., Nakanishi, T., Kawai, A., Asaumi, K., Yamaai, T., Asano, M., Nishida, T., Mitani, S., Inoue, H. and Takigawa, M. (2002) Expression of connective tissue growth factor/hypertrophic chondrocyte- specific gene product 24 (CTGF/Hcs24) during fracture healing. Bone, 31, 441-7.
92. Takigawa, M. (2003) CTGF/Hcs24 as a multifunctional growth factor for fibroblasts, chondrocytes and vascular endothelial cells. Drug News Perspect, 16, 11-21.
93. Nishida, T., Kubota, S., Nakanishi, T., Kuboki, T., Yosimichi, G., Kondo, S. and Takigawa, M. (2002) CTGF/Hcs24, a hypertrophic chondrocyte-specific gene product, stimulates proliferation and differentiation, but not hypertrophy of cultured articular chondrocytes. J Cell Physiol, 192, 55-63.
94. Ivkovic, S., Yoon, B.S., Popoff, S.N., Safadi, F.F., Libuda, D.E., Stephenson, R.C., Daluiski, A. and Lyons, K.M. (2003) Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development. Development, 130, 2779-2791.
95. Cash, D.E., Gates, P.B., Imokawa, Y. and Brockes, J.P. (1998) Identification of newt connective tissue growth factor as a target of retinoid regulation in limb blastemal cells. Gene, 222, 119-24.
96. Moussad, E.E., Rageh, M., Tassava, R., Brigstock, D.R. (2001) Localization of connective tissue growth factor in normal regenerating and denervated non- regenerating scarring limb stumps of adult newts. Mol Pathol, 54, 111.
97. Chen, C.C., Mo, F.E. and Lau, L.F. (2001) The angiogenic factor Cyr61 activates a genetic program for wound healing in human skin fibroblasts. J Biol Chem, 276, 47329-37.
98. Nishida, T., Nakanishi, T., Asano, M., Shimo, T. and Takigawa, M. (2000) Effects of CTGF/Hcs24, a hypertrophic chondrocyte-specific gene product, on the proliferation and differentiation of osteoblastic cells in vitro. J Cell Physiol, 184, 197-206.
168 99. Wang, J.F., Olson, M.E., Reno, C.R., Kulyk, W., Wright, J.B. and Hart, D.A. (2000) Molecular and cell biology of skin wound healing in a pig model. Connect Tissue Res, 41, 195-211.
100. Wang, J.F., Olson, M.E., Reno, C.R., Wright, J.B. and Hart, D.A. (2001) The pig as a model for excisional skin wound healing: Characterization of the molecular and cellular biology, and bacteriology of the healing process. Comp Med, 51, 341- 349.
101. Frank, S., Madlener, M. and Werner, S. (1996) Transforming growth factors beta1, beta2, and beta3 and their receptors are differentially regulated during normal and impaired wound healing. J Biol Chem, 271, 10188-93.
102. Pawar, S., Kartha, S. and Toback, F.G. (1995) Differential gene expression in migrating renal epithelial cells after wounding. J Cell Physiol, 165, 556-65.
103. Hishikawa, K., Oemar, B.S., Tanner, F.C., Nakaki, T., Fujii, T. and Luscher, T.F. (1999) Overexpression of connective tissue growth factor gene induces apoptosis in human aortic smooth muscle cells. Circulation, 100, 2108-12.
104. Hishikawa, K., Nakaki, T. and Fujii, T. (2000) Connective tissue growth factor induces apoptosis via caspase 3 in cultured human aortic smooth muscle cells. Eur J Pharmacol, 392, 19-22.
105. Hishikawa, K., Oemar, B.S., Tanner, F.C., Nakaki, T., Luscher, T.F. and Fujii, T. (1999) Connective tissue growth factor induces apoptosis in human breast cancer cell line MCF-7. J Biol Chem, 274, 37461-6.
106. Babic, A.M., Chen, C.C. and Lau, L.F. (1999) Fisp12/mouse connective tissue growth factor mediates endothelial cell adhesion and migration through integrin alphavbeta3, promotes endothelial cell survival, and induces angiogenesis in vivo. Mol Cell Biol, 19, 2958-66.
107. Lin, C., Leu, S.J., Chen, N., Tebeau, C.M., Lin, S.X., Yeung, C.Y. and Lau, L.F. (2003) CCN3 (NOV) is a novel angiogenic regulator of the CCN protein family. J Biol Chem.
108. Brigstock, D.R. (2002) Regulation of angiogenesis and endothelial cell function by connective tissue growth factor (CTGF) and cysteine-rich 61 (CYR61). Angiogenesis, 5, 153-165.
109. Shimo, T., Nakanishi, T., Nishida, T., Asano, M., Kanyama, M., Kuboki, T., Tamatani, T., Tezuka, K., Takemura, M., Matsumura, T. and Takigawa, M. (1999) Connective tissue growth factor induces the proliferation, migration, and
169 tube formation of vascular endothelial cells in vitro, and angiogenesis in vivo. J Biochem (Tokyo), 126, 137-45.
110. Tsai, M.S., Hornby, A.E., Lakins, J. and Lupu, R. (2000) Expression and function of CYR61, an angiogenic factor, in breast cancer cell lines and tumor biopsies. Cancer Res, 60, 5603-7.
111. Inoki, I., Shiomi, T., Hashimoto, G., Enomoto, H., Nakamura, H., Makino, K., Ikeda, E., Takata, S., Kobayashi, K. and Okada, Y. (2002) Connective tissue growth factor binds vascular endothelial growth factor (VEGF) and inhibits VEGF-induced angiogenesis. Faseb J, 16, 219-21.
112. Hashimoto, G., Inoki, I., Fujii, Y., Aoki, T., Ikeda, E. and Okada, Y. (2002) Matrix metalloproteinases cleave connective tissue growth factor and reactivate angiogenic activity of vascular endothelial growth factor 165. J Biol Chem, 277, 36288-95.
113. Igarashi, A., Hayashi, N., Nashiro, K. and Takehara, K. (1998) Differential expression of connective tissue growth factor gene in cutaneous fibrohistiocytic and vascular tumors. J Cutan Pathol, 25, 143-8.
114. Frazier, K.S. and Grotendorst, G.R. (1997) Expression of connective tissue growth factor mRNA in the fibrous stroma of mammary tumors. Int J Biochem Cell Biol, 29, 153-61.
115. Kasaragod, A.B., Lucia, M.S., Cabirac, G., Grotendorst, G.R. and Stenmark, K.R. (2001) Connective Tissue Growth Factor Expression in Pediatric Myofibroblastic Tumors. Pediatr Dev Pathol, 3, 37-45.
116. Pan, L.H., Beppu, T., Kurose, A., Yamauchi, K., Sugawara, A., Suzuki, M., Ogawa, A. and Sawai, T. (2002) Neoplastic cells and proliferating endothelial cells express connective tissue growth factor (CTGF) in glioblastoma. Neurol Res, 24, 677-83.
117. Perbal, B. (2001) NOV (nephroblastoma overexpressed) and the CCN family of genes: structural and functional issues. Mol Pathol, 54, 57-79.
118. Pilarsky, C.P., Schmidt, U., Eissrich, C., Stade, J., Froschermaier, S.E., Haase, M., Faller, G., Kirchner, T.W. and Wirth, M.P. (1998) Expression of the extracellular matrix signaling molecule Cyr61 is downregulated in prostate cancer. Prostate, 36, 85-91.
119. Sampath, D., Winneker, R.C. and Zhang, Z. (2001) Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology, 142, 2540-8.
170
120. Genini, M., Schwalbe, P., Scholl, F.A. and Schafer, B.W. (1996) Isolation of genes differentially expressed in human primary myoblasts and embryonal rhabdomyosarcoma. Int J Cancer, 66, 571-7.
121. Tong, X., Xie, D., O'Kelly, J., Miller, C.W., Muller-Tidow, C. and Koeffler, H.P. (2001) Cyr61, a member of CCN family, is a tumor suppressor in non-small cell lung cancer. J Biol Chem, 276, 47709-14.
122. Maillard, M., Cadot, B., Ball, R.Y., Sethia, K., Edwards, D.R., Perbal, B. and Tatoud, R. (2001) Differential expression of the ccn3 (nov) proto-oncogene in human prostate cell lines and tissues. Mol Pathol, 54, 275-80.
123. Glukhova, L., Angevin, E., Lavialle, C., Cadot, B., Terrier-Lacombe, M.J., Perbal, B., Bernheim, A. and Goguel, A.F. (2001) Patterns of specific genomic alterations associated with poor prognosis in high-grade renal cell carcinomas. Cancer Genet Cytogenet, 130, 105-10.
124. Manara, M.C., Perbal, B., Benini, S., Strammiello, R., Cerisano, V., Perdichizzi, S., Serra, M., Astolfi, A., Bertoni, F., Alami, J., Yeger, H., Picci, P. and Scotlandi, K. (2002) The expression of ccn3(nov) gene in musculoskeletal tumors. Am J Pathol, 160, 849-59.
125. Perbal, B., Brigstock, D.R. and Lau, L.F. (2003) Report on the second international workshop on the CCN family of genes. Mol Pathol, 56, 80-85.
126. Igarashi, A., Nashiro, K., Kikuchi, K., Sato, S., Ihn, H., Fujimoto, M., Grotendorst, G.R. and Takehara, K. (1996) Connective tissue growth factor gene expression in tissue sections from localized scleroderma, keloid, and other fibrotic skin disorders. J Invest Dermatol, 106, 729-33.
127. Igarashi, A., Nashiro, K., Kikuchi, K., Sato, S., Ihn, H., Grotendorst, G.R. and Takehara, K. (1995) Significant correlation between connective tissue growth factor gene expression and skin sclerosis in tissue sections from patients with systemic sclerosis. J Invest Dermatol, 105, 280-4.
128. Sato, S., Nagaoka, T., Hasegawa, M., Tamatani, T., Nakanishi, T., Takigawa, M. and Takehara, K. (2000) Serum levels of connective tissue growth factor are elevated in patients with systemic sclerosis: association with extent of skin sclerosis and severity of pulmonary fibrosis. J Rheumatol, 27, 149-54.
129. Denton, C.P. and Abraham, D.J. (2001) Transforming growth factor-beta and connective tissue growth factor: key cytokines in scleroderma pathogenesis. Curr Opin Rheumatol, 13, 505-11.
171 130. Oemar, B.S., Werner, A., Garnier, J.M., Do, D.D., Godoy, N., Nauck, M., Marz, W., Rupp, J., Pech, M. and Luscher, T.F. (1997) Human connective tissue growth factor is expressed in advanced atherosclerotic lesions. Circulation, 95, 831-9.
131. Yokoi, H., Sugawara, A., Mukoyama, M., Mori, K., Makino, H., Suganami, T., Nagae, T., Yahata, K., Fujinaga, Y., Tanaka, I. and Nakao, K. (2001) Role of connective tissue growth factor in profibrotic action of transforming growth factor-beta: a potential target for preventing renal fibrosis. Am J Kidney Dis, 38, S134-8.
132. Yokoi, H., Mukoyama, M., Sugawara, A., Mori, K., Nagae, T., Makino, H., Suganami, T., Yahata, K., Fujinaga, Y., Tanaka, I. and Nakao, K. (2002) Role of connective tissue growth factor in fibronectin expression and tubulointerstitial fibrosis. Am J Physiol Renal Physiol, 282, F933-42.
133. Riser, B.L. and Cortes, P. (2001) Connective tissue growth factor and its regulation: a new element in diabetic glomerulosclerosis. Ren Fail, 23, 459-70.
134. Wang, S., Denichilo, M., Brubaker, C. and Hirschberg, R. (2001) Connective tissue growth factor in tubulointerstitial injury of diabetic nephropathy. Kidney Int, 60, 96-105.
135. Goldschmeding, R., Aten, J., Ito, Y., Blom, I., Rabelink, T. and Weening, J.J. (2000) Connective tissue growth factor: just another factor in renal fibrosis? Nephrol Dial Transplant, 15, 296-9.
136. Clarkson, M.R., Gupta, S., Murphy, M., Martin, F., Godson, C. and Brady, H.R. (1999) Connective tissue growth factor: a potential stimulus for glomerulosclerosis and tubulointerstitial fibrosis in progressive renal disease [editorial]. Curr Opin Nephrol Hypertens, 8, 543-8.
137. Ito, Y., Aten, J., Bende, R.J., Oemar, B.S., Rabelink, T.J., Weening, J.J. and Goldschmeding, R. (1998) Expression of connective tissue growth factor in human renal fibrosis. Kidney Int, 53, 853-61.
138. Lasky, J.A., Ortiz, L.A., Tonthat, B., Hoyle, G.W., Corti, M., Athas, G., Lungarella, G., Brody, A. and Friedman, M. (1998) Connective tissue growth factor mRNA expression is upregulated in bleomycin-induced lung fibrosis. Am J Physiol, 275, L365-71.
139. Pan, L.H., Yamauchi, K., Uzuki, M., Nakanishi, T., Takigawa, M., Inoue, H. and Sawai, T. (2001) Type II alveolar epithelial cells and interstitial fibroblasts express connective tissue growth factor in IPF. Eur Respir J, 17, 1220-7.
172 140. Allen, J.T., Knight, R.A., Bloor, C.A. and Spiteri, M.A. (1999) Enhanced insulin- like growth factor binding protein-related protein 2 (Connective tissue growth factor) expression in patients with idiopathic pulmonary fibrosis and pulmonary sarcoidosis. Am J Respir Cell Mol Biol, 21, 693-700.
141. Ohnishi, H., Oka, T., Kusachi, S., Nakanishi, T., Takeda, K., Nakahama, M., Doi, M., Murakami, T., Ninomiya, Y., Takigawa, M. and Tsuji, T. (1998) Increased expression of connective tissue growth factor in the infarct zone of experimentally induced myocardial infarction in rats. J Mol Cell Cardiol, 30, 2411-22.
142. di Mola, F.F., Friess, H., Martignoni, M.E., Di Sebastiano, P., Zimmermann, A., Innocenti, P., Graber, H., Gold, L.I., Korc, M. and Buchler, M.W. (1999) Connective tissue growth factor is a regulator for fibrosis in human chronic pancreatitis. Ann Surg, 230, 63-71.
143. di Mola, F.F., Friess, H., Riesle, E., Koliopanos, A., Buchler, P., Zhu, Z., Brigstock, D.R., Korc, M. and Buchler, M.W. (2002) Connective tissue growth factor is involved in pancreatic repair and tissue remodeling in human and rat acute necrotizing pancreatitis. Ann Surg, 235, 60-7.
144. Dammeier, J., Brauchle, M., Falk, W., Grotendorst, G.R. and Werner, S. (1998) Connective tissue growth factor: a novel regulator of mucosal repair and fibrosis in inflammatory bowel disease? Int J Biochem Cell Biol, 30, 909-22.
145. Wunderlich, K., Pech, M., Eberle, A.N., Mihatsch, M., Flammer, J. and Meyer, P. (2000) Expression of connective tissue growth factor (CTGF) mRNA in plaques of human anterior subcapsular cataracts and membranes of posterior capsule opacification. Curr Eye Res, 21, 627-36.
146. Wunderlich, K., Senn, B.C., Reiser, P., Pech, M., Flammer, J. and Meyer, P. (2000) Connective tissue growth factor in retrocorneal membranes and corneal scars. Ophthalmologica, 214, 341-6.
147. Lee, E.H. and Joo, C.K. (1999) Role of transforming growth factor-beta in transdifferentiation and fibrosis of lens epithelial cells. Invest Ophthalmol Vis Sci, 40, 2025-32.
148. Folger, P.A., Zekaria, D., Grotendorst, G. and Masur, S.K. (2001) Transforming growth factor-beta-stimulated connective tissue growth factor expression during corneal myofibroblast differentiation. Invest Ophthalmol Vis Sci, 42, 2534-41.
149. Uzel, M.I., Kantarci, A., Hong, H.H., Uygur, C., Sheff, M.C., Firatli, E. and Trackman, P.C. (2001) Connective tissue growth factor in drug-induced gingival overgrowth. J Periodontol, 72, 921-31.
173 150. Hayashi, N., Kakimuma, T., Soma, Y., Grotendorst, G.R., Tamaki, K., Harada, M. and Igarashi, A. (2002) Connective tissue growth factor is directly related to liver fibrosis. Hepatogastroenterology, 49, 133-5.
151. Sedlaczek, N., Jia, J.D., Bauer, M., Herbst, H., Ruehl, M., Hahn, E.G. and Schuppan, D. (2001) Proliferating bile duct epithelial cells are a major source of connective tissue growth factor in rat biliary fibrosis. Am J Pathol, 158, 1239-44.
152. Abou-Shady, M., Friess, H., Zimmermann, A., di Mola, F.F., Guo, X.Z., Baer, H.U. and Buchler, M.W. (2000) Connective tissue growth factor in human liver cirrhosis. Liver, 20, 296-304.
153. Williams, E.J., Gaca, M.D., Brigstock, D.R., Arthur, M.J. and Benyon, R.C. (2000) Increased expression of connective tissue growth factor in fibrotic human liver and in activated hepatic stellate cells. J Hepatol, 32, 754-61.
154. Paradis, V., Dargere, D., Vidaud, M., De Gouville, A.C., Huet, S., Martinez, V., Gauthier, J.M., Ba, N., Sobesky, R., Ratziu, V. and Bedossa, P. (1999) Expression of connective tissue growth factor in experimental rat and human liver fibrosis. Hepatology, 30, 968-76.
155. Tamatani, T., Kobayashi, H., Tezuka, K., Sakamoto, S., Suzuki, K., Nakanishi, T., Takigawa, M. and Miyano, T. (1998) Establishment of the enzyme-linked immunosorbent assay for connective tissue growth factor (CTGF) and its detection in the sera of biliary atresia. Biochem Biophys Res Commun, 251, 748- 52.
156. Rachfal, A.W. and Brigstock, D.R. (2003) Connective tissue growth factor (CTGF/CCN2) in hepatic fibrosis. Hepatol Res, 26, 1-9.
157. Ito, Y., Kleij, L., Aten, J., Oemar, B.S., Weening, J.J., Rabelink, T. and Goldschmeding, R. (1997) CTGF: expression in the rat Thy 1.1 model and regulation in mesangial cells and podocytes. J Am Soc Nephrol, 8, 517A (Abstract).
158. Shi-wen, X., Abraham, D.J., Pantelides, P., Martin, G.R., du Bois, R.M. and Black, C.M. (1997) Connective tissue growth factor in scleroderma-associated lung. Thorax, 52, S79 (Abstract).
159. Vozenin-Brotons, M.C., Milliat, F., Sabourin, J.C., de Gouville, A.C., Francois, A., Lasser, P., Morice, P., Haie-Meder, C., Lusinchi, A., Antoun, S., Bourhis, J., Mathe, D., Girinsky, T. and Aigueperse, J. (2003) Fibrogenic signals in patients with radiation enteritis are associated with increased connective tissue growth factor expression. Int J Radiat Oncol Biol Phys, 56, 561-72.
174 160. Razzaque, M.S., Foster, C.S. and Ahmed, A.R. (2003) Role of connective tissue growth factor in the pathogenesis of conjunctival scarring in ocular cicatricial pemphigoid. Invest Ophthalmol Vis Sci, 44, 1998-2003.
161. Blalock, T.D., Duncan, M.R., Varela, J.C., Goldstein, M.H., Tuli, S.S., Grotendorst, G.R. and Schultz, G.S. (2003) Connective tissue growth factor expression and action in human corneal fibroblast cultures and rat corneas after photorefractive keratectomy. Invest Ophthalmol Vis Sci, 44, 1879-87.
162. Konishi, M., Kajihara, M., Kato, S., Horie, Y., Aiso, S. and Ishii, H. (2001) Ethanol enhances expression of connective tissue growth factor (CTGF) in HEPG2 cell line stably expressing cytochrome P-4502E1. Hepatology, 34, 377A.
163. Konishi, M., Kato, S., Kajihara, M., Yamagishi, Y., Horie, Y., Aiso, S. and Ishii, H. (2002) Expression of connective tissue growth factor (CTGF) in alcoholic liver fibrosis and in HEPG2 cell line stably expressiong cytochrome P-4502E1. Hepatology, 36, 248A.
164. Bernasconi, P., Torchiana, E., Confalonieri, P., Brugnoni, R., Barresi, R., Mora, M., Cornelio, F., Morandi, L. and Mantegazza, R. (1995) Expression of transforming growth factor-beta 1 in dystrophic patient muscles correlates with fibrosis. Pathogenetic role of a fibrogenic cytokine. J Clin Invest, 96, 1137-44.
165. Yamazaki, M., Minota, S., Sakurai, H., Miyazono, K., Yamada, A., Kanazawa, I. and Kawai, M. (1994) Expression of transforming growth factor-beta 1 and its relation to endomysial fibrosis in progressive muscular dystrophy. Am J Pathol, 144, 221-6.
166. Passerini, L., Bernasconi, P., Baggi, F., Confalonieri, P., Cozzi, F., Cornelio, F. and Mantegazza, R. (2002) Fibrogenic cytokines and extent of fibrosis in muscle of dogs with X-linked golden retriever muscular dystrophy. Neuromuscul Disord, 12, 828-35.
167. Bernasconi, P., Di Blasi, C., Mora, M., Morandi, L., Galbiati, S., Confalonieri, P., Cornelio, F. and Mantegazza, R. (1999) Transforming growth factor-beta1 and fibrosis in congenital muscular dystrophies. Neuromuscul Disord, 9, 28-33.
168. Fukushima, K., Badlani, N., Usas, A., Riano, F., Fu, F. and Huard, J. (2001) The use of an antifibrosis agent to improve muscle recovery after laceration. Am J Sports Med, 29, 394-402.
169. Paradis, V., Perlemuter, G., Bonvoust, F., Dargere, D., Parfait, B., Vidaud, M., Conti, M., Huet, S., Ba, N., Buffet, C. and Bedossa, P. (2001) High glucose and hyperinsulinemia stimulate connective tissue growth factor expression: a potential
175 mechanism involved in progression to fibrosis in nonalcoholic steatohepatitis. Hepatology, 34, 738-44.
170. Tsuneyama, K., Kouda, W. and Nakanuma, Y. (2002) Portal and parenchymal alterations of the liver in idiopathic portal hypertension: a histological and immunochemical study. Pathol Res Pract, 198, 597-603.
171. Nakanishi, T., Yamaai, T., Asano, M., Nawachi, K., Suzuki, M., Sugimoto, T. and Takigawa, M. (2001) Overexpression of connective tissue growth factor/hypertrophic chondrocyte-specific gene product 24 decreases bone density in adult mice and induces dwarfism. Biochem Biophys Res Commun, 281, 678-81.
172. Yoshioka, H., Iyama, K., Inoguchi, K., Khaleduzzaman, M., Ninomiya, Y. and Ramirez, F. (1995) Developmental pattern of expression of the mouse alpha 1 (XI) collagen gene (Col11a1). Dev Dyn, 204, 41-7.
173. Robbins, P.D. and Ghivizzani, S.C. (1998) Viral vectors for gene therapy. Pharmacol Ther, 80, 35-47.
174. During, M.J. (1997) Adeno-associated virus as a gene delivery system. Adv Drug Deliv Rev, 27, 83-94.
175. Monahan, P.E. and Samulski, R.J. (2000) Adeno-associated virus vectors for gene therapy: more pros than cons? Mol Med Today, 6, 433-40.
176. Nakanishi, T., Nishida, T., Shimo, T., Kobayashi, K., Kubo, T., Tamatani, T., Tezuka, K. and Takigawa, M. (2000) Effects of CTGF/Hcs24, a product of a hypertrophic chondrocyte-specific gene, on the proliferation and differentiation of chondrocytes in culture. Endocrinology, 141, 264-73.
177. Haberberger, T.C., Kupfer, K. and Murphy, J.E. (2000) Profiling of genes which are differentially expressed in mouse liver in response to adenoviral vectors and delivered genes. Gene Ther, 7, 903-9.
178. Bonniaud, P., Margetts, P.J., Kolb, M., Haberberger, T., Kelly, M., Robertson, J. and Gauldie, J. (2003) Adenoviral Gene Transfer Of Connective Tissue Growth Factor In The Lung Induces Transient Fibrosis. Am J Respir Crit Care Med.
179. Prince, H.M. (1998) Gene transfer: a review of methods and applications. Pathology (Phila). 30, 335-47.
180. Kotin, R.M., Siniscalco, M., Samulski, R.J., Zhu, X.D., Hunter, L., Laughlin, C.A., McLaughlin, S., Muzyczka, N., Rocchi, M. and Berns, K.I. (1990) Site- specific integration by adeno-associated virus. Proc Natl Acad Sci U S A, 87, 2211-5.
176
181. Samulski, R.J., Zhu, X., Xiao, X., Brook, J.D., Housman, D.E., Epstein, N. and Hunter, L.A. (1991) Targeted integration of adeno-associated virus (AAV) into human chromosome 19. Embo J, 10, 3941-50.
182. Schnepp, B.C., Clark, K.R., Klemanski, D.L., Pacak, C.A. and Johnson, P.R. (2003) Genetic fate of recombinant adeno-associated virus vector genomes in muscle. J Virol, 77, 3495-504.
183. Clark, K.R., Sferra, T.J. and Johnson, P.R. (1997) Recombinant adeno-associated viral vectors mediate long-term transgene expression in muscle. Hum Gene Ther, 8, 659-69.
184. Koeberl, D.D., Alexander, I.E., Halbert, C.L., Russell, D.W. and Miller, A.D. (1997) Persistent expression of human clotting factor IX from mouse liver after intravenous injection of adeno-associated virus vectors. Proc Natl Acad Sci U S A, 94, 1426-31.
185. Lo, W.D., Qu, G., Sferra, T.J., Clark, R., Chen, R. and Johnson, P.R. (1999) Adeno-associated virus-mediated gene transfer to the brain: duration and modulation of expression. Hum Gene Ther, 10, 201-13.
186. Clark, K.R., Sferra, T.J., Lo, W., Qu, G., Chen, R. and Johnson, P.R. (1999) Gene transfer into the CNS using recombinant adeno-associated virus: analysis of vector DNA forms resulting in sustained expression. J Drug Target, 7, 269-83.
187. Halbert, C.L., Rutledge, E.A., Allen, J.M., Russell, D.W. and Miller, A.D. (2000) Repeat transduction in the mouse lung by using adeno-associated virus vectors with different serotypes. J Virol, 74, 1524-32.
188. Flannery, J.G., Zolotukhin, S., Vaquero, M.I., LaVail, M.M., Muzyczka, N. and Hauswirth, W.W. (1997) Efficient photoreceptor-targeted gene expression in vivo by recombinant adeno-associated virus. Proc Natl Acad Sci U S A, 94, 6916-21.
189. During, M.J., Xu, R., Young, D., Kaplitt, M.G., Sherwin, R.S. and Leone, P. (1998) Peroral gene therapy of lactose intolerance using an adeno-associated virus vector. Nat Med, 4, 1131-5.
190. Russell, D.W. and Kay, M.A. (1999) Adeno-associated virus vectors and hematology. Blood, 94, 864-74.
191. Xiao, X., Li, J. and Samulski, R.J. (1996) Efficient long-term gene transfer into muscle tissue of immunocompetent mice by adeno-associated virus vector. J Virol, 70, 8098-108.
177 192. Vogel, S., Piantedosi, R., Frank, J., Lalazar, A., Rockey, D.C., Friedman, S.L. and Blaner, W.S. (2000) An immortalized rat liver stellate cell line (HSC-T6): a new cell model for the study of retinoid metabolism in vitro. J Lipid Res, 41, 882-93.
193. Steffen, C.L., Ball-Mirth, D.K., Harding, P.A., Bhattacharyya, N., Pillai, S. and Brigstock, D.R. (1998) Characterization of cell-associated and soluble forms of connective tissue growth factor (CTGF) produced by fibroblast cells in vitro. Growth Factors, 15, 199-213.
194. Varadaraj, K. and Skinner, D.M. (1994) Denaturants or cosolvents improve the specificity of PCR amplification of a G + C-rich DNA using genetically engineered DNA polymerases. Gene, 140, 1-5.
195. Brigstock, D.R., Heap, R.B., Barker, P.J. and Brown, K.D. (1990) Purification and characterization of heparin-binding growth factors from porcine uterus. Biochem J, 266, 273-82.
196. Yang, D.H., Kim, H.S., Wilson, E.M., Rosenfeld, R.G. and Oh, Y. (1998) Identification of glycosylated 38-kDa connective tissue growth factor (IGFBP- related protein 2) and proteolytic fragments in human biological fluids, and up- regulation of IGFBP-rP2 expression by TGF-beta in Hs578T human breast cancer cells. J Clin Endocrinol Metab, 83, 2593-6.
197. Boes, M., Dake, B.L., Booth, B.A., Erondu, N.E., Oh, Y., Hwa, V., Rosenfeld, R. and Bar, R.S. (1999) Connective tissue growth factor (IGFBP-rP2) expression and regulation in cultured bovine endothelial cells. Endocrinology, 140, 1575-80.
198. Kubota, S., Eguchi, T., Shimo, T., Nishida, T., Hattori, T., Kondo, S., Nakanishi, T. and Takigawa, M. (2001) Novel mode of processing and secretion of connective tissue growth factor/ecogenin (CTGF/Hcs24) in chondrocytic HCS- 2/8 cells. Bone, 29, 155-61.
199. Muzyczka, N. (1992) Use of adeno-associated virus as a general transduction vector for mammalian cells. Curr Top Microbiol Immunol, 158, 97-129.
200. Kondo, S., Kubota, S., Eguchi, T., Hattori, T., Nakanishi, T., Sugahara, T. and Takigawa, M. (2000) Characterization of a mouse ctgf 3'-UTR segment that mediates repressive regulation of gene expression. Biochem Biophys Res Commun, 278, 119-24.
201. Kubota, S., Kondo, S., Eguchi, T., Hattori, T., Nakanishi, T., Pomerantz, R.J. and Takigawa, M. (2000) Identification of an RNA element that confers post- transcriptional repression of connective tissue growth factor/hypertrophic chondrocyte specific 24 (ctgf/hcs24) gene: similarities to retroviral RNA-protein interactions. Oncogene, 19, 4773-86.
178
202. Manickan, E., Satoi, J., Wang, T.C. and Liang, T.J. (2001) Conditional liver- specific expression of simian virus 40 T antigen leads to regulatable development of hepatic neoplasm in transgenic mice. J Biol Chem, 276, 13989-94.
203. Grotendorst, G.R. (1997) Connective tissue growth factor: a mediator of TGF- beta action on fibroblasts. Cytokine Growth Factor Rev, 8, 171-9.
204. Abraham, D.J., Shiwen, X., Black, C.M., Sa, S., Xu, Y. and Leask, A. (2000) Tumor necrosis factor alpha suppresses the induction of connective tissue growth factor by transforming growth factor-beta in normal and scleroderma fibroblasts. J Biol Chem, 275, 15220-5.
205. Keil, A., Blom, I.E., Goldschmeding, R. and Rupprecht, H.D. (2002) Nitric oxide down-regulates connective tissue growth factor in rat mesangial cells. Kidney Int, 62, 401-11.
206. Stanhope-Baker, P. and Williams, B.R. (2000) Identification of connective tissue growth factor as a target of WT1 transcriptional regulation. J Biol Chem, 275, 38139-50.
207. Nishida, T., Nakanishi, T., Shimo, T., Asano, M., Hattori, T., Tamatani, T., Tezuka, K. and Takigawa, M. (1998) Demonstration of receptors specific for connective tissue growth factor on a human chondrocytic cell line (HCS-2/8). Biochem Biophys Res Commun, 247, 905-9.
208. Segarini, P.R., Nesbitt, J.E., Li, D., Hays, L.G., Yates, J.R., 3rd and Carmichael, D.F. (2001) The low density lipoprotein receptor-related protein/alpha2- macroglobulin receptor is a receptor for connective tissue growth factor. J Biol Chem, 276, 40659-67.
209. Gliemann, J. (1998) Receptors of the low density lipoprotein (LDL) receptor family in man. Multiple functions of the large family members via interaction with complex ligands. Biol Chem, 379, 951-64.
210. Xiong, J.P., Stehle, T., Goodman, S.L. and Arnaout, M.A. (2003) Integrins, cations and ligands: making the connection. J Thromb Haemost, 1, 1642-54.
211. Yamada, K.M., Pankov, R. and Cukierman, E. (2003) Dimensions and dynamics in integrin function. Braz J Med Biol Res, 36, 959-66.
212. Weston, B.S., Wahab, N.A. and Mason, R.M. (2003) CTGF Mediates TGF-beta- Induced Fibronectin Matrix Deposition by Upregulating Active alpha5beta1 Integrin in Human Mesangial Cells. J Am Soc Nephrol, 14, 601-10.
179 213. Tsai, M.S., Bogart, D.F., Castaneda, J.M., Li, P. and Lupu, R. (2002) Cyr61 promotes breast tumorigenesis and cancer progression. Oncogene, 21, 8178-85.
214. Friedman, S.L. (2000) Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J Biol Chem, 275, 2247-50.
215. Twigg, S.M., Joly, A.H., Chen, M.M., Tsubaki, J., Kim, H.S., Hwa, V., Oh, Y. and Rosenfeld, R.G. (2002) Connective tissue growth factor/IGF-binding protein- related protein-2 is a mediator in the induction of fibronectin by advanced glycosylation end-products in human dermal fibroblasts. Endocrinology, 143, 1260-9.
216. Chen, A. (2002) Acetaldehyde stimulates the activation of latent transforming growth factor-beta1 and induces expression of the type II receptor of the cytokine in rat cultured hepatic stellate cells. Biochem J, 368, 683-93.
217. Friedman, S.L. (1999) Stellate cell activation in alcoholic fibrosis--an overview. Alcohol Clin Exp Res, 23, 904-10.
218. Burt, A.D. (1999) Pathobiology of hepatic stellate cells. J Gastroenterol, 34, 299- 304.
219. Britton, R.S. and Bacon, B.R. (1999) Intracellular signaling pathways in stellate cell activation. Alcohol Clin Exp Res, 23, 922-5.
220. Eng, F.J. and Friedman, S.L. (2000) Fibrogenesis I. New insights into hepatic stellate cell activation: the simple becomes complex. Am J Physiol Gastrointest Liver Physiol, 279, G7-G11.
221. Li, D. and Friedman, S.L. (1999) Liver fibrogenesis and the role of hepatic stellate cells: new insights and prospects for therapy. J Gastroenterol Hepatol, 14, 618-33.
222. Kruidering, M. and Evan, G.I. (2000) Caspase-8 in apoptosis: the beginning of "the end"? IUBMB Life, 50, 85-90.
223. Hishikawa, K., Nakaki, T. and Fujii, T. (1999) Transforming growth factor- beta(1) induces apoptosis via connective tissue growth factor in human aortic smooth muscle cells. Eur J Pharmacol, 385, 287-90.
224. Du, W.D., Zhang, Y.E., Zhai, W.R. and Zhou, X.M. (1999) Dynamic changes of type I,III and IV collagen synthesis and distribution of collagen-producing cells in carbon tetrachloride-induced rat liver fibrosis. World J Gastroenterol, 5, 397-403.
180 225. Lamireau, T., Le Bail, B., Boussarie, L., Fabre, M., Vergnes, P., Bernard, O., Gautier, F., Bioulac-Sage, P. and Rosenbaum, J. (1999) Expression of collagens type I and IV, osteonectin and transforming growth factor beta-1 (TGFbeta1) in biliary atresia and paucity of intrahepatic bile ducts during infancy. J Hepatol, 31, 248-55.
226. Lang, A. and Brenner, D.A. (1999) Gene regulation in hepatic stellate cell. Ital J Gastroenterol Hepatol, 31, 173-9.
227. Mohri, H. (1997) Interaction of fibronectin with integrin receptors: evidence by use of synthetic peptides. Peptides, 18, 899-907.
228. Zhou, X., Zhang, Y., Zhang, J., Zhu, H., Du, W., Zhang, X. and Chen, Q. (2000) Expression of fibronectin receptor, integrin alpha 5 beta 1 of hepatic stellate cells in rat liver fibrosis. Chin Med J (Engl), 113, 272-6.
229. Rudack, C., Maune, S., Eble, J. and Schroeder, J.M. (2003) The Primary Role in Biologic Activity of the Neutrophil Chemokines IL-8 and GRO-alpha in Cultured Nasal Epithelial Cells. J Interferon Cytokine Res, 23, 113-23.
230. Woodward, J.K., Elshaw, S.R., Murray, A.K., Nichols, C.E., Cross, N., Laws, D., Rennie, I.G. and Sisley, K. (2002) Stimulation and inhibition of uveal melanoma invasion by HGF, GRO, IL-1alpha and TGF-beta. Invest Ophthalmol Vis Sci, 43, 3144-52.
231. Glynn, P.C., Henney, E.M. and Hall, I.P. (2001) Peripheral blood neutrophils are hyperresponsive to IL-8 and Gro-alpha in cryptogenic fibrosing alveolitis. Eur Respir J, 18, 522-9.
232. Lin, J., Liliensiek, B., Kanitz, M., Schimanski, U., Bohrer, H., Waldherr, R., Martin, E., Kauffmann, G., Ziegler, R. and Nawroth, P.P. (1998) Molecular cloning of genes differentially regulated by TNF-alpha in bovine aortic endothelial cells, fibroblasts and smooth muscle cells. Cardiovasc Res, 38, 802- 13.
233. Liu, X., Wu, H., Liu, F., Huang, M., Qiang, O. and Huang, S. (2001) [Effects of tumor necrosis factor alpha on the expression of connective tissue growth factor in hepatic stellate cells]. Zhonghua Gan Zang Bing Za Zhi, 9 Suppl, 15-7.
234. Blazejewski, S., Le Bail, B., Boussarie, L., Blanc, J.F., Malaval, L., Okubo, K., Saric, J., Bioulac-Sage, P. and Rosenbaum, J. (1997) Osteonectin (SPARC) expression in human liver and in cultured human liver myofibroblasts. Am J Pathol, 151, 651-7.
181 235. Nakatani, K., Seki, S., Kawada, N., Kitada, T., Yamada, T., Sakaguchi, H., Kadoya, H., Ikeda, K. and Kaneda, K. (2002) Expression of SPARC by activated hepatic stellate cells and its correlation with the stages of fibrogenesis in human chronic hepatitis. Virchows Arch, 441, 466-74.
236. Frizell, E., Liu, S.L., Abraham, A., Ozaki, I., Eghbali, M., Sage, E.H. and Zern, M.A. (1995) Expression of SPARC in normal and fibrotic livers. Hepatology, 21, 847-54.
237. Tokes, A.M., Hortovanyi, E., Kulka, J., Jackel, M., Kerenyi, T. and Kadar, A. (1999) Tenascin expression and angiogenesis in breast cancers. Pathol Res Pract, 195, 821-8.
238. Zagzag, D., Shiff, B., Jallo, G.I., Greco, M.A., Blanco, C., Cohen, H., Hukin, J., Allen, J.C. and Friedlander, D.R. (2002) Tenascin-C promotes microvascular cell migration and phosphorylation of focal adhesion kinase. Cancer Res, 62, 2660-8.
239. Mai, J., Sameni, M., Mikkelsen, T. and Sloane, B.F. (2002) Degradation of extracellular matrix protein tenascin-C by cathepsin B: an interaction involved in the progression of gliomas. Biol Chem, 383, 1407-13.
240. Benyon, R.C. and Arthur, M.J. (2001) Extracellular matrix degradation and the role of hepatic stellate cells. Semin Liver Dis, 21, 373-84.
241. Yoshiji, H., Kuriyama, S., Miyamoto, Y., Thorgeirsson, U.P., Gomez, D.E., Kawata, M., Yoshii, J., Ikenaka, Y., Noguchi, R., Tsujinoue, H., Nakatani, T., Thorgeirsson, S.S. and Fukui, H. (2000) Tissue inhibitor of metalloproteinases-1 promotes liver fibrosis development in a transgenic mouse model. Hepatology, 32, 1248-54.
242. Yoshiji, H., Kuriyama, S., Yoshii, J., Ikenaka, Y., Noguchi, R., Nakatani, T., Tsujinoue, H., Yanase, K., Namisaki, T., Imazu, H. and Fukui, H. (2002) Tissue inhibitor of metalloproteinases-1 attenuates spontaneous liver fibrosis resolution in the transgenic mouse. Hepatology, 36, 850-60.
243. Kondo, S., Kubota, S., Shimo, T., Nishida, T., Yosimichi, G., Eguchi, T., Sugahara, T. and Takigawa, M. (2002) Connective tissue growth factor increased by hypoxia may initiate angiogenesis in collaboration with matrix metalloproteinases. Carcinogenesis, 23, 769-776.
244. Ramadori, G., Neubauer, K., Odenthal, M., Nakamura, T., Knittel, T., Schwogler, S. and Meyer zum Buschenfelde, K.H. (1992) The gene of hepatocyte growth factor is expressed in fat-storing cells of rat liver and is downregulated during cell growth and by transforming growth factor-beta. Biochem Biophys Res Commun, 183, 739-42.
182
245. Matsuda, Y., Matsumoto, K., Ichida, T. and Nakamura, T. (1995) Hepatocyte growth factor suppresses the onset of liver cirrhosis and abrogates lethal hepatic dysfunction in rats. J Biochem (Tokyo), 118, 643-9.
246. Matsuda, Y., Matsumoto, K., Yamada, A., Ichida, T., Asakura, H., Komoriya, Y., Nishiyama, E. and Nakamura, T. (1997) Preventive and therapeutic effects in rats of hepatocyte growth factor infusion on liver fibrosis/cirrhosis. Hepatology, 26, 81-9.
247. Ueki, T., Kaneda, Y., Tsutsui, H., Nakanishi, K., Sawa, Y., Morishita, R., Matsumoto, K., Nakamura, T., Takahashi, H., Okamoto, E. and Fujimoto, J. (1999) Hepatocyte growth factor gene therapy of liver cirrhosis in rats. Nat Med, 5, 226-30.
248. Ozaki, I., Zhao, G., Mizuta, T., Ogawa, Y., Hara, T., Kajihara, S., Hisatomi, A., Sakai, T. and Yamamoto, K. (2002) Hepatocyte growth factor induces collagenase (matrix metalloproteinase-1) via the transcription factor Ets-1 in human hepatic stellate cell line. J Hepatol, 36, 169-78.
249. Inoue, T., Okada, H., Kobayashi, T., Watanabe, Y., Kanno, Y., Kopp, J.B., Nishida, T., Takigawa, M., Ueno, M., Nakamura, T. and Suzuki, H. (2003) Hepatocyte growth factor counteracts transforming growth factor-beta1, through attenuation of connective tissue growth factor induction, and prevents renal fibrogenesis in 5/6 nephrectomized mice. Faseb J, 17, 268-70.
250. Stratton, R., Shiwen, X., Martini, G., Holmes, A., Leask, A., Haberberger, T., Martin, G.R., Black, C.M. and Abraham, D. (2001) Iloprost suppresses connective tissue growth factor production in fibroblasts and in the skin of scleroderma patients. J Clin Invest, 108, 241-50.
251. Kubo, M., Kikuchi, K., Nashiro, K., Kakinuma, T., Hayashi, N., Nanko, H. and Tamaki, K. (1998) Expression of fibrogenic cytokines in desmoplastic malignant melanoma. Br J Dermatol, 139, 192-7.
252. Desmet, V.J. (1992) What is congenital hepatic fibrosis? Histopathology, 20, 465- 77.
253. de Koning, T.J., Nikkels, P.G., Dorland, L., Bekhof, J., De Schrijver, J.E., van Hattum, J., van Diggelen, O.P., Duran, M., Berger, R. and Poll-The, B.T. (2000) Congenital hepatic fibrosis in 3 siblings with phosphomannose isomerase deficiency. Virchows Arch, 437, 101-5.
254. Ishak, K.G., Sharp, H.L. (2002) Developmental abnormalities and liver disease in childhood. In MacSween, R.N.M., Burt, A.D., Portmann, B.C., Ishak, K.G.,
183 Scheuer, P.J., Anthony, P.P. (ed.), Pathology of the Liver. 4th ed. Harcourt Publishers Limited, London, pp. 107-151.
255. El-Youssef, M., Mu, Y., Huang, L., Stellmach, V. and Crawford, S.E. (1999) Increased expression of transforming growth factor-beta1 and thrombospondin-1 in congenital hepatic fibrosis: possible role of the hepatic stellate cell. J Pediatr Gastroenterol Nutr, 28, 386-92.
256. Leuschner, I., Radig, K. and Harms, D. (1996) Desmoplastic small round cell tumor. Semin Diagn Pathol, 13, 204-12.
257. Rodriguez, E., Sreekantaiah, C., Gerald, W., Reuter, V.E., Motzer, R.J. and Chaganti, R.S. (1993) A recurring translocation, t(11;22)(p13;q11.2), characterizes intra-abdominal desmoplastic small round-cell tumors. Cancer Genet Cytogenet, 69, 17-21.
258. Froberg, K., Brown, R.E., Gaylord, H. and Manivel, C. (1999) Intra-abdominal desmoplastic small round cell tumor: immunohistochemical evidence for up- regulation of autocrine and paracrine growth factors. Ann Clin Lab Sci, 29, 78-85.
259. Scharnhorst, V., van der Eb, A.J. and Jochemsen, A.G. (2001) WT1 proteins: functions in growth and differentiation. Gene, 273, 141-61.
260. Lee, T.H., Moffett, P. and Pelletier, J. (1999) The Wilms' tumor suppressor gene (wt1) product represses different functional classes of transcriptional activation domains. Nucleic Acids Res, 27, 2889-97.
261. Karnieli, E., Werner, H., Rauscher, F.J., 3rd, Benjamin, L.E. and LeRoith, D. (1996) The IGF-I receptor gene promoter is a molecular target for the Ewing's sarcoma-Wilms' tumor 1 fusion protein. J Biol Chem, 271, 19304-9.
262. Rageh, M.A., Moussad, E.E., Wilson, A.K. and Brigstock, D.R. (2001) Steroidal regulation of connective tissue growth factor (CCN2; CTGF) synthesis in the mouse uterus. Mol Pathol, 54, 338-46.
263. de Alava, E., Ladanyi, M., Rosai, J. and Gerald, W.L. (1995) Detection of chimeric transcripts in desmoplastic small round cell tumor and related developmental tumors by reverse transcriptase polymerase chain reaction. A specific diagnostic assay. Am J Pathol, 147, 1584-91.
264. Yoshiji, H., Kuriyama, S., Yoshii, J., Ikenaka, Y., Noguchi, R., Hicklin, D.J., Wu, Y., Yanase, K., Namisaki, T., Yamazaki, M., Tsujinoue, H., Imazu, H., Masaki, T. and Fukui, H. (2003) Vascular endothelial growth factor and receptor interaction is a prerequisite for murine hepatic fibrogenesis. Gut, 52, 1347-54.
184 265. Lae, M.E., Roche, P.C., Jin, L., Lloyd, R.V. and Nascimento, A.G. (2002) Desmoplastic small round cell tumor: a clinicopathologic, immunohistochemical, and molecular study of 32 tumors. Am J Surg Pathol, 26, 823-35.
266. Koliopanos, A., Friess, H., di Mola, F.F., Tang, W.H., Kubulus, D., Brigstock, D., Zimmermann, A. and Buchler, M.W. (2002) Connective tissue growth factor gene expression alters tumor progression in esophageal cancer. World J Surg, 26, 420- 7.
267. Moritani, N.H., Kubota, S., Nishida, T., Kawaki, H., Kondo, S., Sugahara, T. and Takigawa, M. (2003) Suppressive effect of overexpressed connective tissue growth factor on tumor cell growth in a human oral squamous cell carcinoma- derived cell line. Cancer Lett, 192, 205-14.
268. Shakunaga, T., Ozaki, T., Ohara, N., Asaumi, K., Doi, T., Nishida, K., Kawai, A., Nakanishi, T., Takigawa, M. and Inoue, H. (2000) Expression of connective tissue growth factor in cartilaginous tumors. Cancer, 89, 1466-73.
269. Kang, Y., Siegel, P.M., Shu, W., Drobnjak, M., Kakonen, S.M., Cordon-Cardo, C., Guise, T.A. and Massague, J. (2003) A multigenic program mediating breast cancer metastasis to bone. Cancer Cell, 3, 537-49.
270. Menendez, J.A., Mehmi, I., Griggs, D.W. and Lupu, R. (2003) The angiogenic factor CYR61 in breast cancer: molecular pathology and therapeutic perspectives. Endocrine-Related Cancer, 10, 139-150.
271. Harding, P.A., Surveyor, G.A. and Brigstock, D.R. (1998) Characterization of pig connective tissue growth factor (CTGF) cDNA, mRNA and protein from uterine tissue. DNA Seq, 8, 385-90.
272. Gries, L.K., Geisert, R.D., Zavy, M.T., Garrett, J.E. and Morgan, G.L. (1989) Uterine secretory alterations coincident with embryonic mortality in the gilt after exogenous estrogen administration. J Anim Sci, 67, 276-84.
273. Geisert, R.D. and Yelich, J.V. (1997) Regulation of conceptus development and attachment in pigs. J Reprod Fertil Suppl, 52, 133-49.
274. Bowen, J.A., Bazer, F.W. and Burghardt, R.C. (1996) Spatial and temporal analyses of integrin and Muc-1 expression in porcine uterine epithelium and trophectoderm in vivo. Biol Reprod, 55, 1098-106.
275. Burghardt, R.C., Bowen, J.A., Newton, G.R. and Bazer, F.W. (1997) Extracellular matrix and the implantation cascade in pigs. J Reprod Fertil Suppl, 52, 151-64.
185 276. Denker, H.W. (1993) Implantation: a cell biological paradox. J Exp Zool, 266, 541-58.
277. Tamada, H., McMaster, M.T., Flanders, K.C., Andrews, G.K. and Dey, S.K. (1990) Cell type-specific expression of transforming growth factor-beta 1 in the mouse uterus during the periimplantation period. Mol Endocrinol, 4, 965-72.
278. Das, S.K., Flanders, K.C., Andrews, G.K. and Dey, S.K. (1992) Expression of transforming growth factor-beta isoforms (beta 2 and beta 3) in the mouse uterus: analysis of the periimplantation period and effects of ovarian steroids. Endocrinology, 130, 3459-66.
279. Das, S.K., Lim, H., Wang, J., Paria, B.C., BazDresch, M. and Dey, S.K. (1997) Inappropriate expression of human transforming growth factor (TGF)- alpha in the uterus of transgenic mouse causes downregulation of TGF- beta receptors and delays the blastocyst-attachment reaction. J Mol Endocrinol, 18, 243-57.
280. Rivera-Gonzalez, R., Petersen, D.N., Tkalcevic, G., Thompson, D.D. and Brown, T.A. (1998) Estrogen-induced genes in the uterus of ovariectomized rats and their regulation by droloxifene and tamoxifen. J Steroid Biochem Mol Biol, 64, 13-24.
281. Takahashi, T., Eitzman, B., Bossert, N.L., Walmer, D., Sparrow, K., Flanders, K.C., McLachlan, J. and Nelson, K.G. (1994) Transforming growth factors beta 1, beta 2, and beta 3 messenger RNA and protein expression in mouse uterus and vagina during estrogen- induced growth: a comparison to other estrogen-regulated genes. Cell Growth Differ, 5, 919-35.
282. Zhang, Z., Funk, C., Roy, D., Glasser, S. and Mulholland, J. (1994) Heparin- binding epidermal growth factor-like growth factor is differentially regulated by progesterone and estradiol in rat uterine epithelial and stromal cells. Endocrinology, 134, 1089-94.
283. Das, S.K., Chakraborty, I., Paria, B.C., Wang, X.N., Plowman, G. and Dey, S.K. (1995) Amphiregulin is an implantation-specific and progesterone-regulated gene in the mouse uterus. Mol Endocrinol, 9, 691-705.
284. Rider, V. and Piva, M. (1997) Role of Growth Factors of Uterine and Fetal- Placental Origin During Pregnancy. In Bazer, F.W. (ed.), The Endocrinology of Pregnancy. Humana Press, Inc., Totowa, NJ, pp. 83-124.
285. Rider, V., Carlone, D.L. and Foster, R.T. (1997) Oestrogen and progesterone control basic fibroblast growth factor mRNA in the rat uterus. J Endocrinol, 154, 75-84.
186