Tensile Stress Stimulates the Expression of Osteogenic Cytokines

Biomedical Research (Tokyo) 37 (2) 117–126, 2016

Tensile stress stimulates the expression of osteogenic cytokines/growth factors and matricellular proteins in the mouse cranial suture at the site of osteoblast differentiation

1, 2 3 4 1, 5 6 Mika IKEGAME , Yoshiaki TABUCHI , Yukihiro FURUSAWA , Mariko KAWAI , Atsuhiko HATTORI , Takashi 4 1 KONDO , and Toshio YAMAMOTO 1 Department of Oral Morphology, Okayama University, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan; 2 Advanced Research Center for Oral and Craniofacial Sciences, Okayama University Dental School, Okayama, Japan; 3 Division of Molecular Genetics, Life Science Research Center, University of Toyama, Toyama, Japan; 4 Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama, Japan; 5 Department of Pharma- cology, Osaka Dental University, Osaka, Japan; and 6 College of Liberal Arts and Sciences, Tokyo Medical and Dental University, Chiba, Japan (Received 28 January 2016; and accepted 9 February 2016)

ABSTRACT Mechanical stress promotes osteoblast proliferation and differentiation from mesenchymal stem cells (MSCs). Although numerous growth factors and cytokines are known to regulate this process, information regarding the differentiation of mechanically stimulated osteoblasts from MSCs in in vivo microenvironment is limited. To determine the significant factors involved in this process, we performed a global analysis of differentially expressed genes, in response to tensile stress, in the mouse cranial suture wherein osteoblasts differentiate from MSCs. We found that the gene expression levels of several components involved in bone morphogenetic protein, Wnt, and epithelial growth factor signalings were elevated with tensile stress. Moreover gene expression of some extracellular matrices (ECMs), such as cysteine rich protein 61 (Cyr61)/CCN1 and galectin-9, were upregulated. These ECMs have the ability to modulate the activities of cytokines and are known as matricellular proteins. Cyr61/CCN1 expression was prominently increased in the fibroblastic cells and preosteoblasts in the suture. Thus, for the first time we demonstrated the mechanical stimulation of Cyr61/CCN1 expression in osteogenic cells in an ex vivo system. These results suggest the importance of matricellular proteins along with the cytokine-mediated signaling for the mechanical regulation of MSC proliferation and differentiation into osteoblastic cell lineage in vivo.

Mechanical stress controls bone mass by affecting ulated by mechanical stress, especially the mecha- recruitment of osteoprogenitors as well as osteoblast nism for osteogenic differentiation of MSCs, will differentiation from mesenchymal stem cells (MSCs) contribute to the progress of regenerative medicine in the bone tissue (7, 8). Elucidation of the precise for effective production of bone tissue from MSC mechanisms involved in the osteoblastogenesis stim- sources. Increasing evidence has revealed that the process of mechanical stress-stimulated osteoblastogenesis is Address correspondence to: Mika Ikegame, Department of Oral Morphology, Okayama University, Graduate controlled by many cytokines/growth factors (9, 32, School of Medicine, Dentistry and Pharmaceutical Sci- 34, 36). Especially bone morphogenetic protein ences, 2-5-1, Shikata-cho, Okayama 700-8525, Japan (BMP) signaling and Wnt signaling play important Tel: +81-86-235-6631, Fax: +81-86-235-6634 roles in the development of osteoblasts from MSCs E-mail: [email protected] (5), but the more relevant factors among these or 118 M. Ikegame et al. even the existence of any other significant factors is not clear. Furthermore, it is argued that the biological activities of these factors will be affected by extracellular matrix (ECM) (44). ECM provides the physical environment as a scaffold for the cells to attach, which should affect strain sensing and differentiation. Moreover, some ECMs are known to modulate cell functions and have been termed as ‘matricellular’ proteins (3). During the process of osteogenesis in vivo, MSCs proliferate and then differentiate into osteoblastic cell lineage in a microenvironment associated with a heterogeneous population of cells and ECMs, under the influence of cell-cell and cell-matrix interactions (8). Therefore, for better understand- ing of the mechanism of mechanical stress-stimulated Fig. 1 Schematic illustration of the helical springs that ex- osteoblastogenesis, a global analysis needs to be ert tensile stress (0.2 g) or maintain static position (0 g) in performed to examine the cellular response to me- calvarial sutures. chanical stress in a microenvironment similar to that found in vivo. Microarray technology enables the systematic MATERIALS AND METHODS analysis of gene expression, and several studies have utilized it to assess the regulation of in vivo gene Organ culture and mechanical force device. Meth- expression by mechanical stress in bone tissues (28, ods for organ culture and the tensile stress device 50, 51). However, most of these studies have utilized have been described previously (17). Briefly, pari- long bones wherein bone formation occurs alongside etal bones including the mid-sagittal suture from bone resorption or remodeling. Thus, it seems diffi- 4-day-old ddY mice were dissected out and incubat- cult to pinpoint the factors specific for accelerated ed in 24-well plates (Thermo Scientific Nunc A/S, osteogenic differentiation using long bones. Roskilde, Denmark) in the absence of stress (0 g, Therefore, to clarify the mechanism for mechani- control) or with 0.2 g mechanical tensile stress ap- cal stress-induced osteogenic differentiation of MSCs plied by helical coiled springs (Fig. 1). Incubation under the microenvironment similar to that found in was carried out in BGJb medium (Gibco BRL, Life vivo, we used an ex vivo experimental model of the Technologies, Inc., Rockville, MD, USA) containing cranial suture from young animals. Since bone mod- 10% fetal bovine serum (FBS; Nichirei Biosciences eling by intramembranous ossification is under prog- Inc., Tokyo, Japan), penicillin G (100 U/mL), and ress in such immature cranial sutures, there are a streptomycin (100 mg/mL), at 37°C and in 5% CO2 number of undifferentiated osteoprogenitors and atmosphere. The study was approved by the Animal MSCs among the components of ECM as found in Care and Use Committee, Okayama University. vivo (53). We have previously investigated the effect of tensile stress on osteoblastogenesis using this mod- RNA extraction. After incubation, cranial sutures el, and found increased gene expression of BMP-4 were dissected free from the parietal bones under a prior to an increase in preosteoblasts in the suture dissection microscope and total RNA was extracted upon mechanical stimulation (17). Here we used this using an RNeasy Fibrous Tissue RNA Extraction ex vivo system and performed microarray analysis to Kit (Qiagen K.K., Tokyo, Japan) along with on-col- find the significant factors stimulated by mechanical umn DNase I treatment (RNase-free DNase kit, Qia- stretch, that affect osteoblastogenesis. We found that gen). RNA quality was analyzed using a Bioanalyzer in addition to the increased gene expression of the 2100 (Agilent Technologies, Inc., Santa Clara, CA, proteins involved in BMP signaling and Wnt signal- USA). RNA samples that had RNA integrity number ing, the expression of epithelial growth factor (EGF) (RIN) values above 9.5 were considered acceptable. family molecules was also upregulated. We further RNA from 10 to 20 non-stressed control or tensile- identified a prominent increase in gene expression stressed sutures was pooled as one sample for micro- of some components of the ECM, such as Cyr61/ array analysis and subsequent real-time PCR analysis. CCN1 and galectin-9, which exert biological effects Six such pairs of samples were generated for each on osteoblastogenesis. of the 3 h and 6 h groups. Tensile stress stimulates the expression of matricellular proteins 119

Table 1 Primer sets used for real-time PCR Gene Forward primer (5’-3’) Reverse primer (5’-3’) Accession No. Areg acagcgaggatgacaaggac gtgataacgatgccgatgc NM_009704 Bmp4 ggtccaggaagaagaata ccacaatccaatcattcc NM_007554 Bmpr1b cgctatatgcctccagaagtg gcaatctcccagaggatgag NM_007560 Cyr61 ataccggcccaaatactgc tctctccatcttcgcatcg NM_010516 Ereg gtgtggctcaagtgcagattac tcacatcgcagaccagtgtag NM_007950 Fst tctctgcgatgagctgtgtc tcaagaagcacgccagaag NM_001301373 Fz9 gaagctggagaagctgatgg aagtccatgttgaggcgttc NM_010246 Gapdh aactcccactcttccaccttc cctgttgctgtagccgtattc NM_001289726 Hbegf tttctcctccaagccacaag tgaggcatgggtctctcttc NM_010415 Lgals9 cattgccttccacttcaacc gcatctgcatctttctctcctc NM_001159301 Nov aacaggaatcgccagtgtg ctgtaggtggatggctttcag NM_010930 Sostdc1 cctcctgccattcatctctc attcagggtgctgttgctg NM_025312 Ucma ggtgctcctgtgtagtgtgaaac ttcatctcgggacttaggagac NM_026754 Wif1 tgctttaatggagggacctg ttcgggcacttacacttgc NM_011915 Wisp2 gaatacaggtgccaggaagg gcagatgcaggagtgacaag NM_016873 Wnt2 gcctttgtttacgccatctc ttgctgtccttggcacttc NM_023653 Wnt5b gaccgtttgaaggagaagtacg tcattacgcaggcagtagtcag NM_009525

High-density oligonucleotide microarray and com- in Table 1. putational gene expression analyses. Gene expres- The temperature cycling conditions for each prim- sion was analyzed using a GeneChip® system with a er consisted of 30 s at 95°C followed by 40 cycles Mouse Genome 430 2.0 array (Affymetrix, Inc., of 5 s at 95°C and 30 s at 60°C. The dissociation Santa Clara, CA, USA). Samples for array hybrid- analysis was carried out over a range from 60°C to ization were prepared as described in the Affymetrix 95°C by monitoring SYBR green fluorescence. Data GeneChip® Expression Technical Manual. Briefly, were analyzed using relative expression levels of 500 ng of total RNA were used to synthesize cRNA target mRNA normalized to glyceraldehyde-3-phos- using a GeneChip® 3’ IVT Express Kit (Affymetrix). phate dehydrogenase (Gapdh) mRNA levels. After fragmentation, biotin-labeled cRNA was al- lowed to hybridize to the array at 45°C for 16 h. Histochemical studies. After incubation, the cranial The arrays were washed, stained with streptavidin- sutures were fixed with 4% paraformaldehyde solu- phycoerythrin and scanned using a probe array scan- tion in PBS overnight at 4°C, embedded in O.C.T. ner. The resultant hybridization intensity data were compound (Tissue-Tek®, Miles, Inc., Elkhart, IN, further analyzed using GeneSpring® GX (Agilent USA) and 5-μm cryosections were cut using a Cryo- Technologies) to extract the significant genes. To ex- tome (Leica CM 1850; Leica Biosystems, Nussloch, amine gene ontology, the data were analyzed using Germany). Ingenuity® Pathway Analysis tools (IPA) (Ingenuity For immunohistological analysis, the cryosections Systems, Inc., Mountain View, CA, USA) (45). We were preincubated in PBS containing 10% goat se- used pooled RNA from three pairs of samples for rum for 1 h at room temperature (RT) and then incu- one GeneChip microarray analysis and repeated it bated with rabbit polyclonal antibody against human using another RNA pool from different three pairs. CCN1 (ab10760; Abcam, Japan) diluted 1 : 500 for 18 h at 4°C. After being washed with PBS, sections Real-time quantitative PCR assay. Complementary were incubated with biotinylated goat anti-rabbit IgG DNA was produced from total RNA using a Prime (1 : 200; Vector Laboratories, Inc. CA, USA) for Script RT Reagent Kit (Takara Bio Inc., Shiga, Ja- 30 min at RT, rinsed with PBS, followed by incuba- pan) with random hexamers and oligo-dT primers. tion with Avidin-Biotin Peroxidase Complex (Vector Real-time quantitative PCR was performed in a Laboratories) for 30 min. Antigens were visualized StepOnePlus™ Real-Time PCR System (Applied with 3, 3’-diaminobenzidine tetrahydrochloride (DAB) Biosystems Japan, Ltd., Japan) at the Central Re- solution containing 0.01% hydrogen peroxide. As search Laboratory, Okayama University Medical negative control, non-immunized rabbit IgG or pre- School, using SYBR® PreMix ExTaq II (Takara Bio absorbed primary antibody against the CCN1 pep- Inc.). The specific primer sequences used are listed tide used for immunization (ab24416; Abcam) was 120 M. Ikegame et al.

Table 2 Differentially expressed genes related to the signaling of BMP, Wnt and some other factors with known roles in the osteoblast development Family Entrez Gene Gene name Fold change Gene ID symbol (mean) 3 h 6 h BMP 12159 Bmp4 bone morphogenic protein 4 1.4 1.4 12167 Bmpr1b bone morphogenetic protein receptor, type 1B 2.5 1.9 14560 Gdf10 growth differentiation factor 10 (Bmp3b) 1.4 1.1 14313 Fst follistatin 1.4 1.6 WNT 22413 Wnt2 wingless-related MMTV integration site family, member 2 1.4 1.4 22417 Wnt4 wingless-related MMTV integration site family, member 4 1.4 1.0 22419 Wnt5b wingless-related MMTV integration site family, member 5B 1.4 1.2 14370 Fz8 frizzled homolog 8 (Drosophila) 1.1 1.4 14371 Fz9 frizzled homolog 9 (Drosophila) 1.6 1.3 13380 Dkk1 dickkopf homolog 1 (Xenopus laevis) −1.3 −1.4 56811 Dkk2 dickkopf homolog 2 (Xenopus laevis) 1.4 1.1 66042 Sostdc1 sclerostin domain containing 1 1.5 1.6 24117 Wif1 Wnt inhibitory factor 1 −1.5 −1.7 EGF 11839 Areg amphiregulin 1.7 1.2 13874 Ereg epiregulin 2.4 1.7 15200 Hbegf heparin binding EGF-like growth factor 1.4 1.4 CCN 16007 Cyr61 cysteine rich protein 61 (CCN1) 1.8 2.5 18133 Nov nephroblastoma overexpressed gene (CCN3) 1.2 1.7 22403 Wisp2 WNT1 inducible signaling pathway protein 2 (CCN5) 1.3 1.4 Others 16859 Lgals9 lectin, galactose binding, soluble 9 (galectin-9) 1.6 1.5 68527 Ucma upper zone of growth plate and cartilage matrix associated 1.4 1.2 19206 Ptch1 patched homolog 1 −1.7 −1.3 20750 Spp1 secreted phosphoprotein 1 (osteopontin) −1.9 −1.4 20855 Stc1 stanniocalcin 1 −2.1 −1.3 Relative fold changes (0.2 g over 0 g, average of duplicated data) for gene expression in microarray analysis. EGF, epidermal growth factor. used instead of the specific primary antibody. were regarded as differentially expressed. Among the In the adjacent sections, alkaline phosphatase differentially expressed genes, 228 were upregulated (ALP) activity was detected according to the azo- and 443 were downregulated at 3 h, whereas 238 dye method described by Burstone (4). All sections were upregulated and 546 were downregulated at were counter stained with 1% methyl green. 6 h (means of results from repeated experiments). An IPA function analysis showed the top three func- Statistical analysis. Results were expressed as the tional groups of genes that were differentially ex- mean ± standard error (SEM). Differences in the pressed upon tensile stress as follows: at 3 h, i) means were analyzed using the Student’s t-test, and P cellular growth and proliferation, ii) cellular devel- values < 0.05 were regarded as statistically significant. opment, iii) cellular movement; at 6 h, i) cellular movement, ii) cellular development, iii) cellular growth and proliferation. RESULTS Next, we examined the differences in gene ex- Microarray analysis of differentially expressed genes pression of the BMP and Wnt family members, and by tensile stress their receptors and antagonists. These families in- We examined the global gene expression profiles on clude several members reported as major osteogenic two sets of RNA pools from control (0 g) and ten- factors inducing the differentiation of MSCs toward sile-stressed (0.2 g) mouse cranial sutures cultured osteoblasts (5). With IPA function analysis, we fur- for 3 h and 6 h, and at these times, proliferation (16) ther searched other differentially expressed extracel- and osteoblastic differentiation (17) were obvious, lular factors that have roles in development of respectively. Genes with a difference in expression osteoblasts. The factors expressed differentially at of 1.5-fold or more between the 0 g and 0.2 g groups least once by 1.5-fold or more in the repeated mi- Tensile stress stimulates the expression of matricellular proteins 121

Fig. 2 Real-time PCR analysis of the genes that were differentially expressed between 0 g and 0.2 g tensile-stressed mice cranial sutures, as determined by microarray analysis. Open bar, 0 g; closed bar, 0.2 g. *P < 0.05, **P < 0.01, ***P < 0.001 versus 0 g for each time point. Values are presented as mean ± SEM of delta CT values from five independent preparations, normalized to Gapdh. croarray data, and also by 1.4-fold or more in the also known as CCN1), which is a member of the mean values are shown in Table 2. CCN family. Therefore we further examined the Among the BMP family-related genes, expression gene expression for other members of the EGF and levels of bone morphogenetic protein-4 (Bmp4) and CCN families, and found significant increase in the bone morphogenetic protein receptor type IB (Bmpr1b) expression of epiregulin (Ereg), heparin binding were upregulated at both 3 h and 6 h. The gene ex- EGF (Hbegf), nephroblastoma overexpressed gene pression levels of some BMP signaling inhibitory fac- (Nov)/CCN3, and WNT1 inducible signaling path- tors such as growth differentiation factor 10 (Gdf10) way protein 2 (Wisp)/CCN5. The expression of con- and follistatin (Fst) were also increased. Among the nective tissue growth factor (Ctgf)/CCN2 was also Wnt-related factors, gene expression levels for Wnt2, increased but not to a significant level (maximum Wnt4, and Wnt5b, and for the Wnt receptors, frizzled fold change was 1.4). In addition, the gene expres- homolog 8 (Fz8) and Fz9, were upregulated. Genes sion of galectin-9 (Lgals9) and upper zone of growth for the Wnt antagonists, dickkopf homolog 1 (Dkk1) plate and cartilage matrix associated (Ucma), which and Wnt inhibitory factor 1 (Wif1), were downregu- are kinds of ECM, were also increased. lated. In contrast, gene expression levels for other antagonists such as Dkk2 and sclerostin domain con- Real-time PCR analysis of differentially expressed taining 1 (Sostdc1) were upregulated. genes in microarray data IPA analysis for cellular development and differ- We focused on several differentially expressed sig- entiation of osteoblasts showed increased expression naling molecules that regulate proliferation and dif- of amphiregulin (Areg) which is a member of the ferentiation of MSCs and some components of the EGF family, and cysteine rich protein 61 (Cyr61, ECM that are involved in differentiation of osteo- 122 M. Ikegame et al.

Fig. 3 Histological analysis of mouse cranial sutures upon tensile stress. (A) A schematic illustration of the mid-sagittal suture in the frontal section. The area indicated by the dotted square is the observed area presented in (B), (C) and (D). (B, C, D) Histochemical detection of ALP enzyme activity and Cyr61/CCN1 immunoreactivity in the suture for 0 h (B), 3 h (C), 6 h (D). Cyr61/CCN1 reactivity was detected in fibroblastic cells around the osteogenic front in the suture (arrow-heads) and the stronger reactivity was detected in ALP positive preosteoblasts in the tensile-stressed suture (arrows). ALP: alkaline phosphatase enzyme histochemistry, HE: hematoxylin-eosin staining, CCN1: Cry61/CCN1 immunohistochemistry, NC: negative control for immunohistochemistry without the primary antibody. Blue arrows show the center of the suture. Scale bar in (B, NC) indicates 20 μm and all pictures represent the same magnification. Tensile stress stimulates the expression of matricellular proteins 123 blasts, and confirmed their expression levels by real- blasts developed in close contact with each other at time PCR. The results were normalized to Gapdh to the osteogenic front and most of these possessed obtain the relative expression for each sample and strong immunoreactivity for Cyr61/CCN1 in their the means of relative expression (N = 5) are shown in cytoplasm upon tension (Fig. 3D). Fig. 2. The relative expression levels of Bmp4, Bm- pr1b and Fst were upregulated with tension (Fig. 2A, DISCUSSION B, C). The gene expression level of Bmp4 in the 0.2 g tensile-stressed group was greater at 6 h than We performed a microarray analysis using young at 3 h (Fig. 2A). Among the Wnt signaling factors, cranial sutures to investigate the important regula- we chose some of the ligands, receptors, and antag- tors of osteoblastogenesis from MSCs stimulated by onists that showed relatively greater changes in ex- mechanical stress. The results of the functional anal- pression levels for real-time PCR analysis. The ysis of the microarray data suggested increased cell increased gene expression levels of Wnt2, Wnt5b, proliferation at 3 h and progressed differentiation at Fz9, and Sostdc1 upon tensile stress were confirmed. 6 h. These results are consistent with previous reports However, they tended to decrease at 6 h compared that used similar experimental systems (16, 17). to those at 3 h (Fig. 2D, E, F, G). Besides, the ex- Among the osteoblast regulating factors, expres- pression level of another Wnt antagonist gene, Wif1 sion of Cyr61, also known as CCN1, was most great- tended to decrease with tensile stress, but not to a ly increased, and kept increasing with mechanical significant level (Fig. 2H). As for the EGF family, tensile stress at least up to 6 h. Cyr61/CCN1 is a gene expression was upregulated for Areg and Hbegf member of the CCN protein family belonging to the at 6 h, and for Ereg at both 3 h and 6 h (Fig. 2I, J, K). matricellular proteins, and is a non-structural ECM Relative expression levels of Areg and Hbegf tended that plays multi-functional roles (24, 30). It has to be lower at 6 h compared to those at 3 h (Fig. 2I, been shown to play a principal role in osteogenesis K). With regard to the CCN family members and by stimulating the migration and differentiation of ECMs, gene expression was upregulated for Cyr61/ MSCs into osteoblasts (41, 42), and by stimulating CCN1, Wisp2/CCN5 and Lgals9 at both 3 h and 6 h proliferation and differentiation of osteoblasts in an (Fig. 2L, N, O), and for Nov/CCN3 and Ucma at 6 h integrin and BMP dependent manner (43). The ex- (Fig. 2M, P). The relative expression levels of Cyr61/ pression of Cyr61/CCN1 is known to be activated in CCN1, Wisp2/CCN5 and Lgals9 tended to increase response to mechanical stress at the transcriptional at 6 h compared to those at 3 h upon tensile stress level (6) in several kinds of cells, such as fibroblasts (Fig. 2L, N, O). The fold change in the expression (40), smooth muscle cells (13) in vitro, and skeletal of Cyr61/CCN1 at 6 h was the greatest (4.4-fold) muscle in vivo (20). With regard to bone cells and among all the examined genes (Fig. 2L). MSCs, only in vitro studies with shear stress have reported the upregulation of Cyr61/CCN1 (19, 21, Immunohistochemical analysis of Cyr61/CCN1 in 48). This is the first study to show the stimulated the mouse cranial suture expression of Cry61/CCN1 with mechanical tensile We examined the immunolocalization of Cyr61/ stress in the cranial suture tissue where intramem- CCN1, the expression of which was greatly in- branous ossification is under progress. creased with tension among the osteoblast regulatory Our histochemical analysis revealed that Cyr61/ factors. Osteoblast development occurs at the osteo- CCN1 expression was increased in fibroblastic cells genic front in the young cranial suture, and many and preosteoblasts at the osteogenic front of the ten- undifferentiated mesenchymal cells, which usually sile-stressed suture. This suggests that Cyr61/CCN1 possess fibroblastic appearance, are found in the plays a pivotal role in osteoblastogenesis induced middle of the suture (46). The outer layer of the su- by mechanical tension in the cranial suture. The ex- ture is composed of fibroblastic cells and collagen pression of Cyr61/CCN1 is regulated by Wnt and fibers (Fig. 3A). In unstimulated control sutures, BMP signaling (35, 42). Conversely, Cyr61/CCN1 modest immunoreactivity of Cry61/CCN1 was de- protein stimulates BMP signaling and Wnt signaling tected in osteoblasts, preosteoblasts, and in some of to enhance the proliferation and differentiation of the fibroblastic cells (Fig. 3B, C, D). At 3 h with ten- osteoblasts (18, 43). Therefore, it is presumed that sion, all the cells in the suture were elongated in the increased Cyr61/CCN1 protein expression in pre- direction of tension, and strong immunoreactivity osteoblasts will attract MSCs toward the osteogenic was detected in a few fibroblastic cells around the front, and the growth factors and cytokines induced bone edges (Fig. 3C). At 6 h, ALP-positive preosteo- by interaction with Cyr61/CCN1 around the pre- 124 M. Ikegame et al. osteoblasts would affect those cells to proliferate MSCs to osteoblasts (2) and plays a significant role and differentiate into the osteogenic lineage. Further in osteogenic differentiation of adipose-derived stem investigation is needed to clarify the critical role of cells (52). These reports suggest a specific role for Cyr61/CCN1 in exerting its effects on osteoblasto- BMP-4 and BMPR-IB in BMP signaling during os- genesis in the suture. teogenic differentiation of MSCs in the suture upon Another CCN member, Nov/CCN3 is known to mechanical stimulation. play a significant role in skeletal development (55). Wnt signaling is known to stimulate the prolifera- Increased gene expression of Nov/CCN3 at 6 h in tion and osteoblastic differentiation of MSCs (5, the tensile-stressed suture may reflect its role as a 26). It has been reported that mechanical stimulation negative regulator of Cyr61/CCN1 (33). Moreover, regulates the expression of several Wnt signaling the expression of Wisp2/CCN5, known as a target of components including ligands and receptors in os- Wnt/β-catenin signaling (37), was also increased teoblastic cells in vitro (24, 38) and in vivo (1, 37). with tension. Although little is known about its role In this study, the gene expression levels of Wnt2, in the skeletal tissue, some reports suggest its role Wnt4, Wnt5B, Fz8 and Fz9 were found to be mod- in the regulation of MSC differentiation and bone estly increased with tensile stress in the microarray metabolism (14, 22). Therefore, Wisp2/CCN5 may analysis. Real-time PCR analysis revealed that gene contribute to regulation of osteoblast differentiation expression levels of Wnt2, Wnt5B, and Fz9 were up- from MSCs. regulated with tension, and that they were higher at We also found other tensile stress-induced upreg- 3 h when cell proliferation in progress. Among ulated ECM genes such as galectin-9 and Ucma. these, Wnt5B and Fz9 are mediators of non-canoni- Ucma is a γ-carboxyglutamate (Gla)-containing pro- cal Wnt signaling and have been reported to exert tein expressed in cartilage and also in bone cells (49), positive effects on bone formation (7, 12, 15). This and has positive effects on differentiation of MC3T3- suggests that regulating the expression of these Wnt E1 and nodule formation (25). However, it does not signaling molecules should play relevant roles in seem related to osteogenic differentiation of MSCs enhancing cell proliferation during the mechanical since the skeletal development of Ucma-deficient stress-stimulated bone formation. Meanwhile, the mice was found to be normal (10). Galectin-9 is a expression of a Wnt antagonist, Sostdc1, was also in- kind of lectin and a matricellular protein, which is creased. Sostdc1 antagonizes Wnt signaling by bind- suggested to affect bone metabolism as a modulator ing to the Wnt co-receptor, low density lipoprotein of BMP signaling in vitro (47). Increasing expres- receptor related protein 5/6 (LRP5/6) (11), and also sion of galectin-9 with tension suggests its consis- antagonizes BMP signaling (27). Recently, it has tent role in both proliferation and differentiation of been reported that Wise (another name of Sostdc1) osteoblasts in response to mechanical stress. plays a key role in controlling osteoblast number In the microarray analysis, expression levels of during skeletal development (11). Therefore, upreg- several components of BMP, Wnt and EGF signal- ulated Sostdc1 expression may imply a negative ing were changed in the tensile-stressed suture. BMP feedback response to the accelerated Wnt signaling signaling is known to induce ectopic bone formation for regulation of osteoblastogenesis from MSCs in vivo by stimulating osteogenic differentiation of upon tension. MSCs (5, 26). In the immature cranial suture, ex- EGF signaling is involved in bone development pression of Bmp4 was specifically increased at both by stimulating the proliferation of preosteoblasts and 3 h and 6 h with tension, and was greater at 6 h than inhibiting their full differentiation (31, 54). However, at 3 h in the tensile-stressed group. This result is little is known about its role in mechanical stress- consistent with our previous report demonstrating stimulated bone formation. In our study, the expres- that Bmp4 is expressed in fibroblastic cells and in sion levels of Areg, Ereg, and Hbegf were increased preosteoblasts at the osteogenic front of the tensile- in the tensile-stressed suture. The cranial suture of stressed suture (17). Upregulation of Bmp4 expres- young animals contains many MSCs and osteopro- sion has been also reported in other mechanical genitors. Therefore, the increased expression of EGF stimulated bones and osteoblasts (23, 29, 39). In ad- family members should contribute to increasing the dition, although there are several reports for the in- number of osteoblasts and maintaining the source of creased expression of BMP receptors with mechanical precursors. stress (23, 29), we found prominent upregulation of In summary, during the accelerated proliferation BMPR-IB. It has been reported that BMPR-IB is in- and differentiation process of MSCs into osteoblas- creased dramatically during the differentiation of tic lineage cells in the mouse cranial sutures with Tensile stress stimulates the expression of matricellular proteins 125 tensile stress, gene expression levels of some com- position through genetic interactions with Lrp5. PLoS One 9, ponents of BMP, Wnt, and EGF signalings were in- e96257. 12. Estrada K, Styrkarsdottir U, Evangelou E, Hsu YH, Duncan creased. Moreover we found upregulation of some EL, et al. (2012) Genome-wide meta-analysis identifies 56 genes for ECMs, such as Cyr61/CCN1 and galec- bone mineral density loci and reveals 14 loci associated with tin-9. The upregulation of Cyr61/CCN1 expression risk of fracture. Nat Genet 44, 491–501. was especially prominent and the protein was main- 13. Grote K, Bavendiek U, Grothusen C, Flach I, Hilfiker-Kleiner ly increased in preosteoblasts. These results suggest D, Drexler H and Schieffer B (2004) Stretch-inducible expression of the angiogenic factor CCN1 in vascular smooth that the role of matricellular proteins, such as CCNs muscle cells is mediated by Egr-1. J Biol Chem 279, 55675– and galectins, should be considered as modulators 55681. of growth factors/cytokines for the regulation of os- 14. Grünberg JR, Hammarstedt A, Hedjazifar S and Smith U teoblastogenesis from MSCs with mechanical stimu- (2014) The novel secreted adipokine WNT1-inducible signaling pathway protein 2 (WISP2) is a mesenchymal cell acti- li in vivo. vator of canonical WNT. J Biol Chem 289, 6899–6907. 15. Heilmann A, Schinke T, Bindl R, Wehner T, Rapp A, Haffner- Luntzer M, Nemitz C, Liedert A, Amling M and Ignatius A Acknowledgments (2013) The Wnt serpentine receptor Frizzled-9 regulates new The authors thank Dr. Masaki Nakano for his tech- bone formation in fracture healing. PLoS One 8, e84232. 16. Hickory WB and Nanda R (1987) Effect of tensile force nical support in real-time PCR. This work was sup- magnitude on release of cranial suture cells into S phase. Am ported by Grant-in-Aids from Japan Society for the J Orthod Dentofacial Orthop 91, 328–334. Promotion of Science (No.22592036, 25462853). 17. Ikegame M, Ishibashi O, Yoshizawa T, Shimomura J, Komori T, Ozawa H and Kawashima H (2001) Tensile stress induces REFERENCES bone morphogenetic protein 4 in preosteoblastic and fibroblastic cells, which later differentiate into osteoblasts leading 1. Armstrong VJ, Muzylak M, Sunters A, Zaman G, Saxon LK, to osteogenesis in the mouse calvariae in organ culture. J Price JS and Lanyon LE (2007) Wnt/beta-catenin signaling is Bone Miner Res 16, 24–32. a component of osteoblastic bone cell early responses to load- 18. Kawaki H, Kubota S, Suzuki A, Suzuki M, Kohsaka K, bearing and requires estrogen receptor alpha. J Biol Chem Hoshi K, Fujii T, Lazar N, Ohgawara T, Maeda T, Perbal B, 282, 20715–20727. Takano-Yamamoto T and Takigawa M (2011) Differential 2. Biver E, Soubrier AS, Thouverey C, Cortet B, Broux O, roles of CCN family proteins during osteoblast differentia- Caverzasio J and Hardouin P (2012) Fibroblast growth factor tion: Involvement of Smad and MAPK signaling pathways. 2 inhibits up-regulation of bone morphogenic proteins and Bone 49, 975–989. their receptors during osteoblastic differentiation of human 19. Kim KM, Choi YJ, Hwang JH, Kim AR, Cho HJ, Hwang mesenchymal stem cells. Biochem Biophys Res Commun 427, ES, Park JY, Lee SH and Hong JH (2014) Shear stress in- 737–742. duced by an interstitial level of slow flow increases the os- 3. Bornstein P and Sage EH (2002) Matricellular proteins: ex- teogenic differentiation of mesenchymal stem cells through tracellular modulators of cell function. Curr Opin Cell Biol TAZ activation. PLoS One 9, e92427. 14, 608–616. 20. Kivelä R, Kyröläinen H, Selänne H, Komi PV, Kainulainen 4. Burstone MS (1961) Histochemical demonstration of phos- H and Vihko V (2007) A single bout of exercise with high phatases in frozen sections with naphthol AS-phosphates. J mechanical loading induces the expression of Cyr61/CCN1 Histochem Cytochem 9, 146–153. and CTGF/CCN2 in human skeletal muscle. J Appl Physiol 5. Canalis E (2009) Growth factor control of bone mass. J Cell 103, 1395–1401. Biochem 108, 769–777. 21. Kulkarni RN, Bakker AD, Everts V and Klein-Nulend J (2012) 6. Chaqour B and Goppelt-Struebe M (2006) Mechanical regu- Mechanical loading prevents the stimulating effect of IL-1β lation of the Cyr61/CCN1 and CTGF/CCN2 proteins. FEBS on osteocyte-modulated osteoclastogenesis. Biochem Biophys J 273, 3639–3649. Res Commun 420, 11–16. 7. Charoenpanich A, Wall ME, Tucker CJ, Andrews DM, Lalush 22. Kumar S, Hand AT, Connor JR, Dodds RA, Ryan PJ, Trill DS, Dirschl DR and Loboa EG (2014) Cyclic tensile strain JJ, Fisher SM, Nuttall ME, Lipshutz DB, Zou C, Hwang SM, enhances osteogenesis and angiogenesis in mesenchymal stem Votta BJ, James IE, Rieman DJ, Gowen M and Lee JC (1999) cells from osteoporotic donors. Tissue Eng Part A 20, 67–78. Identification and cloning of a connective tissue growth fac- 8. Chen JC and Jacobs CR (2013) Mechanically induced osteo- tor-like cDNA from human osteoblasts encoding a novel reg- genic lineage commitment of stem cells. Stem Cell Res Ther ulator of osteoblast functions. J Biol Chem 274, 17123– 4, 107. 17131. 9. Chen JH, Liu C, You L and Simmons CA (2010) Boning up 23. Lau K-HW, Kapur S, Kesavan C and Baylink DJ (2006) Up- on Wolff’s Law: mechanical regulation of the cells that make regulation of the Wnt, estrogen receptor, insulin-like growth and maintain bone. J Biomech 43, 108–118. factor-I, and bone morphogenetic protein pathways in 10. Eitzinger N, Surmann-Schmitt C, Bösl M, Schett G, Engelke C57BL/6J osteoblasts as opposed to C3H/HeJ osteoblasts in K, Hess A, von der Mark K and Stock M (2012) Ucma is part contributes to the differential anabolic response to fluid not necessary for normal development of the mouse skeleton. shear. J Biol Chem 281, 9576–9588. Bone 50, 670–680. 24. Lau LF (2011) CCN1/CYR61: the very model of a modern 11. Ellies DL, Economou A, Viviano B, Rey JP, Paine-Saunders S, matricellular protein. Cell Mol Life Sci 68, 3149–3163. Krumlauf R and Saunders S (2014) Wise regulates bone de- 25. Lee YJ, Park SY, Lee SJ, Boo YC, Choi JY and Kim JE (2015) 126 M. Ikegame et al.

Ucma, a direct transcriptional target of Runx2 and Osterix, primary human bone marrow-derived mesenchymal stem promotes osteoblast differentiation and nodule formation. Os- cells during osteogenic, chondrogenic and adipogenic differ- teoarthritis Cartilage 23, 1421–1431. entiation. Cell Commun Signal 3, 5. 26. Lin GL and Hankenson KD (2011) Integration of BMP, Wnt, 42. Si W, Kang Q, Luu HH, Park JK, Luo Q, Song WX, Jiang W, and notch signaling pathways in osteoblast differentiation. J Luo X, Li X, Yin H, Montag AG, Haydon RC and He TC Cell Biochem 112, 3491–3501. (2006) CCN1/Cyr61 is regulated by the canonical Wnt signal 27. Lintern KB, Guidato S, Rowe A, Saldanha JW and Itasaki N and plays an important role in Wnt3A-induced osteoblast dif- (2009) Characterization of wise protein and its molecular ferentiation of mesenchymal stem cells. Mol Cell Biol 26, mechanism to interact with both Wnt and BMP signals. J 2955–2964. Biol Chem 284, 23159–23168. 43. Su JL, Chiou J, Tang CH, Zhao M, Tsai CH, Chen PS, 28. Mantila Roosa SM, Liu Y and Turner CH (2011) Gene ex- Chang YW, Chien MH, Peng CY, Hsiao M, Kuo ML and pression patterns in bone following mechanical loading. J Yen ML (2010) CYR61 regulates BMP-2-dependent osteo- Bone Miner Res 26, 100–112. blast differentiation through the αvβ3 integrin/integrin-linked 29. Mitsui N, Suzuki N, Maeno M, Yanagisawa M, Koyama Y, kinase/ERK pathway. J Biol Chem 285, 31325–31336. Otsuka K and Shimizu N (2006) Optimal compressive force 44. Sun Y, Chen CS and Fu J (2012) Forcing stem cells to be- induces bone formation via increasing bone morphogenetic have: a biophysical perspective of the cellular microenviron- proteins production and decreasing their antagonists produc- ment. Annu Rev Biophys 41, 519–542. tion by Saos-2 cells. Life Sci 78, 2697–2706. 45. Tabuchi Y, Takasaki I, Doi T, Ishii Y, Sakai H and Kondo T 30. Mo FE, Muntean AG, Chen CC, Stolz DB, Watkins SC and (2006) Genetic networks responsive to sodium butyrate in Lau LF (2002) CYR61 (CCN1) is essential for placental de- colonic epithelial cells. FEBS Lett 580, 3035–3041. velopment and vascular integrity. Mol Cell Biol 22, 8709– 46. Taléns-Visconti R, Bonora A, Jover R, Mirabet V, Carbonell F, 8720. Castell JV and Gómez-Lechón MJ (2006) Hepatogenic dif- 31. Nakamura T, Toita H, Yoshimoto A, Nishimura D, Takagi T, ferentiation of human mesenchymal stem cells from adipose Ogawa T, Takeya T and Ishida-Kitagawa N (2010) Potential tissue in comparison with bone marrow mesenchymal stem involvement of Twist2 and Erk in the regulation of osteo- cells. World J Gastroenterol 12, 5834–5845. blastogenesis by HB-EGF-EGFR signaling. Cell Struct Funct 47. Tanikawa R, Tanikawa T, Hirashima M, Yamauchi A and 35, 53–61. Tanaka Y (2010) Galectin-9 induces osteoblast differentiation 32. Nomura S and Takano-Yamamoto T (2000) Molecular events through the CD44/Smad signaling pathway. Biochem Biophys caused by mechanical stress in bone. Matrix Biol 19, 91–96. Res Commun 394, 317–322. 33. Ouellet V and Siegel PM (2012) CCN3 modulates bone turn- 48. Thi MM, Iacobas DA, Iacobas S and Spray DC (2007) Fluid over and is a novel regulator of skeletal metastasis. J Cell shear stress upregulates vascular endothelial growth factor Commun Signal 6, 73–85. gene expression in osteoblasts. Ann N Y Acad Sci 1117, 73–81. 34. Papachroni KK, Karatzas DN, Papavassiliou KA, Basdra EK 49. Viegas CS, Simes DC, Laize V, Williamson MK, Price PA and Papavassiliou AG (2009) Mechanotransduction in osteo- and Cancela ML (2008) Gla-rich protein (GRP), a new vita- blast regulation and bone disease. Trends Mol Med 15, 208– min K-dependent protein identified from sturgeon cartilage 216. and highly conserved in vertebrates. J Biol Chem 283, 35. Parisi MS, Gazzerro E, Rydziel S and Canalis E (2006) Ex- 36655–36664. pression and regulation of CCN genes in murine osteoblasts. 50. Xing W, Baylink D, Kesavan C, Hu Y, Kapoor S, Chadwick Bone 38, 671–677. RB and Mohan S (2005) Global gene expression analysis in 36. Pearson OM and Lieberman DE (2004) The aging of Wolff’s the bones reveals involvement of several novel genes and “law”: ontogeny and responses to mechanical loading in cor- pathways in mediating an anabolic response of mechanical tical bone. Am J Phys Anthropol Suppl 39, 63–99. loading in mice. J Cell Biochem 96, 1049–1060. 37. Robinson JA, Chatterjee-Kishore M, Yaworsky PJ, Cullen 51. Zhang P, Turner CH and Yokota H (2009) Joint loading-driv- DM, Zhao W, Li C, Kharode Y, Sauter L, Babij P, Brown en bone formation and signaling pathways predicted from EL, Hill AA, Akhter MP, Johnson ML, Recker RR, Komm genome-wide expression profiles. Bone 44, 989–998. BS and Bex FJ (2006) Wnt/beta-catenin signaling is a nor- 52. Zhang X, Guo J, Zhou Y and Wu G (2014) The roles of mal physiological response to mechanical loading in bone. J bone morphogenetic proteins and their signaling in the osteo- Biol Chem 281, 31720–31728. genesis of adipose-derived stem cells. Tissue Eng Part B Rev 38. Santos A, Bakker AD, Zandieh-Doulabi B, Semeins CM and 20, 84–92. Klein-Nulend J (2009) Pulsating fluid flow modulates gene 53. Zhao H, Feng J, Ho TV, Grimes W, Urata M and Chai Y expression of proteins involved in Wnt signaling pathways in (2015) The suture provides a niche for mesenchymal stem osteocytes. J Orthop Res 27, 1280–1287. cells of craniofacial bones. Nat Cell Biol 17, 386–396. 39. Sato M, Ochi T, Nakase T, Hirota S, Kitamura Y, Nomura S 54. Zhu J, Shimizu E, Zhang X, Partridge NC and Qin L (2011) and Yasui N (1999) Mechanical tension-stress induces ex- EGFR signaling suppresses osteoblast differentiation and in- pression of bone morphogenetic protein (BMP)-2 and BMP-4, hibits expression of master osteoblastic transcription factors but not BMP-6, BMP-7, and GDF-5 mRNA, during distrac- Runx2 and Osterix. J Cell Biochem 112, 1749–1760. tion osteogenesis. J Bone Miner Res 14, 1084–1095. 55. Zuo GW, Kohls CD, He BC, Chen L, Zhang W, Shi Q, 40. Schild C and Trueb B (2004) Three members of the connec- Zhang BQ, Kang Q, Luo J, Luo X, Wagner ER, Kim SH, tive tissue growth factor family CCN are differentially regulat- Restegar F, Haydon RC, Deng ZL, Luu HH, He TC and Luo ed by mechanical stress. Biochim Biophys Acta 1691, 33–40. Q (2010) The CCN proteins: important signaling mediators 41. Schutze N, Noth U, Schneidereit J, Hendrich C and Jakob F in stem cell differentiation and tumorigenesis. Histol Histo- (2005) Differential expression of CCN-family members in pathol 25, 795–806.