GGGG Motifs Intron 3 Splicing by DQB1 Promotion of Position

Position-Dependent Repression and Promotion of DQB1 Intron 3 Splicing by GGGG Motifs

This information is current as Jana Královic?ová and Igor Vor?echovský of October 1, 2021. J Immunol 2006; 176:2381-2388; ; doi: 10.4049/jimmunol.176.4.2381 http://www.jimmunol.org/content/176/4/2381 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2006/01/27/176.4.2381.DC1 Material References This article cites 71 articles, 30 of which you can access for free at:

http://www.jimmunol.org/content/176/4/2381.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on October 1, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Position-Dependent Repression and Promotion of DQB1 Intron 3 Splicing by GGGG Motifs1

Jana Královic˘ová and Igor Vor˘echovsky´2

Alternative splicing of HLA-DQB1 exon 4 is allele-dependent and results in variable expression of soluble DQ␤. We have recently shown that differential inclusion of this exon in mature transcripts is largely due to intron 3 variants in the branch point sequence (BPS) and polypyrimidine tract. To identify additional regulatory cis-elements that contribute to haplotype-specific splicing of DQB1, we systematically examined the effect of guanosine (G) repeats on intron 3 removal. We found that the GGG or GGGG repeats generally improved splicing of DQB1 intron 3, except for those that were adjacent to the 5؅ splice site where they had the opposite effect. The most prominent splicing enhancement was conferred by GGGG motifs arranged in tandem upstream of the BPS. Replacement of a G-rich segment just 5؅ of the BPS with a series of random sequences markedly repressed splicing, whereas substitutions of a segment further upstream that lacked the G-rich elements and had the same size did not result in comparable Downloaded from splicing inhibition. Systematic mutagenesis of both suprabranch guanosine quadruplets (G4) revealed a key role of central G residues in splicing enhancement, whereas cytosines in these positions had the most prominent repressive effects. Together, these results show a significant role of tandem G4NG4 structures in splicing of both complete and truncated DQB1 intron 3, support position dependency of G repeats in splicing promotion and inhibition, and identify positively and negatively acting sequences that contribute to the haplotype-specific DQB1 expression. The Journal of Immunology, 2006, 176: 2381–2388.

ukaryotic mRNAs are transcribed as precursors contain- interact with RNA-binding factors that positively or negatively http://www.jimmunol.org/ ing intervening sequences or introns that are subsequently regulate splicing, including serine/arginine-rich (SR) proteins and E removed by splicing (1). This process is conducted by the heterogenous nuclear RNPs. SR proteins typically mediate splicing spliceosome, a macromolecular complex assembled by the step- enhancement by binding to exon splicing enhancers (reviewed in wise association of the pre-mRNA substrate with small nuclear Refs. 4 and 9), although they may also repress splicing (10, 11). ribonucleoprotein particles (snRNPs;3 U1, U2, U4/U6, and U5) The auxiliary elements are important not only in constitutive, but and a large number of non-snRNP proteins (1). In addition to these also in alternative splicing, which generates distinct mRNAs from trans-acting factors, spliceosome assembly requires the presence a single gene and plays a major role in regulating gene expression of cis-elements in the precursor (pre-)mRNAs: the 5Ј splice sites and enhancing proteomic diversity (reviewed in Ref. 12). by guest on October 1, 2021 (5Јss), 3Јss, the polypyrimidine tract (PPT), and the branchpoint A growing number of studies have shown that pre-mRNA splic- sequence (BPS). In higher eukaryotes, these signal recognition se- ing can be influenced by cis-acting elements that contain repetitive quences are degenerate and often insufficient to define exon-intron guanosines (Gs), largely acting as ISEs (13–22). The GGG motifs Ј boundaries. Auxiliary elements that activate or repress splicing, (G3) are abundant near the 5 ends of human introns and to a lesser known as exonic and intronic splicing enhancers (ISEs) or silenc- extent at the 3Ј ends (15, 23–25), suggesting that they play a role ers, allow the authentic splice sites to be correctly recognized in exon definition. The G3 runs were found to be underrepresented among pseudosites that have similar signal sequences but outnum- in ϳ100 nt intronic segments downstream of brain-specific cas- ber genuine splice sites by an order of magnitude (2, 3). Splicing sette exons as compared with controls (26), pointing to their po- silencers and enhancers have been identified through mutations or tential general importance in alternative splicing. In addition, G3 naturally occurring variants, selection experiments, and bioinfor- are common in relative enhancer and silencer classification by matics approaches (4–8), and some of them have been shown to unanimous enrichment-predicted ISE hexamers downstream of the 5Јss and upstream of the 3Јss and exhibit significant species-specific differences in the prevalence (7). Apart from the enhancing Division of Human Genetics, University of Southampton, School of Medicine, effect of G repeats on splicing, the guanosine quadruplet (G4) runs Southampton, United Kingdom located close to the 5Јss have been recently shown to mediate Received for publication August 31, 2005. Accepted for publication November silencing of a brain-region-specific exon of the GRIN1 gene (27). 16, 2005. G-rich repeats have been proposed to function cooperatively in The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance combination with exonic UAGG elements (27), but the ambiguous with 18 U.S.C. Section 1734 solely to indicate this fact. effects of G repeats on splicing are poorly understood. 1 This work was supported by the Juvenile Diabetes Research Foundation Interna- DQB1 is a highly polymorphic MHC class II gene encoding the tional, the Wellcome Trust Value in People Award, and the Annual Grant from the ␤-chains of membrane heterodimers DQ that are critical for the University of Southampton. development of adaptive immune responses and tolerance. The 2 Address correspondence and reprint requests to Dr. Igor Vor˘echovsky´, Division of Ͼ Human Genetics, University of Southampton School of Medicine, MP808, Southamp- gene has 60 alleles that are classified into five lineages desig- ton, U.K. E-mail address: [email protected] nated DQB1*02 through *06 (28). DQB1 exon 4, which encodes 3 Abbreviations used in this paper: snRNP, small nuclear ribonucleoprotein particle; the transmembrane domain of DQ␤, is fully included only in BPS, branchpoint sequence; G3, guanosine triplets; G4, guanosine quadruplets; IVS, DQB1*02 and *05 mRNAs, whereas the DQB1*03, *04, and *06 intervening sequence or intron; ISE, intronic splicing enhancers; SNP, single nucleotide polymorphism; hnRNP, heterogeneous nuclear RNP; sHLA, soluble molecules; alleles show partial exon exclusion. Proteins immunoprecipitated ss, splice sites; PPT, polypyrimidine tract. with a mAb against DQ were found in supernatants of cultured

cells that produce mRNAs lacking this exon, but not in those that do not generate these transcripts (29). Differential skipping of exon 4 results from poor recognition of the 3Јss of intron 3, which is largely due to single nucleotide polymorphisms (SNPs) that weaken the BPS and PPT (30). DQB1 intron 3 contains several polymorphic G repeats, but their signiﬁcance in the allele-speciﬁc expression of this gene is unclear. In this study, we have used splicing reporter assays to systematically examine the effects of G repeats on intron 3 splicing. We

show that two G4 motifs arranged in tandem upstream of the exon 4 BPS are key G-rich ISEs, whereas the same motifs located just proximal to the 5Јss inhibit intron 3 splicing. Our results support position dependency of these elements in splicing enhancement and repression and identify important intronic signatures that in- ﬂuence allele-dependent expression of this disease gene.

Materials and Methods Splicing reporter constructs

The development of allele-speciﬁc DQB1 splicing reporters was described Downloaded from previously (30). For mutagenesis, we used a reporter construct that contained exons 3 through 6 of the DQB1*0602 allele (Fig. 1A). This minigene was cloned into the mammalian expression vector pCR3.1 (Invitrogen Life Technologies) as described elsewhere (30). Mutated minigenes were prepared by overlap-extension PCR (31) and validated by sequencing as described previously (32). Truncations in intron 3 were introduced as previously described (30). The mutated constructs contained the following replacements of the suprabranch region (Fig. 1A): Ran1, random sequence http://www.jimmunol.org/ generated by an online random sequence tool, available at http://tandem. bu.edu/rsg.html; ran2, a randomly mutated suprabranch sequence of adenovirus major late as described elsewhere (33); and IIIa, sequence upstream FIGURE 1. DQB1 sequences upstream of the BPS enhance intron 3 of an adenovirus BPS that was previously implicated in a repressive effect of ASF/SF2 on splicing (10). DQB1 exon 5, which encodes a cytoplasmic splicing. A, Schematic representation of splicing reporter constructs. Open portion of the ␤-chain, is not included on the HLA-DQB1*0602 allele due boxes in the upper panel represent exons (E; drawn to scale); lines repre- to an inactivating 3Јss SNP of intron 4 (34, 35). Full sequences of intron 3 sent introns (IVS; not to scale). Scale units are base pairs (bp). Slash in- and 4/5 are shown as a multiple alignment of DQB1 alleles.4 Exon 4 se- dicates intron truncations as described previously (30). Segments 1 and 2 quences are available from the HLA/IMGT database (28). The nucleotide are shown as small open rectangles; the exon 4 BPS is shown as a small

sequence of the wild-type DQB1 segment 2 (Fig. 1A) was TGG ACT TCA closed rectangle. Correctly spliced and intron 3-retaining isoforms are by guest on October 1, 2021 ACT CCT CAG CAG G. shown schematically above and below the splicing reporter construct, re- Cell cultures and transfections spectively. The lower panel shows nucleotide sequences of wild-type and mutated segment 1. G4 in position IVS3–33-36 and IVS3–40-43 of the Highly transfectable human embryonic kidney 293T cells were grown un- wild-type sequence are boxed. Cytosine substitutions introduced in G4 re- der standard conditions in RPMI 1640 supplemented with 10% (v/v) FCS peats are underlined. The relative distance (bp) from the 3Јss of intron 3 is (Invitrogen Life Technologies). Transient transfections were performed in indicated on a scale at the bottom. SNPs IVS3–36A/G and IVS3–38A/G 6- or 12-well plates using FuGENE 6 (Roche) as described previously (30, are denoted by stars. B, Sequence-specific enhancement of intron 3 splic- 36), with a plating density ϳ2 and ϳ1 ϫ 105 cells/well, respectively. The ing. RNA products are schematically shown on the right. White, gray, and medium was changed when reaching ϳ50% confluency 2 h before transfection. Plasmids were purified with the Wizard Plus SV Minipreps (Pro- black boxes represent exons 3, 4, and 6 as in panel A; retained intron 3 is mega). Cells were harvested for RNA extraction 48 h posttransfection. shown as a line. ‘No transfection’ and ‘no template’ controls are not shown. The type of DQB1 construct (complete or truncated intron 3) used Detection of RNA products for mutagenesis is shown at the bottom. Total RNA was isolated using Tri-Reagent (Sigma-Aldrich) and treated ␮ ␮ with DNase I (Ambion) according to the manufacturers’ recommendations. mM creatine phosphate, RNasin, and 1 g/ l tRNA at 30°C for 20 min. First-strand cDNA was reverse transcribed using oligo(dT) primers and The samples were irradiated on ice with a 254-nm UV cross-linker (Ul- 15 2 ␮ Moloney murine virus reverse transcriptase (Promega). PCR products were tralum) at 1.9 J/cm and digested with RNase T1 (0.8 U/ l) and RNase A ␮ amplified with primers directed to vector sequences and with a combina- (0.4 U/ l) (Ambion) at 37°C for 30 min. Cross-linked proteins were re- Ϫ tion of cDNA and vector primers as described (30) to validate the ratios of solved by SDS-PAGE followed by autoradiography at 70°C. RNA products. Exon inclusion levels were measured with FluorImager 595 Exon 4 inclusion of murine H2-IA genes using FluorQuant and Phoretix software (Nonlinear Dynamics) as described previously (30, 36). Mouse cDNA samples were prepared from total RNA isolated from freshly prepared thymus, spleen, and PBMC of strains C3H (haplotype H-2k),

UV cross-linking C57BL (H-2b), and DBA (H-2d) using oligo(dT)15 primers. Amplification primers were 523 (AGK AAT GGG GAC TGG ACC TTC; K is G and T), A 115-nt PCR product was amplified with primers A (5Ј-TAA TAC GAC 939 (AGA CAG AGA CTG GGG GAC TCC), 68 (CAG GGA CTG AGG TCA CTA TAG GGT GGA CTT CAA CTC CTC AGC AGG GAT; T7 GCG GAA ACT), and 907 (GCT GAG GTG GTG GAT ACA ATA). promoter sequence is in italics) and B (5Ј-CTG GGC AGA TTC AGA CT; Mouse strains were purchased from Harlan U.K. Fig. 1A) and plasmid reporter DNA as a template. PCR products were gel purified using the MinElute kit (Qiagen). Riboprobes were transcribed us- Results ing the MAXIScript kit (Ambion) in the presence of [␣-32P]GTP (Amer- sham). RNAs were incubated in 10-␮l reaction mixtures containing HeLa A G-rich segment upstream of the BPS modulates splicing of

nuclear and S100 extracts (4C Biotech), 2 mM MgCl2, 0.5 mM ATP, 20 DQB1 intron 3 Intron 3 is weakly spliced due to poor recognition of the 3Јss on 4 The online version of this article contains supplemental material. the DQB1*03, DQB1*04, and DQB1*06 alleles, resulting in exon The Journal of Immunology 2383

4 skipping (30). In contrast, the remaining two DQB1 lineages show constitutional inclusion of this exon in mRNAs (30). Allele- dependent intron 3 retention and exon 4 skipping are largely influenced by the IVS3–24A/C/T and IVS3–6C/T SNPs in the BPS and PPT, respectively, with a subset of exon 4 variants contributing to differential exon skipping only to a small extent (30). A 20-nt region upstream of the BPS has been shown to bind components of splicing factor SF3a/SF3b in a sequence-independent manner and to facilitate U2 snRNP anchoring (33, 37). To study the significance of polymorphic suprabranch sequences in DQB1 splicing, we examined the splicing pattern of the DQB1*0602 minigene with truncated intron 3. This reporter pre- mRNA generates a mixture of intron 3-retaining and correctly spliced transcripts 48 h posttransfection (30), thus providing a sen- sitive assay for testing auxiliary cis-elements. We replaced two adjacent 22-nt segments (designated 1 and 2; Fig. 1A; see intron 3 alignments4) upstream of exon 4 BPS with random sequences (designated ran1 and ran2) and with a sequence upstream of adenovirus BPS (termed IIIa). The latter sequence was previously associated with a repressive effect of the SR protein ASF/SF2 on Downloaded from splicing (10). Segment 1 was separated from the BPS by two adenosines, while segment 2 was immediately adjacent to segment 1 further upstream (Fig. 1A and footnote 4). We transiently transfected wild-type and mutated reporter constructs into 293T cells and examined their splicing products. Intron 3 splicing was im- FIGURE 2. G upstream of the BPS are the most effective G-rich ISEs. http://www.jimmunol.org/ paired in all constructs in which segment 1 was replaced, whereas 4 A, The upper panel shows a schematic representation of G3 and G4 repeats identical substitutions of segment 2 did not reduce splicing, except (open boxes) in exon 4 (gray box) and flanking intronic sequences (lines). for a small inhibitory effect of the randomly generated sequence Arrows indicate the G4 motifs upstream of the BPS (closed rectangle). The ran1 (Fig. 1B). lower panel shows RNA products of splicing reporters mutated systemat-

Because segment 1 had tandem arranged G4 runs that were ab- ically in each G run in exon 4 and ﬂanking intronic sequences. % spl., sent in segment 2 (Fig. 1A), we next tested whether its stimulating percentage of correctly spliced products relative to the sum of natural tran- effect on splicing is inﬂuenced by these elements. We introduced scripts, transcripts with intron 3 retention and exon skipping. Means and SD (SD) were computed from two duplicate transfection experiments. B, G to C transversions in both G4 and examined RNA products after transfection of wild-type and mutated constructs. All transversions Effect of mutations in intron 3 and exon 4 G repeats on splicing of the DQB1 minigenes containing complete intron 3. % ES, percentage of exon by guest on October 1, 2021 dramatically increased intron 3 retention (Fig. 1B). Together, these 4 skipping; % IR, percentage of intron retention; hd, heteroduplexes. Re- results suggested that segment 1 contains G-rich ISE(s) and that porter constructs are schematically shown below each panel. the G repeats may be critical for the enhancing effect mediated by segment 1.

G4 upstream of the BPS are key G-rich ISEs of DQB1 intron 3 To confirm the importance of suprabranch G4 runs in the context of complete intron 3, we mutated a subset of G repeats in con- Next, we examined the influence of G repeats on DQB1 splicing structs carrying the wild-type, 509-nt intron with a total of 11 G . systematically by mutating each G and G in exon 4 and in flank- 3 3 4 As expected, mutations of the suprabranch G showed the largest ing intronic sequences (Fig. 2A and footnote 4). The wild-type 4 reduction of splicing, whereas mutations in the remaining G re- DQB1*0602 construct carrying truncated intron 3 has two runs of peats had only minor or no effects, including tandem arranged G G and three runs of G . The latter motifs are close to the 5Јss and, 3 3 4 B in a tandem arrangement, just upstream of exon 4 BPS. This BPS, in the middle of intron 3 (nucleotide position 265 and 274, Fig. 2 which is located in intron positions Ϫ21 to Ϫ27 relative to the and footnote 4). Interestingly, G3 mutations in positions 60–61 of 3Јss, is the best match to a mammalian consensus within 40 nt exon 4, which were in the vicinity of a previously identified exon upstream of authentic 3Јss (30), was predicted through comparison splicing enhancer 5D (30), markedly decreased exon skipping. of human and mouse introns (38) and confirmed by mutagenesis Together, these results showed that G4 located just upstream of and branchpoint mapping (30). The G run adjacent to the BPS is BPS are key G-rich ISEs that promote splicing of both full-length 4 Ј and truncated DQB1 intron 3, whereas a G4 motif located 5 ss invariable, whereas the G4 motif further upstream and the inter- proximal acts as an intronic splicing silencer. vening sequence between the two G4 contain G/A SNPs IVS3–38 and IVS3–36, respectively (Fig. 1A). Examination of RNA products after transfection of mutated A critical role of central G residues in splicing enhancement minigenes showed that intron 3 splicing was markedly repressed 4 by mutations that disrupt tandem G runs located upstream of the To define a role of individual nucleotides in both suprabranch G4

BPS (Fig. 2A). Single or double mutations of G3 further upstream ISEs, we mutated systematically G in each position into A, T, and reduced splicing less (IVS3–51-52), while most mutations of G3 in C and transfected mutated reporters into 293T cells (Fig. 3, A and exon 4 had no or only minor effects (mutations 60/61, 75, 76/77, B). Mutations of the second and third Gs were most effective in 81/82). By contrast, mutations in the G repeats that were located repressing intron 3 splicing. G to C substitutions resulted in the ϩ ϩ close to the splice sites of intron 3 (IVS3 7 and E4 2/3) im- strongest inhibition of intron 3 splicing in both G4 runs, with uri- proved intron 3 splicing. dines and adenosines exhibiting smaller effects. 2384 DISSECTION OF ALLELE-SPECIFIC EXPRESSION OF SOLUBLE DQ␤

FIGURE 4. Detection of protein binding to a G4-containing DQB1 pre- mRNAs. UV cross-linking of uniformly [␣-32P] GTP-labeled wild-type (wt) and mutated RNA probes to ϳ45–50 kDa proteins in HeLa nuclear (NE) or S100 (lane 1) extracts. A NE-speciﬁc ϳ68 kDa protein was present in both UV-treated and untreated samples (not shown). The pattern of ϳ45–50 kDa proteins corresponds to that observed for the hnRNP H/HЈ/F subfamily (27). Downloaded from

ratio of correctly spliced to intron 3-retaining transcripts was sim-

ilar, all substitutions of CϪ31 increased exon skipping, suggesting that this nucleotide plays an important role in exon deﬁnition.

Because the tandem G4 runs upstream of the BPS are the only G repeats that are very close to one another in intron 3, it is pos- http://www.jimmunol.org/ sible that the GxNyGx structures have a stronger effect on splicing if the y values are small. To test whether the length of the gap between G runs is important for DQB1 splicing, we inserted an FIGURE 3. G to C substitutions in central positions of suprabranch G 4 additional 3 and 6 bp after the first nucleotide of the intervening are the most potent repressor mutations. A, Systematic mutagenesis of sequence (Fig. 3D). However, transfection of the mutated con- proximal G4. Mutations are shown at the indicated intronic positions above the panel. Means of two transfection experiments in triplicate (SD) are structs into 293T cells and examination of their splicing pattern did shown below. RNA products are schematically shown on the right. % spl., not reveal significant alterations of intron removal, suggesting that percentage of correctly spliced transcripts. B, Systematic mutagenesis of the distance between the two runs in this range is not critical. distal G . C, Influence of the IVS3–38G/A SNP and the AC box on intron Finally, because G4-rich sequences have been shown to act as 4 by guest on October 1, 2021 3 splicing. The AC dinucleotide is located just downstream of the proximal binding sites for the member(s) of the H/F family heterogeneous Ϫ Ϫ G4 in positions 31 to 32 (Fig. 1A). Mutated construct are shown above, nuclear RNPs (hnRNPs) (13, 18, 19, 40–47), we attempted to D, The length of inter-G4 sequence and intron 3 splicing. Sequences of tri- identify proteins that bind to suprabranch G runs. Both wild-type and hexanucleotides inserted between the tandem G4 are shown above. and mutated GTP-labeled pre-mRNA substrates were subjected to UV cross-linking in HeLa nuclear and S100 cytoplasmic extracts

A central nucleotide in the 3-nt intervening sequence between the two G4 runs (Fig. 1A) is polymorphic, with the A allele associated with the DQB1*02 lineage and the G allele with the remaining lineages (28, 30). Assuming previously determined allelic fre- quencies at DQB1 (39) and absolute linkage disequilibrium between exon 2 specificities and this variant, the frequency of the A allele is ϳ25% and ϳ22% in white and black populations, respectively. The first nucleotide of the proximal G4 motif is also polymorphic, with the invariant G allele present in the DQB1*02, *05, and *06 lineages (28, 30). To test the influence of these variants on splicing, we prepared reporter constructs containing mutations to the other allele in these positions. Both the IVS3– 38G3A and IVS3–36G3A mutations reduced intron 3 splicing to a small extent (Fig. 3, A and C), consistent with an increased exon skipping of the latter SNP, which was previously observed for constructs with complete intron 3 (30). The structure of the suprabranch ISE (G N G ; Fig. 1) was re- 4 3 4 ␤ markably similar to G N G elements identified previously in the FIGURE 5. Exon 4 of murine H2-IA is constitutively included in 3 3 3 mRNA. A, RT-PCR with two pairs of PCR primers (left) using cDNA human ␣-globin gene (22) and a G N G motif found in the gene 4 3 4 preparations from three H2-IA␤-expressing tissues (top) of three mouse for human growth hormone (20). The activity of the latter ISE was strains (bottom) that carry haplotypes d (49),b, and k (50). RNA products Ј modified by an adjacent AC element (20). Because the 3 G4 run are shown schematically on the right side. B, multiple alignment of the just upstream of the DQB1 BPS was also followed by this dinu- available H2-IA␤ alleles at the 3Јss of intron 3. SNPs are shown as stars. cleotide (Fig. 1A), we systematically substituted each AϪ32CϪ31 Putative branch point is shown as å. Full intron 3 sequences are available position with the remaining nucleotides (Fig. 3C). Although the as a multiple alignment.4 The Journal of Immunology 2385

Table I. Comparison of the effects of intronic G3 and G4 repeats on splicing of mammalian pre-mRNA substrates

Pre-mRNA Substrate Sequence Contexta Structure of G Repeats Distance between the G Runs and the ss Effect on Splicing Reference

␣-globin CGGGCCTGGGCCGCACTGAC G3N0–4G3 29–35 nt upstream of 3Јss and 3 nt ISE 15, 22 upstream of predicted BPS

E1␣ pyruvate dehydrogenase GGTGGGGCCGG(GϾA)GCCAAGGC G4CCG4 18 nt downstream of 5Јss of intron 7 ISE 71

Src GTAGAGGGGGATGCTTCGCT G5N16G5 23 and 44 nt downstream of 5Јss (the ISE. Binds hnRNP H, 13, 16, 17 GAGGCTGGGGGCTGCTCTCT 3Ј end of exon N1) which interacts with hnRNP F

␤-tropomyosin GCTGCTGGGGGGGCAGAG...(RG1) G4N2G3 (RG1); RG1 is 22 nt downstream of 5Јss; ISE that binds a 55-kDa 19 AGGGTTGAGGGGAGCAGGGT (RG2) G3N4G4N4G3N9G4(RG2–RG3) RG2 is 49 nt downstream of 5Јss; protein CCTTCACTGGGGTGAAGAAC (RG3) RG3 is 29 nt upstream of predicted branch site adenosine

Neuroﬁbromin TCTTGCTGGG/GTAAGTAAAT G4 Bridging the 5Јss Promotes 5Јss selection. 46 Binds hnRNP H, restricting accessibility of U1 snRNP

Cystathionine ␤-synthase TGGGGTGGATCATCCAGGTGGGG G4N14G4 44 and 62 nt upstream of distal 3Јss Promotion of distal 3Јss in 45 vivo. Binds hnRNP H1

Cardiac troponin T CTGGGGCTGACCTGCAACAG G4N12G4N3G3N12G4N14G4 The ﬁrst G run is 49 nt downstream ISE. Promotion of homo- 14, 21

AAGTGGGGCTGAGGGAAGGA of the 3Ј end of 5-nt microexon and heterologous exon Downloaded from CTGTCCTGGGGACTGGTGTC inclusion if inserted AGAGCGGGGTTGGTGACTCT either upstream or downstream of microexon. Binds SF1. Enhancer effect weakened with increasing distance

from the exon http://www.jimmunol.org/

Bcl-x CAG/GTAGTGAATGAACTCTTC G4N6G4 25 nt downstream of distal 5Јss Promotion of distal 5Јss in 47 CGGGATGGGGTAAACTGGGGTC vitro and in vivo. Binds hnRNP F and H.

Thyroid hormone receptor GAGGGTGTGCGGAGCTGGTGGG G3N14G4N16G4N4G3 141–191 nt downstream of 5Јss ISE. Binds ASF/SF2 and 44 GAGGAGCCTGGAGAGAAGGGGC hnRNP H AGAGCTGGGGGCTGAGGGAGA

Proteolipid protein TAACAAGGGGTGGGGGAAAA G4NG4 34 nt downstream of the 5Јss of Oligodendrocyte-speciﬁc 72 intron 3 ISE promoting exon 3 splicing by guest on October 1, 2021 Growth hormone GGCGGGGATGGGGGAGACC G4N1–4G4 26 nt downstream of 5Јss ISE - promotes exon 3 20 splicing

DQB1 ATGGGGT(A3G)T(G3A)GGGACA G4N3G4 28–44 nt upstream of 3Јss ISE This study

Glutamate NMDA R1 GTAAGGGGAAGAGCACCCC G4 5 nt downstream of 5Јss Intronic splicing silencer 27 receptor (GRIN1)

DQB1 GTAAGG(G3A)GATATTGAGTTT G4, except for the DQB1*05 5 nt downstream of 5Јss Intronic splicing silencer This study lineage

a Predicted BPS is in italics; 3, naturally occurring mutations or polymorphisms; /, splice site. G runs are underlined; AC dinucleotides are boxed.

(Fig. 4). Both substrates cross-linked to several proteins of 50). We, therefore, examined the inclusion of mouse exon 4 in ϳ45–50 kDa (Fig. 4), a size range corresponding to hnRNPs the H2-I-A␤ mRNAs of three inbred mouse strains carrying Ј H/H /F observed previously for G4-containing pre-mRNAs (27). haplotypes that were previously fully sequenced (Fig. 5A and This pattern was similar for the wild-type and mutated reporters, footnote 4). However, RT-PCR with two independent primer presumably due to the presence of other G4 repeats in the substrate, pairs revealed no detectable amounts of transcripts lacking the although the CϪ42 pre-mRNA gave a somewhat weaker signal. transmembrane exons (Fig. 5B). This suggests that, in contrast Together, these results showed that central G4 guanosines were to the weakly spliced human exon 4 (30), the mouse homolog is the most important nucleotides for the G4N3G4-mediated splicing constitutively included in mature transcripts on the available enhancement, whereas the influence of polymorphic variants or haplotypes. Interestingly, examination of sequence alignments inter-G4 distance on splicing was minor or insignificant. They also of the mouse (49, 50) and the rat (51) introns showed a com- showed an important role of cytosine Ϫ31 in exon 4 inclusion and plete absence of tandem arranged G runs upstream of the pre- confirmed a previously observed cross-linking pattern, consistent dicted BPS.4 This finding raises the hypothesis that the su- with binding the hnRNP H/HЈ/F family of proteins. prabranch G-rich ISEs identified in this study have been selected in humans to promote splicing of poorly recognized ␤ Exon 4 of the mouse H2-IA is constitutively included in mRNA intron 3 and to maintain sufficient expression of natural DQB1 Alternative splicing of conserved exons is frequently species spe- transcripts that encode membrane-bound molecules. cific and these events modify conserved domains in proteins more frequently than other classes of alternative splicing (48). Human Discussion and mouse exons encoding the transmembrane domain of DQ␤ are Membrane proteins are often regulated by mechanisms that release highly conserved, with a nucleotide identity of ϳ90% (28, 49, their soluble forms from its membrane anchorage (52). More than 2386 DISSECTION OF ALLELE-SPECIFIC EXPRESSION OF SOLUBLE DQ␤

40% of alternatively spliced genes that encode single-pass trans- the observed silencing effects. The comparison in Table I also membrane proteins produce splice variants lacking exons coding reveals that G-rich ISEs are often tandem arranged structures that for the transmembrane domains, potentially generating soluble are separated by an intervening sequence of a variable length and protein isoforms (53). Alternatively spliced HLA transcripts that composition. The length of the intervening sequence is often very lack transmembrane exons enter the endocytic compartment, are short, up to several nucleotides, with longer sequences often within released by cells, and can be detected as soluble molecules (sHLA) the 12–18 nt range, raising a speculation that their overall length in body fluids (29, 54). sHLAs may induce apoptosis of alloreac- distribution may not be random. A recent analysis of the interven- tive T cells in vitro, modulate immune responses, and play a role ing loops in G quadruplexes showed that the loop length was sig- in the induction and maintenance of peripheral tolerance (55, 56). nificantly deviated from a random distribution, suggesting that the In addition, serum levels of sHLA are increased in inflammatory intervening sequences, which play a role in determining the qua- and autoimmune diseases and correlate positively with disease ac- druplex stability, are under selective pressure (65). Interestingly, tivity and autoantibody titers (54, 57), further supporting a phys- some of the intervening sequences in tandem G repeats (Table I) iological role for sHLA. matched those that are among the most frequent in quadruplex In healthy individuals, serum sHLA levels vary on different loops, such as CCT, CT, CC, AAA, and AA (66). Although ex- HLA haplotypes (58) and in vitro, the amount of soluble DQ mol- tending the gap between G repeats did not alter splicing (Fig. 3D), ecules in culture supernatants has been linked to the haplotype- we could not exclude a confounding effect of newly introduced specific expression of transcripts lacking DQB1 exon 4 (29). In nucleotides. Ј this, and in our recent study (30), we have begun to dissect mo- The inhibitory influence of G4 close to the 5 ss and stimulatory lecular mechanisms underlying differential expression of mRNA effects of identical G runs located further away from the 5Јss strik- isoforms lacking exon 4, the most prominent example of allele- ingly resembled those recently described for sequences flanking Downloaded from dependent alternative splicing in the MHC class II region. We have the CI cassette exon of the GRIN1 gene (27). The GRIN1 G4 is identified a suprabranch segment that promoted splicing of both located in the same intron position relative to the 5Јss (ϩ5toϩ8) Ј full-length and truncated DQB1 intron 3 and found that G repeats as the 5 proximal G4 in DQB1 intron 3 (Fig. 2A and footnote 4) in this segment were critical enhancer elements (Fig. 1). Because and cytosine substitutions in the GRIN1 motif also markedly en- mutations of these motifs markedly diminished natural transcripts hanced exon inclusion (27). The presence of adenosine in position in our minigene splicing assays, germline mutations of these in- IVS3ϩ7ontheDQB1*05 alleles is likely to weaken this silencer http://www.jimmunol.org/ tronic sequences are likely to alter the expression of DQB1. Like- and contribute to efficient splicing of intron 3, which is character- Ј wise, a subset of polymorphisms in these elements such as IVS3– istic of this DQB1 lineage (30). Although 5 ss proximal G4 were 31G/A (Fig. 3C) is likely to contribute to the allele-specific found to be associated with exon skipping (27), DQB1 exon 3 is splicing pattern of DQB1. The importance of intronic mutations or constitutively included in the mRNA, but allele-specific differ- variants in gene expression is supported by recent estimates ex- ences in the inclusion of this highly polymorphic, ␤2 domain- ploiting the complete set of disease genes with a newly developed encoding exon cannot be excluded. probabilistic model, suggesting that ϳ62% of human disease gene Our systematic mutagenesis of suprabranch G repeats showed mutations alter splicing and that splicing mutations are the most that cytosines were the most efficient repressors of intron 3 splic- by guest on October 1, 2021 common cause of hereditary disorders (59). Indeed, deficient pre- ing, with the second and third position being the most effective. mRNA splicing has been shown to result in HLA null alleles (60– This pattern is very similar to that observed for tandem G4 runs in 62). Although these cases are uncommon, they are likely to be an ISE located upstream of the putative BPS of GH1 exon 4 (20). underrepresented because intronic regions of the MHC class II and In addition, G to C substitutions in the 5Јss proximal GRIN1 other disease genes have been analyzed for mutations only excep- GGGG motif were also powerful activators of splicing (27). A tionally. Similarly, clonal somatic mutations in these intronic el- similar systematic analysis of a splicing silencer element derived ements in tumor cells may contribute to a failure to express mature from a sense Alu repeat showed that cytosines had the strongest HLA Ags. stimulatory effect on exon inclusion (67). ␣ In addition to DQB1, the -chain-encoding DQA1 gene also un- In summary, our results showed that G4N3G4 structures up- dergoes allele-dependant alternative splicing of exon 4. Apart from stream of the branch site promote splicing of DQB1 intron 3 and the recently described diversity of DQA1 mRNAs generated by al- that the central Gs in both repeats are the most powerful splicing ternative polyadenylation (63, 64), this gene produces exon 4-lacking enhancers. A significant influence of G repeats on splicing and transcripts spliced to downstream splice sites in the 3Ј untranslated exon inclusion suggests that naturally occurring DNA variants that region. Our analysis of expressed sequence tag libraries showed that remove or create these elements may alter the amounts of natural DQA1 sequences lacking exon 4 were derived from alleles in linkage transcripts or relative expression of alternatively spliced isoforms, disequilibrium with exon-skipping transcripts DQB1*03/*04 (Gen- thus contributing to interindividual differences in gene expression Bank accession numbers CA309994.1, BF891581.1, BF891575.1, and phenotypic variability. In addition to exonic variants that com- BF963070.1, BF896819.1, BF891027.1, BF950596.1, BF891573.1, monly affect exon inclusion (4, 30, 68, 69), the influence of G-rich and BF890947.1) and DQB1*06 (BG537384), suggesting that they intronic variants on gene expression, such as a GGG insertion/ may participate in the expression of soluble DQ molecules. deletion polymorphism in an OCA1 intron (70), may be underap-

In contrast to the suprabranch G repeats, G4 motifs located close preciated, and it will be interesting to examine variants in these to the 5Јss inhibited intron 3 splicing (Fig. 2A). Comparison of the motifs in future studies. previously reported G3 and G4 runs that affected splicing (Table I) suggests that, except for a G repeat bridging the 5Јss (46), their Disclosures Ј 5 ss proximal location was associated with splicing inhibition, The authors have no ﬁnancial conﬂict of interest. whereas their more distal position with splicing promotion. The effect of G4 motifs is likely to depend on the relative distance from the splice sites that are sequentially recognized by a number of References 1. Burge, C. B., T. Tuschl, and P. A. Sharp. 1999. Splicing of precursors to mRNAs splicing factors. The proximity of these motifs to the splice sites by the spliceosome. In The RNA World. R. F. Gesteland, T. R. Cech, and A. J. F., might involve a distinct set of interactions that would account for eds. Cold Spring Harbor Lab. Press, New York, pp. 525–560. The Journal of Immunology 2387

2. Fairbrother, W. G., and L. A. Chasin. 2000. Human genomic sequences that 33. Gozani, O., R. Feld, and R. Reed. 1996. Evidence that sequence-independent inhibit splicing. Mol. Cell. Biol. 20: 6816–6825. binding of highly conserved U2 snRNP proteins upstream of the branch site 3. Sun, H., and L. A. Chasin. 2000. Multiple splicing defects in an intronic false is required for assembly of spliceosomal complex A. Genes Dev. 10: exon. Mol. Cell. Biol. 20: 6414–6425. 233–243. 4. Cartegni, L., S. L. Chew, and A. R. Krainer. 2002. Listening to silence and 34. Larhammar, D., J. J. Hyldig-Nielsen, B. Servenius, G. Andersson, L. Rask, and understanding nonsense: exonic mutations that affect splicing. Nat. Rev. Genet. 3: P. A. Peterson. 1983. Exon-intron organization and complete nucleotide sequence 285–298. of a human major histocompatibility antigen DC ␤ gene. Proc. Natl. Acad. Sci. 5. Fairbrother, W. G., R. F. Yeh, P. A. Sharp, and C. B. Burge. 2002. Predictive USA 80: 7313–7317. identification of exonic splicing enhancers in human genes. Science 297: 35. Senju, S., A. Kimura, M. Yasunami, N. Kamikawaji, H. Yoshizumi, 1007–1013. Y. Nishimura, and T. Sasazuki. 1992. Allele-specific expression of the cytoplas- 6. Zhang, X. H., and L. A. Chasin. 2004. Computational definition of sequence mic exon of HLA-DQB1 gene. Immunogenetics 36: 319–325. motifs governing constitutive exon splicing. Genes Dev. 18: 1241–1250. 36. Královic˘ová, J., M. B. Christensen, and I. Vor˘echovsky´. 2005. Biased exon/intron 7. Yeo, G., S. Hoon, B. Venkatesh, and C. B. Burge. 2004. Variation in sequence distribution of cryptic and de novo 3Ј splice sites. Nucleic Acids Res. 33: and organization of splicing regulatory elements in vertebrate genes. Proc. Natl. 4882–4898. Acad. Sci. USA 101: 15000–15005. 37. Gozani, O., J. Potashkin, and R. Reed. 1998. A potential role for U2AF-SAP 155 8. Wang, Z., M. E. Rolish, G. Yeo, V. Tung, M. Mawson, and C. B. Burge. 2004. interactions in recruiting U2 snRNP to the branch site. Mol. Cell. Biol. 18: Systematic identification and analysis of exonic splicing silencers. Cell 119: 4752–4760. 831–845. 38. Kol, G., G. Lev-Maor, and G. Ast. 2005. Human-mouse comparative analysis 9. Graveley, B. R. 2000. Sorting out the complexity of SR protein functions. RNA reveals that branch-site plasticity contributes to splicing regulation. Hum. Mol. 6: 1197–1211. Genet. 14: 1559–1568. 10. Kanopka, A., O. Muhlemann, and G. Akusja¨rvi. 1996. Inhibition by SR proteins 39. Mignot, E., L. Lin, W. Rogers, Y. Honda, X. Qiu, X. Lin, M. Okun, of splicing of a regulated adenovirus pre-mRNA. Nature 381: 535–538. H. Hohjoh, T. Miki, S. Hsu, et al. 2001. Complex HLA-DR and -DQ inter- 11. Ibrahim el, C., T. D. Schaal, K. J. Hertel, R. Reed, and T. Maniatis. 2005. Serine/ actions confer risk of narcolepsy-cataplexy in three ethnic groups. arginine-rich protein-dependent suppression of exon skipping by exonic splicing Am. J. Hum. Genet. 68: 686–699. enhancers. Proc. Natl. Acad. Sci. USA 102: 5002–5007. 40. Matunis, M. J., J. Xing, and G. Dreyfuss. 1994. The hnRNP F protein: unique primary structure, nucleic acid-binding properties, and subcellular localization.

12. Graveley, B. R. 2001. Alternative splicing: increasing diversity in the proteomic Downloaded from world. Trends Genet. 17: 100–107. Nucleic Acids Res. 22: 1059–1067. 13. Min, H., R. C. Chan, and D. L. Black. 1995. The generally expressed hnRNP F 41. Blanchette, M., and B. Chabot. 1999. Modulation of exon skipping by high- is involved in a neural-specific pre-mRNA splicing event. Genes Dev. 9: affinity hnRNP A1-binding sites and by intron elements that repress splice site 2659–2671. utilization. EMBO J. 18: 1939–1952. 14. Carlo, T., D. A. Sterner, and S. M. Berget. 1996. An intron splicing enhancer 42. Fogel, B. L., and M. T. McNally. 2000. A cellular protein, hnRNP H, binds to the containing a G-rich repeat facilitates inclusion of a vertebrate micro-exon. RNA negative regulator of splicing element from Rous sarcoma virus. J. Biol. Chem. 2: 342–353. 275: 32371–32378. 15. McCullough, A. J., and S. M. Berget. 1997. G triplets located throughout a class 43. Caputi, M., and A. M. Zahler. 2001. Determination of the RNA binding speci- of small vertebrate introns enforce intron borders and regulate splice site selec- ficity of the heterogeneous nuclear ribonucleoprotein (hnRNP) H/H’/F/2H9 fam- http://www.jimmunol.org/ tion. Mol. Cell. Biol. 17: 4562–4571. ily. J. Biol. Chem. 276: 43850–43859. 16. Modafferi, E. F., and D. L. Black. 1997. A complex intronic splicing enhancer 44. Hastings, M. L., C. M. Wilson, and S. H. Munroe. 2001. A purine-rich intronic from the c-src pre-mRNA activates inclusion of a heterologous exon. Mol. Cell. element enhances alternative splicing of thyroid hormone receptor mRNA. RNA Biol. 17: 6537–6545. 7: 859–874. 17. Chou, M. Y., N. Rooke, C. W. Turck, and D. L. Black. 1999. hnRNP H is a 45. Romano, M., R. Marcucci, E. Buratti, Y. M. Ayala, G. Sebastio, and component of a splicing enhancer complex that activates a c-src alternative exon F. E. Baralle. 2002. Regulation of 3Ј splice site selection in the 844ins68 poly- in neuronal cells. Mol. Cell. Biol. 19: 69–77. morphism of the cystathionine ␤-synthase gene. J. Biol. Chem. 277: 18. Chen, C. D., R. Kobayashi, and D. M. Helfman. 1999. Binding of hnRNP H to 43821–43829. an exonic splicing silencer is involved in the regulation of alternative splicing of 46. Buratti, E., M. Baralle, L. De Conti, D. Baralle, M. Romano, Y. M. Ayala, and the rat ␤-tropomyosin gene. Genes Dev. 13: 593–606. F. E. Baralle. 2004. hnRNP H binding at the 5Ј splice site correlates with the 19. Sirand-Pugnet, P., P. Durosay, E. Brody, and J. Marie. 1995. An intronic (A/ pathological effect of two intronic mutations in the NF-1 and TSH␤ genes. Nu- U)GGG repeat enhances the splicing of an alternative intron of the chicken ␤-tro- cleic Acids Res. 32: 4224–4236. by guest on October 1, 2021 pomyosin pre-mRNA. Nucleic Acids Res. 23: 3501–3507. 47. Garneau, D., T. Revil, J. F. Fisette, and B. Chabot. 2005. Heterogeneous nuclear 20. McCarthy, E. M., and J. A. Phillips, 3rd. 1998. Characterization of an intron ribonucleoprotein F/H proteins modulate the alternative splicing of the apoptotic splice enhancer that regulates alternative splicing of human GH pre-mRNA. mediator Bcl-X. J. Biol. Chem. 280: 22641–22650. Hum. Mol. Genet. 7: 1491–1496. 48. Pan, Q., M. A. Bakowski, Q. Morris, W. Zhang, B. J. Frey, T. R. Hughes, and 21. Carlo, T., R. Sierra, and S. M. Berget. 2000. A 5Ј splice site-proximal enhancer B. J. Blencowe. 2005. Alternative splicing of conserved exons is frequently spe- binds SF1 and activates exon bridging of a microexon. Mol. Cell. Biol. 20: cies-specific in human and mouse. Trends Genet. 21: 73–77. 3988–3995. 49. Malissen, M., T. Hunkapiller, and L. Hood. 1983. Nucleotide sequence of a light 22. McCullough, A. J., and S. M. Berget. 2000. An intronic splicing enhancer binds chain gene of the mouse I-A subregion: A␤d. Science 221: 750–754. U1 snRNPs to enhance splicing and select 5Ј splice sites. Mol. Cell. Biol. 20: 50. Choi, E., K. McIntyre, R. N. Germain, and J. G. Seidman. 1983. Murine I-A ␤ 9225–9235. chain polymorphism: nucleotide sequences of three allelic I-A ␤ genes. Science 23. Nussinov, R. 1988. Conserved quartets near 5Ј intron junctions in primate nuclear 221: 283–286. pre-mRNA. J. Theor. Biol. 133: 73–84. 51. Eccles, S. J., and W. R. McMaster. 1985. DNA sequence analysis of a rat RT1 24. Engelbrecht, J., S. Knudsen, and S. Brunak. 1992. G ϩ C-rich tract in 5Ј end of class II A ␤ gene. Immunogenetics 22: 653–663. human introns. J. Mol. Biol. 227: 108–113. 52. Rose-John, S., and P. C. Heinrich. 1994. Soluble receptors for cytokines and 25. Majewski, J., and J. Ott. 2002. Distribution and characterization of regulatory growth factors: generation and biological function. Biochem. J. 300: 281–290. elements in the human genome. Genome Res. 12: 1827–1836. 53. Xing, Y., Q. Xu, and C. Lee. 2003. Widespread production of novel soluble 26. Brudno, M., M. S. Gelfand, S. Spengler, M. Zorn, I. Dubchak, and protein isoforms by alternative splicing removal of transmembrane anchoring J. G. Conboy. 2001. Computational analysis of candidate intron regulatory domains. FEBS Lett. 555: 572–578. elements for tissue-specific alternative pre-mRNA splicing. Nucleic Acids 54. Aultman, D., I. Adamashvili, K. Yaturu, M. Langford, F. Gelder, M. Gautreaux, Res. 29: 2338–2348. G. E. Ghali, and J. McDonald. 1999. Soluble HLA in human body fluids. Hum. 27. Han, K., G. Yeo, P. An, C. B. Burge, and P. J. Grabowski. 2005. A combinatorial Immunol. 60: 239–244. code for splicing silencing: UAGG and GGGG motifs. PLoS Biol. 3: e158. 55. Zavazava, N., and M. Kronke. 1996. Soluble HLA class I molecules induce 28. Robinson, J., M. J. Waller, P. Parham, N. de Groot, R. Bontrop, L. J. Kennedy, apoptosis in alloreactive cytotoxic T lymphocytes. Nat. Med. 2: 1005–1010. P. Stoehr, and S. G. Marsh. 2003. IMGT/HLA and IMGT/MHC: sequence da- 56. Rhode, P. R., M. Burkhardt, J. Jiao, A. H. Siddiqui, G. P. Huang, and tabases for the study of the major histocompatibility complex. Nucleic Acids Res. H. C. Wong. 1996. Single-chain MHC class II molecules induce T cell activation 31: 311–314. and apoptosis. J. Immunol. 157: 4885–4891. 29. Briata, P., S. F. Radka, S. Sartoris, and J. S. Lee. 1989. Alternative splicing of 57. Kippner, L., C. Klint, G. Sturfelt, A. A. Bengtsson, H. Eriksson, and HLA-DQB transcripts and secretion of HLA-DQ ␤-chain proteins: allelic poly- L. Truedsson. 2001. Increased level of soluble HLA class I antigens in systemic morphism in splicing and polyadenylylation sites. Proc. Natl. Acad. Sci. USA 86: lupus erythematosus: correlation with anti-DNA antibodies and leukopenia. 1003–1007. J. Autoimmun. 16: 471–478. 30. Královic˘ová, J., S. Houngninou-Molango, A. Kra¨mer, and I. Vor˘echovsky´. 2004. 58. Weyand, C. M., M. Jendro, and J. J. Goronzy. 1991. Soluble HLA-DR molecules Branch sites haplotypes that control alternative splicing. Hum. Mol. Genet. 13: in patients with HLA class II versus class I associated disorders. Autoimmunity 8: 3189–3202. 281–287. 31. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. 59. Lopez-Bigas, N., B. Audit, C. Ouzounis, G. Parra, and R. Guigo. 2005. Are Site-directed mutagenesis by overlap extension using the polymerase chain re- splicing mutations the most frequent cause of hereditary disease? FEBS Lett. 579: action. Gene 77: 51–59. 1900–1903. 32. Vor˘echovsky´, I., L. Luo, M. J. Dyer, D. Catovsky, P. L. Amlot, J. C. Yaxley, 60. Elsner, H. A., G. Bernard, B. Eiz-Vesper, M. de Matteis, A. Bernard, and L. Foroni, L. Hammarstro¨m, A. D. Webster, and M. A. Yuille. 1997. Clustering R. Blasczyk. 2002. Non-expression of HLA-A*2901102 N is caused by a nucle- of missense mutations in the ataxia-telangiectasia gene in a sporadic T-cell leu- otide exchange in the mRNA splicing site at the beginning of intron 4. Tissue kaemia. Nat. Genet. 17: 96–99. Antigens 59: 139–141. 2388 DISSECTION OF ALLELE-SPECIFIC EXPRESSION OF SOLUBLE DQ␤

61. Curran, M. D., F. Williams, A. M. Little, B. K. Rima, J. A. Madrigal, and 67. Lei, H., and I. Vor˘echovsky´. 2005. Identiﬁcation of splicing silencers and en- D. Middleton. 1999. Aberrant splicing of intron 1 creates a novel null HLA- hancers in sense Alus: a role for pseudo-acceptors in splice site repression. Mol. B*1501 allele. Tissue Antigens 53: 244–252. Cell. Biol. 25: 6912–6920. 62. Reinders, J., E. H. Rozemuller, H. G. Otten, A. J. Houben, A. Dormoy, 68. Kashima, T., and J. L. Manley. 2003. A negative element in SMN2 exon 7 A. Mulder, J. G. van den Tweel, E. J. Petersen, and M. G. Tilanus. 2005. Iden- inhibits splicing in spinal muscular atrophy. Nat. Genet. 34: 460–463. tiﬁcation of HLA-A*0111N: a synonymous substitution, introducing an alterna- 69. Pagani, F., C. Stuani, M. Tzetis, E. Kanavakis, A. Efthymiadou, S. Doudounakis, tive splice site in exon 3, silenced the expression of an HLA-A allele. Hum. T. Casals, and F. E. Baralle. 2003. New type of disease causing mutations: the Immunol. 66: 912–920. example of the composite exonic regulatory elements of splicing in CFTR exon 63. Hoarau, J. J., F. Festy, M. Cesari, and M. Pabion. 2005. A new splicing acceptor 12. Hum. Mol. Genet. 12: 1111–1120. site and poly(A)ϩ sequence signal within DQA1*0401 and DQA1*0501 mRNA 3ЈUTR contribute to increase the extraordinary diversity of mRNA isoforms. 70. Tsai, C. H., F. J. Tsai, J. Y. Wu, S. P. Lin, J. G. Chang, C. F. Yang, and C. C. Lee. Immunogenetics 57: 182–188. 1999. Insertion/deletion mutations of type I oculocutaneous albinism in chinese 64. Hoarau, J. J., M. Cesari, H. Caillens, F. Cadet, and M. Pabion. 2004. HLA DQA1 patients from Taiwan. Hum. Mutat. 14: 542. genes generate multiple transcripts by alternative splicing and polyadenylation of 71. Mine, M., M. Brivet, G. Touati, P. Grabowski, M. Abitbol, and C. Marsac. 2003. the 3Ј untranslated region. Tissue Antigens 63: 58–71. Splicing error in E1␣ pyruvate dehydrogenase mRNA caused by novel intronic 65. Huppert, J. L., and S. Balasubramanian. 2005. Prevalence of quadruplexes in the mutation responsible for lactic acidosis and mental retardation. J. Biol. Chem. human genome. Nucleic Acids Res. 33: 2908–2916. 278: 11768–11772. 66. Todd, A. K., M. Johnston, and S. Neidle. 2005. Highly prevalent putative 72. Hobson, G. M., Z. Huang, K. Sperle, D. L. Stabley, H. G. Marks, and F. Cambi. quadruplex sequence motifs in human DNA. Nucleic Acids Res. 33: 2002. A PLP splicing abnormality is associated with an unusual presentation of 2901–2907. PMD. Annu. Neurol. 52: 477–488. Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021