A Novel Salicylanilide Derivative Induces Autophagy Cell Death In

Published OnlineFirst September 17, 2019; DOI: 10.1158/1535-7163.MCT-19-0387

MOLECULAR CANCER THERAPEUTICS | SMALL MOLECULE THERAPEUTICS

A Novel Salicylanilide Derivative Induces Autophagy Cell Death in Castration-Resistant Prostate Cancer via ER Stress-Activated PERK Signaling Pathway Chia-Ling Hsieh1,2, Hsu-Shan Huang3, Kuan-Chou Chen4,5,6, Teigi Saka4, Chih-Ying Chiang1, Leland W.K. Chung7, and Shian-Ying Sung1,2,8,9

ABSTRACT ◥ Metastatic castration-resistant prostate cancer (CRPC) is cur- CRPC cells, and it was associated with the suppressed AKT/ rently incurable. Cancer growth and progression is intimately mTOR signaling pathways, a major negative regulator of autop- affected by its interaction with host microenvironment. Cotargeting hagy. Moreover, an expanded morphology of the endoplasmic of the stroma and prostate cancer is therefore an emerging ther- reticulum (ER), increased expression of the ER stress markers apeutic strategy for metastatic CRPC. Cancer-induced osteoclas- GRP78 and PERK, and eIF2a phosphorylation were observed. togenesis is known to contribute to CRPC bone metastasis. This Blockage of autophagy and PERK pathways using small molecule study is to extend pharmacologic value of our synthesized LCC03, a inhibitors or shRNA knockdown reversed LCC03-induced derivative of 5-(20,40-difluorophenyl)-salicylanilide that has pre- autophagy and cell death, thus indicating that the PERK–eIF2a viously testified for its osteoclastogenesis activity, by exploring its pathway contributed to the LCC03-induced autophagy. Further- additional cytotoxic properties and underlying mechanism in more, treatment of tumor-bearing mice with intraperitoneal CRPC cells. LCC03 was chemically synthesized and examined for administered LCC03 suppressed the growth of CRPC xenografts cell growth inhibition in a serial of CRPC cell lines. We dem- in mouse bone without systemic toxicity. The dual action of onstrated that LCC03 dose-dependently suppressed proliferation 5-(20,40-difluorophenyl)-salicylanilide on targeting both the and retarded cell-cycle progression in CRPC cells. The classical osteoclasts and the tumor cells strongly indicates that LCC03 autophagy features, including autophagosome formation and is a promising anticancer candidate for preventing and treating LC3-II conversion, were dramaticallyshowninLCC03-treated metastatic CRPC.

Introduction ton (1). Bone metastasis and skeletal complications are the major contributing factors to morbidity and mortality in patients with Despite high response rates to androgen deprivation therapy in prostate cancer. Over time, the conventional treatment is ineffec- men with advanced prostate cancer, nearly all types of prostate tive, and the patients die of CRPC; the survival time is less than cancer are eventually progression to the androgen-independent 19 months. Although new therapies (and drugs), including tubulin stage, which is termed castration-resistant prostate cancer (CRPC). targeting chemotherapy (cabazitaxel), immunotherapy (sipuleucel-T), CRPC is an incurable stage of prostate cancer, in which approx- the steroidogenesis inhibitor (abiraterone), AR antagonist (enzalu- imately 90% of patients develop metastases, mainly in the skele- tamide), and a-emitting radiotherapy (radium-223), have shown promising results in impairing the tumor growth and extending survival, a considerable proportion of patients with CRPC become 1The Ph.D. Program for Translational Medicine, College of Medical Science and unresponsive or become resistant to these treatment after a short Technology, Taipei Medical University, Taipei, Taiwan. 2TMU Research Center of period (2). The development of novel therapeutics that target 3 Cancer Translational Medicine, Taipei Medical University, Taipei, Taiwan. Grad- distinct mechanisms of action is necessary to overcome resistance uate Institute of Cancer Molecular Biology and Drug Discovery, College of in patients with CRPC. Medical Science and Technology, Taipei Medical University, Taipei, Taiwan. 4Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical The endoplasmic reticulum (ER) plays pivotal roles in cell homeo- University, Taipei, Taiwan. 5Department of Urology, College of Medicine, Taipei stasis and survival, which involved in biosynthesis of lipids, regulation Medical University, Taipei, Taiwan. 6Department of Urology, Taipei Medical of intracellular calcium concentration and metabolism of carbohy- University-Shuang Ho Hospital, New Taipei City, Taiwan. 7Department of Med- drates, and synthesis and folding of proteins. The accumulation of 8 icine, Cedars-Sinai Medical Center, Los Angeles, California. Joint Clinical misfolded proteins within the ER lumen induces ER stress that triggers ﬁ Research Center, Of ce of Human Research, Taipei Medical University, Taipei, the unfolded protein response (UPR), an evolutionarily adaptive Taiwan. 9Clinical Research Center, Taipei Medical University Hospital, Taipei Medical University, Taipei, Taiwan. mechanism for restoring ER homeostasis; thus, UPR protects cells against the toxic accumulation of misfolded proteins (3). Under Note: Supplementary data for this article are available at Molecular Cancer environmental stress, such as nutrient deprivation or hypoxia, malig- Therapeutics Online (http://mct.aacrjournals.org/). nant cells are particularly prone to protein misfolding and UPR Corresponding Author: Shian-Ying Sung, The Ph.D. Program for Translational activation, which lead to tumor progression and survival (4). However, Medicine, College of Medical Science and Technology, Taipei Medical University, 250 Wu-Hsing Street, Taipei 11031, Taiwan. Phone: 88-62269-72035, ext. 105; in contrast to cytoprotection, recent studies have highlighted the role E-mail: [email protected] of severe or unresolved ER stress in cell death (5); unsolved ER stress has been previously associated with various human diseases, including Mol Cancer Ther 2019;XX:XX–XX atherosclerosis (6), neurodegenerative disorders (7), and type 2 dia- doi: 10.1158/1535-7163.MCT-19-0387 betes (8). Therefore, the pharmacologic modulation of cellular 2019 American Association for Cancer Research. responses toward ER stress-induced cell death pathway may prevent

AACRJournals.org | OF1

Hsieh et al.

tumor development and growth, thus representing an attractive using an ECL Kit (Advansta) and an AI 600 chemiluminescent therapy for different cancers (9), including prostate cancer. imaging and analysis system (GE Healthcare Life Sciences). Each blot Cancer growth and progression is intimately affected by its inter- was performed at least twice. action with the adjacent host microenvironment, that comprised of various stromal cell types, growth factors, and extracellular matrices, Gene knockdown and thus presents an attractive target for therapeutic intervention (10). Small hairpin RNA (shRNA) expression plasmids, including Salicylanilides are a key class of aromatic pharmacophore, comprising pLKO.1-shPERK (TRCN0000262373, target sequence TGCATCT- amides of salicylic acid and aniline. Salicylanilides derivatives have GCCTGGTTACTTAA), pLKO.1-shAtg7 (TRCN0000007584, target been reported to possess myriad pharmacological activities, such as sequence GCCTGCTGAGGAGCTCTCCAT; TRCN0000007587, antimicrobial [against bacterial (11), mycobacteria (12), viruses (13), target sequence CCCAGCTATTGGAACACTGTA), and a mam- and fungi (14)], anti-inflammatory (15), and antitumor proper- malian nontargeting shRNA control pLKO.1-shGFP (sh-ctr, ties (16). Recently, a novel function of 5-(20,40-difluorophenyl)-sali- TRCN0000072178, target sequence, CAACAGCCACAACGTCTA- cylanilide derivatives as potent inhibitors of osteoclastogenesis has also TAT) were obtained from the National RNAi Core Facility (Institute of been discovered (17–19). Because pathological osteoclast activation is Molecular Biology). The recombinant lentivirus was generated by associated with an increased risk of tumor progression (20), subse- transfecting shRNA plasmids along with the packaging plasmids quent skeletal complications and death due to metastatic CRPC, in this pCMV-cR8.91(Gag/Pol/Rev) and pMD.G (VSV-G envelope) in study, the additional pharmacological value of 5-(20,40-difluorophe- 293FT cells and used for infecting the PC3 and C4-2 cells according nyl)-salicylanilide was examined by determining its effect and eluci- to a previously described protocol (23). The extent of gene knockdown dating mechanism of action underlying its direct cytotoxicity to CRPC was determined through an immunoblotting assay. cells. Transmission electron microscopy Sample preparation for TEM were prepared with aid from the Materials and Methods Imaging Core at Taipei Medical University. Briefly, the cells grown on Cell lines and cell culture plastic chamber slides were fixed using 2% paraformaldehyde (PFA) Human prostate cancer cell lines: PC3, DU145, C4-2, and and 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.4) CWR22Rv1 were originally obtained from ATCC. Human benign for 30 minutes at room temperature and then subjected to postfixation prostatic hyperplasia (BPH) epithelial cell line BPH-1 was a kind gift of with 2% osmium tetroxide. After dehydration in ascending grades of Dr. Su-Hwa Lin (The University of Texas MD Anderson Cancer ethanol and propylene oxide, the samples were embedded in Epon. Center). No further authentication was performed by authors. The Epon polymerization was conducted at 62 C for 48 hours. Ultrathin cells were maintained in RPMI1640 medium (Thermo Fisher Scien- sections (approximately 70 nm in thickness) were obtained using an tific) containing 10% FBS (GeneDireX), 100 U/mL of penicillin, and ultramicrotome (Leica Ultracut UCT; Leica Microsystems GmbH) and 100 mg/mL of streptomycin (Thermo Fisher Scientific) at 37C under 5 were collected on 100 mesh copper grids. After double staining with %CO2 for less than 25 passages after thawing and routinely testing uranyl acetate and lead citrate, the sections were examined under a negative for Mycoplasma contamination using a PCR Mycoplasma Hitach H-600 Transmission Electron Microscope operating at 100 kV. Detection Kit (Abcam) to conduct described experiments. Immunofluorescence staining Chemicals The PC3 and C4-2 cells transfected with the EGFP-LC3 (24) N-(3,4-difluorophenyl)-20,40-difluoro-4-hydroxy[1,10-biphenyl]- plasmid (a gift from Karla Kirkegaard; Addgene plasmid #11546) 3-carboxamide (C19H11F4NO2; LCC03) was chemically synthesized were grown on coverslips for overnight and treated with DMSO or using previously published procedures (21). The chemical structure LCC03 combined with GSK2606414 for 72 hours. After removing the of LCC03 is shown in Fig. 1A. 3-Methyladenine (3-MA, PubChem culture media, the cells were fixed using 4% PFA and washed thrice CID:135398661), an autophagy inhibitor was purchased from using PBS. Subsequently, the cells were stained with DAPI and then Sigma-Aldrich. Selective PERK inhibitor GSK2606414 (PubChem mounted in ProLong Gold Antifade reagent (Thermo Fisher Scien- CID:53469448) was purchased from EMD Millipore. tific). Images of the cells were acquired using a Carl Zeiss LSM 510 META confocal microscope (Carl Zeiss) equipped with a Plan Apoc- Cell proliferation and viability assay hromat 63 oil/1.4 NA DIC objective. The cytotoxic effects of LCC03 was assayed using a WST-1 Cell Proliferation Assay Kit (Roche Applied Science) following the man- Animal studies ufacturer's protocol. The IC50 was calculated as the concentration of Animal experiments were approved by the Institutional Animal Care sample needed to reduce 50% of the absorbance compared with the and Use Committee of Taipei Medical University (LAC-2016-0345) dimethyl sulfoxide (DMSO)-treated control. The viability of the PC3 and complied with their regulations. Six-week-old male nude mice and C4-2 cells treated with LCC03 in the absence or presence of 3-MA (BALB/cAnN.Cg-Foxn1nu/CrlNarl) were purchased from the National (2 mmol/L) for 72 hours was assessed through trypan-blue exclusion Laboratory Animal Center (Taipei, Taiwan) and maintained under the (Thermo Fisher Scientific). All assays were done in 6 replicates on at specific pathogen-free conditions and cared for according to the criteria least 4 independent experiments. outlined in the National Academy of Sciences Guide for the Care and Use of Laboratory Animals. To initiate experimental prostate bone Western blot analysis metastasis in the xenograft models, the mice were anesthetized by Protein expression was analyzed as performed previously (22). The Zoletil and Rompun mixture, and subjected to an intraosseous injection primary antibodies were listed in Supplementary Table S1. After of 2 105 PC3-Luc cells into the mouse tibia following our previously incubation with an HRP-conjugated secondary antibody (1:5,000; GE established protocol (23). One week after cell injection, the tumor- Healthcare Life Sciences), the corresponding bands were detected bearing mice were randomized and given the following intraperitoneal

OF2 Mol Cancer Ther; 2019 MOLECULAR CANCER THERAPEUTICS

Salicylanilide as an Autophagy Inducer for CRPC Therapy

Figure 1. Effect of LCC03 on cell growth and cell-cycle progression in prostate cancer cell lines. A, Rational design synthesis and chemical structures of small molecule LCC03. B, Proliferation of benign (BPH) and malignant prostate cancer cell lines treated with a serial of doses of LCC03 for 48 hours was determined using the WST-1 assay. Relative cell proliferation is presented as the mean SD percentage of absorbance (at 450 nm) compared with the DMSO-vesicle–treated control (0 mmol/L LCC03) for at least 4 independent experiments (n 4). C, Bar graphs of the percentages of G1,S,andG2–M populations in the PC3 and C4-2 cells treated with the DMSO vesicle control and the indicated concentrations of LCC03 for 48 hours. The results of 1 of 3 independent experiments are shown. D, Western blotting analysis of cell- cycle checkpoint markers. b-Actin is shown as the protein loading control. The expected molecular weight of each protein is indicated on the left side of the figure. treatments twice per week for 4 weeks (n ¼ 10 for each group): (i) IHC staining untreated, (ii) DMSO, (iii) LCC03 (20 mg/kg), and (iv) LCC03 Bone specimens were fixed in 10% neutral buffered formalin for (40 mg/kg). The tumor growing in the bone were monitored through 24 hours. They were then decalcified using 14% EDTA (pH 7.2) for bioluminescent imaging (BLI) weekly by using the IVIS 2000 system 14 days at room temperature and embedded in paraffin. IHC and the Living Image software (Caliper Life Sciences) for quantification analyses were performed using the Novolink Polymer Detection of luminescence intensity. The body weights of all the mice were System (Leica Microsystems) with the following antibodies: mouse measured thrice per week for 4 weeks. The mice were sacrificed at monoclonal anti-Ki-67 antibody (1:100; Clone GM010; Genemed 5 weeks after the initial treatment and the heart, lung, kidney, liver, Biotechnologies) and rabbit polyclonal anti-human LC3B (1:50; spleen, and tibia were excised for histopathologic analyses. Before the LS-B9807; LifeSpan BioSciences). The extent of apoptosis and animals were sacrificed, blood samples were collected to analyze osteoclastogenesis was evaluated using an Apo-BrdU-IHC In Situ biochemical parameters with aid from the TMU Animal Care Facility. DNA Fragmentation Assay Kit (BioVision, Inc.) and a TRACP &

AACRJournals.org Mol Cancer Ther; 2019 OF3

Hsieh et al.

ALP Double-Stain Kit (TaKaRa), respectively following the man- blotting analysis further confirmed the time- and dose-dependent ufacturer's instructions. repression of cyclin D1 as well as the cdc2/cyclin B complex activity by LCC03 in both cell lines (Fig. 1D), thus indicating a strong effect of Statistical analysis LCC03 on the cell-cycle checkpoints. Statistical analysis was performed using GraphPad Prism 6 (Graph- Pad Software). Data are presented as mean SD and % change versus LCC03 causes cytotoxic activity through autophagy but not via controls. Difference between 2 groups was measured by Student t test. an apoptosis-dependent pathway A probability value of P < 0.05 was considered statistically significant. The cytotoxic effect of LCC03 on prostate cancer cell survival was assessed through the trypan blue assay after incubating the cells for 3 days with LCC03. LCC03 treatment reduced cell viability in a dose- Results dependent manner (Fig. 2A), which was similar to the effect of LCC03 induces growth retardation and cell-cycle arrest in LCC03 on cell proliferation. We then assessed whether the cytotoxic prostate cancer cells effect of LCC03 on prostate cancer cells was correlated with increased Treating patients with CRPC remains a substantial clinical chal- apoptosis. Notably, the percentage of annexin V-positive cells lenge. Thus, we assessed whether LCC03, a novel derivative of 5-(20,40- increased only slightly among the PC3 cells and decreased among difluorophenyl)-salicylanilide (Fig. 1A), is potentially toxic to a series the C4-2 cells, when the cells were treated with LCC03 (up to their of CRPC-like cell lines, including androgen receptor (AR)-positive cell respective IC50 concentrations) for 72 hours (Supplementary lines C4-2 and CWR22rv1 and the AR-negative cell lines PC3 and Fig. S2A). Moreover, Western blotting analysis revealed that only DU145. A cell proliferation assay revealed that the incubation of minimal cleavage of PARP and caspase 3 was detectable in LCC03- prostate cancer cells with LCC03 for 48 hours caused a marked and treated cells (Supplementary Fig. S2B). Collectively, these data indi- dose-dependent growth inhibition (Fig. 1B). The IC50 in different cell cate that LCC03-induced cytotoxicity was not closely associated with lines was 0.69 to 4.8 mmol/L (Table 1). By contrast, the cell prolifer- the apoptotic cell death. ation of benign hyperplastic prostatic epithelial cells (BPH-1) was Recent studies have identified autophagy as the major mechanism of < m unaffected by LCC03 at a concentration of 5 mol/L. The IC50 value cell death in addition to apoptosis in response to cellular stress. Hence, of LCC03 for BPH-1 (15.7 mmol/L) cells was 3 to 20 times higher than we examined whether autophagy is induced by LCC03 and whether it that for the cancerous cells, thus indicating that LCC03 is selectively has a critical role in mediating cell death. Cyto-ID green fluorescent more toxic to cancerous cells than to noncancerous cells. The highest dye was used to stain autophagic vacuoles in the cells and the fl fi fl IC50 value of LCC03 was observed in the PC3 cell line, which was uorescence intensity was quanti ed through ow cytometry. Similar originally derived from patient bone metastases. The lowest IC50 value to the treatment with the autophagy inducers tunicamycin and of LCC03 was observed in the C4-2 cells; thus, the C4-2 cells were most rapamycin, an increase in fluorescent intensity was observed in the sensitive to LCC03. These 2 cell lines were selected for subsequent PC3 and C4-2 cells after treatment of LCC03 for 72 hours, thus investigation of the anticancer properties of LCC03. suggesting the induction of autophagy (Fig. 2B). To confirm this We analyzed the cell-cycle distribution in the PC3 and C4-2 cells result, TEM was performed for ultrastructural analysis. Numerous after 48 hours of incubation with LCC03 to characterize the anti- autophagic vacuoles and empty vacuoles were observed in the LCC03- proliferative properties of LCC03 in detail. We observed dose- treated PC3 cells, and most of the autophagic vacuoles contained intact – dependent accumulation of the PC3 cells in the G2 M phase on lamellar structure and/or residual digested materials (Fig. 2C). The LCC03 exposure (Supplementary Fig. S1A and S1C, PC3). The DMSO-vesicle treated control exhibited only a few autophagic fea- – increase in the (G2 M phase) was coupled with a reduction in tures. The Western blot analysis results (Fig. 2D) revealed a time- and percentage of cells in the G0–G1 phase. In the C4-2 cells, LCC03 dose-dependent increase in the conversion of LC3B-I to LC3B-II, treatment increased the proportion of cells in the G1 phase and reduced which is a hallmark of macroautophagy. LCC03 also induced a the proportion of cells in the G2 phase (Supplementary Fig. S1A and higher amount of the autophagy factor Atg12-Atg5 conjugate S1C, C4-2). The effect of LCC03 on cell-cycle progression was also between 48 and 72 hours after treatment, and its induction was supported by the result of mRNA array-based gene profiling analysis, associated with increased LC3B conversion in both cell lines. which showed a marked change in the cell-cycle pathway in the PC3 Notably, Beclin-1 protein, a key regulator complexed with class III cells after treatment with LCC03 (Supplementary Fig. S1B). Western PI3K for autophagosome formation through dissociation from the anti-apoptotic protein Bcl2, was upregulated concomitantly with a decreased in Bcl2 in the C4-2 cells after treatment with LCC03. However, no significant changes were observed in the PC3 cells, Table 1. Summary of IC50 values for LCC03 in 1 human benign prostate hyperplasia (BPH) and 4 prostate cancer cell lines after thus suggesting that LCC03 elicited a canonical or noncanonical – 48 hours' treatment. autophagic pathway in a cell-type dependent manner. Because Bcl- 2 is a prosurvival protein, the increased expression of Bcl-2 seen in

Mean IC50 SD PC3 cells after the longer exposure (72 hours) of LCC03 might Cell line (mmol/L)a contribute to helping cell surviving under treatment, by which PC3 cells acquire more resistance than C4-2 cells to the cytotoxic effects BPH-1 15.7322 8.944 of LCC03. In addition, blockage of autophagosome formation by C4-2 0.688 0.061 CWR22r-v1 2.57 0.55 using 3-MA, a PI3K inhibitor, or genetically knocking down ATG7 ﬁ PC3 4.48 2.58 autophagy-related 7 ( ) expression signi cantly attenuated the DU145 2.64 0.83 induction of autophagosome marker expression and restored the viability of cells treated with LCC03 (Fig. 2E and F), thus con- aAll values were presented as mean SD of 6 replicates in 4 independent ﬁrming that LCC03 induced cytotoxicity in prostate cancer cells experiments. through activation of autophagy.

OF4 Mol Cancer Ther; 2019 MOLECULAR CANCER THERAPEUTICS

Salicylanilide as an Autophagy Inducer for CRPC Therapy

Figure 2. Effect of LCC03 on autophagy activation in CRPC cells. A and F, Trypan blue staining for cell viability assay of the (A) parental and (F) ATG-(sh-ATG) and nontargeting shRNA-expressing (sh-ctr) PC3 and C4-2 cells treated with the indicated concentrations of LCC03, and with or without autophagy blocker 3-MA for 72 hours. Data are presented as mean SD of 5 independent experiments (n ¼ 5). , P < 0.05; , P <0.005 versus vesicle control. B, Representative flow cytometry histogram of 3 independent assays (n ¼ 3) for CytoID fluorescence in the PC3 cells. Cells treated with 10 mg/mL tunicamycin or rapamycin as a positive control. Cell acquisition was performed on Attune Nxt flow cytometer (Thermo Fisher Scientific) and analyzed using FlowJo 10.2 software. C, TEM images with different magnifications of the PC3 cells treated with DMSO vesicle control and LCC03. Images are representative of 3 independent treatments. D and E, Western blot analyses of the proteins involved in autophagy from the total cell extracts of the (D) parental and (E) shRNA-expressing PC3 and C4-2 cells treated with the indicated concentrations of LCC3. b-Actin is shown as the protein loading control. The expected molecular weight of each protein is indicated on the left side of the figure. The cells were treated with LCC03 for 72 hours in all assays unless specified otherwise.

LCC03 activates ER-stress–induced PERK–eIF2a–ATF4 addition to the autophagosome-like vesicles, TEM revealed that the signaling pathway LCC03-treated cells exhibited abnormal ER expansion (Fig. 3B). To gain a better insight into the LCC03-induced autophagic path- Therefore, we determined whether LCC03 could induce an ER stress ways, we identified autophagy-related signaling molecules. The kinase response and subsequently regulate autophagy. The Western blot mTOR is a critical regulator of autophagy induction. The phosphor- analysis results revealed upregulation of GRP78 expression, which ylation of mTOR suppresses autophagy, whereas the dephosphoryla- indicated the activation of ER stress (Fig. 3C). Moreover, LCC03 tion of mTOR promotes autophagy. Our results identified significant treatment considerably increased the expression of the ER stress sensor downregulation of p-mTOR level in C4-2 and PC3 cells treated with PERK, the levels of phosphorylated eIF2a and ATF4, and the ATF4 LCC03 (Fig. 3A). This downregulation of p-mTOR was strongly downstream target genes CHOP (a transcription factor known to associated with Akt inactivation by dephosphorylation alone in the induce autophagy) and TRIB3 (a negative regulator of Akt activation) PC3 cells or together with reduced expression of total Akt protein in in a time- and dose-dependent manner. These results demonstrated the C4-2 cells. The expression of AMPK, a negative regulator of that the PERK–eIF2a–signaling pathway was activated during LCC03- mTOR, although did not differ significantly between the LCC03- and induced ER stress. DMSO-treated cells, the phosphorylation of AMPK-a was massively induced upon LCC03 treatment. Collectively, these findings indicate Blockage of the PERK activation attenuates the LCC03-induced that LCC03 triggered autophagy activation in the prostate cancer cells autophagic cell death via an AMPK- and Akt-dependent mTOR pathway. We investigated whether LCC03-induced autophagic cell death in Several reports have reported that ER-stress-activated UPR can the tested cells was mechanistically related to ER stress signaling trigger several signaling pathways that cause autophagy (25, 26). In pathways by using pharmacological and genetic approaches to inhibit

AACRJournals.org Mol Cancer Ther; 2019 OF5

Hsieh et al.

Figure 3. Time and dose effect of LCC03 on ER stress activation in CRPC cells. A and C, Western blotting analysis of signaling molecules involved in (A) autophagy and (C)ER stress activation in the PC3 and C4-2 cells. b-Actin is shown as the protein loading control. The expected molecular weight of each protein is indicated on the left side of the ﬁgure. B, Ultrastructural analysis of ER stress activation in the PC3 cells treated with DMSO or 10 mmol/L LCC03 for 48 hours through TEM. Asterisks indicate the enlarged ER. Images are representative of 3 independent treatments.

ER stress sensor PERK activity. Stable transfection of EIF2AK3- exposed to LCC03 (Fig. 4B). We further analyzed autophagosome targeting shRNA (sh-PERK) significantly suppressed PERK expres- formation in the PC3 and C4-2 cells that were transfected with a sion, blocked LCC03-induced upregulation of LC3B conversion, and plasmid expressing autophagosome-associated LC3 protein fused to inhibited eIF2a phosphorylation compared with cells transfected with green fluorescent protein (GFP-LC3). In the GFP-LC3 transfected negative control shRNA (Fig. 4A). Similarly, inhibition of PERK cells, treatment with LCC03 resulted in an increase in the redistribu- kinase activity by using the compound GSK2606414 slightly increased tion of green fluorescence from diffused to a punctum pattern in the the basal levels of PERK; however, it prevented the phosphorylation of perinuclear region. Treatment with GSK2606414 also suppressed the eIF2 a and the conversion of LC3B-I to LC3B-II when the cells were LCC03-induced autophagosome formation, which was indicated by

OF6 Mol Cancer Ther; 2019 MOLECULAR CANCER THERAPEUTICS

Salicylanilide as an Autophagy Inducer for CRPC Therapy

Figure 4. Effect of PERK antagonists on LCC03-induced cell death in CRPC cells. A and B, Western blotting analysis of PERK signaling molecules involved in autophagy activation and in the PC3 and C4-2 cells that (A) stably expressed PERK-targeting shRNA or (B) were treated with PERK inhibitor GSK2606414 in the presence of the indicated concentration of LCC03 for 48 hours. Nontargeting shRNA (sh-ctr) and DMSO treatment (0 mmol/L LCC03) are the corresponding negative controls. C, Representative confocal fluorescent images of the PC3 and C4-2 cells transfected with LC3-GFP followed by the treatment of PERK inhibitor GSK2606414 or DMSO- vesicle control combined with the indicated concentrations of LCC03 for 48 hours. The right panel is the enlarged images of the boxed regions at the left side. D, Cell viability as assessed by trypan blue-exclusion assay in PC3 and C4-2 cells that express PERK-targeting shRNA or treated with PERK inhibitor GSK2606414 in the presence of the indicated concentration of LCC03 for 72 hours. Data are presented as mean SD of 5 independent experiments (n ¼ 5). , P < 0.05 versus the corresponding nontargeting shRNA (sh-ctr) or DMSO-vesicle control. the reduced appearance of GFP-LC3 puncta (Fig. 4C). The PERK allowed to form tumors for 10 days, as demonstrated through BLI. The signaling pathway attenuated by either shRNA or small molecule tumor-bearing mice received intraperitoneal administration of LCC03 inhibitors restored cell survival in response to LCC03 treatment, thus at a low (20 mg/kg) and high (40 mg/kg) dose or DMSO vesicle every confirming the critical role of PERK-mediated ER-stress-signaling other day (QOD) for 4 weeks. A control group received no treatment. pathway in LCC03-induced cell death (Fig. 4D). Interestingly, Simultaneously, the body weights of all the mice were also recorded. knocked down of EIF2AK3 did not reverse the LCC03-mediated The responsiveness of the PC3-Luc tumors to this therapy was mTOR dephosphorylation (Fig. 4A). Conversely, activation of mTOR monitored was monitored through weekly BLI. During the 5-week by MHY1485 decreased PERK expression in LCC03-treated PC3 cells monitoring period, the bioluminescence signal gradually increased (Supplementary Fig. S3), implying that PERK-mediated autophagy by with time in the untreated control group, which indicated that the LCC03, at least in part, is regulated via mTOR pathway. tumors progressed aggressively (Fig. 5A, imaging). A similar imaging pattern was observed in the mice treated with DMSO vesicles and the LCC03 treatment suppresses the growth of osteolytic prostate low-dose LCC03, which indicated that 20 mg/kg QOD of LCC03 was cancer metastasis in mouse bone not effective at suppressing tumor growth. By contrast, the mice To investigate the therapeutic potential of LCC03 for prostate treated with high-dose (40 mg/kg) LCC03 exhibited a relatively cancer, particularly targeting CRPC bone metastases and the associ- constant or slowly changing profile of bioluminescence signals over ated osteoclast activation, PC3 cells that are relatively highly resistant time. A quantitative analysis of the BLI data revealed that the average to LCC03 and produce a pure osteolytic reaction in the bone were used signal intensity in the mice treated with high-dose LCC03 was in an experimental animal model. Luciferase expressing-PC3 cells approximately 75% less than that in the untreated and DMSO- (PC3-Luc) were injected directly into the tibia of the nude mice and treated control mice (Fig. 5A); thus confirmed a significant anticancer

AACRJournals.org Mol Cancer Ther; 2019 OF7

Hsieh et al.

Figure 5. Therapeutic effects of LCC03 in an experimental model of prostate cancer bone metastasis. A, Bioluminescent images of representative individual mice bearing PC3- Luc tumor at tibia 1 day before LCC03 treatment (week 1) and during the 4-week monitoring period after initial treatment. Signals were adjusted to the same color scale for the entire time course. Quantification of photon counts of each individual at the end of the experiment (week 5) relative to that 1 day before treatment is shown on the bottom. Bars indicate the mean fold change for each (n ¼ 10). Values of P were calculated through 1-way analysis of variance. B, Toxicity evaluation of LCC03 in tumor-bearing mice. Mean body weight–time profile (top) for each group. Data are expressed as the mean SD. Hematoxylin and eosin staining of multiple organs (bottom, 200) from the representative mice treated with DMSO vesicle control and high-dose LCC03 at the end of the experiment. C, Representative image of histopathology (H&E), IHC for cell proliferation (Ki67), autophagy (LC3B), and apoptosis (TUNEL), and TRAP staining for osteoclasts (stained in red) in serial tumor sections of representative individual mice. The original magnification is indicated.

effect on tumor growth. These results confirmed dose-dependent cells were detected in these tumors. IHC staining of LC3B indicated a inhibition of tumor growth by LCC03 and demonstrated that 40 mg/kg strong increase in LC3B expression in the tumors from the mice treated QOD for 4 weeks are the efficacious dose to induce regression. with high-dose LCC03. TUNEL staining results of the tumors indi- In addition, the high-dose treatment was not associated with any cated that apoptotic cells were absent (Fig. 5C, LC3B and TUNEL). observed adverse effect in the body weight and cellular structure of Collectively, these results confirmed that the considerable tumor nontarget organ tissues (Fig. 5B). The biochemical parameters, regression caused by systemic LCC03 treatment was associated with including BUN (blood urea nitrogen), CREA (creatinine), ALT (ala- autophagy but not apoptosis. Moreover, the tartrateresistant acid nine aminotransferase), ALP (alkaline phosphatase), and TBIL (total phosphatase (TRAP)-positive osteoclasts were distributed mainly in bilirubin) were all within the reference range and no significant osteolytic bone lesions of the control groups but barely detected in the changes (P > 0.1) in mice before and after treatment with LCC03 LCC03-treated tumor sections (Fig. 5C, TRAP), further confirming (40 mg/kg) for 5 weeks (Supplementary Table S2), which indicated that the dual targeting of prostate cancer cells and osteoclastogenesis by the administered dose of LCC03 was safe for therapeutic use. LCC03. Histologic analysis (Fig. 5C, H&E) of the affected legs from the sacrificed mice after 5 weeks of treatment revealed healthy and packed tumor cells growing in the marrow cavity of the control groups (no Discussion treatment or DMSO-vesicle treatment). The highly proliferative The NF-kB ligand (RANKL) pathways participate in the activation nature of the tumor cells in these control groups was confirmed and survival of osteoclasts; therefore, they represent a therapeutic through ki-67 expression (Fig. 5C, ki-67). By contrast, extensive target for osteoclast-induced bone destruction in treatment- and necrotic regions were found in the tumors excised from the mice metastatic cancer-induced osteolysis. The RANKL inhibitor denosu- treated with high-dose LCC03, and only a few ki-67-stained cancer mab is recently approved by the U.S. FDA for the prevention of skeletal

OF8 Mol Cancer Ther; 2019 MOLECULAR CANCER THERAPEUTICS

Salicylanilide as an Autophagy Inducer for CRPC Therapy

related events in men with metastatic CRPC, but studies on these sensitizes cancer cells to chemotherapy and radiation (42, 43), suggest- compounds have not demonstrated a survival benefit (27). Moreover, ing autophagy stimulation for tumor-targeted therapy. Because autop- recent drug discovery efforts have identified small molecules that hagy is negatively regulated by mTOR, the pharmacological anticancer impair the ER function for therapeutic intervention. For example, agents, including rapamycin, everolimus, and temsirolimus, which bortezomib, the first FDA-approved proteasome inhibitor that induces operate at the level of the mTOR pathway level are currently under severe ER stress and causes apoptosis, was used to treat patients with investigation for clinical induction of autophagy. In the present study, multiple myeloma (28). However, the ineffectiveness of the aforemen- we defined LCC03 as a novel ER stressor that initiates cell death in tioned small molecules against several solid tumors including prostate prostate cancer cells through autophagy induction. Although class III cancer emphasized the need for the development effective drugs. PI3K activation directly affects autophagy, our results reveled that in Autophagy can be stimulated in response to multiple forms of cellular addition to AMPK pathway, LCC03 considerably suppressed class I stress, such as intracellular pathogens, nutrient and growth factor PI3K/Akt activation that regulates autophagy indirectly via the mTOR deprivation, hypoxia, damaged organelles, and ER stress (29). In the pathway in both AR-positive and AR-negative prostate cancer cell present study, we provided the first evidence that LCC03, a derivative populations. Thus, it provides the mechanistic rationale for the efficacy of 5-(20,40-difluorophenyl)-salicylanilides that was originated reported of LCC03 in autophagy induction against prostate cancer and may as a small molecular inhibitor of RANKL-induced osteoclastogenesis, extend to other tumor types. exhibits strong activity against prostate cancer cell growth through ER- Three signaling proteins, IRE1a,ATF6,andPERK,areinvolved stress-mediated autophagy via the PERK/eIF2a signaling pathway. in the initiation of ER-stress response (5). PERK was associated with Other salicylanilide derivatives, such as Niclosamide (30) and nitro- ER stress-induced autophagy. Once activated, this kinase directly substituted hydroxybenzamides (31–33) that share structure similar- phosphorylates eIF2a to block translation initiation, leading to the ities with gefitinib and erlotinib, a class of small molecule inhibitors of upregulation of autophagy-related genes and inhibition of autop- the epidermal growth factor receptor (EGFR) exhibited antiprolifera- hagy suppressors. Although the involvement of the IRE1a and tive and/or proapoptotic activities against a spectrum of human cancer ATF6 pathways in the anticancer property of LCC03 was not cell lines. However, therapies targeting the EGFR by using gefitinib, addressed in this study, we determined that blockage of PERK and erlotinib showed nonsignificant clinical benefit in patients with expression by sequence-specific siRNA or selective small molecule CRPC (34). The dual action of 5-(20,40-difluorophenyl)-salicylanilides inhibitors rendered prostate cancer cells resistant to LCC03 to a on both the osteoclasts and various CRPC cell lines (both AR-positive similar degree as the untreated group, thus implicating PERK as a and AR-negative) may make it a superior anticancer candidate to major effector of LCC03-induced cell death. Notably, a basal level of EGFR tyrosine kinase inhibitors and AR-targeting agents to prevent LC3-B conversion in response to LCC03 treatment was still retained and treat metastatic CRPC. even when the cell viability was nearly completely restored by PERK We demonstrated that LCC03 exerts a robust antiproliferative antagonist, suggesting that the other ER-stress signaling pathways, effect, induces cell-cycle arrest and reduces the viability in a dose- such as the IRE1a and ATF6 pathways, may contribute to cyto- dependent manner in various prostate cancer cell lines. The tumor protective rather than cytotoxic autophagy induction. Our current suppressor protein p53 is a master regulator with pleiotropic effects on knowledge and future work in the area of autophagy regulation metabolism, anti-oxidant defense, genomic stability, proliferation, should facilitate the development of improved therapeutic senescence, and cell death. The activation of p53 was shown to inhibit approaches for cancer. mTOR activity and transactivate autophagy-inducing genes (35). Four CRPC is well recognized to be resistant to conventional therapies, core autophagy genes: ATG4B, ATG4D, ULK1, and ULK2 were also mainly due to its typical feature of apoptosis resistance (44). Our recently defined as AR-targeting genes (36). The higher susceptibility in vivo proof of principle study showed the clinical benefit and safety of of C4-2 to LCC03 compared with the cell lines DU145 (AR-null and LCC03 treatment in CRPC bone metastases in the clinically relevant p53-mutant cells), CWR22r-v1 (AR-positive and p53-mutant cells), animal models. Thus, strongly support the translational application of and PC3 (AR-null and p53-null cells) may be attributable to the LCC03 [5-(20,40-difluorophenyl)-salicylanilide derivative] for poten- expression of both functional p53 and AR to induce autophagy. tial monotherapy and combination therapy against metastatic CRPC. Thomas and colleagues (37) has demonstrated a 2-signal model for Additional optimization studies for therapeutic index and biologics the regulation of cell proliferation during ER stress. The first signal formulation are warranted to improve its potency and pharmacolog- represents inhibition of protein translation mediated via the phos- ical properties. a – phorylation of eIF2 by PERK, leading to impaired G2 M cell cycle progression. The second signal, which induces G1 at later stages of ER Disclosure of Potential Conflicts of Interest stress, requires functional p53. Moreover, autophagy is known to be No potential conflicts of interest were disclosed. associated with the advancement of the cell cycle, with a preference for the G and S phases (38). These, in theory, may explain somewhat why 1 Authors’ Contributions LCC03 induced G1 phase arrest in the C4-2 cells but G2 phase arrest with an increased S-phase population in the PC3 cells. Although TP53 Conception and design: C.-L. Hsieh, H.-S. Huang, K.-C. Chen, L.W.K. Chung, S.-Y. Sung represents one of the most frequent individual mutated genes in Development of methodology: C.-L. Hsieh, H.-S. Huang, L.W.K. Chung, S.-Y. Sung prostate cancer, the frequency of p53 alternations is approximately Acquisition of data (provided animals, acquired and managed patients, provided 10% to 15% in prostate cancer (39), which is lower than in many other facilities, etc.): K.-C. Chen, T. Saka, C.-Y. Chiang, cancers. Therefore, prostate cancer, regardless to the disease status, Analysis and interpretation of data (e.g., statistical analysis, biostatistics, could be considered as the primary indication of LCC03. computational analysis): H.-S. Huang, T. Saka, C.-Y. Chiang, S.-Y. Sung Numerous studies have suggested that autophagy induction is a cell Writing, review, and/or revision of the manuscript: H.-S. Huang, K.-C. Chen, S.-Y. Sung survival mechanism of chemoresistance (40, 41); therefore, blocking Administrative, technical, or material support (i.e., reporting or organizing data, autophagy during cancer treatment can improve clinical outcomes. constructing databases): H.-S. Huang, However, other studies have indicated that autophagy induction Study supervision: C.-L. Hsieh, H.-S. Huang,

AACRJournals.org Mol Cancer Ther; 2019 OF9

Hsieh et al.

Acknowledgments The costs of publication of this article were defrayed in part by the We would like to acknowledge Ms. Huei-Min Chen for her exceptional technical payment of page charges. This article must therefore be hereby marked advertisement support for TEM at Taipei Medical University Core Facility. This work was supported in in accordance with 18 U.S.C. Section 1734 solely to indicate part by Ministry of Science and Technology in Taiwan (Grant No. MOST 107-2320-B- this fact. 038-057 and 106-2320-B-038-056 to C.-L. Hsieh, 106-2320-B-038-055 to S.-Y. Sung, and 106-2113-M-038-003 to H.-S. Huang), Taipei Medical University (Grant No. DP2- 107-21121-C-01), and the “TMUResearchCenterofCancerTranslationalMedicine” from The Featured Areas Research Center Program within the framework of the Higher Received April 10, 2019; revised July 24, 2019; accepted September 12, 2019; Education Sprout Project by the Ministry of Education (MOE). published ﬁrst September 17, 2019.

References 1. Bubendorf L, Schopfer A, Wagner U, Sauter G, Moch H, Willi N, et al. Metastatic 22. Hung SC, Wu IH, Hsue SS, Liao CH, Wang HC, Chuang PH, et al. Targeting l1 patterns of prostate cancer: an autopsy study of 1,589 patients. Hum Pathol 2000; cell adhesion molecule using lentivirus-mediated short hairpin RNA interference 31:578–83. reverses aggressiveness of oral squamous cell carcinoma. Mol Pharm 2010;7: 2. Omlin A, Pezaro C, Gillessen Sommer S. Sequential use of novel therapeutics in 2312–23. advanced prostate cancer following docetaxel chemotherapy. Ther Adv Urol 23. Sung SY, Wu IH, Chuang PH, Petros JA, Wu HC, Zeng HJ, et al. Targeting L1 cell 2014;6:3–14. adhesion molecule expression using liposome-encapsulated siRNA suppresses 3. Rao RV, Bredesen DE. Misfolded proteins, endoplasmic reticulum stress and prostate cancer bone metastasis and growth. Oncotarget 2014;5:9911–29. neurodegeneration. Curr Opin Cell Biol 2004;16:653–62. 24. Jackson WT, Giddings TH Jr, Taylor MP, Mulinyawe S, Rabinovitch M, Kopito 4. Clarke HJ, Chambers JE, Liniker E, Marciniak SJ. Endoplasmic reticulum stress RR, et al. Subversion of cellular autophagosomal machinery by RNA viruses. in malignancy. Cancer Cell 2014;25:563–73. PLoS Biol 2005;3:e156. 5. Sano R, Reed JC. ER stress-induced cell death mechanisms. Biochim Biophys 25. Ogata M, Hino S, Saito A, Morikawa K, Kondo S, Kanemoto S, et al. Autophagy is Acta 2013;1833:3460–70. activated for cell survival after endoplasmic reticulum stress. Mol Cell Biol 2006; 6. Hotamisligil GS. Endoplasmic reticulum stress and atherosclerosis. Nat Med 26:9220–31. 2010;16:396–9. 26. Senft D, Ronai ZA. UPR, autophagy, and mitochondria crosstalk underlies the 7. Lindholm D, Wootz H, Korhonen L. ER stress and neurodegenerative diseases. ER stress response. Trends Biochem Sci 2015;40:141–8. Cell Death Differ 2006;13:385–92. 27. Hayes AR, Brungs D, Pavlakis N. Osteoclast inhibitors to prevent bone metas- 8. Back SH, Kaufman RJ. Endoplasmic reticulum stress and type 2 diabetes. tases in men with high-risk, non-metastatic prostate cancer: a systematic review Annu Rev Biochem 2012;81:767–93. and meta-analysis. PloS one 2018;13:e0191455. 9. Luo B, Lee AS. The critical roles of endoplasmic reticulum chaperones and 28. Chen D, Frezza M, Schmitt S, Kanwar J, Dou QP. Bortezomib as the first unfolded protein response in tumorigenesis and anticancer therapies. Oncogene proteasome inhibitor anticancer drug: current status and future perspectives. 2013;32:805–18. Curr Cancer Drug Targets 2011;11:239–53. 10. Chung LW, Hsieh CL, Law A, Sung SY, Gardner TA, Egawa M, et al. New targets 29. Murrow L, Debnath J. Autophagy as a stress-response and quality-control for therapy in prostate cancer: modulation of stromal-epithelial interactions. mechanism: implications for cell injury and human disease. Annu Rev Pathol Urology 2003;62:44–54. 2013;8:105–37. 11. Kratky M, Vinsova J, Novotna E, Mandikova J, Trejtnar F, Stolakova J. 30. Li Y, Li PK, Roberts MJ, Arend RC, Samant RS, Buchsbaum DJ. Multi-targeted Antibacterial activity of salicylanilide 4-(trifluoromethyl)-benzoates. Molecules therapy of cancer by niclosamide: a new application for an old drug. Cancer Lett 2013;18:3674–88. 2014;349:8–14. 12. ImramovskyA,VinsovaJ,FerrizJM,DolezalR,JampilekJ,KaustovaJ,etal. 31. Imramovsky A, Jorda R, Pauk K, Reznickova E, Dusek J, Hanusek J, et al. New antituberculotics originated from salicylanilides with promising in vitro Substituted 2-hydroxy-N-(arylalkyl)benzamides induce apoptosis in cancer cell activity against atypical mycobacterial strains. Bioorg Med Chem 2009;17: lines. Eur J Med Chem 2013;68:253–9. 3572–9. 32. Kauerova T, Kos J, Gonec T, Jampilek J, Kollar P. Antiproliferative and pro- 13. Kratky M, Vinsova J. Antiviral activity of substituted salicylanilides—a review. apoptotic effect of novel nitro-substituted hydroxynaphthanilides on human Mini Rev Med Chem 2011;11:956–67. cancer cell lines. Int J Mol Sci 2016;17:1219. 14. Kratky M, Vinsova J. Antifungal activity of salicylanilides and their esters with 4- 33. Zhu XF, Wang JS, Cai LL, Zeng YX, Yang D. SUCI02 inhibits the erbB-2 tyrosine (trifluoromethyl)benzoic acid. Molecules 2012;17:9426–42. kinase receptor signaling pathway and arrests the cell cycle in G1 phase in breast 15. Brown ME, Fitzner JN, Stevens T, Chin W, Wright CD, Boyce JP. Salicylanilides: cancer cells. Cancer Sci 2006;97:84–9. selective inhibitors of interleukin-12p40 production. Bioorg Med Chem 2008;16: 34. Rathkopf DE, Larson SM, Anand A, Morris MJ, Slovin SF, Shaffer DR, et al. 8760–4. Everolimus combined with gefitinib in patients with metastatic castration- 16. Wang B, Wang Z, Ai F, Tang WK, Zhu G. A monofunctional platinum(II)-based resistant prostate cancer: Phase 1/2 results and signaling pathway implications. anticancer agent from a salicylanilide derivative: synthesis, antiproliferative Cancer 2015;121:3853–61. activity, and transcription inhibition. J Inorg Biochem 2015;142:118–25. 35. Feng Z, Zhang H, Levine AJ, Jin S. The coordinate regulation of the p53 and 17. Chen CL, Lee CC, Liu FL, Chen TC, Ahmed Ali AA, Chang DM, et al. Design, mTOR pathways in cells. Proc Natl Acad Sci U S A 2005;102:8204–9. synthesis and SARs of novel salicylanilides as potent inhibitors of RANKL- 36. Blessing AM, Rajapakshe K, Reddy Bollu L, Shi Y, White MA, Pham AH, et al. induced osteoclastogenesis and bone resorption. Eur J Med Chem 2016;117: Transcriptional regulation of core autophagy and lysosomal genes by the 70–84. androgen receptor promotes prostate cancer progression. Autophagy 2017;13: 18. Chen CL, Liu FL, Lee CC, Chen TC, Ahmed Ali AA, Sytwu HK, et al. Modified 506–21. salicylanilide and 3-phenyl-2H-benzo[e][1,3]oxazine-2,4(3H)-dione derivatives 37. Thomas SE, Malzer E, Ordonez A, Dalton LE, van't Wout EF, Liniker E, et al. p53 as novel inhibitors of osteoclast differentiation and bone resorption. J Med Chem and translation attenuation regulate distinct cell cycle checkpoints during 2014;57:8072–85. endoplasmic reticulum (ER) stress. J Biol Chem 2013;288:7606–17. 19. Liu FL, Chen CL, Lee CC, Wu CC, Hsu TH, Tsai CY, et al. The simultaneous 38. Tasdemir E, Maiuri MC, Tajeddine N, Vitale I, Criollo A, Vicencio JM, et al. Cell inhibitory effect of niclosamide on RANKL-induced osteoclast formation and cycle-dependent induction of autophagy, mitophagy and reticulophagy. osteoblast differentiation. Int J Med Sci 2017;14:840–52. Cell Cycle 2007;6:2263–7. 20. Smith MR. Osteoclast targeted therapy for prostate cancer: bisphosphonates and 39. Kluth M, Harasimowicz S, Burkhardt L, Grupp K, Krohn A, Prien K, et al. beyond. Urol Oncol 2008;26:420–5. Clinical significance of different types of p53 gene alteration in surgically treated 21. Lee CC, Liu FL, Chen CL, Chen TC, Chang DM, Huang HS. Discovery of 5-(20,40- prostate cancer. Int J Cancer 2014;135:1369–80. difluorophenyl)-salicylanilides as new inhibitors of receptor activator of NF- 40. Garcia JA, Danielpour D. Mammalian target of rapamycin inhibition as a kappaB ligand (RANKL)-induced osteoclastogenesis. Eur J Med Chem 2015;98: therapeutic strategy in the management of urologic malignancies. 115–26. Mol Cancer Ther 2008;7:1347–54.

OF10 Mol Cancer Ther; 2019 MOLECULAR CANCER THERAPEUTICS

Salicylanilide as an Autophagy Inducer for CRPC Therapy

41. Thorburn J, Horita H, Redzic J, Hansen K, Frankel AE, Thorburn A. Autophagy 43. Fiorini C, Cordani M, Gotte G, Picone D, Donadelli M. Onconase induces regulates selective HMGB1 release in tumor cells that are destined to die. autophagy sensitizing pancreatic cancer cells to gemcitabine and activates Akt/ Cell Death Differ 2009;16:175–83. mTOR pathway in a ROS-dependent manner. Biochim Biophys Acta 2015;1853: 42. Chen YR, Tsou B, Hu S, Ma H, Liu X, Yen Y, et al. Autophagy induction causes a 549–60. synthetic lethal sensitization to ribonucleotide reductase inhibition in breast 44. Leo S, Accettura C, Lorusso V. Castration-resistant prostate cancer: targeted cancer cells. Oncotarget 2016;7:1984–99. therapies. Chemotherapy 2011;57:115–27.

AACRJournals.org Mol Cancer Ther; 2019 OF11

A Novel Salicylanilide Derivative Induces Autophagy Cell Death in Castration-Resistant Prostate Cancer via ER Stress-Activated PERK Signaling Pathway

Chia-Ling Hsieh, Hsu-Shan Huang, Kuan-Chou Chen, et al.

Mol Cancer Ther Published OnlineFirst September 17, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1535-7163.MCT-19-0387

Supplementary Access the most recent supplemental material at: Material http://mct.aacrjournals.org/content/suppl/2019/09/17/1535-7163.MCT-19-0387.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mct.aacrjournals.org/content/early/2019/12/11/1535-7163.MCT-19-0387. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.