Microrna-720 Promotes in Vitro Cell Migration by Targeting Rab35
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
NIH Public Access Author Manuscript Obesity (Silver Spring)
NIH Public Access Author Manuscript Obesity (Silver Spring). Author manuscript; available in PMC 2011 November 1. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Obesity (Silver Spring). 2011 May ; 19(5): 1019±1027. doi:10.1038/oby.2010.256. Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women Damien C. Croteau-Chonka1,2,3, Amanda F. Marvelle1,2, Ethan M. Lange1,4, Nanette R. Lee5, Linda S. Adair6, Leslie A. Lange1, and Karen L. Mohlke1 1)Department of Genetics, University of North Carolina, Chapel Hill, NC 2)Curriculum in Genetics and Molecular Biology, University of North Carolina, Chapel Hill, NC 3)Bioinformatics and Computational Biology Training Program, University of North Carolina, Chapel Hill, NC 4)Department of Biostatistics, University of North Carolina, Chapel Hill, NC 5)Office of Population Studies Foundation Inc., University of San Carlos, Cebu City, Philippines 6)Department of Nutrition, University of North Carolina, Chapel Hill, NC Abstract Increased values of multiple adiposity-related anthropometric traits are important risk factors for many common complex diseases. We performed a genome-wide association (GWA) study for four quantitative traits related to body size and adiposity (body mass index [BMI], weight, waist circumference, and height) in a cohort of 1,792 adult Filipino women from the Cebu Longitudinal Health and Nutrition Survey. This is the first GWA study of anthropometric traits in Filipinos, a population experiencing a rapid transition into a more obesogenic environment. In addition to identifying suggestive evidence of additional SNP association signals (P < 10−5), we replicated (P < 0.05, same direction of additive effect) associations previously reported in European populations of both BMI and weight with MC4R and FTO, of BMI with BDNF, and of height with EFEMP1, ZBTB38, and NPPC, but none with waist circumference. -
Longitudinal Replication Studies of GWAS Risk Snps Influencing Body Mass Index Over the Course of Childhood and Adulthood
Longitudinal Replication Studies of GWAS Risk SNPs Influencing Body Mass Index over the Course of Childhood and Adulthood Hao Mei1, Wei Chen2, Fan Jiang3, Jiang He1, Sathanur Srinivasan2, Erin N. Smith4, Nicholas Schork5, Sarah Murray5, Gerald S. Berenson2* 1 Department of Epidemiolog, Tulane University, New Orleans, Louisiana, United States of America, 2 Tulane Center for Cardiovascular Health, Tulane University, New Orleans, Louisiana, United States of America, 3 Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, Shanghai, China, 4 Department of Pediatrics and Rady’s Children’s Hospital, University of California at San Diego, School of Medicine, La Jolla, California, United States of America, 5 Scripps Genomic Medicine and Scripps Translational Science Institute, La Jolla, California, United States of America Abstract Genome-wide association studies (GWAS) have identified multiple common variants associated with body mass index (BMI). In this study, we tested 23 genotyped GWAS-significant SNPs (p-value,5*10-8) for longitudinal associations with BMI during childhood (3–17 years) and adulthood (18–45 years) for 658 subjects. We also proposed a heuristic forward search for the best joint effect model to explain the longitudinal BMI variation. After using false discovery rate (FDR) to adjust for multiple tests, childhood and adulthood BMI were found to be significantly associated with six SNPs each (q-value,0.05), with one SNP associated with both BMI measurements: KCTD15 rs29941 (q-value,7.6*10-4). These 12 SNPs are located at or near genes either expressed in the brain (BDNF, KCTD15, TMEM18, MTCH2, and FTO) or implicated in cell apoptosis and proliferation (FAIM2, MAP2K5, and TFAP2B). -
KCTD15 (AT4C3): Sc-517410
SAN TA C RUZ BI OTEC HNOL OG Y, INC . KCTD15 (AT4C3): sc-517410 BACKGROUND PRODUCT KCTD15 is a 283 amino acid protein that contains one BTB (POZ) domain and Each vial contains 100 µg IgG 3 in 1.0 ml of PBS with < 0.1% sodium azide exists as 2 alternatively spliced isoforms. The gene that encodes KCTD15 and 0.1% gelatin. consists of approximately 18,918 bases and maps to human chromosome 19q13.11. Consisting of around 63 million bases with more than 1,400 genes, APPLICATIONS chromosome 19 makes up over 2% of the human genome. It is the genetic KCTD15 (AT4C3) is recommended for detection of KCTD15 of human origin home for a number of immunoglobulin superfamily members including the by Western Blotting (starting dilution 1:200, dilution range 1:100-1:1000), killer cell and leukocyte Ig-like receptors, a number of ICAMs, the CEACAM immunoprecipitation [1-2 µg per 100-500 µg of total protein (1 ml of cell and PSG families, and Fc receptors. Key genes for eye color and hair color lysate)], immunofluorescence (starting dilution 1:50, dilution range 1:50- also map to chromosome 19. Peutz-Jeghers syndrome, spinocerebellar atax ia 1:500), flow cytometry (1 µg per 1 x 10 6 cells) and solid phase ELISA (start ing type 6, the stroke disorder CADASIL, hypercholesterolemia and Insulin- depen - dilution 1:30, dilution range 1:30-1:3000). dent diabetes have been linked to chromosome 19. Translocations with chro - mosome 19 and chromosome 14 can be seen in some lymphoproliferative Suitable for use as control antibody for KCTD15 siRNA (h): sc-97204, KCTD15 disorders and typically involve the proto-oncogene Bcl3. -
Genome Sequences of Tropheus Moorii and Petrochromis Trewavasae, Two Eco‑Morphologically Divergent Cichlid Fshes Endemic to Lake Tanganyika C
www.nature.com/scientificreports OPEN Genome sequences of Tropheus moorii and Petrochromis trewavasae, two eco‑morphologically divergent cichlid fshes endemic to Lake Tanganyika C. Fischer1,2, S. Koblmüller1, C. Börger1, G. Michelitsch3, S. Trajanoski3, C. Schlötterer4, C. Guelly3, G. G. Thallinger2,5* & C. Sturmbauer1,5* With more than 1000 species, East African cichlid fshes represent the fastest and most species‑rich vertebrate radiation known, providing an ideal model to tackle molecular mechanisms underlying recurrent adaptive diversifcation. We add high‑quality genome reconstructions for two phylogenetic key species of a lineage that diverged about ~ 3–9 million years ago (mya), representing the earliest split of the so‑called modern haplochromines that seeded additional radiations such as those in Lake Malawi and Victoria. Along with the annotated genomes we analysed discriminating genomic features of the study species, each representing an extreme trophic morphology, one being an algae browser and the other an algae grazer. The genomes of Tropheus moorii (TM) and Petrochromis trewavasae (PT) comprise 911 and 918 Mbp with 40,300 and 39,600 predicted genes, respectively. Our DNA sequence data are based on 5 and 6 individuals of TM and PT, and the transcriptomic sequences of one individual per species and sex, respectively. Concerning variation, on average we observed 1 variant per 220 bp (interspecifc), and 1 variant per 2540 bp (PT vs PT)/1561 bp (TM vs TM) (intraspecifc). GO enrichment analysis of gene regions afected by variants revealed several candidates which may infuence phenotype modifcations related to facial and jaw morphology, such as genes belonging to the Hedgehog pathway (SHH, SMO, WNT9A) and the BMP and GLI families. -
Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing -
The Genetics of Bipolar Disorder
Molecular Psychiatry (2008) 13, 742–771 & 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00 www.nature.com/mp FEATURE REVIEW The genetics of bipolar disorder: genome ‘hot regions,’ genes, new potential candidates and future directions A Serretti and L Mandelli Institute of Psychiatry, University of Bologna, Bologna, Italy Bipolar disorder (BP) is a complex disorder caused by a number of liability genes interacting with the environment. In recent years, a large number of linkage and association studies have been conducted producing an extremely large number of findings often not replicated or partially replicated. Further, results from linkage and association studies are not always easily comparable. Unfortunately, at present a comprehensive coverage of available evidence is still lacking. In the present paper, we summarized results obtained from both linkage and association studies in BP. Further, we indicated new potential interesting genes, located in genome ‘hot regions’ for BP and being expressed in the brain. We reviewed published studies on the subject till December 2007. We precisely localized regions where positive linkage has been found, by the NCBI Map viewer (http://www.ncbi.nlm.nih.gov/mapview/); further, we identified genes located in interesting areas and expressed in the brain, by the Entrez gene, Unigene databases (http://www.ncbi.nlm.nih.gov/entrez/) and Human Protein Reference Database (http://www.hprd.org); these genes could be of interest in future investigations. The review of association studies gave interesting results, as a number of genes seem to be definitively involved in BP, such as SLC6A4, TPH2, DRD4, SLC6A3, DAOA, DTNBP1, NRG1, DISC1 and BDNF. -
Exploring Extracellular Vesicles Biogenesis in Hypothalamic Cells Through a Heavy Isotope Pulse/Trace Proteomic Approach
cells Article Exploring Extracellular Vesicles Biogenesis in Hypothalamic Cells through a Heavy Isotope Pulse/Trace Proteomic Approach Chee Fan Tan 1,2 , Hui San Teo 2, Jung Eun Park 2, Bamaprasad Dutta 2, Shun Wilford Tse 2, Melvin Khee-Shing Leow 3,4,5 , Walter Wahli 3,6 and Siu Kwan Sze 2,* 1 NTU Institute for Health Technologies, Interdisciplinary Graduate School, Nanyang Technological University, Singapore 637335, Singapore; [email protected] 2 School of Biological Sciences, Nanyang Technological University, Singapore 637551, Singapore; [email protected] (H.S.T.); [email protected] (J.E.P.); [email protected] (B.D.); [email protected] (S.W.T.) 3 Lee Kong Chian School of Medicine, Nanyang Technological University, Singapore 636921, Singapore; [email protected] (M.K.-S.L.); [email protected] (W.W.) 4 Department of Endocrinology, Tan Tock Seng Hospital, Singapore 308433, Singapore 5 Cardiovascular and Metabolic Disorder Program, Duke-NUS Medical School, Singapore 169857, Singapore 6 Center for Integrative Genomics, University of Lausanne, Le Génopode, CH-1015 Lausanne, Switzerland * Correspondence: [email protected]; Tel.: +65-6514-1006; Fax: +65-6791-3856 Received: 24 March 2020; Accepted: 21 May 2020; Published: 25 May 2020 Abstract: Studies have shown that the process of extracellular vesicles (EVs) secretion and lysosome status are linked. When the lysosome is under stress, the cells would secrete more EVs to maintain cellular homeostasis. However, the process that governs lysosomal activity and EVs secretion remains poorly defined and we postulated that certain proteins essential for EVs biogenesis are constantly synthesized and preferentially sorted to the EVs rather than the lysosome. -
Supplementary Tables S1-S3
Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse) -
Systematic Elucidation of Neuron-Astrocyte Interaction in Models of Amyotrophic Lateral Sclerosis Using Multi-Modal Integrated Bioinformatics Workflow
ARTICLE https://doi.org/10.1038/s41467-020-19177-y OPEN Systematic elucidation of neuron-astrocyte interaction in models of amyotrophic lateral sclerosis using multi-modal integrated bioinformatics workflow Vartika Mishra et al.# 1234567890():,; Cell-to-cell communications are critical determinants of pathophysiological phenotypes, but methodologies for their systematic elucidation are lacking. Herein, we propose an approach for the Systematic Elucidation and Assessment of Regulatory Cell-to-cell Interaction Net- works (SEARCHIN) to identify ligand-mediated interactions between distinct cellular com- partments. To test this approach, we selected a model of amyotrophic lateral sclerosis (ALS), in which astrocytes expressing mutant superoxide dismutase-1 (mutSOD1) kill wild-type motor neurons (MNs) by an unknown mechanism. Our integrative analysis that combines proteomics and regulatory network analysis infers the interaction between astrocyte-released amyloid precursor protein (APP) and death receptor-6 (DR6) on MNs as the top predicted ligand-receptor pair. The inferred deleterious role of APP and DR6 is confirmed in vitro in models of ALS. Moreover, the DR6 knockdown in MNs of transgenic mutSOD1 mice attenuates the ALS-like phenotype. Our results support the usefulness of integrative, systems biology approach to gain insights into complex neurobiological disease processes as in ALS and posit that the proposed methodology is not restricted to this biological context and could be used in a variety of other non-cell-autonomous communication -
Heterogeneity Between Primary Colon Carcinoma and Paired Lymphatic and Hepatic Metastases
MOLECULAR MEDICINE REPORTS 6: 1057-1068, 2012 Heterogeneity between primary colon carcinoma and paired lymphatic and hepatic metastases HUANRONG LAN1, KETAO JIN2,3, BOJIAN XIE4, NA HAN5, BINBIN CUI2, FEILIN CAO2 and LISONG TENG3 Departments of 1Gynecology and Obstetrics, and 2Surgical Oncology, Taizhou Hospital, Wenzhou Medical College, Linhai, Zhejiang; 3Department of Surgical Oncology, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang; 4Department of Surgical Oncology, Sir Run Run Shaw Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang; 5Cancer Chemotherapy Center, Zhejiang Cancer Hospital, Zhejiang University of Chinese Medicine, Hangzhou, Zhejiang, P.R. China Received January 26, 2012; Accepted May 8, 2012 DOI: 10.3892/mmr.2012.1051 Abstract. Heterogeneity is one of the recognized characteris- Introduction tics of human tumors, and occurs on multiple levels in a wide range of tumors. A number of studies have focused on the Intratumor heterogeneity is one of the recognized charac- heterogeneity found in primary tumors and related metastases teristics of human tumors, which occurs on multiple levels, with the consideration that the evaluation of metastatic rather including genetic, protein and macroscopic, in a wide range than primary sites could be of clinical relevance. Numerous of tumors, including breast, colorectal cancer (CRC), non- studies have demonstrated particularly high rates of hetero- small cell lung cancer (NSCLC), prostate, ovarian, pancreatic, geneity between primary colorectal tumors and their paired gastric, brain and renal clear cell carcinoma (1). Over the past lymphatic and hepatic metastases. It has also been proposed decade, a number of studies have focused on the heterogeneity that the heterogeneity between primary colon carcinomas and found in primary tumors and related metastases with the their paired lymphatic and hepatic metastases may result in consideration that the evaluation of metastatic rather than different responses to anticancer therapies. -
WO 2016/040794 Al 17 March 2016 (17.03.2016) P O P C T
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/040794 Al 17 March 2016 (17.03.2016) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 1/19 (2006.01) C12Q 1/02 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/81 (2006.01) C07K 14/47 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (21) International Application Number: KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, PCT/US20 15/049674 MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (22) International Filing Date: PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, 11 September 2015 ( 11.09.201 5) SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, 62/050,045 12 September 2014 (12.09.2014) US TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, (71) Applicant: WHITEHEAD INSTITUTE FOR BIOMED¬ DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, ICAL RESEARCH [US/US]; Nine Cambridge Center, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Cambridge, Massachusetts 02142-1479 (US). -
Variation in Protein Coding Genes Identifies Information Flow
bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.