USP6 Confers Sensitivity to IFN-Mediated Apoptosis Through Modulation of TRAIL Signaling in Ewing Sarcoma Ian C

Published OnlineFirst August 21, 2018; DOI: 10.1158/1541-7786.MCR-18-0289

Cell Death and Survival Molecular Cancer Research USP6 Confers Sensitivity to IFN-Mediated Apoptosis through Modulation of TRAIL Signaling in Ewing Sarcoma Ian C. Henrich1, Robert Young1, Laura Quick1, Andre M. Oliveira2, and Margaret M. Chou1

Abstract

Ewing sarcoma is the second most common sarcoma of the an IFN response signature, both in cultured Ewing sarcoma bone, afflicting predominantly the pediatric population. cells in vitro and in clinical specimens in vivo. Not only does Although patients with localized disease exhibit favorable USP6 independently induce activation of the IFN signaling survival rates, patients with metastatic disease suffer a dismal mediators, JAK1 and STAT1, but it also renders Ewing sarcoma 5-year rate of approximately 25%. Thus, there is a great need cells exquisitely responsive to exogenous IFNs, potentiating to develop treatments to combat the disseminated disease. activation of STAT1 and STAT3. Furthermore, IFNb (a type I Ubiquitin-specific protease 6 (USP6/TRE17) has been impli- IFN) induces apoptosis specifically in USP6-positive but not cated as the key etiologic factor in several benign mesenchymal USP6-negative Ewing sarcoma cells. Finally, apoptosis is medi- tumors, including nodular fasciitis and aneurysmal bone cyst ated through the proapoptotic ligand TRAIL, which is syner- (ABC). However, the role of USP6 in the biology of malignant gistically induced by type I IFN and USP6. entities remains unexplored. Previously, it was observed that USP6 is sufficient to drive formation of tumors mimicking Implications: These findings provide the first insights into ABC and nodular fasciitis, and that it functions through JAK1/ USP6 functions in a clinically relevant malignant entity, and STAT3 signaling. However, in the context of Ewing sarcoma, raise the possibility of using IFN for targeting USP6-positive USP6 does not enhance the transformation, but rather triggers Ewing sarcoma. Mol Cancer Res; 16(12); 1834–43. 2018 AACR.

Introduction efforts have been aimed at identifying its critical targets. Multiple effectors that contribute to pathogenesis have been identified, Sarcomas are a diverse class of malignancies that represent a both in cultured cells in vitro and in murine models. Furthermore, significant challenge in oncology. Ewing sarcoma is the second therapeutics have been developed against some of these effectors, most common bone sarcoma, and typically affects individuals in including IGF, VEGF, and EWS-FLI1 itself (3, 4). However, their the first two decades of life (1). Although patients with localized clinical efficacy has been limited, underscoring the need to iden- disease experience 5-year survival rates of 75%, patients with tify novel targets and approaches for Ewing sarcoma treatment. metastatic disease face a dismal survival probability of approxi- Our research focuses on the ubiquitin-specific protease 6 mately 20%. Thus, there is an urgent need to identify biomarkers (USP6) oncogene, which is translocated in multiple benign that can predict recurrence and response to therapy, and develop mesenchymal tumors, including primary aneurysmal bone cyst strategies to combat metastatic disease. (ABC), and nodular fasciitis (5, 6). USP6 translocations were also The key etiologic agent in Ewing sarcoma is a translocation identified in fibroma of tendon sheath and giant–cell rich gran- product that fuses the EWS RNA-binding protein with an Ets uloma (7, 8). In all cases, translocation resulted in promoter family transcription factor, most commonly FLI1 (2). Sustained swapping and high-level expression of wild-type USP6. USP6 EWS–FLI1 activity is required for transformation, and significant expression is normally highly restricted in adult human tissues, with significant levels observed only in testes (9). Although USP6 was first cloned in 1992 (10), until recently, little was known 1Department of Pathology and Laboratory Medicine, Children's Hospital of regarding its molecular functions, either physiologically or during Philadelphia, Perelman School of Medicine at University of Pennsylvania, tumorigenesis. We have shown that when ectopically expressed in 2 Philadelphia, Pennsylvania. Department of Laboratory Medicine and Pathology, candidate cells of origin for ABC and nodular fasciitis (i.e., Mayo Clinic, Rochester, Minnesota. fibroblasts and preosteoblasts), USP6 induces formation of Note: Supplementary data for this article are available at Molecular Cancer tumors that recapitulate key clinical, histologic, and molecular Research Online (http://mcr.aacrjournals.org/). features of the human tumors (11–13), with its catalytic activity as Corresponding Author: Margaret M. Chou, Children's Hospital of Philadelphia, a deubiquitylating enzyme being essential (12). Our more recent University of Pennsylvania, 3615 Civic Center Boulevard, ARC Room 816E, work revealed that USP6 promotes tumorigenesis through mul- Philadelphia, PA 19104. Phone: 267-426-9228; Fax: 267-426-5165; E-mail: tiple pathways, including Jak1/STAT3, Wnt/b-catenin, and NFkB [email protected] (11, 14, 15). Within the Jak1/STAT3 pathway, Jak1 itself is the doi: 10.1158/1541-7786.MCR-18-0289 critical target of USP6 (15). Deubiquitylation of Jak1 by USP6 2018 American Association for Cancer Research. rescues it from proteasomal degradation, leading to greatly

1834 Mol Cancer Res; 16(12) December 2018

USP6 in IFN-Mediated Apoptosis of Ewing Sarcoma

elevated levels of the kinase, and sensitizing cells to Jak1 agonists 752904) and anti-TRAIL (catalog no. 308202) were obtained such as IL6 (15). from BioLegend. Caspase-3/7 (#G8090) and caspase-9 (#G8210) Although translocation-driven overexpression of USP6 plays a activation kits were purchased from Promega, and assays were key role in benign neoplasms, its role in malignant entities where performed on Molecular Devices SpectroMax. Annexin V staining it is not the oncogenic driver remains unexplored. It is often kit was obtained from eBioscience (#88-8007-72), and samples incorrectly cited that USP6 is widely expressed in cancer cell lines. were analyzed on BD Biosciences Accuri C6 and LSR II machines. However, this erroneous conclusion is based on an early study in which Northern probes cross-reacted with the highly related, Immunoblotting and qRT-PCR widely expressed USP32 gene (10). Later reverse transcription- Cell lysis was performed as described previously (12). Jak1 (cs- quantitative PCR (RT-qPCR) of primary tumors with USP6- 3332), pSTAT1 (cs-9167), pSTAT3 (cs-9145), TRAIL (cs-3219), specific primers indicated that its expression is far more restrict- PARP (cs-9542), caspase-8 (cs-9746), and Bid (cs-2002) were ed: high USP6 expression appears to occur predominantly in obtained from Cell Signaling Technology. HA (sc-805), STAT1 tumors of mesenchymal origin (16). Yet, to date, there have (sc-346), STAT3 (sc-482), and p65 (sc-372) were obtained from been few publications exploring USP6 functions in malignant Santa Cruz Biotechnology. Erk antibody was obtained from Dr. cells, with most in HeLa cells (14, 17–20). John Blenis, Weill Cornell Medical College, New York, NY. fi We sought to investigate functions of USP6 in Ewing sarcoma, Quanti cation was performed using the Image Studio Lite. TRIzol one of the malignancies shown to express high levels (16). We was used for RNA isolation, and qPCR was performed using SYBR fi show that USP6 triggers a gene signature reflective of response to Green (catalog no. 436765, Thermo Fisher Scienti c). Erk, STAT3, IFN, a Jak1 agonist that functions in immunity. USP6 renders and p65 were used as protein-loading controls as described – Ewing sarcoma cells exquisitely sensitive to exogenous IFNs: not previously (22 25); their levels were comparable across condi- only is STAT1-mediated gene expression dramatically potentiated tions as shown. in USP6-expressing cells by IFN treatment, but Type I IFN is Gene expression profiling/pathway analysis and DNA selectively cytotoxic to USP6-positive but not USP6-negative methylation Ewing sarcoma cells. IFN-induced death is mediated by TRAIL, RNA was isolated from USP6/RD-ES cells treated with or without a potent proapoptotic ligand. This work represents one of the first doxycycline and IFNa for 24 hours. RNA sequencing (RNA-seq), studies to examine USP6 functions in malignant cells, and suggest alignment, processing, and repository deposit was performed by that it might serve as a prognostic indicator for response of Ewing the University of Pennsylvania Next-Generation Sequencing Core sarcoma to IFN treatment. (GSE107307). The CDF files for the Affymetrix U133A and U133 Materials and Methods Plus 2.0 arrays were edited to remove probes from the USP6 probe set (206405_x_at) that cross-reacted with USP32 or other genes. Cell lines and CRISPR-mediated gene targeting This refined USP6-specific probe set comprised Probe 4, 8, 9, and RD-ES and TC-71 were from Dr. Frederic Barr (National Cancer 11. Publicly available Ewing sarcoma datasets [GSE7007 (26) and Institute, Bethesda, MD) and Dr. Lee Helman (Children's Hos- GSE37371 U133A (27)] were sorted by USP6 expression. Patients pital of Los Angeles, Keck School of Medicine, Los Angeles, CA), with the highest USP6 levels were compared to those with the respectively. CHLA-10 and SK-N-MC were from Dr. Irfan Asan- lowest (5 per group). For the germ cell tumor dataset GSE10615 gani (Perelman School of Medicine at the University of Pennsyl- (28), samples were segregated as seminomas (USP6high) versus vania, Philadelphia, PA). Lines expressing USP6 in a doxycycline- yolk sac tumors (USP6low). Gene Set Enrichment Analysis (GSEA) inducible manner were generated as described previously (12). was performed as described previously, using the "Hallmarks" Cells were tested for mycoplasma every 3 to 6 months, and molecular signature database. Gene expression analysis in nodular prophylactically maintained in Mycoplasma Removal Agent (MP fasciitis was compared with other USP6-nonexpressing mesenchy- Biomedicals #09350044) for 2 weeks after thawing. All experi- mal tumors, as described previously (15). ments used cells maintained for fewer than 20 passages after DNA methylation datasets for five Ewing sarcoma cell lines fi thawing. Cell line identity was con rmed by short tandem repeat (CADO-ES1, SK-NMC, A673, RD-ES, and SK-ES-1) were procured analysis just prior to manuscript submission. from the Cancer Cell Line Encyclopedia (CCLE; https://portals. Validated CRISPR target sequences for Jak1, STAT1, and STAT3 broadinstitute.org/ccle; refs. 29, 30), and relative CpG methyla- were from published sequences (21). Target gRNAs [Jak1 tion for various genes was plotted using GraphPad. Methylation (CACCGTCCCATACCTCATCCGGTAG), STAT1 (CACCGTCC- probe IDs for the USP6 promoter were obtained from MExpress CATTACAGGCTCAGTCG), and STAT3 (CACCGAGATTGCC- (31) and used in conjunction with GSE89041 (32). CGGATTGTGGCC)] were subcloned into LentiCRISPRv2 (Addgene #52961) as described previously (21). USP6/RD-ES Results cells were transfected with CRISPR constructs and subjected to puromycin selection. Clones were screened by immunoblotting. USP6 triggers an IFN response in Ewing sarcoma in patient samples and cultured cells Reagents Little is known about how USP6 functions in the context of Doxycycline was obtained from ClonTech (#8634–1). Jak malignant cells where it is not the oncogenic driver, with only a Inhibitor I (CAS 457081-03-7; #420099) and PS-1145 (P6624) handful of reports largely restricted to HeLa (14, 17–20). As were obtained from Sigma-Aldrich. Lipofectamine 2000 was mentioned, USP6 expression in neoplasms is far more restricted obtained from Life Technologies. IFNa, IFNb, and IFNg were than initially believed: screening of a broad panel of primary obtained from PBL Assay Science (#11410-2 and #11200-1) and samples demonstrated that high expression was predominantly PeproTech (#300-02), respectively. ZVAD (FMK001) and IETD confined to tumors of mesenchymal origin, including Ewing (FMK007) were obtained from R&D Systems. TRAIL (catalog no. sarcoma (16).

www.aacrjournals.org Mol Cancer Res; 16(12) December 2018 1835

Henrich et al.

Figure 1. USP6 induces an IFN response in ES cells in vitro and in primary tumors. A, Samples from primary Ewing sarcoma datasets (GSE7007 and GSE37371) were ranked by USP6 expression level, and GSEA was performed comparing the 5 samples with the highest levels to the 5 with the lowest. B, The indicated RD-ES cell lines were grown in the presence of doxycycline overnight, then blotted as indicated. The USP6 line represents a pooled population, whereas USP6 (High) and USP6 (Med) are clonal. C, RNA-sequencing was performed on USP6/RD-ES treated with or without doxycycline (dox), followed by GSEA pathway analysis. D, GSEA was performed for nodular fasciitis dataset (15), which utilized the Illumina Human HT12 v4.0 BeadChip. This platform contains one USP6 probe, which is speciﬁc for USP6. E, Relative USP6 levels were evaluated in samples from the germ cell tumor dataset GSE10615 (U133A Microarray). F, GSEA of the germ cell tumor dataset, comparing seminomas to yolk sac tumors.

To explore what functions USP6 might have in Ewing sarcoma, To determine whether USP6 directly induces these gene sig- gene expression patterns were investigated in primary patient natures, we sought to perform mechanistic studies in immortal- samples. Most large Ewing sarcoma patient datasets utilize Affy- ized Ewing sarcoma cells. However, none of the commonly used metrix microarrays, which use probesets consisting of 11 distinct Ewing sarcoma lines expressed appreciable USP6 levels (data not probes against a given gene. However, most probes in the USP6 shown). We found extensive CpG methylation across the probeset (206405_x_at) cross-reacted with USP32 or other genes. USP6 promoter in all immortalized Ewing sarcoma cell lines Therefore, GSEA analysis was refined to use only the USP6-specific examined, while comparatively low methylation was observed subset of probes, comparing Ewing sarcoma tumors with the in primary Ewing sarcoma tumors (Supplementary Fig. S1A). highest versus lowest levels of USP6 expression. From two inde- CpG methylation heatmaps revealed significant silencing of USP6 pendent patient datasets, IFNa (type I) and IFNg (type II) in multiple Ewing sarcoma cell lines relative to genes known responses emerged among the top signatures associated with to be highly expressed in Ewing sarcoma, such as Myc and EZH2 high USP6 expression (Fig. 1A; see Supplementary Table S1 for (Supplementary Fig. S1B). How USP6 becomes methylated expanded GSEA results). In addition, the IL6/Jak/STAT3 pathway upon cell immortalization is unknown, but regardless, this neces- was potently activated, which we previously showed to be sitated expression of USP6 ectopically. We generated clonal and induced by USP6 in our model of ABC. pooled stable lines expressing varied levels of USP6 in a

1836 Mol Cancer Res; 16(12) December 2018 Molecular Cancer Research

USP6 in IFN-Mediated Apoptosis of Ewing Sarcoma

doxycycline-inducible manner in the patient-derived Ewing sar- ovaries or testes) uniformly express low USP6 levels, whereas coma cell line, RD-ES (Fig. 1B). USP6 induced dose-dependent seminomas (i.e., germ cell tumors arising from the germinal upregulation of the Jak1 kinase (which we recently reported to be epithelium of the testes) exhibit high levels (Fig. 1E). GSEA stabilized by direct deubiquitylation by USP6) and phosphory- comparing seminomas to yolk sac tumors revealed that high lation of STAT3 (Fig. 1B), similar to what we observed in our USP6 expression was again correlated with IFN and Jak-STAT3 models of ABC and nodular fasciitis (15). In addition, we signatures (Fig. 1F). Together, these results indicate that USP6 observed robust phosphorylation of STAT1, the key STAT family may be more broadly associated with an IFN response in human member that mediates IFN signaling (Fig. 1B). RNA-seq was tumors. performed comparing the pooled cell line, USP6/RD-ES, in the presence versus absence of doxycycline. As in primary Ewing USP6 sensitizes Ewing sarcoma cells to exogenous IFN sarcoma samples, IFNa and IFNg responses emerged as the top treatment "hits," followed by IL6/Jak/STAT3 activation (Fig. 1C; Supple- We speculated that in addition to triggering an IFN response by mentary Table S1). Together, these results demonstrate that not itself, USP6 might render RD-ES hypersensitive to exogenous IFN only is USP6 associated with an IFN response in Ewing sarcoma in due to the elevated Jak1 levels. Indeed, dramatic enhancement vivo, but that it is sufficient to activate this pathway. They also and prolongation of STAT1/3 activation in USP6/RD-ES cells validate that our RD-ES cell model faithfully reflects physiologic was observed with Type I and II IFNs (IFNa/IFNb and IFNg, USP6 functions in Ewing sarcoma patient samples. respectively; Fig. 2; Supplementary Fig. S2). Treatment of parental We next explored whether USP6 was associated with an IFN RD-ES cells with IFNa or IFNg induced phosphorylation of STAT1 response in other tumor types. An IFN signature was also induced and STAT3, which peaked within 30 minutes and gradually in nodular fasciitis, which is driven by translocation-driven over- declined by 8 hours. In contrast, STAT1 and STAT3 phosphory- expression of USP6 (Fig. 1D; Supplementary Table S1). In addi- lation was augmented and prolonged in USP6/RD-ES, with tion, USP6 expression was associated with an IFN response in significant activation persisting at 8 hours (Fig. 2A and B; germ-cell tumors. Yolk sac tumors (i.e., germ-cell tumors arising Supplementary Fig. S2). Interestingly, we also noted that type I from cells lining the yolk sac that are normally destined to become IFNs induced downregulation of USP6 (Fig. 2A; discussed below).

Figure 2. USP6 enhances signaling and sensitivity of Ewing sarcoma cells to type I and type II IFNs. A, Parental or USP6/RD-ES cells were grown in doxycycline overnight, then treated with IFNa (left) or IFNg (right) (1,000 U/mL) for the indicated times, and blotted. B, Cells were treated with doxycycline overnight, then treated with the indicated dose of IFNb for 0.5 hours or 8 hours. Samples were blotted as indicated; STAT3 was used as a loading control.

www.aacrjournals.org Mol Cancer Res; 16(12) December 2018 1837

Henrich et al.

In addition to prolonging STAT1/3 activation, USP6 height- functional (Supplementary Fig. S5B). To confirm the requirement ened sensitivity to low-dose IFN (Fig. 2B; Supplementary of the Jak1/STAT pathway, CRISPR-mediated knockouts of Jak1, Fig. S2). At doses ranging from 10 to 1,000 U/mL, USP6/ STAT1, and STAT3 were generated in USP6/RD-ES cells (Fig. 4F; RD-ES cells showed elevated STAT1/3 phosphorylation com- Supplementary Fig. S5C). Figure 4F shows that Jak1 deletion pared with parental RD-ES. The ability of USP6 to enhance and/ significantly reduced death. Deletion of both STAT1 and STAT3 or prolong STAT activation was confirmed in three additional was required to obtain robust inhibition of death, indicating that patient-derived Ewing sarcoma lines, TC-71, CHLA-10, and SK- they play distinct roles in the apoptotic response, consistent with N-MC (Supplementary Figs. S3), indicating that its effects are their ability to function as homo- and heterodimers in response to widely observed in Ewing sarcoma, and are not a peculiarity of IFN. These genetic and pharmacologic approaches demonstrate the RD-ES line. that Jak1, STAT1, and STAT3 are required for IFNb-mediated Strikingly, we noticed that with prolonged treatment, type I IFN apoptosis of USP6/RD-ES. was selectively cytotoxic to USP6-expressing but not parental RD- ES cells. IFNb exhibited the greatest cytotoxicity, followed by IFNb-induced apoptosis of USP6/RD-ES cells is mediated by IFNa, then IFNg, as monitored by PARP cleavage and Trypan TRAIL pathway blue exclusion (Fig. 3A and B). Annexin V staining confirmed that IFN can induce expression of the proapoptotic ligands, FasL IFNb-induced death occurred through apoptosis (Fig. 3C; Sup- and TRAIL. Our RNA-seq data indicated that TRAIL, but not Fas, plementary Fig. S4A). IFNb induced apoptosis more effectively was synergistically induced by IFN in USP6/RD-ES relative to than IFNa at doses up to 2,500 U/mL (Supplementary Fig. S4B), parental cells. RT-qPCR confirmed that IFNs had little or no effect likely due to its greater affinity for the type I IFN receptor. on TRAIL expression in RD-ES (Fig. 5A). However, TRAIL mRNA Furthermore, USP6 conferred sensitivity to IFNb in a dose-depen- levels were dramatically increased in USP6/RD-ES treated with dent manner, as the extent of death correlated with the level of IFNb. Induction was also observed, but to a much lesser degree, USP6 expression (Fig. 3D). USP6 also sensitized TC-71 cells to with IFNa and IFNg (Fig. 5A), correlating with the extent of death IFNb-induced apoptosis (Fig. 3E and F). However, USP6 mini- induced by each (Fig. 3). In contrast, FasL expression was not mally enhanced death in CHLA-10 cells and SK-N-MC cells significantly affected by USP6 (Supplementary Fig. S6). We also (Supplementary Fig. S4C); the mechanism underlying this dif- examined expression of the five TRAIL receptors, both the active ferential response is discussed below. Notwithstanding, these (DR4/DR5) and inactive decoy (TNFRSF10C/D and OPG) forms, results indicate that USP6 can dictate the magnitude of response whose balance has been shown to a play an important role in to IFN, and can greatly sensitize ES cells to the apoptotic potential sensitization of cancer cells to TRAIL-induced apoptosis (33). of IFN. USP6 did not alter expression of receptors in a manner consistent with sensitization to death (Supplementary Fig. S6). IFN-induced apoptosis involves extrinsic and intrinsic Figure 5C confirms that TRAIL protein was strongly induced pathways, and requires Jak1–STAT1/3 upon IFNb treatment in USP6/RD-ES in a doxycycline-dependent We next sought to dissect the mechanism of IFN-induced manner. Induction of TRAIL transcription and protein was also apoptosis. Depending on cell type, IFN can trigger extrinsic confirmed in the USP6/TC-71 Ewing sarcoma cell line (Fig. 5B apoptosis, which occurs through ligand binding to cell surface and C). Neutralizing anti-TRAIL antibody inhibited IFNb-induced receptors, or intrinsic apoptosis, which occurs through mitochon- apoptosis of both of USP6/RD-ES and USP6/TC-71 cells, as drial dysregulation. These pathways can be distinguished by their measured by PARP cleavage and Annexin V staining (Fig. 5D requirement for distinct caspase proteases (see Supplementary and E). Furthermore, CRISPR-mediated deletion of TRAIL Fig. S5A for pathway summary). Extrinsic apoptosis requires completely abrogated death of USP6/RD-ES by IFNb (Fig. 5F). cleavage/activation of caspase-8, followed by caspase-3/7; intrin- These data confirm that TRAIL plays a dominant role in mediating sic apoptosis entails cleavage of the mitochondrial protein, Bid, IFNb-induced apoptosis of USP6-positive Ewing sarcoma cells. and caspase-9 activation, which also triggers caspase-3/7 activa- As described above, the various Ewing sarcoma lines exhibited tion. However, in some circumstances extrinsic apoptosis induced differential sensitivities to IFNb-induced apoptosis in the pres- by IFN can feed into the mitochondrial route, and trigger cleavage/ ence of USP6: RD-ES and TC-71 were very sensitive, while CHLA- activation of Bid and caspase-9. 10 and SK-N-MC were largely unresponsive (Fig. 3; Supplemen- IFNinduced death of USP6/RD-ES was blocked by the cas- tary Fig. S4). To determine whether this was due to disparate pase-8–specific inhibitor, IETD (Fig. 4A), and was accompanied induction of TRAIL in these lines, qRT-PCR was performed. by caspase-8 cleavage (Fig. 4B), implicating the extrinsic pathway. However, we found that TRAIL transcription was also synergisti- However, IFNb also induced Bid cleavage (Fig. 4B) and caspase-9 cally induced in insensitive Ewing sarcoma lines (Fig. 5B). We activation (Fig. 4C), indicating engagement of the mitochondrial then explored whether the differential responsiveness might arise route. Activation of Caspase-3/7 was also observed, and could be from varied expression of TRAIL receptor. Strikingly, we found blocked by caspase-8 inhibitor (Fig. 4D). In sum, these data sensitivity to IFNb in the presence of USP6 correlated precisely indicate that IFNb-induced death of USP6/RD-ES cells occurs with expression of the TRAIL receptor DR4: DR4 levels were through a cell surface–mediated, extrinsic route that entails mito- highest in RD-ES and TC-71, and largely undetectable in the chondrial dysregulation. insensitive Ewing sarcoma lines (Fig. 5G). To further dissect the signaling mechanisms underlying apoptosis, we examined the roles of Jak1-STAT and NFkB, both of IFN triggers USP6 downregulation through TRAIL-dependent which have been shown to participate in IFN-mediated death (22, caspase activation 23). A pan-Jak family inhibitor completely blocked apoptosis of As mentioned above, type I IFNs induce downregulation of USP6/RD-ES, whereas the NFkB inhibitor was ineffective (Fig. USP6 protein (Fig. 2,3,4). We noted that TRAIL also triggered 4E). Reporter assays confirmed that the NFkB inhibitor was USP6 downregulation, in a time- and dose-dependent manner

1838 Mol Cancer Res; 16(12) December 2018 Molecular Cancer Research

USP6 in IFN-Mediated Apoptosis of Ewing Sarcoma

Figure 3. USP6 renders Ewing sarcoma cells sensitive to apoptosis by type I IFN. USP6/RD- Ewing sarcoma cells were grown in the absence or presence of doxycycline (dox), then treated with the indicated IFN at 1,000 U/mL for 24 hours. Cells were subjected to blotting (A), or Trypan blue exclusion assays to monitor viability (n ¼ 3) (B). C, Cells were grown in doxycycline, then treated with 1,000 U/mL IFNb for 18 hours or 24 hours. Apoptosis was quantiﬁed by Annexin V staining (n ¼ 4). D, USP6(Med), USP6 (High), and parental RD-ES cells were treated with doxycycline (dox) and IFNb overnight, then blotted as indicated. Arrowhead indicates cleaved PARP product. E, USP6/TC-71 cells were grown in the absence or presence of doxycycline (dox), then treated with 100 U/mL of the indicated IFN for 24 hours. F, Cells were grown in doxycycline (dox), then treated with 100 U/mL of the indicated IFN for 24 hours. Apoptosis was quantiﬁed by Annexin V staining (n ¼ 3). ERK or p65 was used as a loading control.

(Fig. 6A and B). TRAIL acted more rapidly, with USP6 down- caspase-8 inhibitor IETD completely blocked IFNb- and TRAIL- regulation observed within 4 hours, whereas IFNb required 12 induced USP6 downregulation (Figs. 4A and 6C, respectively). to 18 hours (Figs. 2A and 6B). Because caspases play a key Together, these results reveal a negative feedback mechanism role in TRAIL signaling, we tested whether they mediate USP6 whereby USP6 induces TRAIL transcription, which then signals downregulation. Both the pan-caspase inhibitor ZVAD and the through DR4 to trigger caspase-dependent downregulation of

www.aacrjournals.org Mol Cancer Res; 16(12) December 2018 1839

Henrich et al.

Figure 4. IFNb-induced apoptosis requires Jak1-STAT1/STAT3 and entails extrinsic and intrinsic death pathways. A and B, Cells were treated with doxycycline (dox) and IFNb overnight, in the absence or presence of 50 mmol/L pan-caspase inhibitor ZVAD (pan) or caspase-8 inhibitor IETD (8). Lysates were blotted as indicated. C and D, Cells treated with doxycycline (dox) and IFNb overnight, in the presence of caspase inhibitors as indicated, and caspase-9 (n ¼ 6) and caspase-3/7 activity was measured (n ¼ 3). Activity was calculated as fold relative to that in untreated USP6 (High)/RD-ES. E, USP6 (High)/RD-ES were treated with doxycycline (dox) and IFNb overnight, in the presence of a pan-Jak inhibitor (1 mmol/L) or NFkB inhibitor PS-1145 (15 mmol/L). F, Jak1, STAT1, or STAT3 were deleted by CRISPR gene editing. Cells were treated with doxycycline and IFNb overnight, then blotted as shown. Arrowhead indicates cleaved PARP product; ERK was used as a loading control.

USP6 (see Model Fig. 6D). Notably, this identifies type I IFNs and primary tumor samples by Oliveira and colleagues revealed that TRAIL as the first physiologic agonists to regulate USP6. among human malignancies, highest USP6 expression was most commonly observed in mesenchymal cancers, including Ewing fi Discussion sarcoma. The current study is the rst to explore functions of USP6 in Ewing sarcoma. We have found that USP6 expression is Although it has long been recognized that USP6 plays a key associated with an IFN signature in primary Ewing sarcoma etiologic role in several benign neoplasms, its functions in the tumors. Furthermore, USP6 is sufficient to trigger this response biology of malignant entities is poorly understood. Analysis of when inducibly expressed in cultured Ewing sarcoma cells. USP6

1840 Mol Cancer Res; 16(12) December 2018 Molecular Cancer Research

USP6 in IFN-Mediated Apoptosis of Ewing Sarcoma

Figure 5. IFNb induces apoptosis of USP6-positive Ewing sarcoma cells through synergistic production of TRAIL. A and B, Cells were treated with doxycycline (dox) and the indicated IFN (1,000 U/mL) for 24 hours. TRAIL mRNA levels were quantified by qRT-PCR, and fold-induction relative to untreated RD-ES determined. C, The indicated cells were treated with doxycycline (dox) and IFNb (1,000 U/mL) for 24 hours, and blotted as indicated. D and E, The indicated cells were treated overnight with IFNb (1,000 U/mL) or reTRAIL (200 ng/mL), in the presence of increasing amounts (1.0, 1.5, or 2.0 mg) of anti-TRAIL or control IgG. Samples were blotted in D, or subjected to Annexin V staining in E. F, TRAIL was depleted from USP6/RD-ES cells using CRISPR. Cells were treated overnight as indicated, and blotted as shown. G, The indicated Ewing sarcoma cell lines were blotted as shown. ERK or p65 was used as a loading control. also confers exquisite sensitivity of Ewing sarcoma cells to exog- activity modulated, or what normal physiologic processes it enous IFNs. Strikingly, Type I IFNs (particularly IFNb) induce participates in. We identify type I IFNs and TRAIL as the first TRAIL-mediated apoptosis of USP6-positive but not USP6-neg- physiologic agonists to induce posttranslational modification of ative Ewing sarcoma cells, in a DR4-dependent manner USP6. We show that TRAIL triggers the caspase-dependent pro- (see Fig. 6D for results summary). cessing and downregulation of USP6, and that type I IFN can also To date there are notably few studies on USP6, and thus trigger this downregulation through induction of TRAIL signaling. nothing is known of how its expression is regulated, how its We speculate that this negative feedback loop (wherein USP6

www.aacrjournals.org Mol Cancer Res; 16(12) December 2018 1841

Henrich et al.

Figure 6. Type I IFN induces USP6 downregulation through a TRAIL- and caspase-mediated mechanism. A–C, USP6/RD-ES cells were treated with doxycycline (dox) and the indicated doses of TRAIL or IFNa (1,000 U/mL) for the indicated times. In C, TRAIL was used at 10 ng/mL, and pan-caspase inhibitor ZVAD (pan) or caspase-8 inhibitor (8) was added as shown. STAT3 or p65 was used as a loading control. D, Mechanism of IFN-induced apoptosis of USP6-positive Ewing sarcoma cells: Jak1 levels are upregulated by USP6-mediated deubiquitination, greatly sensitizing cells to IFNs. Type I IFNs, particularly IFNb, induces transcription of TRAIL, which induces apoptosis through binding its receptor DR4. TRAIL/DR4 then triggers USP6 downregulation through caspase activation.

serves to amplify IFN-mediated induction of TRAIL, which then broader use has been limited by severe systemic side effects due elicits downregulation of USP6) may play an important role to its potent immunostimulatory activity (42). Our current results during normal physiology to restrict TRAIL-induced functions, may help alleviate this issue, because USP6 greatly sensitizes cells which include not only apoptosis but also inflammation (34, 35). to low-dose IFN. Thus, reduced IFN doses could be utilized that Along this vein, a key area for future pursuit is determining the would retain tumoricidal activity while minimizing systemic side consequences of USP6-mediated IFN signaling in Ewing sarcoma effects. Furthermore, because USP6 appears to be associated with pathogenesis. Numerous studies have indicated that IFNs can an IFN response in other cancers, our findings may be applicable either promote or antagonize tumor progression across broad to other malignancies in which USP6 is overexpressed. tumor types (36–38). This complexity can be ascribed to its ability to act not only on tumor cells, but also on immune cells and other Disclosure of Potential Conflicts of Interest cells in the tumor microenvironment. In some scenarios, IFNs can No potential conflicts of interest were disclosed. promote an inflammatory microenvironment that enhances proliferation and metastasis of tumor cells (38). In others, IFNs can Authors' Contributions stimulate immune infiltration and thereby promote tumor-cell Conception and design: I.C. Henrich, M.M. Chou killing. Thus, future studies will determine whether activation of Development of methodology: I.C. Henrich, M.M. Chou Acquisition of data (provided animals, acquired and managed patients, IFN signaling by USP6 acts in a pro- or antitumorigenic manner in in vivo provided facilities, etc.): I.C. Henrich, A.M. Oliveira, M.M. Chou Ewing sarcoma . Notably, previous studies have shown that Analysis and interpretation of data (e.g., statistical analysis, biostatistics, IFNs and TRAIL largely function in an antitumorigenic capacity in computational analysis): I.C. Henrich, M.M. Chou Ewing sarcoma, both in vitro and in murine xenografts (39–41). Writing, review, and/or revision of the manuscript: I.C. Henrich, M.M. Chou Results have been somewhat variable, with IFN being sufficient to Administrative, technical, or material support (i.e., reporting or organizing block proliferation and induce death in some studies, but requir- data, constructing databases): I.C. Henrich, R. Young, M.M. Chou Study supervision: I.C. Henrich, M.M. Chou ing cotreatment with other agents in others. Our work provides a Other (performed/carried out experiments): R. Young, L. Quick potential mechanism by which Ewing sarcoma cells acquire sensitivity to the apoptotic effects of IFNs. Acknowledgments Standard of care for patients with Ewing sarcoma has pro- The authors thank Gerd A. Blobel for critical reading of the manuscript. This gressed minimally over the past two decades. General cytotoxic work was funded by NIH/NCI grants CA168452 and CA178601 (to M.M. chemotherapy is typically inefficacious in patients with dissem- Chou) and TG 32GM008076 (to I.C. Henrich). inated or recurrent disease. Therefore, essential goals have been to develop novel therapies to prevent and treat recurrent/dissemi- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in nated disease, and to identify biomarkers that can predict accordance with 18 U.S.C. Section 1734 solely to indicate this fact. response to therapy. Type I IFN has previously been explored as a potential therapeutic for several cancers, but its use is currently Received March 25, 2018; revised May 5, 2018; accepted August 2, 2018; restricted to advanced cases of melanoma (42). However, its published first August 21, 2018.

References 1. Biswas B, Bakhshi S. Management of Ewing sarcoma family of tumors: 2. Cidre-Aranaz F, Alonso J. EWS/FLI1 target genes and therapeutic oppor- current scenario and unmet need. World J Orthop 2016;7:527–38. tunities in Ewing sarcoma. Front Oncol 2015;5:162.

1842 Mol Cancer Res; 16(12) December 2018 Molecular Cancer Research

USP6 in IFN-Mediated Apoptosis of Ewing Sarcoma

3. Gaspar N, Hawkins DS, Dirksen U, Lewis IJ, Ferrari S, Le Deley MC, et al. by ubiquitin-independent proteasomal degradation of alpha-catenin. Ewing sarcoma: current management and future approaches through J Biol Chem 2005;280:12758–65. collaboration. J Clin Oncol 2015;33:3036–46. 23. Huang H, Muddiman DC, Tindall DJ. Androgens negatively regulate 4. Toomey EC, Schiffman JD, Lessnick SL. Recent advances in the molecular forkhead transcription factor FKHR (FOXO1) through a proteolytic mech- pathogenesis of Ewing's sarcoma. Oncogene 2010;29:4504–16. anism in prostate cancer cells. J Biol Chem 2004;279:13866–77. 5. Oliveira AM, Hsi B, Weremowicz S, Rosenberg AE, Dal Cin P, Joseph N, 24. Banerjee S, Byrd JN, Gianino SM, Harpstrite SE, Rodriguez FJ, Tuskan RG, et al. USP6 (Tre2) fusion oncogenes in aneurysmal bone cyst. Cancer Res et al. The neurofibromatosis type 1 tumor suppressor controls cell growth 2004;64:1920–3. by regulating signal transducer and activator of transcription-3 activity in 6. Erickson-Johnson MR, Chou MM, Evers BR, Roth CW, Seys AR, Jin L, et al. vitro and in vivo. Cancer Res 2010;70:1356–66. Nodular fasciitis: a novel model of transient neoplasia induced by MYH9- 25. Chien Y, Scuoppo C, Wang X, Fang X, Balgley B, Bolden JE, et al. Control of USP6 gene fusion. Lab Invest 2011;91:1427–33. the senescence-associated secretory phenotype by NF-kappaB promotes 7. Agaram NP, LeLoarer FV, Zhang L, Hwang S, Athanasian EA, Hameed M, senescence and enhances chemosensitivity. Genes Dev 2011;25:2125–36. et al. USP6 gene rearrangements occur preferentially in giant cell reparative 26. Tirode F, Laud-Duval K, Prieur A, Delorme B, Charbord P, Delattre O. granulomas of the hands and feet but not in gnathic location. Hum Pathol Mesenchymal stem cell features of Ewing tumors. Cancer Cell 2007; 2014;45:1147–52. 11:421–9. 8. Carter JM, Wang X, Dong J, Westendorf J, Chou MM, Oliveira AM. USP6 27. Martignetti L, Laud-Duval K, Tirode F, Pierron G, Reynaud S, Barillot E, genetic rearrangements in cellular fibroma of tendon sheath. Mod Pathol et al. Antagonism pattern detection between microRNA and target expres- 2016;8:865–9. sion in Ewing's sarcoma. PLoS One 2012;7:e41770. 9. Paulding CA, Ruvolo M, Haber DA. The Tre2 (USP6) oncogene is a 28. Palmer RD, Barbosa-Morais NL, Gooding EL, Muralidhar B, Thornton CM, hominoid-specific gene. Proc Natl Acad Sci USA 2003;100:2507–11. Pett MR, et al. Pediatric malignant germ cell tumors show characteristic 10. Nakamura T, Hillova J M-SR, Onno M HK, Cannizzaro LA, Boghosian-Sell transcriptome profiles. Cancer Res 2008;68:4239–47. L, Croce CM, et al. A novel transcriptional unit of the tre oncogene widely 29. Barretina J, Caponigro G, Stransky N, Venkatesan K, Margolin AA, Kim S, expressed in human cancer cells. Oncogene 1992;7:733–41. et al. The cancer cell line encyclopedia enables predictive modelling of 11. Pringle LM, Young R, Quick L, Riquelme DN, Oliveira AM, May MJ, et al. anticancer drug sensitivity. Nature 2012;483:603–7. Atypical mechanism of NF-kappaB activation by TRE17/ubiquitin-specific 30. Cancer Cell Line Encyclopedia Consortium, Genomics of drug sensitivity protease 6 (USP6) oncogene and its requirement in tumorigenesis. in Cancer Consortium. Pharmacogenomic agreement between two cancer Oncogene 2012;31:3525–35. cell line data sets. Nature 2015;528:84–7. 12. Ye Y, Pringle LM, Lau AW, Riquelme DN, Wang H, Jiang T, et al. TRE17/ 31. Koch A, De Meyer T, Jeschke J, Van Criekinge W. MEXPRESS: visualizing USP6 oncogene translocated in aneurysmal bone cyst induces matrix expression, DNA methylation and clinical TCGA data. BMC Genomics metalloproteinase production via activation of NF-kappaB. Oncogene 2015;16:636. 2010;29:3619–29. 32. Huertas-Martinez J, Court F, Rello-Varona S, Herrero-Martin D, Almacellas- 13. Lau AW, Pringle LM, Quick L, Riquelme DN, Ye Y, Oliveira AM, et al. Rabaiget O, Sainz-Jaspeado M, et al. DNA methylation profiling identifies TRE17/ubiquitin-specific protease 6 (USP6) oncogene translocated PTRF/Cavin-1 as a novel tumor suppressor in Ewing sarcoma when co- in aneurysmal bone cyst blocks osteoblastic maturation via an autocrine expressed with caveolin-1. Cancer Lett 2017;386:196–207. mechanism involving bone morphogenetic protein dysregulation. 33. von Karstedt S, Montinaro A, Walczak H. Exploring the TRAILs less J Biol Chem 2010;285:37111–20. travelled: TRAIL in cancer biology and therapy. Nat Rev Cancer 14. Madan B, Walker MP, Young R, Quick L, Orgel KA, Ryan M, et al. USP6 2017;17:352–66. oncogene promotes Wnt signaling by deubiquitylating Frizzleds. Proc Nat 34. Zoller V, Funcke JB, Roos J, Dahlhaus M, Abd El Hay M, Holzmann K, et al. Acad Sci U S A 2016;113:E2945–54. Trail (TNF-related apoptosis-inducing ligand) induces an inflammatory 15. Quick L, Young R, Henrich IC, Wang X, Asmann YW, Oliveira AM, et al. response in human adipocytes. Sci Rep 2017;7:5691. Jak1-STAT3 signals are essential effectors of the USP6/TRE17 oncogene in 35. Azijli K, Weyhenmeyer B, Peters GJ, de Jong S, Kruyt FA. Non-canonical tumorigenesis. Cancer Res 2016;76:5337–47. kinase signaling by the death ligand TRAIL in cancer cells: discord in the 16. Oliveira AM, Perez-Atayde AR, Dal Cin P, Gebhardt MC, Chen CJ, Neff JR, death receptor family. Cell Death Differ 2013;20:858–68. et al. Aneurysmal bone cyst variant translocations upregulate USP6 tran- 36. Bekisz J, Sato Y, Johnson C, Husain SR, Puri RK, Zoon KC. Immunomod- scription by promoter swapping with the ZNF9, COL1A1, TRAP150, and ulatory effects of interferons in malignancies. J Interferon Cytokine Res OMD genes. Oncogene 2005;24:3419–26. 2013;33:154–61. 17. Masuda-Robens JM, Kutney SN, Qi H, Chou MM. The TRE17 oncogene 37. Wang BX, Platanias LC, Fish EN. STAT activation in malignancies: roles in encodes a component of a novel effector pathway for Rho GTPases Cdc42 tumor progression and in the generation of antineoplastic effects of IFNs. and Rac1 and stimulates actin remodeling. Mol Cell Biol 2003;23: J Interferon Cytokine Res 2013;33:181–8. 2151–61. 38. Zaidi MR, Merlino G. The two faces of interferon-gamma in cancer. Clin 18. Rueckert C, Haucke V. The oncogenic TBC Domain Protein USP6/ Cancer Res 2011;17:6118–24. TRE17 regulates cell migration and cytokinesis. Biol Cell 2012;104: 39. Kontny HU, Hammerle K, Klein R, Shayan P, Mackall CL, Niemeyer CM. 22–33. Sensitivity of Ewing's sarcoma to TRAIL-induced apoptosis. Cell Death 19. Li L, Yang H, He Y, Li T, Feng J, Chen W, et al. Ubiquitin-specific protease Differ 2001;8:506–14. USP6 regulates the stability of the c-Jun Protein. Mol Cell Biol 2017;38:pii: 40. Wietzerbin J, Abadie A. Involvement of TNFrelated apoptosisinducing e00320–17. ligand (TRAIL) induction in interferon gMediated apoptosis in Ewing 20. Funakoshi Y, Chou MM, Kanaho Y, Donaldson JG. TRE17/USP6 regulates tumor cells. Ann N Y Acad Sci 2003;1010:117–120. ubiquitylation and trafficking of cargo proteins that enter cells by clathrin- 41. Picarda G, Lamoureux F, Geffroy L, Delepine P, Montier T, Laud K, et al. independent endocytosis. J Cell Sci 2014;127:4750–61. Preclinical evidence that use of TRAIL in Ewing's sarcoma and osteosar- 21. Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide coma therapy inhibits tumor growth, prevents osteolysis, and increases libraries for CRISPR screening. Nat Methods 2014;11:783–4. animal survival. Clin Cancer Res 2010;16:2363–74. 22. Hwang SG, Yu SS, Ryu JH, Jeon HB, Yoo YJ, Eom SH, et al. Regulation 42. Wang BX, Rahbar R, Fish EN. Interferon: current status and future prospects of beta-catenin signaling and maintenance of chondrocyte differentiation in cancer therapy. J Interferon Cytokine Res 2011;31:545–52.

www.aacrjournals.org Mol Cancer Res; 16(12) December 2018 1843

USP6 Confers Sensitivity to IFN-Mediated Apoptosis through Modulation of TRAIL Signaling in Ewing Sarcoma

Ian C. Henrich, Robert Young, Laura Quick, et al.

Mol Cancer Res 2018;16:1834-1843. Published OnlineFirst August 21, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-18-0289

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2018/08/21/1541-7786.MCR-18-0289.DC1

Cited articles This article cites 42 articles, 15 of which you can access for free at: http://mcr.aacrjournals.org/content/16/12/1834.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://mcr.aacrjournals.org/content/16/12/1834.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/16/12/1834. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.