Phylogeny of the Genus Argia (Odonata: Coenagrionidae) with Emphasis on Evolution
of Reproductive Morphology
Dissertation
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University
By
Ryan Matthew Caesar
Graduate Program in Evolution, Ecology and Organismal Biology
The Ohio State University
2012
Dissertation Committee:
Dr. Norman Johnson, Advisor
Dr. Marymegan Daly
Dr. John Freudenstein
Dr. Hans Klompen
Copyright by
Ryan Matthew Caesar
2012
Abstract
The damselfly genus Argia is found throughout the New World where some species are common and abundant members of lotic freshwater and adjacent ecosystems.
Argia species are not only important predators of aquatic and terrestrial invertebrates but are themselves an important prey item to a variety of other insects and vertebrates. The distribution of species is highly variable within the genus and some species are locally threatened or endangered due to range limitation and habitat loss. Damselflies and dragonflies (Odonata) may be useful indicators of aquatic ecosystem health as well as indicators of climate change.
There are approximately 120 species described with at least twenty suspected undescribed species. The taxonomy of the North American species is well known, but the
Central and South American species are in need of revision. The phylogeny of the genus has never been studied using modern, repeatable methods. Therefore the evolutionary history of the genus has never been thoroughly explored.
The reproductive biology of Odonata is unique among insects and provides a model system for testing hypotheses related to character evolution by sexual selection and other mechanisms of evolution. Argia species have unique morphologies of male and female secondary sexual characters, the modified cerci and paraprocts of males and the
ii
corresponding plates of the female pro- and meso-nota that are grasped by males during
copulation and oviposition. The patterns of variation in these structures, both within and among species, may reveal the extent to which sexual and natural selection help shape the
current diversity of the group.
This dissertation presents phylogenetic hypotheses for the genus Argia using data
from external morphology and ribosomal DNA. Maximum parsimony and maximum
likelihood analyses were performed on the data, resulting in topologies that are mostly
congruent, well-resolved, and moderately to highly supported. The variation in male
cercus morphology is examined using three dimensional morphometrics where shape is
quantified from computer tomography models. The phylogenetic hypotheses are used to
examine patterns of cercus variation across the genus. The same methods are applied to
populations of the widespread species Argia moesta in an attempt to test whether
intrasexual selection applies to these important reproductive structures.
iii
Dedication
Dedicated to my Father, Rodney Bruce Caesar
January 8, 1949 – July 22, 2009
iv
Acknowledgments
There are many people who directly and indirectly played key roles in my
graduate training and the production of this dissertation. I cannot possibly thank these
people enough within the confines of this document, but I will mention them in brief as a sincere token of my appreciation for their support, guidance, and love.
I would like to foremost thank my committee members for their guidance and
patience during my time as a graduate student at Ohio State: Dr. Meg Daly, Dr. Hans
Klompen, Dr. John Freudenstein and my advisor Dr. Norm Johnson. Not only has their instruction been instrumental in my growth as a biologist, for which I am especially grateful.
I came to Ohio State and worked for several years as a student of Dr. John
Wenzel before he took a position outside of the university. John taught me more about phylogenetic systematics, natural history, and many other topics than anyone else in my life. I am indebted to him for expanding my knowledge and abilities as a biologist and educator and for his support and friendship.
Without the assistance of two generous scientists my work would not have been possible. I especially thank Dr. Rosser Garrison of the California Department of Food
v
and Agriculture and Dr. Mark McPeek of Dartmouth College for sharing their expertise
with me on odonate biology.
Dr. Ajit Chaudpari of the OSU Sports Biomechanics laboratory generously lent
me use of his facilities computers and software for CT image analysis.
My undergraduate advisor Dr. John Abbott of the University of Texas and my master’s degree advisor Dr. Anthony Cognato of Michigan State University continue to
serve as mentors and friends, and their role in shaping me as a scientist is considerable. I
thank them for all they continue to do for me.
As an undergraduate student, Ahalya Skandarajah assisted me with molecular
laboratory work. She presented a posted of her contributions at the Annual Meeting of the
Entomological Society of America in Indianapolis in 2010.
Members of the Wenzel lab that overlapped with me have not only become good
friends but also helped shape many of the ideas in this dissertation: Sibyl Bucheli, Hojun
Song, Joe Raczkowsi, Todd Gilligan, and Glené Mynhardt. For their friendship and
collegiality I am eternally grateful.
Many fellow graduate students, postdocs and researchers in the Museum of
Biological Diversity at Ohio State have been helpful and inspirational along the way and
I thank you immensely, including: Craig Barrett, Elijah Talamas, Steve Passoa, Alejandro
Valerio, Charuwat Taekul, Monica Farfan, Kaitlyn Upstrom, Annie Lindgren, Brandon
Sinn, Paul Larson, Abby Reft, Luciana Gusmao.
I am grateful to my immediate family members for various forms of support, including but not limited to financial, motivational, and emotional: my parents-in-law Jim
vi and Rita Shave, my brother-in-law Ryan Shave and his wife Carol, my sister Jenny
Cresswell and her husband Ronny, my brother Chris, and my parents Rodney and Sue.
For my entire life, Mom and Dad provided gentle guidance, never imposing demands but always suggesting that I explore all options and alternatives and take the path that suited me best. I hope I have done so.
Most importantly of all, I thank my loving wife Jenny. She provided vast technical assistance with the production of figures for this document as well as numerous presentations throughout my graduate career, and her skills as a production artist are immeasurable. Her support, patience, and friendship are invaluable. Along the way, she gave me the greatest gift of my life, our son August Rodney. I’m sorry I took so long, and
I love you dearly!
vii
Vita
August 16, 1975 ...... Born- Fort Knox, Kentucky
May 2001 ...... B.A. Zoology, University of Texas
May 2004 ...... M.S. Entomology, Texas A&M
University
Publications
Caesar, R. M., N. Gillette, and A.I. Cognato. 2005. Population Genetic Structure of an
Edaphic Beetle (Ptiliidae) Among Late Successional Reserves in the Klamath-
Siskiyou Ecoregion, California. Annals of the Entomological Society of America
98(6): 931-940.
Caesar, R. M., M. Sörensson, and A. I. Cognato. 2006. Integrating DNA Data and
Traditional Taxonomy to Streamline Biodiversity Assessment: An example from
Edaphic Beetles in the Klamath Ecoregion, California, USA. Diversity and
Distributions 12(5): 483-489.
Caesar, R.M. and J.W. Wenzel. 2009. A Phylogenetic Test of Classical Species Groups in
Argia (Odonata: Coenagrionidae). Entomologica Americana 115(2): 97-108.
viii
Fields of Study
Major Field: Evolution, Ecology and Organizmal Biology
Specialization: Entomology, Systematics of Odonata
ix
Table of Contents
Abstract ...... ii
Dedication ...... iv
Acknowledgments...... v
Vita ...... viii
Table of Contents ...... x
List of Tables ...... xv
List of Figures ...... xvi
Chapter 1 : General Introduction ...... 1
The Order Odonata ...... 1
The Genus Argia ...... 2
Description of Dissertation Project ...... 3
Chapter 2 : A Phylogenetic Test of Classical Species Groups in Argia (Odonata:
Coenagrionidae) ...... 5
Introduction ...... 5
Materials and Methods ...... 7 x
Taxon sampling ...... 7
Character analysis ...... 8
Phylogenetic analysis ...... 12
Results ...... 13
Discussion ...... 14
References ...... 27
Chapter 3 : General Review of the Reproductive Biology of Odonata, With Emphasis on the Genus Argia (Coenagrionidae) ...... 33
Introduction ...... 33
Territoriality, Courtship, and Precopulatory Behavior ...... 37
Initiating Mating and Tandem Linkage ...... 39
Copulation ...... 41
Sperm Displacement ...... 43
Duration and Frequency of Mating ...... 44
Sex Ratio ...... 45
Oviposition ...... 46
Color Polymorphism ...... 49
Reproductive Characters in Phylogenetic Studies of Odonates ...... 49
Previous Classifications of Mating Systems for Argia ...... 52
xi
Does Sexual Selection Operate on Argia species? ...... 54
Conclusions and Future Research Needs ...... 57
References ...... 61
Chapter 4 : Phylogeny of the Damselfly genus Argia (Odonata: Coenagrionidae) based on
Combined Morphological and Molecular Data ...... 72
Introduction ...... 72
Status of Taxonomy ...... 73
Materials and Methods ...... 76
Taxon Selection ...... 76
Morphological Data ...... 78
Molecular Data ...... 79
Phylogenetic Analysis ...... 81
Results ...... 82
Analysis of Combined Data ...... 82
Utility of Morphological Characters...... 84
Discussion ...... 86
Argia oculata group ...... 87
Metallic Clade...... 88
Argia fumipennis ...... 90
xii
“Hyponeura” clade ...... 91
Argia pulla complex ...... 92
Argia fissa clade ...... 93
Argia tibialis clade ...... 93
vivda-plana-extranea ...... 94
Other findings ...... 95
Morphological Characters in Taxonomy and Phylogeny ...... 96
Implications of Phylogeny for Sexual Selection ...... 98
Conclusions ...... 100
References ...... 115
Chapter 5 : Geographic Variation in Mitochondrial DNA and Reproductive Morphology in Argia moesta ...... 125
Introduction ...... 125
Materials and Methods ...... 131
Taxon Sampling ...... 131
Results ...... 136
Population structure/ Phylogenetic analysis ...... 136
Morphological Analysis ...... 137
Discussion ...... 137
xiii
Conclusions ...... 143
References ...... 151
Bibliography ...... 155
Appendix A: Taxonomic information, collection records and GenBank accession numbers for Argia and outgroup species used in phylogenetic analyses...... 175
Appendix B: List of Morphological Characters with Comments ...... 179
Appendix C: Morphological Data matrix used in Chapter 4 ...... 186
xiv
List of Tables
Table 2.1: Morphological character matrix used for parsimony analysis of Argia. See
Methods for coding...... 21
Table 3.1: Comparison of select recent phylogenetic analyses emphasizing Odonata and the primary character partitions upon which the studies are based...... 60
Table 4.1: Table of support values for selected clades. Values are reported for the
separate and combined data sets analyzed by MP and ML...... 102
Table 5.1: Sampling data for specimens of A. moesta included in this study...... 144
xv
List of Figures
Figure 2.1: Photo of the pro- and mesothorax of a female of Argia emma, lateral oblique angle. Arrows indicate some of the characters coded in the morphological matrix...... 22
Figure 2.2: Strict consensus of 38 equally parsimonious trees resulting from analysis of
16S data alone. Clades with dots are recovered in both ML and parsimony analyses.
Numbers below branches are Bremer support values...... 23
Figure 2.3: Best maximum likelihood tree generated by analysis of the 16S data using
GARLI...... 24
Figure 2.4: Strict consensus of six equally parsimonious trees generated from combined
16S and morphology data. Clades with dots are recovered in ML analyses of 16S alone.
Numbers below branches are Bremer support values...... 25
Figure 2.5: Alternate arrangement of three components accounts for a majority of the
disagreement between the molecular-only and combined analyses...... 26
Figure 4.1: One of 11 equally parsimonious tree of 1,520 steps based on the combined
data set. Numbers above branches are Bremer Support Values. Some of the clades
discussed in the text are highlighted with colors and labeled...... 103
Figure 4.2: Strict consensus of 11 equally parsimonious trees of length 1,520 from MP
analysis of the combined data...... 104
xvi
Figure 4.3: One of 10 equally parsimonious trees of 1092 steps from analysis of 16S data.
Colors indicate some clades discussed in the text ...... 105
Figure 4.4: Strict consensus of 10 equally parsimonious trees of length 1092 from
analysis of 16S data...... 106
Figure 4.5: ML tree of 16S data with bootstrap values for each node...... 107
Figure 4.6: Ventral view of right cerci of A) Argia eliptica B) A. difficilis and C) A.
oculata. Images are models based on CT scans...... 108
Figure 4.7: Ventral view of right cerci of A) Argia barretti B) A. ulmeca and C) A. herberti. Images are models based on CT scans...... 109
Figure 4.8: Ventral view of right cerci of some species in the "metallics" clade: A) Argia cupraurea B) A. dunklei C) A. joergenseni D) A. oenea E) A. dives F) A. orichalcea.
Images are models based on CT scans...... 110
Figure 4.9: Ventral view of right cerci of A) Argia bipunctulata B) A. leonorae C) A.
fumipennis and D) A. pallens. Images are models based on CT scans...... 111
Figure 4.10 Ventral view of right cerci of A) Argia azula B) A. anceps and C) A. westfalli. Images are models based on CT scans...... 112
Figure 4.11: Ventral view of right cerci of A) Argia lugens and B) A. moesta. Images are
models based on CT scans ...... 112
Figure 4.12: Ventral view of right cerci of A) Argia translata B) A. emma and C) A.
tibialis. Images are models based on CT scans...... 113
Figure 4.13: Ventral view of right cerci of A) Argia tezpi B) A. tarascana and C) A.
apicalis. Images are models based on CT scans ...... 114
xvii
Figure 5.1: Apparent geographic variation in cerci morphology (highlighted with line) of
male A. moesta. From dorsal view. (FL- Florida; UT- Utah; NY- New York; TX- Texas).
...... 145
Figure 5.2: Right cerci of select male A. moesta specimens from different populations, reconstructed from CT scans. These cerci are pictured from a ventro-medial angle. .... 145
Figure 5.3: Phylogeny of A. moesta populations based on 16S. MP and ML produce the same result. Colors indicate populations discussed in the text: northeast (red), central upland (green) and gulf (purple). See Table 5.1 for details about sampling location of
specimens...... 146
Figure 5.4: Phylogeny of A. moesta populations based on COI (MP tree, no ML analysis performed). See Table 5.1 for details about sampling location of specimens...... 147
Figure 5.5: Right cercus of a male A. moesta from Texas with position of six of seven
landmarks indicated by spheres (the seventh is placed on the opposite side of the cercus
in this orientation)...... 148
Figure 5.6: PCA of right cercus for Argia. cuprea, A. translata, A. emma, A. azula, and A.
moesta populations from Texas, California, Utah, New York, New Jersey, North
Carolina, Florida, Ohio and Mexico. See Table 5.1 for details about sampling location of
specimens...... 149
Figure 5.7: PCA of same A. moesta populations and data as Fig. 5.6, but analyzed without other species. See Table 5.1 for details about sampling location of specimens...... 150
xviii
Chapter 1 : General Introduction
“…the intrageneric systematics of Argia represents a fertile field for further work…”
-Westfall and May 1996
The Order Odonata
Insects in the order Odonata (dragonflies and damselflies) are among the most
primitive lineages of winged insects (Wheeler et al., 2001; Hovmöller et al., 2002; Ogden
and Whiting, 2003; Kjer, 2004; Simon et al., 2009; Lin et al., 2010; Trautwein et al.,
2012). A number of shared derived characteristics define the order, including the unique
modifications of the primary and secondary reproductive structures. The generalized
reproductive biology of Odonata is known for its distinct behavioral and morphological
features and is considered a model taxon for studies of sexual selection as a mechanism
for phenotypic evolution and speciation (Eberhard, 1985; Eberhard, 1986; Bailey and
Ridsill-Smith, 1991; Shuster and Wade, 2003; Grimaldi and Engel, 2005).
A majority of the research on odonate evolution involves experimental and observational study of behavior and ecology. The taxonomy of the relatively small insect order is well known. Although there has been an increase in numbers of phylogenetic
1 studies (i.e. Carle and Kjer, 2002; Turgeon and McPeek, 2002; O'Grady and May, 2003;
Rehn, 2003; Ware et al., 2007a; Bybee et al., 2008; Carle et al., 2008), little is known about broad phylogenetic patterns and evolution of characters for dragonflies and damselflies. Despite the extraordinary reproductive biology of Odonata, detailed knowledge of many taxa and general evolutionary trends within the order remains limited.
The Genus Argia
The genus Argia (Odonata: Zygoptera: Coenagrionidae: Argiinae) was described by Rambur in 1842. It is speciose in comparison to other odonate genera, with 120 valid species names currently in the literature (Garrison, 1994; Garrison and von Ellenrieder,
2007). The genus is endemic to the New World, with its greatest diversity occurring in the neotropics. Approximately thirty six species can be found in North America north of
México, with high species diversity in the southwestern United States. Some common
Argia species can be locally abundant. Like all odonates, they are voracious predators in all life stages and therefore represent vital components of the trophic webs of freshwater lotic aquatic ecosystems.
Most species of Argia prefer streams over large rivers or lakes (Westfall and May,
1996). Several species are rare, endemic, or threatened, and may be of conservation concern. For example, in Ohio, A. bipunctulata (Hagen) is listed as an endangered species, due to its restriction in the state mainly to the 182 hectare Cedar Bog Preserve and a few other fen habitats (Moody, 2002), although the species is fairly common in
2 adjacent states. Argia sabino Garrison is known from very few localities in Arizona which are threatened by forest fire.
Some of the common species have been studied from a behavioral and ecological perspective (Borror, 1934; Bick and Bick, 1965b; Bick and Bick, 1971; Bick and Bick,
1982; Robinson et al., 1983; Conrad and Pritchard, 1988b; Conrad and Pritchard, 1988a;
Conrad and Pritchard, 1990; Conrad, 1992). Little is known about the biology of most of the tropical species, and there has never been a phylogenetic study of the genus.
Description of Dissertation Project
Chapter Two presents a preliminary phylogeny of the species of Argia that are found in North America north of México, and a test of the proposed species groups that had been made based on morphology many years prior and in absence of a phylogenetic hypothesis. The study is based primarily on sequences of a portion of the 16S small subunit ribosomal RNA as well as a few morphological characters from nymphs, adult males, and females. In most cases, strong support is found by this independent analysis for the morphology-based species groups of previous workers.
The third chapter is a general literature review of the reproductive biology of
Odonata with an emphasis on the genus Argia. The known biology of precopulatory behavior is discussed and compared to the literature on other damselfly families and genera. The process of tandem linkage between males and females is reviewed as a potential target for sexual selection by female choice in Argia. Copulation itself is briefly discussed in light of the potential for sexual selection by sperm competition to act. The
3 role of post-mating guarding via tandem and aggregate oviposition is examined as this process may impact the role of sperm competition in Argia. Finally, the lack of male genital characters in phylogenetic studies, despite evidence for their utility and relative ease of coding, is highlighted and discussed.
Chapter four presents a broad phylogeny of the entire genus Argia based on an expanded 16S rRNA data set as well as additional morphological characters. These data allow for a well-resolved and highly-supported phylogeny of 91 of the 120 described species in the genus. Separate and combined analysis of the data by parsimony and likelihood methods result in well-resolved and congruent topologies. The placement of some species remains uncertain, but there is agreement with the major clades in all analyses performed. This provides a strong foundation for future comparative work on the genus.
Chapter five is a study of Argia moesta utilizing a combined phylogeographic and morphometric approach to test the hypothesis that mechanical isolation is the mechanism that determines observed patterns of variation in secondary sexual morphology of Argia.
The alternate hypotheses include sexual selection, or a combination of sexual selection and mechanical isolation. The preliminary results suggest that both mechanisms may differentially operate within the species, depending on the number of sympatric congeners.
4
Chapter 2 : A Phylogenetic Test of Classical Species Groups in Argia (Odonata:
Coenagrionidae)
Introduction
Rambur described the genus Argia (Odonata: Zygoptera: Coenagrionidae:
Argiinae) in 1842. Argia is extremely speciose in comparison to other odonate genera, with 120 valid described species (Garrison, 1994; Garrison and von Ellenrieder, 2007).
The genus occurs throughout the New World, with its greatest diversity occurring in the neotropical region. There are approximately thirty six species that can be found in North
America north of México, with the highest diversity in the southwestern United States;
twenty three species are known to occur in southeastern Arizona alone. The remaining species occur in subtropical, tropical and temperate regions of Meso- and South America.
Populations of common Argia species can be quite large, and, like all odonates, they are
voracious predators in all life stages. As such, they represent vital components of the
trophic webs of aquatic ecosystems.
Most species of Argia prefer low to mid order streams (Westfall and May, 1996),
unlike the remainder of coenagrionids that tend to occur in lentic systems (Dunkle, 1990).
Several species are rare, endemic, or threatened, and may be of conservation concern. For
5 example, in Ohio, A. bipunctulata (Hagen) is listed as an endangered species, due to its restriction in the state mainly to the 182 hectare Cedar Bog Preserve and a few other fen habitats (Moody, 2002), although the species is fairly common in adjacent states. The recently described species A. sabino Garrison is known from very few localities in
Arizona, most of which are continually threatened by forest fire, and thus it is considered a species of concern by biologists in that state (D. Turner, pers. comm.) Some of the more common species have been thoroughly studied from a behavioral and ecological perspective (Borror, 1934; Bick and Bick, 1965b; Bick and Bick, 1971; Bick and Bick,
1982; Robinson et al., 1983; Conrad and Pritchard, 1988b; Conrad and Pritchard, 1988a;
Conrad and Pritchard, 1990; Conrad, 1992). Little is known about the biology of most of the tropical species, and there has never been a phylogenetic study of the genus.
The current taxonomy of Argia species has been established in the absence of an explicit phylogenetic hypothesis based on modern comparative methods. In his work on
Central American Odonata, Calvert treated forty eight species of Argia (Calvert, 1901), eighteen of which occur in the United States (Garrison, 1994). Kennedy included some
Argia species in his “phylogeny” of Zygoptera (Kennedy, 1920b), and he described several species (Kennedy, 1918; Kennedy, 1919a). Leonora Gloyd did considerable taxonomic work on Argia throughout her life (Gloyd, 1958; Gloyd, 1968b; Gloyd,
1968a), although she died before much of her work was completed (Garrison, 1994). The larvae of some Mexican species were treated by Novelo-Gutiérrez (1992). Garrison
(1994) provided a thorough synopsis of the species of Argia occurring north of México,
including taxonomic keys for adults (these keys are reproduced in Westfall and May
1996), and several informal species groups were outlined. Förster (2001) provides
6 updated taxonomic keys for some of the more common Central American species of
Argia. Garrison is currently continuing the work of Leonora Gloyd on revising the tropical species (personal communication). Many undescribed species are thought to exist, and new species descriptions continue to be published (Daigle, 1991; Garrison,
1994; Daigle, 1995; Garrison, 1996; Garrison and von Ellenrieder, 2007). Here we provide the first modern phylogenetic hypothesis for Argia species based on multiple data
sources and using two phylogenetic optimality criteria. These preliminary phylogenetic
analyses allow us to test existing taxonomic hypotheses, contribute an improved understanding of species relationships, and provide a foundation for resolving the
phylogeny of the genus.
Materials and Methods
Taxon sampling
Our matrix includes thirty eight of the 120 described Argia species, including
nearly all of those found north of México as well as several from Mesoamerica. A.
carlcooki Daigle is the only species currently known to occur north of México that is
missing from our matrix. Collection records for specimens used in this study are listed in
Appendix A, along with GenBank accession numbers. Where possible, we include in this study adult specimens that were recently collected in the field using a hand held aerial net and deposited directly into 95% ethyl alcohol for preservation. Additional specimens were donated by other collectors utilizing various collection and preservation techniques,
7 or were borrowed from the International Odonata Research Institute (IORI; Gainesville,
Florida). Additionally, we did not attempt to collect molecular data from some species for
which few or single specimens were available.
Species were identified on the basis of published keys based on morphological
characters (Garrison, 1994; Westfall and May, 1996; Abbott, 2005). Argia. sp. nov. is an undescribed species collected in northern México; it has been known for several years but remains undescribed. The sister group of Argia is not known; we include six outgroup taxa representing other damselfly lineages. 16S sequences for these outgroup species were taken from GenBank (Appendix A). Specimens used in this study are deposited as vouchers at either the IORI or the Charles Triplehorn Insect Collection at the Ohio State
University (OSUC) in Columbus, Ohio.
Character analysis
We coded ten morphological characters from imagos of both sexes as well as larvae for 35 Argia species. Characters of the head, thorax and abdomen, including secondary sexual characters of both sexes, are represented. Characters were initially chosen based on information in published dichotomous keys. These characters are unambiguous in their interpretation and do not seem to vary within species. The morphological matrix is presented in Table 2.1
.
Character 1. Thorax and head with metallic copper-red coloration (imagos):
absent (0), present (1). This condition is also associated with copper-red to red
8 eyes for specimens in vivo (imagos.) Species with this coloration are often referred to as being associated together in the “metallics” group. While pigmentation is generally not a very useful character for damselflies, as it is often variable within species, this condition is largely a result of structural coloration and is invariant within species.
Character 2. Mesepisternal tubercles (females): absent (0), reduced (1), prominent (2). See Fig. 2.1.
Character 3. Posterior lobes of mesostigmal plates (females): absent (0), broad and flange-like (1), elongate and finger-like (2). See Fig. 2.1.
Character 4. Mesothoracic pits (females): absent (0), shallow (1), deep (2). This character has been discussed in very limited context in the literature, but it has been suggested that it might be informative for phylogenetics (Gloyd, 1958). Here we code it for the first time and show that it is useful.
Character 5. Hairs lining mesothoracic pits (females): absent (0), sparse (1), dense (2).
Character 6. Mesepisternal pits costate (females): absent (0), present (1).
9 Character 7. Pronotal pits (females): absent (0), shallow (1), deep (2). This
character is not utilized in keys or discussed much in the literature, but seems to
be variable enough within Argia to be useful. Indeed, this region corresponds to
the placement of the dorso-posterior potion of the male paraprocts during tandem
linkage and copulation (see Fig. 2.1.)
Character 8. Shape of cerci (males): entire (0), bifid (1), trifid (2). Cerci are a
secondary sexual character, utilized as part of the clasping process during
copulation. The cerci contact the female mesostigmal plates and mesepisternal
tubercules when linked in copula and may be part of the mechanism by which
females recognize and evaluate males.
Character 9. Shape of paraprocts (males): entire (0), bifid (1), trifid (2).
Character 10. Lateral gills with marginal fringe of stout setae (larvae): present
(0), absent (1).
Genomic DNA was extracted from specimens that were either freshly collected and preserved in 95% ethyl alcohol, or older museum specimens that were acetone-dried
(up to 20 years old). A modification of the animal tissue protocol for Quiagen DNeasy extraction kits (Quiagen, Valencia, CA, USA; Caesar et al., 2005) was used to extract
DNA from leg and thoracic muscle tissue that was isolated from specimens using sterile techniques. Dried specimens from which DNA was extracted were labeled as DNA
10 vouchers. DNA template vouchers are stored at -80 °C in the Museum of Biological
Diversity, Ohio State University, Columbus, Ohio, USA (MBD).
16S ribosomal DNA (0.6 kb) from the mitochondria was amplified by the
polymerase chain reaction (PCR) run at 35 cycles with annealing temperature of 50º C.
We used the primers LR-J-12887 (5’ CCGGTCTGAACTCAGATCACGT 3’) and LR-N-
13398 (5’ CGCCTGTTTAACAAAAACAT 3’) (Simon et al., 1994), known to be useful
in several odonate studies (e.g. Misof et al., 2000). Reactions were carried out in 25 µl
volumes, with 12.5 µl of a Taq polymerase master mix (Quiagen, Inc. Valencia, CA,
USA), 3.5 µl of H2O, 2.0 µl of each primer (0.5 pmol/µl), and 5.0 µl genomic DNA
template. A layer of mineral oil was applied to each sample, and reactions occurred on a
PTC-100 Peltier thermal cycler (MJ Research, Ramsey, Minnesota, USA). Amplified
DNA was separated in an agarose gel via electrophoresis and visualized under UV light for verification of presence of amplicon and to check for contamination. PCR products were purified using QIAquick PCR purification kit (Quiagen, Valencia, CA, USA), and purified DNA was sequenced at the Plant Microbe Genomics Facility (Ohio State
University, Columbus, OH) or at Cogenics (Houston, TX).
Editing and assembly of raw sequences was performed using Sequencher 4.1.
(Gene Codes Corp., Ann Arbor, Michigan, USA). We sequenced PCR products in both directions, and and differences or ambiguities between strands were resolved by eye after examining the elecropherograms of each sequence. Edited sequences were initially aligned by eye in Sequencher 4.1, then submitted to CLUSTALW (Thompson et al.,
1994) for further alignment using a 1:1 gap opening: extension cost. After editing and
11 alignment, we utilized 551 base pairs (bp) as our molecular data matrix. All new sequences generated in this study were deposited in GenBank (Appendix A).
Phylogenetic analysis
Calopteryx was designated as outgroup for all phylogenetic analyses. Parsimony analysis was performed on the molecular data only, and in combination with the morphological data. We used the parsimony ratchet implemented in NONA/WinClada
(Nixon, 2000). By default, this implements TBR branch swapping. Gaps in the molecular matrix were treated as missing data. Bremer support values were generated in NONA using the command “>hold 15000; bsupport 5;” to estimate relative clade support. This command generates as many as 15, 000 trees that are up to five steps longer than the most parsimonious trees.
Concordance among trees produced by different methods of phylogenetic reconstructions is considered by some to be a good test of phylogenetic accuracy
(Huelsenbeck, 1997). Thus, we also performed Maximum Likelihood (ML) analysis on the molecular data. We did this using the program GARLI, version 0.96 (Zwickl, 2006), which uses a genetic algorithm to rapidly search for the nucleotide substitution model parameters, branch lengths, and topology that maximize the log likelihood score. Default parameters were used for 100 search replicates.
12 Results
In some cases, DNA extraction and/or PCR amplification of the target sequence
failed for older museum specimens that were otherwise available for study. Thus, our
analyzed matrices do not include all available species. The ClustalW-aligned molecular matrix contains 126 informative sites and yields 38 most parsimonious trees (489 steps,
CI = 0.54, RI=0.61) in the MP analysis. The strict consensus (499 steps) of these is shown in Fig. 2. A monophyletic Argia is recovered with good support, but a basal
polytomy with several weakly supported clades follows. The ML analysis of the
molecular data produced two trees that differ only in the resolution of the clade containing the three species A. apicalis (Say), A. tarascana Calvert, and A. tezpi Calvert.
The ML tree with the best likelihood score is shown in Fig. 3.
Analysis of the morphological matrix (Table 2.2) alone yields trees (not shown)
that are poorly resolved and not informative. Combining the morphological and
molecular characters, we obtained six most parsimonious trees (573 steps, CI = 0.49, RI
=0.58). The consensus (578 steps) is shown in Fig. 2.4. These morphological data in the
combined analysis improved resolution in comparison with the molecular data alone, with few changes in topology. Again Argia is recovered as monophyletic, although the
Bremer support value improves from three to five. The basal polytomy resulting from the
molecular only data is resolved, and we recover the clade of A. funcki (Selys) + A. lugens
(Hagen) as basal to the rest of the genus. In the combined tree, A. moesta (Hagen) is more basal, closer to A. translata Hagen; A. munda Calvert falls out of the clade to which it belonged, sister to the component including A. pima Garrison and A. rhoadsi Calvert.
13 Some taxa are derived more apically in the combined tree compared to the molecular
tree, such as A. oculata Hagen, which is no longer sister to A. oenea Hagen in the basal
paraphyly at the ingroup node of Fig. 2.2. The polytomy in the middle of the molecular
tree (the component including A. alberta Kennedy, nahuana Calvert, leonorae Garrison,
to A. anceps Garrison) has better resolution, and the A. pima- A. westfalli Garrison
component is now sister to the remainder, with the A. emma Kennedy- A. extranea
(Hagen) group coming out next.
Discussion
All but three clades from the MP consensus from the combined matrix are found
in the ML trees, as indicated by the dots on the shared nodes of the MP trees (Figs. 2.2,
2.4), and the ML trees (Fig. 2.3), demonstrating that the solution to our 16S data is
generally stable, despite optimality criterion. The main difference is that the MP tree
places A. funcki and A. lugens rather basally, and the A. rhoadsi and A. sedula (Hagen)
group rather apically, whereas the ML tree places these lineages in the middle of the tree.
This rather modest difference has the undesirable effect of compromising the monophyly
of most groups along the spine of the tree even if the great majority of fundamental relationships remain the same.
Monophyly of Argia is strongly supported by both data partitions and in all phylogenetic analyses conducted for this study (Figs. 2.2, 2.3, and 2.4). This is not surprising, and there are additional morphological features that are autapomorphic for
Argia relative to other Coenagrionidae that support monophyly of Argia. These include
14 the long length of tibial spines (Westfall and May, 1996) and absence of an angulate
frons (Carle et al., 2008). O'Grady and May (2003) also recovered Argia as monophyletic
in their morphological analysis of Coenagrionidae, although only three species were
included. We think that this result will be stable to the addition of data in future analyses.
The solutions to the molecular-only (Fig. 2.2) or combined (Fig. 2.4) matrices
appear very different, and a strict consensus of these trees provides little resolution.
Strict consensus trees are usually used to illustrate groups that are monophyletic for all
solutions, but it is not very useful when there is a great degree of agreement for certain
networks of taxa among otherwise competing solutions. Problematic taxa and rooting
issues that interrupt networks are often not disputed among very different solutions.
While we are always interested in recovering monophyletic lineages, especially for
taxonomic work, analysis of “species groups” should also focus on stable networks of
terminals, even if their placement is ambiguous. We offer figure 2.5 to demonstrate that
the solutions of figs. 2.2 and 2.4 are easily interpretable to be closely related, despite a
poorly resolved consensus. Our discussion is based on three agreement subtrees, each of
which is common to all solutions.
We concentrate on the clade that is sister to A. oculata, where the appearance of
discord is most evident. Excluded from discussion are A. munda and the pair A. agrioides
Calvert and A. hinei Kennedy, because they are not informative for demonstrating
agreement among trees. The first of interest is the sedula-pulla-rhoadsi component (Fig.
2.5a). This component can be placed either basally near A. oculata (Fig. 2.2), or apically in the clade of interest (Fig. 2.4). In both cases the root of this component is between A. sedula and the pair A. pulla Hagen in Selys plus A. rhoadsi. Next we discuss the
15 component that includes the clades emma-extranea, and pima- westfalli (Fig. 2.5b). This combination of ten species is topologically identical in both Figs. 2.2 and 2.4, and also
rooted in the same place. The difference is that in Fig. 2.2 the component is apical in the tree and monophyletic, whereas in Fig. 2.4 it is deeper in the tree and paraphyletic (but with components adjacent, hence identical in topology to the monophyletic interpretation).
Fig. 2.5c summarizes the placement of these components by plotting the alternative arrangements simultaneously on the topology common to both solutions. The alternative placements in Fig. 2.5c produce either Fig. 2.2 or Fig. 2.4. This demonstration, requiring cropping only three species from a total of 27, illustrates that the molecular and combined matrices differ in modest ways with respect to the connection of species to each other, even if these differences have undesirable consequences for a strict consensus. Keeping in mind that the total number of trees possible from this set of 24 terminals is approximately 5 X 1026, it is evident that the matrices are concordant, or
congruent, except in the alternatives shown in Fig. 2.5c. The fact that the entirety of the
component of Fig. 2.5b is identical in both trees is also encouraging. We conclude from
this exploration of agreement subtrees that our analyses identify the same close networks
of species, even if there is ambiguity regarding the placement of those networks. The
main lesson is that morphological data provide adequate phylogenetic signal to move the
sedula-pulla-rhoadsi group apically, away from A. oculata Hagen in Selys, and place the
component of Fig. 2.5b to a more basal portion of the tree, even in combination with
molecular data. These findings demonstrate the importance of morphological data to
16 complement molecular data in Argia, and warrant further investigation of potentially informative morphological characters.
The combined parsimony tree (Fig. 2.4) in many ways accords with traditional groupings of species based on morphology alone. Having a phylogeny with which to compare to these previous non-phylogenetic hypotheses of relationship allows us to provide a test, and a revised hypothesis. Because our phylogeny is based on different characters and analytical methods, it represents an independent test of the classical morphology-based species groups of Calvert, Kennedy, Gloyd, Garrison and others.
The close relationship between A. funcki and A. lugens, and their sister relationship to the remaining Argia, reflects the original placement of these species in the genus Hyponeura by Selys (1865) on the basis of venational characters. Hyponeura, along with Diargia Calvert (which included the species bicellulata Calvert), was synonomized with Argia after it was determined that venational characters are unreliable for species distinction (Gloyd, 1968a). Kennedy (1920a) divided about 55 species of
Argia into five subgenera on the basis of the morphology of the penes; indeed, omitting those taxa that do not fall into the geographic range of our study, we recover many of
Kennedy’s groups in our analyses, both molecular and combined: Cyanargia includes A. lacrimans (Hagen) and A. tonto Calvert; Heliargia is composed of A. vivida Hagen, A. plana Calvert, (plus A. immunda , which we pull out of this clade); Chalcargia, including
A. translata, A. harknessi, A. cuprea, A. oenea, A. ulmeca, A. occulata, (A. garrisoni and
A. sp. nov. were not available to Kennedy). He also placed here A. tezpi and A. sedula although our analyses do not support this. Kennedy defined his species groups solely on
17 morphology of the intromittent penes, so it is satisfying that we find similar patterns
based on molecular and morphological characters not used by Kennedy.
Additionally, taxonomists have proposed close relationships among (A. vivida, A. plana, A. extranea), (A. fumipennis and A. pallens), (A. westfalli and A. anceps), and (A. tonto and A. lacrimans) (Gloyd, 1958; Garrison, 1994; Garrison, 1996; Westfall and
May, 1996), which our analyses support. A. plana was originally described as a variety of
A. vivida by Calvert (1901), and Gloyd (1958) later elevated it to species status on the basis of clasper morphology. Our results validate Gloyd, as we recover A. vivida as sister
to A. plana plus A. extranea. The close relationship between the latter was suggested on the basis of coloration and morphology by Garrison (1994).
In a thorough study of some Argia larvae, Novelo-Gutiérrez (1992) separated species into groups on the basis of a single character: the degree of convexity of the ligula. He placed species into three groups: those with very prominent ligulae (including
A. emma, harknessi, insipida, moesta, oenea, tezpi, translata and ulmeca), moderately prominent ligulae (A. munda, tarascana, and tonto), and slightly prominent ligulae (A.
fumipennis, lacrimans, nahuana, plana, pulla, rhoadsi, and sedula). Our analysis
suggests that this character is not homologous (Fig. .4), or at least is insufficient to accurately infer phylogenetic relationship. Larvae of Argia species remain poorly studied.
Our limited inclusion of larval characters indicates their potential value as sources of phylogenetic characters, but further study of larval morphology is needed. Of the 120 species of Argia currently recognized, larvae are known from relatively few species.
Argia fumipennis is composed of the three subspecies atra, fumipennis, and violacea. These were described as separate species largely on the basis of wing color; A.
18 f. violacea has the typical clear wing color, A. f. fumipennis can have smoky-hyaline wing color in parts of its range, while A. f. atra has dark brown wing pigmentation. These species were unified on the basis of several morphological characters (Gloyd, 1968b).
Closely related to A. fumipennis, on the basis of general size, appearance, and clasper morphology, is A. pallens (Westfall and May, 1996), a species restricted in the U.S. to southeastern Arizona. Our analyses do not include A. f. fumipennis, but based on the molecular data we place A. pallens within the A. fumipennis group, sister to A. f. violacea
(Figs. 2.2, 2.3). The morphological data pull A. pallens out as sister to A. fumipennis (Fig.
2.4) in a monophyletic clade. Both results are only weakly supported, so further investigation of these relationships is warranted, as taxonomic changes may be justified.
A somewhat surprising result is that we fail to recover in our analyses a monophyletic assemblage of the “metallic” species- those that have the cupreous coloration in the head and thorax (A. cuprea, A. oenea, A. orichalcea). We only code one morphological character related to the metallic condition in this study. Further analysis of this group is needed, and more detailed character analysis may provide additional synapomorphies for these species that have traditionally been considered close relatives.
A plethora of additional characters, including several morphological features unique to Argia, are available for further study. For example, males have a unique pair of pad-like structures called “tori”, located posterodorsally on the tenth abdominal segment between the cerci; the morphology of these, and of the cerci and paraprocts, are critical for species identification. These characters are used in published taxonomic keys
(Garrison, 1994; Westfall and May, 1996; Förster, 2001), yet have not been thoroughly explored as phylogenetic characters. Species of Argia also differ dramatically in
19 morphology of the penes (Kennedy, 1920b), and while Kennedy used some of these
structures in his “phylogeny” of Zygoptera, his work predated by many years the formal
development of phylogenetic methodology. A careful reexamination of these structures in
Argia is warranted. Additional mitochondrial genes, as well as both ribosomal and
protein-coding genes such as 12S, 16S, cytochrome oxidases I and II, are already known
to be informative for odonate phylogenetics (Chippendale et al., 1999; Misof et al., 2000;
Turgeon and McPeek, 2002; Bybee et al., 2008). In addition, it has been demonstrated
that nuclear genes such as Histone 3, Elongation Factor 1-alpha, 18S and 28S rDNA
show adequate variation for species-level analyses in odonates (Ware et al., 2007b;
Bybee et al., 2008; Carle et al., 2008). We continue to code, refine, and expand upon our
data set as we continue our work on the systematics and evolution of Argia.
20 Table 2.1: Morphological character matrix used for parsimony analysis of Argia. See
Methods for coding.
Taxon Characters (1-10) Het.ameri ?????????? A.plana1 0111202?11 A.extrane 0101?01111 A.vivida1 0211100011 A.emma1 0222111111 A.munda1 00???1?010 A.anceps2 0110000000 A.westfal 011120000? A.sabino1 011110211? A.lacrima 0?10001110 A.tonto1 0010001110 A.pima1 001??0?11? A.f.atra1 0121201211 A.f.viola 0121201211 A.pallens 0010001211 A.funki1 00212?110? A.lugens1 0122102100 A.moesta1 0222201100 A.hinei1 0020002211 A.agrioid 0120001011 A.alberta 0000000010 A.leonora 000??0?01? A.nahuana 0110001011 A.pulla1 0000001121 A.rhoadsi 0022101001 A.sedula1 0010102011 A.tarasca 0221101110 A.apicali 0100001210 A.tezpi 0221101010 A.tibiali 0000000110 A.immunda 0001001111 A.transla 0222102010 A.ulmeca1 0101002110 A.n.sp.1 0??????11? A.garriso 002000111? A.harknes 0????????? A.oculata 001100201? A.cuprea1 1221102100 A.oenea1 1021102110 Cal.aequa ?????????? Cal.macul ?????????? Ceri.nipp ?????????? Neo.esthe ??????????
21
Figure 2.1: Photo of the pro- and mesothorax of a female of Argia emma, lateral oblique angle. Arrows indicate some of the characters coded in the morphological matrix.
22 Calopteryx aequalbilis C. maculata Hetaerina americana Neoneura esthera Ceriagrion nipponicum Argia translata A. harknessi 1 A. cuprea A. oenea 1 A. oculata A. funki 1 A. lugens A. new species 3 A. ulmeca >5 1 A. garrisoni A. moesta A. sedula A. rhoadsi 1 1 >5 A. pulla A. immunda A. tibialis 1 1 A. tarascana 3 A. apicalis 4 A. tezpi A. hinei 1 1 A. agrioides A. alberta A. nahuana A. leonorae 1 A. fumipennis atra A. pallens 2 1 A. fumipennis violacea 1 A. munda A. emma 1 1 A. vivida 5 A. plana 2 1 A. extranea A. pima A. tonto 5 1 A. lacrimans 1 A. sabino A. westfalli 4 >5 A. anceps
Figure 2.2: Strict consensus of 38 equally parsimonious trees resulting from analysis of 16S data alone. Clades with dots are recovered in both ML and parsimony analyses. Numbers below branches are Bremer support values.
23
24
Figure 2.3: Best maximum likelihood tree generated by analysis of the 16S data using GARLI.
24 Hetaerina americana Calopteryx aequalbilis C. maculata Neoneura esthera Ceriagrion nipponicum Argia funki >5 A. lugens A. moesta 5 1 A. translata 1 A. harknessi 2 A. cuprea A. oenea 1 A. new species 2 A. ulmeca A. garrisoni 1 1 A. oculata 2 A. immunda 1 A. tibialis >5 A. apicalis 1 5 A. tarascana 2 A. tezpi A. munda 1 A. pima A. lacrimans >5 1 A. tonto 1 3 A. sabino A. anceps 5 >5 A. westfalli A. emma 1 A. vivida 2 A. plana 4 3 A. extranea A. nahuana 1 A. alberta A. leonorae A. agrioides A. hinei 1 A. pallens A. fumipennis atra 1 1 A. fumipennis violacea 1 A. sedula A. pulla 3 >5 A. rhoadsi
Figure 2.4: Strict consensus of six equally parsimonious trees generated from combined 16S and morphology data. Clades with dots are recovered in ML analyses of 16S alone. Numbers below branches are Bremer support values.
25
Figure 2.5: Alternate arrangement of three components accounts for a majority of the disagreement between the molecular-only and combined analyses.
26
References
Abbott, J. C. 2005. Dragonflies and Damselflies of Texas and the South-Central United
States : Texas, Louisiana, Arkansas, Oklahoma, and New Mexico. Princeton
University Press, Princeton, N.J., USA.
Bick, G. H., Bick, J. C. 1965. Demography and Behavior of the Damselfly Argia apicalis
(Say), (Odonata: Coenagrionidae). Ecology 46, 461-472.
Bick, G. H., Bick, J. C. 1971. Localization, behavior, and spacing of unpaired males of
the damselfly Argia plana Calvert (Odonata: Coenagrionidae). Proceedings of the
Entomological Society of Washington 73, 146-152.
Bick, J. C., Bick, G. H. 1982. Behavior of adults of dark-winged and clear-winged
subspecies of Argia fumipennis (Burmeister)(Zygoptera: Coenagrionidae).
Odonatologica 11, 99-107.
Borror, D. J. 1934. Biological studies of Argia moesta Hagen (Odonata: Coenagrionidae)
by means of marking. The Ohio Journal of Science 34, 97-108.
Bybee, S. M., Ogden, T. H., Branham, M. A., Whiting, M. F. 2008. Molecules,
morphology and fossils: a comprehensive approach to odonate phylogeny and the
evolution of the odonate wing. Cladistics 23, 1- 38.
Caesar, R. M., Gillete, N., Cognato, A. I. 2005. Population genetic structure of an
edaphic beetle (Ptiliidae)among late successional reserves within the Klamath-
Siskiyou ecoregion, California. Annals of the Entomological Society of America
98, 931-940.
27
Calvert, P. P. 1901. Odonata. In: XX (Ed.) Biologia Centrali Americana: Insecta
Neuroptera. R.H. Porter and Dulau Co., London, UK, pp. XX.
Carle, F. L., Kjer, K. M., May, M. L. 2008. Evolution of Odonata, with special reference
to Coenagrionoidea (Zygoptera). Arthropod Systematics and Phylogeny 66, 37-
44.
Chippendale, P. T., Dave, V. K., Whitmore, D. H., Robinson, J. V. 1999. Phylogenetic
Relationships of North American Damselflies of the Genus Ischnura (Odonata:
Zygoptera: Coenagrionidae) Based on Sequences of Three Mitochondrial Genes.
Mol Phylogenet Evol 11, 110-121.
Conrad, K. F. 1992. Relationships of larval phenology and imaginal size to male pairing
success in Argia vivida Hagen (Zygoptera: Coenagrionidae). Odonatologica 21,
335-342.
Conrad, K. F., Pritchard, G. 1988a. Female dimorphism and physiological colour change
in the damselfly Argia vivida Hagen (Odonata: Coenagrionidae). Canadian
Journal of Zoology 67, 298-304.
Conrad, K. F., Pritchard, G. 1988b. The reproductive behavior of Argia vivida Hagen: an
example of a female-control mating system (Zygoptera: Coenagrionidae).
Odonatologica 17, 179-186.
Conrad, K. F., Pritchard, G. 1990. Pre-oviposition mate-guarding and mating behaviour
of Argia vivida (Odonata: Coenagrionidae). Ecological Entomology 15, 363-370.
Daigle, J. J. 1991. Argia garrisoni spec. nov. from Mexico (Zygoptera: Coenagrionidae).
Odonatologica 20, 337-342.
28
Daigle, J. J. 1995. Argia carlcooki spec. nov. from Mexico (Zygoptera: Coenagrionidae).
Odonatologica 24, 467-471.
Dunkle, S. W. 1990. Damselflies of Florida, Bermuda, and the Bahamas. Scientific
Publishers, Gainesville, Florida, USA.
Förster, S. 2001. The dragonflies of Central America exclusive of Mexico and the West
Indies. Gunnar Rehfeldt, Wolfenbüttel, Germany.
Garrison, R. W. 1994. A synopsis of the genus Argia of the United States with keys and
descriptions of new species, Argia sabino, A. leonorae, and A. pima (Odonata:
Coenagrionidae). Transactions of the American Entomological Society 120, 287-
368.
Garrison, R. W. 1996. A synopsis of the Argia fissa group, with descriptions of two new
species, A. anceps sp. n. and A. westfalli sp. n. (Zygoptera: Coenagrionidae).
Odonatologica 25, 31-47.
Garrison, R. W., von Ellenrieder, N. 2007. The true Argia difficilis Selys, 1865, with the
description of Argia yungensis sp. nov. (Odonata: Coenagrionidae). Transactions
of the American Entomological Society 133, 189-204.
Gloyd, L. K. 1958. The dragonfly fauna of the Big Bend region of Trans-Pecos Texas.
Occasional Papers of the University of Michigan Museum of Zoology 658.
Gloyd, L. K. 1968a. The synonomy of Diargia and Hyponeura with the genus Argia
(Odonata: Coenagrionidae: Argiinae). The Michigan Entomologist 1, 271-274.
29
Gloyd, L. K. 1968b. The union of Argia fumipennis (Burmeister, 1839) with Argia
violacea (Hagen, 1861), and the recognition of three subspecies (Odonata).
Occasional Papers of the University of Michigan Museum of Zoology.
Huelsenbeck, J. P. 1997. Is the Felsenstein zone a fly trap? Syst Biol 46, 69-74.
Kennedy, C. H. 1918. New species of Odonata from the southwestern United States. Part
I. Three new Argias. Canadian Entomologist 50, 256-261.
Kennedy, C. H. 1919. A new species of Argia (Odonata). Canadian Entomologist 51, 17-
18.
Kennedy, C. H. 1920a. Forty-two hitherto unrecognized genera and subgenera of
Zygoptera. The Ohio Journal of Science 21, 83-88.
Kennedy, C. H. 1920b. The phylogeny of the zygopterous dragonflies as based on the
evidence of the penes. The Ohio Journal of Science 21, 19-32.
Misof, B., Anderson, C. L., Hadrys, H. 2000. A Phylogeny of the Damselfly
Genus Calopteryx (Odonata) Using Mitochondrial 16S rDNA Markers. Mol
Phylogenet Evol 15, 5-14.
Moody, D. 2002. Coenagrionidae: Narrow-winged damselflies. In: Glotzhober, R. C.,
McShaffrey, D. (Eds.), The Dragonflies and Damselflies of Ohio. Ohio Biological
Survey, Columbus, Ohio, USA, pp. 91-144.
Nixon, K. C. 2000. WinClada. Nixon, K.C., Ithaca, New York, NY, USA.
Novelo-Gutiérrez, R. 1992. Biosystematics of the larvae of the genus Argia in Mexico
(Zygoptera: Coenagrionidae). Odonatologica 21, 39-71.
30
O'Grady, E. W., May, M. L. 2003. A phylogenetic reassessment of the subfamilies of
Coenagrionidae (Odonata: Zygoptera). Journal of Natural History 37, 2807-2834.
Robinson, J. V., Dickerson, J. E., Bible, D. R. 1983. The demographics and habitat
utilization of adult Argia sedula (Hagen) as determined by mark-recapture
analysis (Zygoptera: Coenagrionidae). Odonatologica 12, 167-172.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P. 1994. Evolution,
weighting, and phylogenetic utility of mitochondrial gene sequences and a
compilation of conserved polymerase chain reaction primers. Annals of the
Entomological Society of America 87, 651-701.
Thompson, J. D., Higgins, D. G., Gibson, T. J. 1994. CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
weighting, positions-specific gap penalties and weight matrix choice. Nucleic
Acids Research 22, 4673-4680.
Turgeon, J., McPeek, M. A. 2002. Phylogeographic analysis of a recent radiation of
Enallagma damselflies (Odonata: Coenagrionidae). Molecular Ecology 11.
Ware, J. L., May, M. L., Kjer, K. M. 2007. Phylogeny of the higher Libelluloidea
(Anisoptera: Odonata): an exploration of the most speciose superfamily of
dragonflies. Mol Phylogenet Evol 45, 289-310.
Westfall, M. J., May, M. L. 1996. Damselflies of North America. Scientific Publishers,
Gainsville, FL, USA.
31
Zwickl, D. J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large
biological sequence datasets under the maximum likelihood criterion. The
University of Texas at Austin, Austin, Texas, USA.
32
Chapter 3 : General Review of the Reproductive Biology of Odonata, With
Emphasis on the Genus Argia (Coenagrionidae)
Introduction
Insects in the order Odonata (dragonflies and damselflies) are among the most
basal lineages of winged insects (pterygotes) (Wheeler et al., 2001; Hovmöller et al.,
2002; Ogden and Whiting, 2003; Kjer, 2004; Simon et al., 2009; Lin et al., 2010;
Trautwein et al., 2012), and of the extant winged orders they are among the most ancient
lineages (Grimaldi and Engel, 2005). A number of synapomorphies define the order, but
most distinctive are the various modifications of the primary and secondary reproductive
morphological structures. The generalized reproductive biology of odonates is widely
known for its unique features and is considered a model case for studies of sexual
selection as a mechanism for phenotypic evolution and speciation (Eberhard, 1985;
Eberhard, 1986; Bailey and Ridsill-Smith, 1991; Shuster and Wade, 2003; Grimaldi and
Engel, 2005).
A majority of the published studies that involve Odonata fall into the basic categories of evolutionary ecology, behavioral ecology, and alpha taxonomy. The
33 characteristics of reproductive morphology, and to a much lesser extent, reproductive behavior, have been used in various ways to improve understanding of odonate systematics and evolution. However, most of the utility of reproductive phenotypes has been limited to the area of primary taxonomy, where morphological characters are included in dichotomous keys, descriptions and other diagnostic/identification tools. That trend has been shifting in recent years, with an increasing number of phylogenetic studies at various taxonomic ranks within the order (i.e. Carle and Kjer, 2002; Turgeon and
McPeek, 2002; O'Grady and May, 2003; Rehn, 2003; Ware et al., 2007a; Bybee et al.,
2008; Carle et al., 2008). Despite this recent shift towards increased interest in phylogenetic studies of Odonata, reproductive characters have not been extensively explored in a phylogenetic context. Most modern phylogenies of extant taxa are primarily based on molecular data (Ballare and Ware, 2011; Table 1).
There is considerable variation within the order with regard to some general features of reproductive biology. An extreme form of reproduction was discovered in
2005 when parthenogenic populations of Ischnura hastata (Coenagrionidae) were discovered in the Azores (Cordero Rivera et al., 2005; Lorenzo-Carballa and Cordero-
Rivera, 2009); this is the first known instance of parthenogenesis in Odonata and provides ample opportunity for future research on sex ratio evolution in diploid species. It is clear, however, that despite the recognition of how remarkable odonate reproductive biology is, detailed knowledge of many taxa and general evolutionary trends within the order remain limited.
34
The purpose of this review is to compile some general information about the behavior and morphological structures involved in the mating process of Odonata, to highlight potential characters for phylogenetic analysis. These reproductive phenotypes can in turn be used to test hypotheses about character evolution with respect to sexual selection and speciation theory. The damselfly genus Argia (Zygoptera: Coenagrionidae) is emphasized and placed in the context of the order.
Argia is one of the most widespread, species-diverse, and morphologically variable genera of New World Odonata. Populations of many species can be locally abundant and specimens are easy to capture, and adult odonates are amenable to ecological experiments that require mark and release. These factors contribute to the potential for Argia to be used as a model genus for study of the evolutionary ecology of sexual reproduction in insects.
A thorough understanding of Argia reproductive biology is also important from a conservation perspective because the long-term survival of some species or populations may be threatened by loss or alteration of habitat. For example, the recently described A. sabino and A. pima (Garrison, 1994) are known only from single canyon streams near
Tucson, Arizona, USA. The habitat of these two species is severely threatened because these streams have suffered from extensive sedimentation due to wildfire-induced erosion in recent years (personal observation). Preservation of threatened or endangered species may be improved by knowledge of the breeding requirements of natural populations.
Argia includes at least 120 described species, with additional species being discovered and described (Daigle, 1991; Garrison, 1994; Daigle, 1995; Garrison, 1996;
35
Garrison and von Ellenrieder, 2007; Meurgey, 2009). The systematics of the genus is currently being revised by Rosser Garrison (personal communication) and a phylogenetic
hypothesis is now available (Caesar and Wenzel, 2009; Chapter 4), so improved
identification tools and interpretation of the evolutionary history of this genus are now
possible.
Much of what is known about the reproductive biology of Argia comes from
detailed studies of several North American species. Thus the knowledge of Argia sexual
biology is somewhat limited, particularly for South American species. The genus is
highly variable compared to other odonates in a number of ways, including karyotype
(Kiauta and Kiauta, 1980), body size (Guillermo-Ferreira and Del-Claro, 2011; Steele et
al., 2011), morphology of terminal abdominal appendages (Garrison, 1994), area of
species ranges (Pritchard, 1982; Garrison, 1994; Westfall and May, 1996), etc. However,
certain aspects of the sexual biology in the genus can be generalized by an extensive
review of what is known for particular exemplar species.
Two species of Argia have received considerable attention as subjects of detailed studies of reproductive ecology. These are A. apicalis (Bick and Bick, 1965b; Bick and
Bick, 1965a) and A. vivida (Leggot and Pritchard, 1986; Conrad and Pritchard, 1988b;
Conrad and Pritchard, 1988a; Pritchard, 1989; Conrad and Pritchard, 1990; Conrad,
1992; Pritchard and Kortello, 1997; Kortello and Ham, 2009). Several other species have been the focus of a handful of studies by a variety of authors, including A. sedula
(Robinson et al., 1983), A. chelata (Hamilton and Montgomerie, 1989), A. moesta
(Borror, 1934; Bick and Bick, 1972; Byers and Eason, 2009), A. fumipennis (Bick and
36
Bick, 1982), and A. plana (Bick and Bick, 1968; Bick and Bick, 1971; Bick and Bick,
1972). Although these papers collectively were published over a time frame that spans roughly 80 years, by reviewing the key elements here a comprehensive picture of the general characteristics of the reproductive biology of the genus can be assembled.
In the remainder of this chapter, the key elements of reproductive behavior and external morphology of Argia species are reviewed and placed in broader context of the order Odonata, where possible. The mating process is discussed in order from precopulatory behavior through oviposition. The duration and frequency of mating, occurrence of color polymorphism, the potential for postcopulatory sperm displacement in Argia (common in some damselflies; Waage, 1979; Waage, 1986; Córdoba-Aguilar,
2003; Córdoba-Aguilar et al., 2003), and sex ratios is reviewed. The use of reproductive characters in odonate phylogenetics is briefly surveyed. The mating biology of Argia is discussed in light of prior classification schemes of mating systems. Finally, the potential for sexual selection to act on the aforementioned components of the reproductive biology of Argia is examined.
Territoriality, Courtship, and Precopulatory Behavior
Compared to other families of Zygoptera, species in the Coenagrionidae
(including Argia) lack complex ritualized pre-mating territorial behavior (Bick and Bick,
1982). Males may tend to occupy specific areas along a stream that correlate to suitable oviposition sites, but their fidelity to these sites is less intense than, for example,
37
calopterygids (Cordero, 1999; Córdoba-Aguilar et al., 2009), and their defense behavior is limited. Some species (e.g. A. apicalis, A. moesta, A. plana, A. immunda) engage in
“wing-clapping”, a stereotyped separation of right and left wings followed by a return to resting position (Bick and Bick, 1978). This seems to be a declaration that a perch is occupied, and in Coenagrionidae only males exhibit this behavior, while in
Calopterygidae both males and females wing-clap in response to each other. The duration and intensity of this behavior in Coenagrionidae does not compare to more elaborate wing-clapping seen in other families (Bick and Bick, 1978).
One hypothesis for the lack of courtship behavior in Argia and other odonates is that the increased visual acuity of Anisoptera affords an individual better ability to recognize conspecific mates without need for elaborate courtship or contact recognition
(Carle, 1982). However, there is little phylogenetic basis to support this hypotheses when
considering the most recent and comprehensive phylogenies of the order (Rehn, 2003;
Bybee et al., 2008). Within Zygoptera, families that engage in territoriality and courtship
behavior are more basal than those that do not, suggesting that increased visual acuity
may be an evolutionary trend. However, Anisoptera may be a more basal lineage than
Zygoptera, or the two may be sister groups (Rehn, 2003; Bybee et al., 2008). This
hypothesis has never been tested using character optimization across the order.
38
Initiating Mating and Tandem Linkage
Sexual encounters are initiated by males. A stereotypical sequence of responses to
potential mates by Argia males can be summarized as follows (Bick and Bick, 1965b): 1)
an exploratory flight toward potential mate, 2) initial contact involves males perching on
thorax of potential mate, 3) initial sexual contact involves the male curving his abdomen
toward the potential mate’s thorax while perched on her, and 4) successful tandem
linkage occurs when his claspers are securely linked to her prothorax and mesostigmal
laminae.
Like most coenagrionids, Argia species do not engage in any form of courtship,
display, or signaling behavior as a precursor to mating attempts (Bick and Bick, 1982).
Males will seize and attempt to engage females in tandem linkage without any behavioral
input from females. In fact, dead, dismembered, heterospecific, and model females will
all elicit sexual responses from Argia males in A. apicalis (Bick and Bick, 1965a), A.
vivida (Paulson, 1974; Conrad and Pritchard, 1988a; Conrad and Pritchard, 1988b), and
A. emma (Paulson, 1974). Males can readily distinguish sex even when presented with multiple conspecific color morphs (Bick and Bick, 1965b) or heterospecific congeners
(Paulson, 1974; Bick and Bick, 1981). Males of A. apicalis seem to use dorsal and lateral thoracic background color (but not the overall patterning of pale background color and dark stripes), and to a lesser extent, color of the tip of abdomen, in evaluating potential mates (Bick and Bick, 1965b). Thus, males will attempt to initiate sexual contact with any female form that meets a baseline model of size and color pattern.
39
Carle (1982) considered the diversity of cercal morphology in Coenagrionoidea
and Anisoptera to be indicative of the role of the structure in mate recognition or
acceptance at the time when tandem contact is made. Females may evaluate the male
based on the mechanical fit of his claspers on her prothorax and mesostigmal laminae,
presumably via mechanoreceptors (Paulson, 1974; Carle, 1982). Females are able to
reject males to various degrees (Carle, 1982), despite the seeming “upper hand” males
have when linked in tandem, as they possess the clasping structures and a more dominant
physical position relative to the female. In some cases, the morphology of the clasper
complex and associated female structures is such that the male is unable to maintain his
grasp (Carle, 1982). In other cases, the female can simply refuse to complete the wheel
formation, preventing sperm from being transferred (Paulson, 1974; McPeek et al., 2011;
Bourret et al., 2012). It is not known whether the females can simply confirm conspecific identity or assess the quality of individual males based on some type of stimulation criteria. Chapter five of this dissertation attempts to address this question to an extent.
Translocation of sperm by the male from the primary genital opening on the ninth
abdominal segment to the sperm vesicle on the third abdominal segment typically occurs while in tandem just after linkage has been established (Bick and Bick, 1982; Carle,
1982). This process takes an average of 10-20 seconds. Males emit sperm from a gonopore located on the ninth abdominal sternum. Prior to copulation, they transfer sperm from the gonopore to secondary genitalic structures located on sternites of the second and third abdominal segment, structures that lie within a “pocket” of the second sternite called the genital fossa (Snodgrass, 1935; Westfall and May, 1996). The sperm
40
vesicle is formed from the sternite of the third abdominal segment where it is kept until
the time of transfer to the female’s reproductive tract (Snodgrass, 1935; Westfall and
May, 1996). When the male flexes the third abdominal segment, sperm is moved out of
the sperm vesicle and down the shaft of the intromittent device, often called the penis.
The penis is not connected to the sperm vesicle in Zygoptera, although it is in Anisoptera.
Because male odonates must translocate sperm to the intromittent organ prior to
transferring it to a female, some authors have characterized this as a type of “indirect
sperm transfer,” implying that it may be homologous to the indirect sperm transfer that is
exhibited in more distantly related arthropods (Carle 1982). Some true bugs in the family
Cimicidae (i.e. bed bugs) have a mating system that does not involve direct contact
between the primary genitals of males and females, but the “traumatic insemination” that
characterizes bed bug mating biology is unlike the form of copulation typical of Odonata.
There is no evidence that translocation of sperm in Odonata represents a homologous
form of indirect sperm transfer with other non-insect arthropods, and is thus merely
analogous. It is more appropriate to designate Odonate reproductive biology as
autapomorphic with regard to general insect phylogeny.
Copulation
Copulation occurs when females bring the tip of their abdomen around under their
thorax to make contact between their genital aperture on the eighth sternite and the penis of the male, such that transfer of sperm from the male to the female can be initiated.
41
Males guide the female’s abdominal apex toward his genital fossa using the hind legs
(Carle, 1982). This results in the characteristic “wheel position” of odonates and may last
18 to 40 minutes in Argia (Bick and Bick, 1965b; Bick and Bick, 1972; Bick and Bick,
1982; Conrad and Pritchard, 1988b; Conrad and Pritchard, 1990). Unlike certain anisopteran genera, damselflies typically complete the copulatory process while perched rather than in flight (Carle, 1982).
During copulation, the male’s abdomen moves rhythmically in a pumping fashion to transfer sperm via the penis to the female (Bick and Bick, 1982). Similar movements may also result in the removal of sperm from previous matings in calopterygids (Waage,
1986), but this does not seem to be the case in Argia where mating frequency is usually once per day and males remain in tandem contact during oviposition.
Like most insects, odonate females have an internal bursa copulatix and spermatheca which are capable of storing sperm until the time of oviposition (Córdoba-
Aguilar et al., 2003). Sperm can be selectively applied to the eggs as they pass by the opening to the spermathecal duct as they traverse the oviduct (Snodgrass, 1935), and the female has some degree of control over this process by the action of musculature attached to the oviduct (Siva-Jothy and Hooper, 1996; Córdoba-Aguilar et al., 2003). Thus, the processes of copulation and insemination are both spatially and temporally separated from that of fertilization, and females may be able to manipulate fertilization to their advantage.
42
Sperm Displacement
Sperm displacement has been extensively studied in some Odonata and is
presumed to be widespread in the order (Waage, 1979; Waage, 1984; Waage, 1986;
Fincke et al., 1997; Córdoba-Aguilar, 2003; Córdoba-Aguilar et al., 2003). The most extensive studies have been on members of the family Calopterygidae; males in this family are able to remove sperm deposited during previous matings using their penis
(Waage, 1979; Córdoba-Aguilar et al., 2003). It is hypothesized on the basis of the
diverse morphology of the male penis in all Odonates that the ability to displace sperm is
widespread, although the number of direct observations or experimental tests of this
hypothesis are limited to few species (Waage, 1986; Andres and Cordero-Rivera, 2000;
Córdoba-Aguilar, 2003; Córdoba-Aguilar et al., 2003; Córdoba-Aguilar, 2009).
In Argia, sperm displacement has never been directly tested, although it has been
predicted to occur based on study of ejaculate volumes and penis and bursa copulatix
morphology of A. moesta, A. sedula and A. fumipennis (Waage, 1984; Waage, 1986;
Córdoba-Aguilar et al., 2003). It seems unlikely that sperm competition plays a major
role in Argia, considering details of daily mating activity that has been extensively
studied. A majority of pairs complete the mating and oviposition process in a single day
while linked in tandem, such that males can guard the female and prevent subsequent
matings (Borror, 1934; Bick and Bick, 1965b; Bick and Bick, 1968; Robinson et al.,
1983; Conrad and Pritchard, 1988b; Conrad and Pritchard, 1990), thereby ensuring
paternity. However, further studies are needed to definitively determine the extent of
43
sperm removal or displacement before sperm competition can be ruled out as a driving
mechanism of genital diversity and speciation in Argia.
Duration and Frequency of Mating
Duration of the complete mating process is variable and depends largely on the
time of day that initial contact is made between pairs. Based on studies of Argia apicalis,
mating frequency appears more limited than might be expected for a promiscuous species
(Bick and Bick, 1965b). Pairs that initially engage in tandem linkage early in the day, generally between 10 AM and 12:30 PM during the peak active season (Bick and Bick,
1982), can take several hours to complete the processes of copulation and oviposition,
and therefore these individuals typically only mate a single time each day (Bick and Bick,
1965b; Conrad and Pritchard, 1988a).
Some odonate females apparently may mate only once in their lifetime (Córdoba-
Aguilar et al., 2003), but in Argia both sexes mate multiple times (Borror, 1934; Bick and
Bick, 1965b; Bick and Bick, 1968; Conrad and Pritchard, 1988b). Lifetime mating frequency is equal for males and females of A. apicalis (Bick and Bick, 1965b). If any single form of sexual selection (female choice, male competition, etc.) has a strong influence, a sexual bias in mating frequency might be expected. Thus, multiple types of sexual selection may influence the evolution of reproductive biology in Argia.
44
Sex Ratio
There have been studies of odonates, including Argia chelata (Hamilton and
Montgomerie, 1989), that report heavily male-biased sex ratios in natural populations
(Fincke, 1982). In a study of A. moesta in central Ohio, Borror (1934) found that females are more abundant than males, existing in a 1:3 male to female sex ratio, although this varied considerably when sampling was conducted near water versus away from it.
Borror (1934) concluded that the operational sex ratio was likely closer to 1:2 male to female, suggesting the possibility for female choice to occur in that species. However, as pointed out by Bick and Bick (1965b) and Kéry and Juillerat (2004), a likely explanation for male biased sex ratios is simply that in Odonata, females are more difficult to find in nature: they typically have inconspicuous coloration and they often forage further from water to support egg production, and thus they simply are not counted as easily. A study of the anisopteran Sympetrum sanguineum at the time of larval emergence showed a 1:1 sex ratio (Falck and Johansson, 2000). This result supports the idea that sex ratios are actually close to 1:1, but that differences in adult behavior account for observed skewed ratios. Male-skewed sex ratios would make it more likely that male-male competition occurs for access to females (Fincke, 1982) and would indicate the potential for strong
sexual selection to operate, but there is no evidence that this is true for Argia. Additional
studies of sex ratio need to be conducted for different Argia species and at different life
stages before generalities regarding actual or operational sex ratios for adults can be
made.
45
Oviposition
Oviposition is a variable part of the reproductive process in Odonata. It can involve tandem oviposition in which the male and female remain linked and the male takes an active role in placement of eggs by guiding the female to the surface of water and assisting her in making contact with the surface, at which time she releases eggs.
Alternatively the male may mate-guard without maintaining tandem contact with the female by perching or hovering nearby. Mate-guarding is presumably to prevent her from re-mating prior to completing the oviposition process, but may also decrease chances for predation or parasitization during oviposition, when the female is more vulnerable. Some females oviposit solo without being guarded, although this is more common in
Anisoptera than Zygoptera.
Following the completion of copulation, Argia pairs typically remain linked in tandem during oviposition. A period of exploration or site selection may follow, depending on the availability of suitable sites for ovipositing. This exploratory phase lasts
0-73 minutes in A. fumipennis, which appears to be the longest observed exploratory time for any of the Argia whose reproductive behavior has been studied (Bick and Bick,
1982). A more typical exploratory phase in Argia is 15-25 minutes (Bick and Bick,
1965b).
Bick and Bick (1982) observed tandem oviposition in all A. fumipennis mating pairs they encountered. This pattern holds for other species of Argia as well, although pairs may become momentarily disengaged (Conrad and Pritchard, 1988b; Conrad and
46
Pritchard, 1990; Byers and Eason, 2009). Tandem oviposition may have evolved from mate-guarding behavior as a means of ensuring paternity by preventing sperm removal from competitors, or as a means of protecting against predation of the vulnerable female or parasitism of eggs (Carle, 1982) although these scenarios have not been tested phylogenetically.
Argia species are endophytic ovipositors that prefer to deposit eggs in living or dead aquatic vegetation that is arranged horizontally at or near the surface of the water, including wet wood such as logs or floating sticks and debris. There does not appear to be a particular preference for any plant taxa as oviposition sites. Duration of oviposition can be between 40 and 90 minutes (Bick and Bick, 1965b; Bick and Bick, 1972; Bick and
Bick, 1982). Some species are known to submerge themselves either partially or completely during oviposition as tandem linked pairs (Walker, 1953).
Aggregations of ovipositing tandem pairs are commonly observed in various species of Argia. Experimental and observational evidence suggests that these aggregations may be beneficial in saving individuals the energetic costs of searching for suitable oviposition sites as well as “diluting” the potential effects of predators and harassment by unmated single males, either conspecific or congeneric (Byers and Eason,
2009). Oviposition aggregations may also simply indicate that a site is free of predators, an important consideration as tandem-linked odonates are more conspicuous, slower, and less agile. Tandem pairs searching for oviposition sites appear to utilize cues of the coloration and stereotypical posture of males that are tandemly linked to ovipositing females as a way of identifying locations that are desirable for egg-laying (Byers and
47
Eason, 2009). Aggregate-ovipositing pairs tend to have longer oviposition duration than pairs that do not oviposit in aggregate (Byers and Eason, 2009), suggesting that there is an advantage that overrides any potential cost in the form of elevated competition among early instar larvae after eggs hatch. High competition for food and space among dense early-instar larval odonate cohorts as well as high incidence of cannibalism has been documented (Fincke, 1992; Byers and Eason, 2009). The selective benefits of aggregate ovipositing are presumably considerable to overcome the cost of high intraspecific competition and mortality.
In many odonate species, males invest considerable post-copulation time guarding their mate, presumably to prevent additional matings by conspecific competitors, and thus improve their fertilization success (Alcock and Gwynne, 1991). This behavior has been supposed to confer a cost in reduced fitness on the male in terms of sacrificed time finding additional mates (Alcock and Gwynne, 1991). An untested alternative hypothesis is that the mate-guarding behavior evolved allows the male to protect or warn against egg parasitoids (such as the trichogrammid hymenopteran Pseudoligosita longifrangiata), which typically attack during oviposition (Querino and Hamada, 2009). Indeed, in some species the mate-guarding does not happen while the male and female are linked in tandem. The male simply rests or hovers near the female while she oviposits, in some cases submerging well below the surface of the water. These behaviors can also be interpreted variously as simply finding the most suitable site for oviposition, or also as a means of protection against egg parasitoids.
48
Color Polymorphism
Female color polymorphism is common among some species of Argia. In species where female color polymorphism is noted, there is no evidence to support males having a preference (Conrad and Pritchard, 1988a). Males will apparently respond to a range of females that fit a generalized model, including those that are heterospecific (Paulson,
1974). In A. vivida, males do not discriminate between female color morphs, so it is not clear what mechanism maintains the polymorphism (Conrad and Pritchard, 1988a).
Various scenarios have been invoked, including mimicry (both as a means of predator- avoidance and as a means of avoiding intraspecific sexual harassment), pseudosexual selection, and species isolation/reinforcing selection (Fincke, 1994; Andres et al., 2000;
Sirot et al., 2003; Svensson et al., 2004; Van Gossum and Mattern, 2008; Sanchez-
Guillen et al., 2011) . For those Argia species that are color polymorphic, there is no evidence that any of the color morphs provides a fitness advantage either by natural or sexual selection.
Reproductive Characters in Phylogenetic Studies of Odonates
A current trend in phylogenetic studies is increased reliance on molecular and genomic data at the expense of more traditional character sources such as morphology.
As such, recent studies of odonate phylogeny have included few characters of the genital morphology (e.g. Chippendale et al., 1999; Kambhampati and Charlton, 1999; Misof et
49 al., 2000; Artiss et al., 2001; Weekers et al., 2001; Hovmöller and Johansson, 2004;
Hasegawa and Kasuya, 2006; Dijkstra et al., 2007; Ware et al., 2007a; Ware et al., 2007b;
Rach et al., 2008; Dumont et al., 2010; Ballare and Ware, 2011). This is somewhat surprising, considering how rich and informative the primary and secondary genitals and secondary sexual structures of both sexes have been when used as phylogenetic characters (Carle and Kjer, 2002; Caesar and Wenzel, 2009). The paucity of reproductive characters in recent phylogenies suggests that the morphology of these common, large and charismatic insects remains inadequately understood. Interestingly, the use of mostly molecular data in phylogenies for Odonata does not necessarily reflect current trends in insect systematics, although it does align more closely with the condition of systematic studies of animal taxa in general over the last two decades (Bybee et al., 2010). It is worth noting that many studies do not typically use morphological data in generating novel matrices, but will use character mapping techniques to study character evolution, revising classifications, (Bybee et al., 2010).
Carle and Kjer (2002) included characters from male genitalia in their study of the anisopteran genus Libellula (other morphological characters included those of wing veination and coloration as well as several characters of the head, legs, thorax and abdomen). In this study, all characters are from the male hamuli, anterior lamina, and the penis. Clasper morphology and female characters are not used. The authors indicate that these genitalic characters are among those that provided the most phylogenetic information for their well-resolved and strongly-supported trees.
50
In a study of the anisopteran genus Sympetrum¸ male genital morphology was found to have overlapping variation among species and was less informative than molecular data in phylogenetic analysis (Pilgrim and Von Dohlen, 2007). However, in a preliminary study of Argia based on combined data, the limited morphological characters used, including claspers used in the mating process, were informative and improved resolution (Caesar and Wenzel, 2009). A cladistic analysis of the Coenagrionidae included primary and secondary sexual morphology in the data, but the authors did not discuss the phylogenetic utility of different data partitions (O'Grady and May, 2003).
Primary and secondary genital morphology and other associated reproductive characters are likely to be rich sources of informative phylogenetic data. For example, the lack of physical connectivity between the sperm vesicle and the penis in Zygoptera may alternatively be considered a synapomorphy of Zygoptera (Rehn, 2003; Bybee et al.,
2008; Carle et al., 2008; Dumont et al., 2010), or the connection of the structures is perhaps a synapomorphy of Anisoptera (Hasegawa and Kasuya, 2006), depending on which phylogenetic analyses one considers. Either way, this important reproductive structure is informative for establishing subordinal relationships within Odonata. The shape of the anterior lamina, the sternite from which anterior hamules extend, has been used to classify some damselfly taxa above the species level (Westfall and May, 1996), but has insufficient variability to diagnose species. Argia females lack a vulvar spine on the sternum of segment eight (Abbott, 2005), a characteristic seen in some other coenagrionids. The accessory lobes that arise from the first and second abdominal sternites surrounding the genital fossa of males are variable within the order (Snodgrass,
51
1935) and warrant further examination as potential characters for phylogenetic analysis.
Genital morphology of some insects is of great value in phylogenetic studies (Song and
Bucheli, 2009), although there are taxa for which the opposite is true (Arnqvist and
Rowe, 2002b; Eberhard, 2004a). Further exploration of the phylogenetic utility of
reproductive morphology at different taxonomic scales within Odonata is necessary.
Previous Classifications of Mating Systems for Argia
Several general classifications of animal mating systems have been proposed
(Waage, 1984; Alcock and Gwynne, 1991; Conrad and Pritchard, 1992; Fincke et al.,
1997; Shuster and Wade, 2003). The interest in odonate reproductive biology has resulted in several attempts to apply these classifications to the order, but the different systems suffer from inconsistent use of terminology and semantic discord.
The general mating system of Argia was classified as “female control” by Conrad and Pritchard (1992). This nomenclature is somewhat confusing, as the category was meant to convey that males exhibit control over females in the mating process, and not that the females exhibit control over the mating process. In their scheme, female choice is dismissed as being limited, possibly occurring when males attempt tandem linkage and females are able to accept or reject, or by avoiding oviposition sites where males are likely to be waiting for females. This classification also requires that males are able to entice females into mating with relative ease, and that intrasexual selection would act on
52
traits that enhance a male’s ability to locate mates, rather than his ability to prevail in
contests or advertise quality.
Additionally, Conrad and Pritchard (1992) consider this to be a form of male
coercion, which dismisses the fact that female damselflies can reject males (Fincke, 1984;
Steele et al., 2011). A clear definition of sexual coercion is lacking, but usually it implies
that aggression with a potential to cause harm is used by one sex over the other in attempt
to copulate. Furthermore, male coercion invokes sexual selection, which seems circular given the limited evidence. Presumably, male coercion in Argia relates to convenience
polyandry, where persistent male harassment reduces the fitness of females by diverting
their time from additional mating, foraging, or ovipositing, thus females mate with males
to minimize wasted time (Fincke, 1997). For Argia, the mating system should not be
considered as coercion, as there is little evidence that conflict or struggle occurs between
males and females, and mating without conflict potentially benefits both partners. In that
sense the mating system is more aptly described as consensual rather than coercive.
Conrad and Pritchard’s “female control” category of odonate mating systems is roughly analogous to the “opportunistic encounters by searching, non-localized males” category used by Waage (1984). This classification differs little from what was
considered the most common odonate mating pattern, “generally localized encounters at
or near oviposition sites”, which is distinguished from the former mainly in terms of
duration and frequency of copulation. Argia differs in the standard characteristics of these
categories somewhat, namely that oviposition is almost always done in tandem, which is
53 considered a feature of Waage’s third category (“encounters at territories localized at oviposition sites”).
Shuster and Wade (2003) established twelve mating system categories which in turn are subdivided further into forty one categories. Distinctions among these categories are subtle and overlapping in many cases. The mating biology of Argia fits into several of these categories simultaneously, depending on which feature is emphasized, including
“coercive polygynandry in itinerant pairs”, “iteroparous feeding site polygyny”, or various forms of “polyandrogyny” (Shuster and Wade, 2003). None of these categories are mutually exclusive and the criteria for assigning any species are subjective and difficult to measure.
Attempts to categorize mating systems suffer from semantic inconsistency as well as bias regarding the relative role and influence of male and female fitness (Fincke,
1997). There is little data on fitness consequences to either males or females under different hypotheses of mating system (Fincke, 1997) and the predictions are often overlapping (Shuster and Wade, 2003). Much additional research in this area is needed before the mating system of Argia can be confidently categorized.
Does Sexual Selection Operate on Argia species?
Damselflies in the family Calopterygidae are among the most well-studied insects with respect to the role of sexual selection. These odonates tend to exhibit precopulatory courtship behavior and territoriality, and have obvious sexually-dimorphic signals that
54 advertise both sexual identity and quality. For example, experimental studies have clearly demonstrated that sexual selection by female choice is prevalent for Hetaerina americana
(Grether, 1996). Coenagrionids in general and Argia species in particular, do not have any obvious signaling mechanisms in either sex for advertising quality. Considering that mating success appears roughly equal for each sex and that female rejection of males is rare, there does not appear to be much opportunity for sexual selection in the evolution of
Argia.
There is considerable opportunity for hybridization among many species of Argia, as many species are sympatric with no apparent differences in ecological niche. It is known that males will readily attempt to engage in heterospecific sexual contact
(Paulson, 1974; Bick and Bick, 1981). In parts of the New World up to twenty-three species are sympatric (Garrison, 1994), and as many as ten species have been observed engaging in mating behavior simultaneously on a single stretch of stream (Rosser
Garrison, personal communication). However, there does not appear to be evidence that hybridization occurs to any great extent. This seems to suggest that some reliable reproductive isolating mechanisms operate among species. In order to prevent widespread hybridization, these isolating mechanisms must be reliable and therefore should not exhibit overlapping variation among sympatric conspecific populations.
Further, in areas where sister species are sympatric any phenotype that confers identity or reinforces reproductive isolation should be variable within species, whereas variation among species should be high as character displacement reduces heterospecific mating
55
and/or as mating barriers are amplified by reinforcement (Howard, 1993; Bourret et al.,
2012).
In the Argia mating system, mating frequency is relatively equal between males
and females, individuals are promiscuous over their lifetime (but usually not within a day), sexual encounters between conspecifics are likely to result in copulation, tandem oviposition prevent subsequent matings by the female prior to fertilization, and neither sex appears to discriminate among individuals. Without apparent signals of fitness, individuals must assume that fitness is equivalent among potential mates. The benefits of mating with conspecifics of equal fitness may outweigh any associated costs, and
therefore selection may not act on the general mating system at all. The behavioral evidence seems consistent with the notion that sexual selection is limited in Argia and
that reproductive phenotypes are more influenced by natural or reinforcing selection.
Therefore, opportunities for sexual selection seem limited.
The most likely opportunity for sexual selection to operate in Argia seems to be
on the morphology of male abdominal clasping appendages and the associated parts of
female pro- and mesothoracic nota. Females may be able to detect some information
about the male identity based on contact mechanoreceptors located on her thorax
(Paulson, 1974; McPeek et al., 2011), and it stands to reason that some information about
male quality could be transmitted via the same mechanism. An obvious test for this
hypothesis would be to demonstrate that females possess mechanoreceptors in their
mesothorax; some species have dense hairs in and around a pit or depression just
posterior to the mesostigmal plates, and these hairs are potentially sensory in function. If
56
male clasper morphology can be utilized as a signal of quality or fitness, then there must
be some quantifiable intraspecific variation in these structures. This hypothesis will be tested later in this dissertation.
Conclusions and Future Research Needs
The reproductive biology of Odonata is unique and complex among insects.
Although this is widely recognized, there remains much to learn about the variability of the phenotypes and what roles these characters might play on generating and maintaining species diversity within the order. Clearly, the process of sexual selection has been important for these animals over millions of years, and the reproductive phenotypes on which it acts likely plays a role not only in speciation but possibly extinction as well.
Robust phylogenetic hypotheses of Odonata will likely help clarify a number of interesting problems in insect evolution, in addition to clarifying uncertainties regarding the placement and monophyly of intraordinal lineages. These include the evolution of various aspects of the unique reproductive biology that is characteristic of the order, evolution of respiratory structures in nymphs, the role of symbiotic associations with
Wolbachia in shaping population sex ratios, to name a few (Bybee et al., 2008; Ballare
and Ware, 2011).
As the number of phylogenetic studies, taxa, and characters of all types continue to accumulate, our knowledge of odonate systematics and evolution will improve.
Improved and increased molecular data, including whole genomes, will provide a source
57 of vast numbers of characters for phylogenetic matrices, which in turn increases the chances of identifying robust homology statements upon which phylogenetic relationships are reconstructed. Reproductive morphology of both sexes represents a potentially informative source of character information for Odonata, and future studies should strive to include these characters along with more molecular data.
The reproductive biology of Argia consists of a number of interesting phenotypes that can serve as models for testing a variety of hypotheses on the evolution of behavior and sexual morphology. Some of these phenotypes seem to lend themselves to character coding for cladistic analyses, and others can be experimentally manipulated relatively easily for ecological study. Given that current knowledge of Argia mating biology is derived from several in-depth studies of a few taxa, additional research on alternate species, especially in Central and South America, will be of great benefit. Studies that incorporate tests of lifetime mating success and fitness of offspring will also shed light on the fitness components of mating and the extent to which male quality varies with regard to reproductive success. Despite the limited taxonomic scope of previous studies, a great deal about the genus is known and can be generalized.
Considering how common and abundant populations of Argia can be and their potential importance to the health of aquatic ecosystems, some members of this genus have the potential to be model systems for the study of insect evolutionary ecology. Such studies will greatly benefit from continued improvement in the placement of Argia in a broader phylogenetic context as well as further refinement of the intrageneric relationships of the genus. Understanding the evolution of the reproductive biology of
58
Argia will require a robust phylogeny of the family Coenagrionidae; existing attempts to place coenagrionid genera in a phylogenetic context (O'Grady and May, 2003; Carle et al., 2008) have been limited by poor taxon sampling and little character data.
59
Table 3.1: Comparison of select recent phylogenetic analyses emphasizing Odonata and the primary character partitions upon which the studies are based.
Character system Other Genital Study Taxonomic Scope Molecular Morphology Morphology Rehn (2003) Odonata X X Bybee et al. Odonata X X (2008) Carle et al. Odonata X (2008) O'Grady and Coenagrionidae X X May (2003) Carle and Kjer Libellula X X (2002) Weekers et al. Calopteryx X (2001) Misof et al. Calopteryx X (2000) Hasegawa and Odonata X Kasuya (2006) Turgeon and Enallagma X McPeek (2002) Chippendale et Ischnura X al. (1999) Pilgrim et al. Cordulegaster X X (2002) Ware et al. Libelluloidea X (2007a) Caesar and Argia X X X Wenzel (2009) Hovmöller and Johansson Leucorrhinia X (2004) Hovmöller Ischnurinae X (2005) Libellula, Artiss et al. Ladona, X (2001) Plathemis Pilgrim and Von Sympetrum X Dohlen (2007)
60
References
Abbott, J. C. 2005. Dragonflies and Damselflies of Texas and the South-Central United
States : Texas, Louisiana, Arkansas, Oklahoma, and New Mexico. Princeton
University Press, Princeton, N.J., USA.
Alcock, J., Gwynne, D. 1991. Evolution of insect mating systems: the impact of
individual selectionist thinking. In: Bailey, W. J., Ridsill-Smith, J. (Eds.),
Reproductive Behaviour of Insects: Individuals and Populations. Chapman and
Hall, London, England, UK, pp. 10-41.
Andres, J. A., Sanchez-Gullen, R. A., Cordero Rivera, A. 2000. Molecular evidence for
selection on female color polymorphism in the damselfly Ischnura graellsii.
Evolution; international journal of organic evolution 54, 2156-2161.
Artiss, T., Schultz, T. R., Polhemus, D. A., Simon, C. 2001. Molecular phylogenetic
analysis of the dragonfly genera Libellula, Ladona, and Plathemis (Odonata:
Libellulidae) based on mitochondrial cytochrome oxidase I and 16S rRNA
sequence data. Mol Phylogenet Evol 18, 348-361.
Bailey, W. J., Ridsill-Smith, J. 1991. Reproductive Behaviour of the Insects: Individuals
and Populations. Chapman and Hall, London, UK.
Ballare, E. F., Ware, J. L. 2011. Dragons fly, biologists classify: an overview of
molecular odonate studies, and our evolutionary understanding of dragonfly and
damselfly (Insecta: Odonata) behavior. International Journal of Odonatology 14,
137-147.
61
Bick, G. H., Bick, J. C. 1965a. Color variation and significance of color in reproduction
in the damselfly, Argia apicalis (Say)(Zygoptera: Coenagriidae (sic)). Canadian
Entomologist 97, 32-41.
Bick, G. H., Bick, J. C. 1965b. Demography and Behavior of the Damselfly Argia
apicalis (Say), (Odonata: Coenagrionidae). Ecology 46, 461-472.
Bick, G. H., Bick, J. C. 1968. Demography of the damselfly, Argia plana Calvert.
Proceedings of the Entomological Society of Washington 70, 197-203.
Bick, G. H., Bick, J. C. 1972. Substrate utilization during reproduction by Argia plana
Calvert and Argia moesta (Hagen) (Odonata: Coenagrionidae). Odonatologica 1,
3-9.
Bick, G. H., Bick, J. C. 1981. Heterospecific pairing among Odonata. Odonatologica 10,
259-270.
Bick, J. C., Bick, G. H. 1982. Behavior of adults of dark-winged and clear-winged
subspecies of Argia fumipennis (Burmeister)(Zygoptera: Coenagrionidae).
Odonatologica 11, 99-107.
Borror, D. J. 1934. Biological studies of Argia moesta Hagen (Odonata: Coenagrionidae)
by means of marking. The Ohio Journal of Science 34, 97-108.
Bybee, S. M., Ogden, T. H., Branham, M. A., Whiting, M. F. 2008. Molecules,
morphology and fossils: a comprehensive approach to odonate phylogeny and the
evolution of the odonate wing. Cladistics 23, 1- 38.
62
Bybee, S. M., Zaspel, J. M., Beucke, K. A., Scott, C. H., Smith, B. W., Branham, M. A.
2010. Are molecular data supplanting morphological data in modern phylogenetic
studies? Systematic Entomology 35, 2-5.
Byers, C. J., Eason, P. K. 2009. Conspecifics and Their Posture Influence Site Choice and
Oviposition in the Damselfly Argia moesta. Ethology 115, 721-730.
Caesar, R. M., Wenzel, J. W. 2009. A phylogenetic test of classical species groups in
Argia (Odonata: Coenagrionidae). Entomologica Americana 115, 97-108.
Carle, F. L. 1982. Evolution of the Odonate Copulatory Process. Odonatologica 11, 271-
286.
Carle, F. L., Kjer, K. M. 2002. Phylogeny of Libellula Linneaus (Odonata: Insecta).
Zootaxa 87, 1-18.
Carle, F. L., Kjer, K. M., May, M. L. 2008. Evolution of Odonata, with special reference
to Coenagrionoidea (Zygoptera). Arthropod Systematics and Phylogeny 66, 37-
44.
Chippendale, P. T., Dave, V. K., Whitmore, D. H., Robinson, J. V. 1999. Phylogenetic
Relationships of North American Damselflies of the Genus Ischnura (Odonata:
Zygoptera: Coenagrionidae) Based on Sequences of Three Mitochondrial Genes.
Mol Phylogenet Evol 11, 110-121.
Conrad, K. F., Pritchard, G. 1988a. Female dimorphism and physiological colour change
in the damselfly Argia vivida Hagen (Odonata: Coenagrionidae). Canadian
Journal of Zoology 67, 298-304.
63
Conrad, K. F., Pritchard, G. 1988b. The reproductive behavior of Argia vivida Hagen: an
example of a female-control mating system (Zygoptera: Coenagrionidae).
Odonatologica 17, 179-186.
Conrad, K. F., Pritchard, G. 1990. Pre-oviposition mate-guarding and mating behaviour
of Argia vivida (Odonata: Coenagrionidae). Ecological Entomology 15, 363-370.
Conrad, K. F., Pritchard, G. 1992. An ecological classification of odonate mating
systems: the relative influence of natural, inter- and intra-sexual selection on
males. Biological Journal of the Linnaean Society 45, 255-269.
Cordero Rivera, A., Lorenzo Carballa, M. O., Utzeri, C., Vieira, V. 2005.
Parthenogenetic Ischnura hastata (Say), widespread in the Azores (Zygoptera:
Coenagrionidae). Odonatologica 34, 1-9.
Córdoba-Aguilar, A. 2003. Predicting mechanisms of sperm displacement based on
genital morphometrics in the Calopterygidae (Odonata). Journal of Insect
Behavior 16, 153-167.
Córdoba-Aguilar, A., Uhía, E., Cordero-Rivera, A. 2003. Sperm competition in Odonata
(Insecta): the evolution of female sperm storage and rivals' sperm displacement.
Journal of Zoology 261, 381-398.
Daigle, J. J. 1991. Argia garrisoni spec. nov. from Mexico (Zygoptera: Coenagrionidae).
Odonatologica 20, 337-342.
Daigle, J. J. 1995. Argia carlcooki spec. nov. from Mexico (Zygoptera: Coenagrionidae).
Odonatologica 24, 467-471.
64
Dijkstra, K. B., Groeneveld, L. F., Clausnitzer, V., Hadrys, H. 2007. The Pseudagrion
split: molecular phylogeny confrims the morphological and ecological dichotomy
of Africa's most diverse genus of Odonata (Coenagrionidae). International Journal
of Odonatology 10, 31-41.
Eberhard, W. G. 1985. Sexual Selection and Animal Genitalia. Harvard University Press,
Cambridge, MA, USA.
Eberhard, W. G. 1986. Female Control: Sexual Selection by Cryptic Female Choice.
Princeton University Press, Princeton, NJ, USA.
Falck, J., Johansson, F. 2000. Patterns in size, sex ratio and time at emergence in a south
Swedish population of Sympetrum sanguineum (Odonata). Aquatic Insects 22,
311-317.
Fincke, O. M. 1982. Lifetime mating success in a natrual population of the damselfly,
Enallagma hageni (Walsh) (Odonata: Coenagrionidae). Behavioral Ecology and
Sociobiology 10, 293-302.
Fincke, O. M. 1992. Consequences of larval ecology for territoriality and reproductive
success of a neotropical damselfly. Ecology 73, 449-492.
Fincke, O. M. 1994. Female colour polymorphism in damselflies: failure to reject the null
hypothesis. Animal Behaviour 47, 1249-1266.
Fincke, O. M., Waage, J. K., Koenig, W. D. 1997. Natural and sexual selection
components of odonate mating patterns. In: Choe, J. C., Crespi, B. J. (Eds.), The
Evolution of Mating Systems In Insects and Arachnids. Cambridge University
Press, Cambridge, UK, pp. 58-74.
65
Garrison, R. W. 1994. A synopsis of the genus Argia of the United States with keys and
descriptions of new species, Argia sabino, A. leonorae, and A. pima (Odonata:
Coenagrionidae). Transactions of the American Entomological Society 120, 287-
368.
Garrison, R. W. 1996. A synopsis of the Argia fissa group, with descriptions of two new
species, A. anceps sp. n. and A. westfalli sp. n. (Zygoptera: Coenagrionidae).
Odonatologica 25, 31-47.
Garrison, R. W., von Ellenrieder, N. 2007. The true Argia difficilis Selys, 1865, with the
description of Argia yungensis sp. nov. (Odonata: Coenagrionidae). Transactions
of the American Entomological Society 133, 189-204.
Grether, G. F. 1996. Sexual selection and survival selection on wing coloration and body
size in the rubyspot damselfly Hetaerina americana. Evolution; international
journal of organic evolution 50, 1939-1948.
Grimaldi, D., Engel, M. 2005. Evolution of the Insects. Cambridge University Press, New
York, New York, USA.
Hamilton, L. D., Montgomerie, R. D. 1989. Population demography and sex ratio in a
neotropical damselfly (Odonata: Coenagrionidae) in Costa Rica. Journal of
Tropical Ecology 5, 159-171.
Hasegawa, E., Kasuya, E. 2006. Phylogenetic analysis of the insect order Odonata using
28S and 16S rDNA sequences: a comparison between data sets with different
evolutionary rates. Entomological Science 9, 55-66.
Hovmöller, R. 2005. Defining Ischnurinae.
66
Hovmöller, R., Pape, T., Kallersjö, M. 2002. The Palaeoptera Problem: Basal Pterygote
Phylogeny Inferred from 18S and 28S rDNA Sequences. Cladistics 18, 313-323.
Kambhampati, S., Charlton, R. E. 1999. Phylogenetic relationship among Libellula,
Ladona and Plathemis (Odonata: Libellulidae) based on DNA sequence of
mitochondrial 16S rRNA gene. Systematic Entomology 24, 37-49.
Kéry, M., Juillerat, L. 2004. Sex ratio estimation and survival analysis for Orthetrum
coerulescens (Odonata, Libellulidae). Canadian Journal of Zoology 82, 399-406.
Kiauta, B., Kiauta, M. A. J. E. 1980. Introduction to the cytotaxonomy of the odonate
genus Argia (Zygoptera: Coenagrionidae). Odonatologica 9, 35-56.
Kjer, K. M. 2004. Aligned 18S and Insect Phylogeny. Syst Biol 53, 506-514.
Lin, C. P., Chen, M. Y., Huang, J. P. 2010. The complete mitochondrial genome and
phylogenomics of a damselfly, Euphaea formosa support a basal Odonata within
the Pterygota. Gene 468, 20-29.
Lorenzo-Carballa, M. O., Cordero-Rivera, A. 2009. Thelytokous parthenogenesis in the
damselfly Ischnura hastata (Odonata, Coenagrionidae): genetic mechanisms and
lack of bacterial infection. Heredity 103, 377-384.
Meurgey, F. 2009. Redescription of Argia concinna (Rambur), with a description of
Argia telesfordi spec. nov. from Grenada, West Indies (Zygoptera:
Coenagrionidae). Zootaxa 2272, 54-62.
Misof, B. 2002. Diversity of Anisoptera (Odonata): Infering speciation processes from
patterns of morphological diversity. Zoology 105, 355-365.
67
Misof, B., Anderson, C. L., Hadrys, H. 2000. A Phylogeny of the Damselfly
Genus Calopteryx (Odonata) Using Mitochondrial 16S rDNA Markers. Mol
Phylogenet Evol 15, 5-14.
O'Grady, E. W., May, M. L. 2003. A phylogenetic reassessment of the subfamilies of
Coenagrionidae (Odonata: Zygoptera). Journal of Natural History 37, 2807-2834.
Ogden, T. H., Whiting, M. F. 2003. The problem with “the Paleoptera Problem:” sense
and sensitivity. Cladistics 19, 432-442.
Paulson, D. R. 1974. Reproductive isolation in damselflies. Systematic Zoology 23, 40-
49.
Pilgrim, E. M., Roush, S. A., Krane, D. E. 2002. Combining DNA sequences and
morphology in systematics: testing the validity of the dragonfly species
Cordulegaster bilineata. Heredity 89, 184-190.
Pilgrim, E. M., Von Dohlen, C. D. 2007. Molecular and morphological study of species-
level questions within the dragonfly genus Sympetrum (Odonata: Libellulidae).
Annals of the Entomological Society of America 100, 688-702.
Querino, R. B., Hamada, N. 2009. An Aquatic Microhymenopterous Egg-Parasitoid of
Argia insipida Hagen in Selys (Odonata: Coenagrionidae) and Biological
Observations in the Central Amazon, Brazil. Neotropical Entomology 38, 346-
351.
Rach, J., DeSalle, R., Sarkar, I. N., Schierwater, B., Hadrys, H. 2008. Character-based
DNA barcoding allows discrimination of genera, species and populations in
Odonata. Proc. Roy. Soc. Lond. B. Biol. Sci. 275, 237-247.
68
Rehn, A. C. 2003. Phylogenetic analysis of higher-level relationships of Odonata.
Systematic Entomology 28, 181-239.
Robinson, J. V., Dickerson, J. E., Bible, D. R. 1983. The demographics and habitat
utilization of adult Argia sedula (Hagen) as determined by mark-recapture
analysis (Zygoptera: Coenagrionidae). Odonatologica 12, 167-172.
Sanchez-Guillen, R. A., Wellenreuther, M., Cordero-Rivera, A., Hansson, B. 2011.
Introgression and rapid species turnover in sympatric damselflies. BMC
evolutionary biology 11, 210.
Shuster, S. M., Wade, M. J. 2003. Mating Systems and Strategies. Princeton University
Press, Princeton, New Jersey, USA.
Simon, S., Strauss, S., von Haeseler, A., Hadrys, H. 2009. A phylogenomic approach to
resolve the basal pterygote divergence. Mol Biol Evol 26, 2719-2730.
Sirot, L. K., Brockmann, H. J., Marnis, C., Muschett, G. 2003. Maintenance of a female-
limited polymorphism in Ischnura ramburi (Zygoptera: Coenagrionidae). Animal
Behaviour 66, 763-775.
Siva-Jothy, M. T., Hooper, R. E. 1996. Differential use of stored sperm during
oviposition in the damselfly Calopteryx splendens xanthostoma (Charpentier).
Behavioral Evology and Sociobiology 39, 389-393.
Snodgrass, R. E. 1935. Principles of Insect Morphology. Cornell University Press, Ithaca,
NY, USA.
Song, H., Bucheli, S. R. 2009. Comparison of phylogenetic signal between male genitalia
and non-genital characters in insect systematics. Cladistics 26, 23-35.
69
Svensson, E. I., Kristoffersen, L., Oskarsson, K., Bensch, S. 2004. Molecular population
divergence and sexual selection on morphology in the banded demoiselle
(Calopteryx splendens). Heredity 93, 423-433.
Trautwein, M. D., Wiegmann, B. M., Beutel, R., Kjer, K. M., Yeates, D. K. 2012.
Advances in insect phylogeny at the dawn of the postgenomic era. Annual
Review of Entomology 57, 449-468.
Turgeon, J., McPeek, M. A. 2002. Phylogeographic analysis of a recent radiation of
Enallagma damselflies (Odonata: Coenagrionidae). Molecular Ecology 11.
Van Gossum, H., Mattern, M. 2008. A phylogenetic perspective on absence and presence
of a sex-limited polymorphism. Animal Biology 58, 257-273.
Waage, J. K. 1979. Dual Function of the Damselfly Penis: Sperm Removal and Transfer.
Science 203, 916-918.
Waage, J. K. 1984. Sperm Competition and the Evolution of Odonate Mating Systems.
In: Smith, R. L. (Ed.) Sperm Competition and the Evolution of Animal Mating
Systems. Academic Press, Inc., Orlando, FL, USA.
Waage, J. K. 1986. Evidence for widespread sperm displacement ability among
Zygoptera (Odonata) and the means for predicting its presence. Biological Journal
of the Linnean Society 28, 285-300.
Walker, E. M. 1953. The Odonata of Canada and Alaska. University of Toronto Press,
[Toronto].
70
Ware, J. L., May, M. L., Kjer, K. M. 2007. Phylogeny of the higher Libelluloidea
(Anisoptera: Odonata): An exploration of the most speciose superfamily of
dragonflies. Mol Phylogenet Evol 45, 289-310.
Weekers, P. H., De Jonckheere, J. F., Dumont, H. J. 2001. Phylogenetic relationships
inferred from ribosomal its sequences and biogeographic patterns in
representatives of the genus Calopteryx (Insecta: Odonata) of the West
Mediterranean and adjacent West European zone. Mol Phylogenet Evol 20, 89-
99.
Westfall, M. J., May, M. L. 1996. Damselflies of North America. Scientific Publishers,
Gainsville, FL, USA.
Wheeler, W. C., Whiting, M. F., Wheeler, Q. D., Carpenter, J. M. 2001. The Phylogeny of the Extant Hexapod Orders. Cladistics 17, 113-169.
71
Chapter 4 : Phylogeny of the Damselfly genus Argia (Odonata: Coenagrionidae)
based on Combined Morphological and Molecular Data
Introduction
Argia is a genus in the family Coenagrionidae which includes approximately 120
species (Garrison, 1994). The center of diversity for the genus is in subtropical regions of central and northern México. Thorough systematic studies of the genus to date have been limited to the taxa that occur in the United States and Canada (Garrison, 1994; Caesar and Wenzel, 2009). Some scattered work has been done in México, Central America, and
South America, consisting primarily of alpha taxonomy and distributional studies
(Tennessen, 2002; De Marmels, 2007; Garrison and von Ellenrieder, 2007; Von
Ellenrieder, 2007; Costa et al., 2008; Guillermo-Ferreira and Del-Claro, 2011). A preliminary phylogeny of the species found in the United States and Canada based on molecular and morphological data, including a portion of the mitochondrial 16S rDNA and several characters of both adults and late-instar nymphs, has been published (Caesar and Wenzel, 2009). Strong support for the monophyly of the genus was found, and several of the species relationships that had been previously
72
proposed (Calvert, 1901; Kennedy, 1920a; Garrison, 1994; Westfall and May, 1996) was
confirmed. The primary intent of Caesar and Wenzel (2009) was to assess the feasibility of generating a robust hypothesis for the genus using available specimens and the 16S and morphological data. This chapter is a follow up to that work.
Status of Taxonomy
While the alpha taxonomy of the genus has been stable and the morphological descriptions and keys that are available for the North American species are reliable
(Garrison, 1994), many of the species found in tropical and subtropical Meso- and South
America need revision. The current taxonomy of Argia species is not based on a phylogenetic hypothesis or modern comparative methods. In his work on Central
American Odonata, Phillip P. Calvert treated forty eight species of Argia (Calvert, 1901), eighteen of which occur in the United States (Garrison, 1994). Clarence Hamilton
Kennedy included some Argia species in his “phylogeny” of Zygoptera (Kennedy,
1920b), and he described several species (Kennedy, 1918; Kennedy, 1919a). Leonora
Gloyd did considerable taxonomic work on Argia throughout her life (Gloyd, 1958;
Gloyd, 1968b; Gloyd, 1968a), although she died before much of her work was completed
(Garrison, 1994). The juveniles of most species have never been described; currently the last instar larvae have been described for thirty-nine species (Westfall, 1990; Novelo-
Gutiérrez, 1992; Hoekstra and Smith, 1999; Novelo-Gutiérrez and Gómez-Anaya, 2006;
De Marmels, 2007; Von Ellenrieder, 2007; Costa et al., 2008; Meurgey, 2011). At least
73 twenty undescribed species are hypothesized (Garrison et al., 2010), and new species descriptions continue to be published (Daigle, 1991; Garrison, 1994; Daigle, 1995;
Garrison, 1996; Tennessen, 2002; Garrison and von Ellenrieder, 2007; Meurgey, 2009).
Garrison (1994) provided a thorough synopsis of the species of Argia occurring north of
México, including taxonomic keys for adults (these keys are reproduced in Westfall and
May 1996), and several informal species groups were outlined. Förster (2001) provides updated taxonomic keys for some of the common Central American species of Argia.
Currently, Rosser Garrison is continuing the work of Leonora Gloyd on revising the tropical species (personal communication). The application of such revisionary work to studies of character evolution may be more useful when placed in a robust phylogenetic context. The preliminary phylogeny of Caesar and Wenzel (2009) focused on the taxa occurring in the United Stated and Canada. Thus, the classification of the genus has yet to be thoroughly tested across its geographic and taxonomic range.
The considerable diversity of secondary reproductive characters in Argia suggests that it may be a useful taxon for studies of sexual selection and reproductive character evolution. Almost universally, the morphology of male clasping structures (modified cerci and paraprocts) and the corresponding parts of the female pro- and meso-nota are species specific and thus useful in identification. Additionally, the genus includes some species which exhibit unique coloration patterns among Coenagrionidae. The phylogenetic distribution of these and other characters has never been examined thoroughly across the genus.
74
Several authors have proposed that Argia originated in the Neotropics and is a
phylogenetically young lineage that has recently diversified and expanded into the
temperate region of North America (Kennedy, 1919b; Walker, 1953; Kiauta and Kiauta,
1980; Pritchard, 1982). These hypotheses were made based on morphological
similarities, species distributions (including number of species as well as proportion of
shared species among different areas), and cytological evidence. The genus illustrates a
latitudinal gradient in species diversity, and Pritchard (1982) hypothesized that
colonization into colder climates has been aided by an elaboration of larval diapauses and
via habitat selection behaviors that minimize the effects of cold temperatures. Two
species that have been proposed to be basal in the genus (Caesar and Wenzel, 2009) also
have the widest geographic ranges: Argia translata ranges from southern Canada to
Brazil, and A. moesta ranges from central Canada to southern México (Pritchard, 1982;
Westfall and May, 1996). This makes it difficult to evaluate the geographic origins of the genus without additional data.
The goals of this chapter are i) to build on the previous preliminary phylogeny of
Argia (Caesar and Wenzel, 2009), expanding it to include a near-complete selection of species in the genus, and to add additional morphological and molecular characters and ii) to examine the patterns of evolution in the secondary reproductive characters. For the latter, males are emphasized for several reasons, although females are included in brief: male secondary sexual characters are easier to observe and image, and relied upon more
heavily in published taxonomic keys, and collections of specimens tend to be male
biased. It is anticipated that the results of this study will clarify some uncertainty
75
regarding species groups and their placement relative to others, as well as identify
potentially useful characters for the diagnosis of clades in future studies of the taxonomy
and phylogeny of Zygoptera.
Here the first phylogenetic hypothesis for Argia species based on multiple data
sources and using two phylogenetic optimality criteria is provided. Data from multiple
character partitions were examined in a combined, total evidence approach. As part of an
examination of the phylogenetic information content of different data partitions, separate
analyses were also performed. These phylogenetic analyses allow for testing of existing
taxonomic hypotheses, contribute an improved understanding of species relationships,
and provide a foundation for future comparative research within the genus.
Materials and Methods
Taxon Selection
The dataset for this phylogenetic study includes 84 terminals in the ingroup
(species currently assigned to the genus Argia) as well as seven outgroup terminals,
representing the other major families of the suborder Zygoptera. These outgroup taxa
serve the purpose of rooting the trees and establishing polarity of characters in the data
matrices. The placement of Argia in a broader taxonomic context is beyond the scope of
this dissertation, although the phylogeny of Coenagrionidae remains uncertain and the
76
placement of Argia relative to other genera in the family is tentative (O'Grady and May,
2003; Rehn, 2003; Bybee et al., 2008; Carle et al., 2008).
The Argia species included in the ingroup represent 71% of the known diversity of the genus (Garrison, 1994), including all hitherto proposed subgenera, species groups, or other intrageneric clusters (Kennedy, 1920a; Garrison, 1994; Caesar and Wenzel,
2009). Species that were not included were either not available at all or were represented by few very old specimens not suitable for molecular study. Additionally, several species were described after the beginning of the study (Garrison and von Ellenrieder, 2007;
Meurgey, 2009) and were therefore not available. One species that was included in the preliminary phylogeny as “new species” (Caesar and Wenzel, 2009) was later confirmed by Rosser Garrison as Argia herberti (personal communication) and was not included in the analyses presented here. A complete list of all taxa included in this analysis along with collection information and GenBank accession numbers is provided in Appendix A.
Specimens examined for this study included a combination of fresh and dried material. Freshly collected specimens were captured in situ using a hand held aerial net and placed directly into 100% USP ethyl alcohol for killing, preservation and long-term storage. Dried specimens were also initially collected using a hand held aerial net, killed using an acetone bath (which helps preserve some of the in vivo coloration), and then stored in 3 X 5 inch cellophane envelopes on a white index card background. Where possible, the morphological and DNA vouchers are the same individual specimen.
Specimens were identified using the taxonomic keys found in Abbott (2005),
Garrison (1994), Förster (2001), and Westfall and May (1996). Some of the donated and
77 loaned materials were previously identified by experts on odonate taxonomy, and these were taken at face value. If specimen identification was not performed by a known odonate expert, the diagnosis was verified using the aforementioned taxonomic resources.
Morphological Data
The morphology was studied by examining intact, whole body adult specimens under a standard stereo dissecting microscope at 6-50X magnification. For closer examination of the male secondary reproductive structures on the terminalia, abdominal segments 7-10 were removed from the specimen and mounted either by gluing onto a paper point mounted on an insect mounting pin, or by temporarily embedding the terminalia in a portion of modeling clay. The morphology of the male cerci was more closely examined by 3-D reconstructions generated by computer tomography (CT) scans.
The morphological data matrix for this study was constructed using WinClada
(Nixon, 2000). A combination of absence/presence and unordered, multi-state characters were included. Those taxa for which data is missing were scored using “-“, and in cases where the character state is unknown a “?” was entered. Such data were treated as missing.
The morphological data matrix analyzed for this study is presented in Appendix
C. Some of the characters included were extracted from identification keys (Garrison,
1994; Westfall and May, 1996), and others were inspired by similar studies in other
Zygoptera taxa (O'Grady and May, 2003). Some of these characters were used in a
78
previous, regional study of this genus that appears in Chapter 2 and has been previously
published (Caesar and Wenzel, 2009). Some of the characters related to the secondary
male genitalia were coded and scored based on 3-D reconstructions of CT scans.
Descriptions and figures of morphological characters are found in Appendix B and in
figures 4.6-4.12.
Molecular Data
DNA sequences included in this study were obtained from tissues dissected from
specimens that were either stored in 70-100% ethyl alcohol or were dried and stored in
cellophane envelopes. Specimens were obtained from a variety of sources (summarized
in Appendix A) and subjected to various storage regimes. In some cases the dried
specimens were initially subjected to acetone soaking and drying, a method intended to
help preserve coloration in insect specimens. This technique has the added effect of
rapidly drying out the tissues and potentially preserving the DNA to an extent comparable to or exceeding that of ethanol-stored specimens (Fukatsu, 1999; Logan,
1999). Of the ethanol stored specimens, some were collected directly into high-purity molecular biology grade 100% ethanol, stored at -20 C, and extracted within 3 years of collection, while others were stored in 70-80% of a technical-grade ethanol and stored at room temperature. There is no indication that any of these preservation methods had an impact on the quality or quantity of DNA that is subsequently extracted and amplified.
79
Tissues were isolated from whole adult specimens with the aid of a stereo microscope and sterilized dissecting tools. A leg and small amount of thoracic flight muscle was removed from the specimen for DNA isolation. This resulted in a variable amount of tissue being isolated, particularly from the dried specimens, as the muscle and exoskeleton often breaks off in an irregular fashion. Where possible, any loose tissue that was not attached to the specimen was added to a collection tube. Extracted DNA was quantified using a spectrophotometer, and there was no discernible pattern regarding relative amount of tissue and yield of genomic DNA or PCR product.
Genomic DNA was isolated from tissue samples using DNEasy® Tissue kits
(Qiagen Inc., Valencia, CA, USA). A modified version of the manufacturers’ standard protocol was implemented to improve yield of DNA isolated (Caesar et al., 2005). 16S ribosomal DNA (0.6 kb) from the mitochondria was amplified by the polymerase chain reaction (PCR) run at 35 cycles with annealing temperature of 50º C. The primers LR-J-
12887 (5’-CCGGTCTGAACTCAGATCACGT-3’) and LR-N-13398 (5’-
CGCCTGTTTAACAAAAACAT-3’) were used (Simon et al., 1994). This primer combination has been shown to be useful in several odonate studies (e.g. Misof et al.,
2000). Reactions were carried out in 25 µl volumes, with 12.5 µl of a Taq polymerase master mix (Quiagen, Inc. Valencia, CA, USA), 3.5 µl of H2O, 2.0 µl of each primer (0.5 pmol/µl), and 5.0 µl genomic DNA template. A layer of mineral oil was applied to each sample, and reactions ran on a PTC-100 Peltier thermal cycler (MJ Research, Ramsey,
Minnesota, USA). Amplified DNA was separated on an agarose gel via electrophoresis and visualized under UV light for verification of presence of amplicon and to check for
80
contamination. PCR products were purified using QIAquick® PCR purification kit
(Quiagen, Valencia, CA, USA). Purified PCR products were sequenced on an ABI 3730
DNA Analyzer (Applied Biosystems, Inc., Carlsbad, CA, USA) by staff at the Plant-
Microbe Genomics Facility at Ohio State University (Columbus, OH, USA) or Cogenics,
Inc. (Houston, TX, USA). Sequences were edited using Sequencher version 4.8 (Gene
Codes Corp., Ann Arbor, MI, USA). PCR products were sequenced in both directions,
and differences or ambiguities between strands were manually resolved after examining
the electropherograms of each sequence. Edited sequences were searched using the Basic
Local Alignment Search Tool (BLAST) tool (Altschul et al., 1990) of GenBank (National
Center for Biotechnology Information, Bethesda, MD, USA) to check for contamination.
Edited sequences were submitted to MUSCLE for alignment (Edgar, 2004) via the
CIPRES Gateway (Miller et al., 2010). After editing and alignment, 551 base pairs (bp)
were included in the final analyzed molecular data matrix. All new sequences generated
in this study were deposited in GenBank (Appendix A).
Phylogenetic Analysis
The morphological and molecular data sets were each analyzed separately and in
combination for a total of three data combinations. For combined analysis, the data sets
from 16S and morphology were merged using Winclada (Nixon, 2000).
Maximum Parsimony (MP) analyses of individual and combined data partitions
were performed using TNT v. 1.1 (Goloboff et al., 2008a). Gaps in the molecular data
81
partition were treated as missing data and all characters were equally weighted. New technology searches with default settings were used for all analyses except that with the
ratchet, 200 iterations were performed and 10 random addition sequences were used in
branch swapping. Relative clade support was estimated using 1000 replicates of the
jackknife procedure with 36% resampling probability and reporting absolute frequencies
in TNT v. 1.1 (Goloboff et al., 2008a). Bremer support values were calculated to assess
branch support (Bremer, 1994) on the MP trees using TNT v. 1.1 (Goloboff et al.,
2008b).
Maximum Likelihood (ML) analysis of the molecular data was performed using
RAxML v. 7.2.6 (Stamatakis, 2006) using the GAMMA model of rate heterogeneity and
the GTR substitution model. Relative branch support was assessed with 1000 bootstrap
replicates and these values were plotted on the ML tree with the best likelihood score
(fig. 4.3).
Results
Analysis of Combined Data
The combined morphological and 16S matrix included 644 characters. Tree
searches using new technology resulted in 12 equally most parsimonious trees of length
1520 steps (Fig 4.1). The strict consensus of these trees collapsed 15 nodes (Fig. 4.2).
82
Jackknife and Bremer support values are presented on the cladograms in Figs. 4.1 and
4.2.
Parsimony analysis of the molecular data in TNT resulted in 11 equally most
parsimonious tree of 1092 steps (Fig. 4.3). The strict consensus of these trees collapsed
23 nodes (Fig. 4.4). The molecular data from 16S provide considerable structure to the tree near the tips, although there is poor resolution of deeper nodes in the tree. The placement of a few individual species and species pairs remains uncertain, but the major clades discussed below are resolved in the consensus and are congruent with the ML results.
Maximum likelihood analysis of the MUSCLE-aligned 16S data yielded the tree presented in Figure 4.5. Bootstrap values for each node are provided on the figure. The
ML tree is nearly fully resolved, with only three polytomies. One of these involves the clade that includes Argia concinna, a species found in the West Indies, and a group of
South American species including A. reclusa, A. modesta, A. tamoyo, A. clausseni, A. croceipennis, A. fraudatricula, A. fumigate, and A. euphorbia. Another ML polytomy involves the clades that include Argia munda, the A. chelata clade, and this is connected to the third polytomy which includes the A. talamanca clade, the A. fumipennis clade, and the A. hinei-medullaris pair.
Likelihood vs. Parsimony
83
There is considerable agreement between the results of ML and MP analyses for
the 16S data (Table 4.1). The placement of a few taxa relative to the spine of the ingroup
is different, but many of the internal and terminal nodes are identical. Under both criteria,
A. translata is the most basal Argia. When the result of the ML analysis of the 16S data is
compared to the consensus of the MP combined data, there is also much similarity
between the trees. The placement of A. pallens relative to the A. fumipennis subspecies
complex differs, with morphology making A. pallens basal relative to all A. fumipennis whereas with 16S alone it is sister to A. fumipennis violacea.
Utility of Morphological Characters
As part of this study several characters were evaluated as putative homologies and
found to be phylogenetically uninformative as either homoplasies, hypervariable, or
apparently non-heritable traits. Refined coding of some of these characters may provide
phylogenetic information for future research. These include several aspects of coloration
(May, 1976; Conrad and Pritchard, 1988a) and wing venation (Kennedy, 1920b; Westfall
and May, 1996). While not surprising, it is nonetheless worthwhile to discuss these
characters in brief for the benefit of future studies of a similar nature.
The pale colors of Argia species have been demonstrated to undergo
physiological color change, likely as a thermoregulatory mechanism (Bick and Bick,
1965a; May, 1976) but possibly also in response to stress (Bick and Bick, 1965ab). These colors can change within several hours and the colors observed on specimens may not
84 reflect the actual color of living individuals. Further, color polymorphism may be widespread in certain species (May, 1976; Conrad and Pritchard, 1988a; Fincke, 1994;
Fincke et al., 2005). Argia species are often characterized in the literature based on the patterning of pale and dark coloration throughout the body, but these colors can vary with age, temperature, sex and geography (Bick and Bick, 1965a; May, 1976; Conrad and
Pritchard, 1988a). This includes the relative amount of dark on the head, the presence and size of postocular spots and bar, the width of middorsal and humeral dark stripes, the degree to which the humeral stripe is forked, the amount of pale coloration on the abdominal tergites, and the color of cerci, paraprocts and tori in males.
The number of postquadrangular antenodal cells in the forewings and hindwings is often listed in taxonomic keys of Argia and it can help narrow down identity, but this character can be variable even within individuals as well as within a species, and is therefore of no use in phylogenetic analysis. Wing venational characters are insufficient even as diagnostic tools and seem to vary as a function of overall body size, which may be plastic within species (Gloyd, 1968a). The developmental and mechanical constraints on wing veins must be flexible enough that the exact arrangement of veins and crossveins is somewhat flexible. As part of the coding for this study, several individuals were observed to have varying numbers of cells from the left to right forewings, for example.
It is otherwise known that specimens of the same species may have either four or five cells (Westfall and May, 1996). Kennedy recognized as long ago as 1920 that wing venation would not be very useful for the phylogeny of coenagrionid damselflies: “…The attempt to show phylogeny by venation which is hopeless because of the numerous
85 convergences” (Kennedy, 1920b, p. 28). Gloyd (1968a) agreed that several commonly reported wing characters, including number of postquadrangular cells and relative size and shape of the pterostigma are of little use in species level systematics for Argia.
Last-instar larvae of Argia species are known from only 39 species (Von
Ellenrieder, 2007; Costa et al., 2008). This makes it difficult to include larval characters in a phylogenetic study of the genus, despite the potential for juvenile semaphoronts to provide useful phylogenetic signal (Caesar and Wenzel, 2009). Future systematic work on the genus should attempt to describe larvae for unknown species and include characters in morphological matrices.
Discussion
In general, the phylogenetic results among different data sets and using different optimality criteria are in close agreement with each other and provide a valuable addition to the knowledge of Odonata systematics. The placement of some species within the phylogeny remains unclear, but for a majority of the clades, resolution is good and support is strong (Table 4.1). The results allow for the testing of taxonomic and evolutionary hypotheses and provide a firm foundation for future research on Argia and coenagrionid systematics.
Argia translata is recovered as the most basal species in the genus in all analyses performed. This species has the widest geographic distribution in the genus, ranging from southern Canada to Argentina (Pritchard, 1982; Westfall and May, 1996). Kennedy
86
(1920a) considered this species a member of the subgenus Chalchargia, grouping it along
with a number of species solely on the basis of having the apex of the penis bifid.
Westfall and May (1996) state that A. translata is “closely related” to A. tezpi, although there is no actual phylogenetic support for that statement. The two species are superficially similar and may be confused, but careful examination of the morphology of the cerci of males and the mesostigmal plates of females should allow them to be distinguished (Garrison, 1994). The cerci of the A. translata and A. tezpi are quite different, the former having a spatulate form and open central cavity in ventral view (fig.
4.12A), the latter being rounded and with an enclosed kidney-shaped central cavity.
Argia translata is the only member of the genus known to have a true m- chromosome
and has a low haploid number for the genus (n=13) (Kiauta and Kiauta, 1980), leading to the hypothesis that this species may have an older “phylogenetic age” than congeners with higher haploid numbers (up to n=19).
Argia oculata group
A species group consisting of Argia oculata, A. eliptica, A. difficilis, and the manuscript name “mini-blue” was recovered with strong support in all analyses. This species group is also likely to contain A. yungensis (Garrison and von Ellenrieder, 2007) although specimens of that species were not available for inclusion in this study. This species complex had been proposed based on morphological similarity (Calvert, 1901;
Garrison and von Ellenrieder, 2007), and is confirmed by both the independent test of
87 molecular data and the combined analysis. Argia indicatrix is recovered as sister to the
Argia oculata group with high support.
The cerci of these species are very similar (fig. 4.6): all have a rounded, divided apical margin, distinct ventral sinus, and a decumbent tooth visible in lateral view. They also share similarities in the morphology of the paraproct, mesostigmal plate and penis
(Garrison and von Ellenrieder, 2007). Argia difficilis exhibits male color polymorphism across its range (Garrison and von Ellenrieder, 2007) as does A. oculata although to a lesser degree. Argia oculata has the broadest range of species in this clade, extending from southern México through Peru and Ecuador and is sympatric with all other members of the clade. The uncertainty of the status of “mini-blue” (apparently a name used by
Leonora Gloyd as she tried to sort out the taxonomy of this species group) suggests that this group needs more work to confirm the current taxonomic status of its members.
Metallic Clade
In the preliminary phylogeny of the North American Argia, the metallic species were not recovered as monophyletic (Caesar and Wenzel, 2009). However, in the expanded data matrix, these species are always a monophyletic clade. These species are characterized by having coppery-reddish coloration on the head, eyes and thorax and include Argia oenea, A. orichalcea, A. joergenseni, A. dunklei, A. dives, A. jocosa, A. limitata, A. cuprea and A. cupraurea. Several of these species were grouped in the subgenus Chalchargia because they share the character of having the a bifid apex of the
88 penis (Kennedy, 1920a), but that grouping included a number of species that are not closely related. It should be noted that the cupreous coloration was coded as a character in the preliminary phylogeny (Caesar and Wenzel, 2009) as well as in the expanded data matrix here. Thus, the monophyly of the metallic clade is supported by evidence independent of cuticular coloration, including the 16S sequence data and morphological characters of the cerci and mesostigmal plates.
The internal resolution of this clade is poor and varies according to analysis.
There is considerable variation in the cerci of species in this group, although A. orichalcea and A. oenea (sister species) are very similar. Argia dunklei and A. dives are recovered as sister species, and also have similar cerci, although there is a difference in the extent to which the apical margin is divided, with A. dives being more bifid and closer to the shapes of A. oenea, A. orichalcea and A. cupraurea (fig. 4.8).
The metallic clade is the sister to either A. insipida or the sister-pair of A. barretti plus A. harknessi. Garrison (1994) pointed out the similarities in a number of features between A. barretti and the metallic species A. oenea and A. cuprea and suggested that it was closely related to A. insipida and A. pipila. The cerci of A. barretti (fig. 4.7A) are similar to those of A. oenea (fig. 4.8.D), A. orichalcea (fig. 4. 8F) and A. cupraurea (fig
4.8A). Argia pipila is not included in this study, but A. insipida is recovered as sister to A. barretti plus A. harknessi and the metallic clade.
89
Argia fumipennis
In a preliminary phylogeny, A. pallens was found to be sister to A. fumipennins violacea based on 16S data, rendering A. fumipennis potentially paraphyletic (Caesar and
Wenzel, 2009). In the current study, the combined analyses find A. pallens to be sister to the three A. fumipennis subspecies, although the 16S data continue to support the previous relationship (fig. 4.2). Argia pallens was originally considered to be a subspecies or variant of A. fumipennis (Calvert, 1901). On the basis of cytological evidence, Kiauta and Kiauta (1980) hypothesized that A. f. violacea is the oldest of the three subspecies in the complex, with A. f. atra being the most derived. Bick and Bick
(1982) agreed, based on a combination of behavioral and geographic evidence. Neither of these studies employed a phylogenetic perspective to this problem, but their hypotheses are supported by the combined analysis (fig. 4.1).
Garrison (1994) pointed out that A. fumipennis is very similar to A. hinei, A. leonorae, A. agriodes, A. pallens, and A. nahuana on the basis of cercal morphology, and
Gloyd (1958) also discussed the extensive similarity between A. hinei and A. fumipennis violacea. The close relationship among these species is confirmed here. Argia bipunctulata is also included in this clade (fig. 4.1) and indeed has very similar cercus morphology to A. leonorae, A. pallens and A. fumipennis (fig. 4.9) despite having considerable differences in size and overall appearance. Argia fumipennis and A. violacea were united by Gloyd (1968b) after examination of more than 2000 male and female specimens yielded no morphological differences by which the two could be
90
distinguished. She also erected the subspecies A. fumipennis atra at that time, with the
main difference among the subspecies being wing pigmentation and range (A. f. atra is restricted to northern and central Florida, USA). Considering the high amount of variation in coloration and wing pigmentation in A. fumipennis and the conflicting findings here regarding the position of A. pallens relative to A. fumipennis, this clade needs further study across its range to confirm the existing taxonomy.
“Hyponeura” clade
Argia funcki and A. lugens have always been considered to be closely related based on a number of characters, including similarity in their penes, the thoracic patterns of females, the cerci, and in having an irregular row of cells between the first cubital vein and the margin of the wing (Gloyd, 1968a; Westfall and May, 1996). These two species were originally described in the genus Hyponeura, although apparently both Calvert
(1901) and Kennedy (1919b) informally considered them to be large species of Argia
(Gloyd, 1968a). Argia moesta has also been considered to be very closely related to A. funcki and A. lugens based on overall similarity in some morphological characters
(Gloyd, 1968a). In all phylogenetic analyses performed as part of this study, A. funcki and
A. lugens were recovered as sister species with strong support. The placement of A. moesta relative to this pair varies depending on analysis, although it was recovered as sister in some cases including the combined MP analysis. Ventral views of the right cerci of A. moesta and A. lugens are shown in fig 4.11.
91
Argia pulla complex
Rosser Garrison has informally proposed that Argia pulla, A. frequentula and A. gaumeri form a species group on the basis of having trilobed paraprocts and similarity in thoracic color patterns (personal communication). His hypothesis is supported by phylogenetic analysis, as a sister relationship between A. pulla and A. frequentula, with
A. gaumeri sister to the pair, was recovered in all analyses with high support values
(Bremer support = 3, fig. 4.1; bootstrap = 95, fig. 4.5). Kennedy (1920a) included all of these species in his subgenus Chalchargia, along with several other species that do not form a clade with the pulla complex including some members of the “”metallics” clade, on the basis of having the apex of the penis bifid. These species also share similarities in the female mesostigmal plates and cerci. The latter structure is broad and angulate with a distinctly divided apical margin, lacking a distinct sinus ventrally and with a decumbent medial tooth that is visible in lateral view. These species are sympatric in eastern and southern México, Belize and Guatemala and are difficult to distinguish without careful study. Further analysis of population structure and species boundaries among these would be useful to test the current taxonomy. Basal to this clade in phylogenetic analysis is another species found in eastern and northern México (extending into southwestern
Texas), A. rhoadsi, which has very different cerci.
92
Argia fissa clade
Two new species of Argia were described in 1996 and placed in a group including
Argia fissa (Garrison, 1996). Specimens of Argia fissa were not available for study here,
but A. anceps and A. westfalli are recovered as sister species in a clade that also includes
A. azula and A. sabino. Argia anceps, A. westfalli, and A. azula all have elongate cerci
with an undivided apical margin and a long and narrow ventral sinus (fig. 4.10). Females
of all three species also have large, foliate mesostigmal lobes (Garrison, 1996).
The grouping of Argia sabino and A. chelata with the fissa clade is based
primarily on molecular data, as the cerci of those two species are considerably different
from the fissa group and each other. Argia chelata has one of the most different cercus
morphologies in the genus, and its placement in all analyses has weak support. Clearly
more data is needed to confidently place A. chelata and A. sabino.
Argia tibialis clade
The Argia tibialis clade includes A. tibialis sister to a clade including A. apicalis
plus the sister pair of A. tarascana and A. tezpi. This relationship was found in the preliminary study on the North American Argia as well (Caesar and Wenzel, 2009) and is
found in all analyses performed here. These species have cerci that differ quite a bit from
each other. A. tezpi (fig. 4.13A) is very similar to A. sabino in morphology and overall
appearance (Garrison, 1994), although the molecular data does not group A. sabino in this
93
clade. Argia tibilais is a widespread species in the eastern United States, ranging from
Ontario in Canada to eastern Texas (Garrison, 1994; Westfall and May, 1996). The
cercus of this species is very distinctive (fig. 4.12C), with a broadly rounded apical
margin that is oriented in a lateral plane, and with a large thumb-like medial tooth. Much
of the range of A. tibialis is sympatric with that of A. apicalis, but not with A. tarascana
or A. tezpi.
vivda-plana-extranea
Argia vivida, A. plana, and A. extranea form a clade along with A. variabilis and
A. elongata with moderate support in all analyses. This finding is consistent with the
preliminary analysis of the genus (Caesar and Wenzel, 2009). Argia vivida and A. plana
were joined in the subgenus Heliargia on the basis of having the “internal fold of penis
small or wanting, terminal segment irregularly triangular or even with a short attenuate
tip. External fold present” (Kennedy, 1920a, p. 85), although there are noticeable
differences in penis morphology of the two species (Garrison, 1994) . Garrison (1994) also noted the similarity in these two widespread species; A. vivida is a color polymorphic species that occurs in western North America and is allopatric with A. plana, an eastern North American species. Argia vivida, A. plana, and A. extranea all have cerci that are intermediate between spatulate and having a distinct central ventral cavity, with angulate and undivided apical margins. Argia variabilis and A. elongata have
94 rather different cercus morphologies and resemble the type seen in A. azula, A. westfalli and A. anceps (fig. 4.10).
Other findings
The species Argia garrisoni was described in 1991 and was proposed to be closely related to A. calida based on morphological similarity (Daigle, 1991; Westfall and
May, 1996). Both species are found in the same areas and the primary differences between the two appear to be slight color variation and microhabitat differences. The phylogenetic analyses recover the two as sister. Considering the intraspecific variability in other species in color patterns and morphology, the sympatric ranges, and the sister relationship, these may represent a synonymy. An investigation of population genetic structure and further analysis of reproductive morphology is warranted. Argia ulmeca and
A. herberti are recovered as sister in these phylogenies, despite having great differences in the morphology of their cerci. Both species are restricted to southern México and
Central America (Förster, 2001) where they are sympatric. The definitive placement of these species as well as those that were unavailable for study here will require additional analyses performed with more data.
95
Morphological Characters in Taxonomy and Phylogeny
Published descriptions and keys of Argia species rely heavily on vague descriptive terms for the morphology of important structures such as cerci and paraprocts, upon which the taxonomy is primarily based. For example, the terms “bifid” and “trifid”, which mean “divided into two (or three, respectively) parts” (Torre-Bueno, 1985) are the most common words used to describe the shape of cerci and paraprocts. These terms seem rather objective, but their use is inconsistent and somewhat subjective in practice.
The description that accompanies Argia tezpi in Westfall and May (1996, p. 282) says that the cerci are “slightly emarginated, not bifid”, yet this structure is clearly divided, albeit to a slight degree (fig. 4.13), making use of bifid indeed appropriate. The emarginated nature of the cercus in dorsal view is not mutually exclusive from it being bifid. Further, the description of the paraprocts of A. bipunctulata uses the phrase “hardly bifid” (Westfall and May, 1996, p. 239). The use of subjective terminology in the description of morphological characters may be unavoidable, but the situation in odonate taxonomy seems excessive. Improvement will come from further critical examination by the scientific community and better images of key structures made widely available by the internet or other electronic means.
The morphological data upon which this phylogenetic analysis is based represents the first attempt at assembling a comprehensive and explicit matrix for the genus Argia.
As such, the characters and character states utilized here represent preliminary hypotheses of homology. Such hypotheses of morphological homology can only be tested
96
by cladistic analysis (in the absence of experiments on the development of the
morphological characters in questions across the genus). After cladistic analysis, the
evidence can be evaluated to ascertain whether the hypotheses of morphological homology are supported or not, and if so whether the homologies then represent plesiomorphy or apomorphy. Following initial tests of the hypotheses via cladistic analysis, the characters can then go through the process of being modified such that they represent new hypotheses of homology, which are then re-tested. This process of reciprocal illumination is central to the science of phylogenetic systematics and is the
best way of testing whether the data are coded appropriately and suitable for the level of
analysis of interest as well as how the results of phylogenetic analysis can be either
accepted or rejected based on the support in the form of evaluated homology statements.
The results of this study include preliminary tests of the homology of all new
characters and for all taxa that were added to the study since the 2009 paper on the North
American species of Argia (Caesar and Wenzel, 2009). It is also a further test of the
phylogenetic hypotheses reported in that paper. These characters provide structure for the
topology of combined analyses. The primary and secondary morphological structures of
male and female odonates are likely to provide additional phylogenetically-informative
data and should be explored further by odonate systematists.The phylogenetic hypotheses
presented here are now available for additional testing in various ways, and as such these
results advance the knowledge of the systematics of Odonata.
Although the taxon sampling for this study includes a considerable percentage of
the species diversity of Argia, since data collection began additional species have been
97
described (Garrison and von Ellenrieder, 2007; Meurgey, 2009, Gonzales-Soriano in press) and specialists estimate that at least twenty additional undescribed species are known (Garrison et al., 2010). Therefore, additional phylogenetic study of the genus including more taxa and character data is needed.
Implications of Phylogeny for Sexual Selection
It is not uncommon that generalizations are made regarding the mechanisms and processes which shape the evolution of reproductive phenotypes based on studies of
single or few species that are then extrapolated to more inclusive taxa (e.g. Hafernik and
Garrison, 1986; Hamilton and Montgomerie, 1989; Gorb, 1998; Sherratt and Forbes,
2001; Córdoba-Aguilar, 2003; Kauppinen and Mappes, 2003; Fincke et al., 2005;
Contreras-Garduno et al., 2008; Byers and Eason, 2009; Herrera et al., 2010; Harris et al.,
2011; Sanchez-Guillen et al., 2011). One of the more interesting results of this study is
that even within a single genus, the mechanisms of evolution that shape character systems
may vary considerably. The clade that includes Argia tibialis, A. apicalis, A. tezpi and A.
tarascana fits the predictions of character displacement by lock and key for species
recognitions and the maintenance of prezygotic reproductive isolation. The clade that
includes A. leonorae, A. pallens and the three A. fumipennis subspecies, on the other
hand, suggests that the characters measured maintain phylogenetic inertia and have not
evolved explicitly for species recognition or the reinforcement of reproductive barriers to
gene flow.
98
A popular hypothesis in recent sexual selection literature is that the evolution of
sexual phenotypes may be driven by sexually antagonistic coevolution (Arnqvist and
Rowe, 2002a; Rowe and Arnqvist, 2002; Cordero and Eberhard, 2005; Bergsten and
Miller, 2007; McPeek et al., 2008). Ample evidence to support this hypothesis exists for some species of aquatic Hemiptera (Arnqvist and Rowe, 2002b; Arnqvist and Rowe,
2002a; Rowe and Arnqvist, 2002) and Coleoptera (Bergsten and Miller, 2007). These organisms have some features in common with Odonata, including elaborate and variable secondary sexual morphology. The data collected for the current study do not suggest that sexual conflict has driven the evolution of male-female differences in reproductive morphology for Argia. Conversely, the data suggest that compensatory cooperative changes have for the most part occurred, allowing males and females to have greater success in attempts to establish tandem linkage and subsequent copulation. This lends support to the suggestion of Eberhard (Eberhard, 1985; Eberhard, 1986; Eberhard, 2004a;
Eberhard, 2004b) that female choice plays a greater role in driving the diversity of secondary sexual characters in Argia.
Consider A. emma as the most obvious example. The male cerci are curved outward laterally in a way not seen in any other Argia species (fig. 4.12B). These cerci come into contact with the female mesepisternal tubercles (fig. 2.1), which are more prominent than in any other Argia. Rather than serving to dislodge the male’s grasp, the female seems to provide a place for the male to hold on to.
While this pattern may not be widely applicable across Odonata, it makes sense that those species for which scramble competition among males for access to mates exists
99 might show this type of cooperative compensatory evolution. Mating itself can cause damage to females, and repeated attempts to engage in tandem linkage as a result of many males aggressively interacting with females over and over again may increase the chances for damage. If females hedge their bets and simply comply with the courtship of the first appropriate conspecific male, then her chances of successful oviposition may increase. Note that this may seem like the situation described under convenience polyandry, but that system requires that the fitness of females does not benefit, which need not be true. Given that some female odonates can store sperm from multiple matings and potentially differentially fertilize eggs as they exit the oviduct (Siva-Jothy and
Hooper, 1996), she may benefit from simply mating multiple times and then choosing paternity during oviposition. Argia males often remain in tandem linkage or nearby the female during oviposition, presumably to prevent additional matings; but if the female has already mated and is influencing paternity internally, a guarding male would be unable to detect her actions and thus cannot guarantee his own reproductive success. Of course, much of this is speculative and additional experiments are needed to provide further support for this hypothesis, but it is nonetheless supported by the patterns revealed here.
Conclusions
This chapter presents the results of a phylogenetic analysis of the the genus Argia
(Odonata: Coenagrionidae) based on molecular and morphological data and parsimony
100
and likelihood methods. The results of separate and combined analyses under both
optimality criteria are largely congruent. Monophyly of the genus is well-supported. New
morphological characters provide phylogenetic information that contributes to the
resolution of topologies that result from combined MP analysis.
Argia translata, the most widespread species in the genus, is found to be most
basal of all species. Several clades of interest are recovered as monophyletic with strong
support, including the “metallics”, the oculata group, and the “hyponeura” species. The
placement of several species remains uncertain, including A. emma, A. nahuana, A.
concinna, and A. tibialis. This study raises some doubt about the validity of several
species including A. pallens and A. garrisoni. Further phylogenetic data and additional analyses will be needed as well as studies of population variation within several species
to clarify some taxonomic questions in the genus.
Some popular hypotheses regarding the potential role of sexual selection in damselflies are evaluated with regard to the phylogeny of Argia. While definitive conclusions cannot be drawn at this time, there is some suggestion that the role of sexual selection versus natural selection processes is variable within the genus. Some clades seem to match the predictions of sexual selection with regard to variation in male secondary sexual morphology, while others do not. If further study can verify this situation, it would be one of the first documented examples of the differential effects of sexual selection within a genus of Odonata.
101
Table 4.1: Table of support values for selected clades. Values are reported for the separate and combined data sets analyzed by MP and ML.
Data Partition and Optimality Criterion Clade 16S ML 16S MP Combined MP Bootstrap Jackknife Bremer Support Argia 95 97 10 “Hyponeura”clade 100 100 9 Metallic clade 15 81 3 “South American” clade 70 - 1 “oculata group” 73 77 3 pallens + fumipennis 80 82 3 Argia fumipennis subspecies - - 1 vivida-plana-extranea 72 86 3 westfalli-azula-anceps 100 99 10 Argia pulla clade 100 99 3 Argia fissa clade 94 84 4 apicalis-tezpi-tarascana 100 100 12 Argia tibialis clade 97 94 8 garrisoni + calida 100 99 8
102
103
Figure 4.1: One of 11 equally parsimonious tree of 1,520 steps based on the combined data set. Numbers above branches are Bremer Support Values. Some of the clades discussed in the text are highlighted with colors and labeled.
103
Figure 4.2: Strict consensus of 11 equally parsimonious trees of length 1,520 from MP analysis of the combined data.
104
105
Figure 4.3: One of 10 equally parsimonious trees of 1092 steps from analysis of 16S data. Colors indicate some clades discussed in the text
105
Figure 4.4: Strict consensus of 10 equally parsimonious trees of length 1092 from analysis of 16S data.
106
Figure 4.5: ML tree of 16S data with bootstrap values for each node.
107
Figure 4.6: Ventral view of right cerci of A) Argia eliptica B) A. difficilis and C) A. oculata. Images are models based on CT scans.
108
Figure 4.7: Ventral view of right cerci of A) Argia barretti B) A. ulmeca and C) A. herberti. Images are models based on CT scans.
109
Figure 4.8: Ventral view of right cerci of some species in the "metallics" clade: A) Argia cupraurea B) A. dunklei C) A. joergenseni D) A. oenea E) A. dives F) A. orichalcea. Images are models based on CT scans.
110
Figure 4.9: Ventral view of right cerci of A) Argia bipunctulata B) A. leonorae C) A. fumipennis and D) A. pallens. Images are models based on CT scans.
111
Figure 4.10 Ventral view of right cerci of A) Argia azula B) A. anceps and C) A. westfalli. Images are models based on CT scans.
Figure 4.11: Ventral view of right cerci of A) Argia lugens and B) A. moesta. Images are models based on CT scans
112
.
Figure 4.12: Ventral view of right cerci of A) Argia translata B) A. emma and C) A. tibialis. Images are models based on CT scans
113
Figure 4.13: Ventral view of right cerci of A) Argia tezpi B) A. tarascana and C) A. apicalis. Images are models based on CT scans
114
References
Abbott, J. C. 2005. Dragonflies and Damselflies of Texas and the South-Central United
States : Texas, Louisiana, Arkansas, Oklahoma, and New Mexico. Princeton
University Press, Princeton, N.J., USA.
Altschul, S. F., Gish, W., Mysers, E. W., Lipman, D. J. 1990. Basic local alignment
search tool. Journal of Molecular Biology 215, 403-410.
Arnqvist, G., Rowe, L. 2002a. Antagonistic coevolution between the sexes in a group of
insects. Nature 415, 787-789.
Arnqvist, G., Rowe, L. 2002b. Correlated evolution of male and female morphologies in
water striders. Evolution; international journal of organic evolution 56, 936-947.
Bergsten, J., Miller, K. B. 2007. Phylogeny of Diving Beetles Reveals a Coevolutionary
Arms Race between the Sexes. PLoS ONE 2, e522.
Bick, G. H., Bick, J. C. 1965. Color variation and significance of color in reproduction in
the damselfly, Argia apicalis (Say) (Zygoptera: Coenagriidae (sic)). Canadian
Entomologist 97, 32-41.
Bick, J. C., Bick, G. H. 1982. Behavior of adults of dark-winged and clear-winged
subspecies of Argia fumipennis (Burmeister)(Zygoptera: Coenagrionidae).
Odonatologica 11, 99-107.
Bybee, S. M., Ogden, T. H., Branham, M. A., Whiting, M. F. 2008. Molecules,
morphology and fossils: a comprehensive approach to odonate phylogeny and the
evolution of the odonate wing. Cladistics 23, 1- 38.
115
Byers, C. J., Eason, P. K. 2009. Conspecifics and Their Posture Influence Site Choice and
Oviposition in the Damselfly Argia moesta. Ethology 115, 721-730.
Caesar, R. M., Gillete, N., Cognato, A. I. 2005. Population genetic structure of an
edaphic beetle (Ptiliidae)among late successional reserves within the Klamath-
Siskiyou ecoregion, California. Annals of the Entomological Society of America
98, 931-940.
Caesar, R. M., Wenzel, J. W. 2009. A phylogenetic test of classical species groups in
Argia (Odonata: Coenagrionidae). Entomologica Americana 115, 97-108.
Calvert, P. P. 1901. Odonata. In: XX (Ed.) Biologia Centrali Americana: Insecta
Neuroptera. R.H. Porter and Dulau Co., London, UK, pp. XX.
Carle, F. L., Kjer, K. M., May, M. L. 2008. Evolution of Odonata, with special reference
to Coenagrionoidea (Zygoptera). Arthropod Systematics and Phylogeny 66, 37-
44.
Conrad, K. F., Pritchard, G. 1988. Female dimorphism and physiological colour change
in the damselfly Argia vivida Hagen (Odonata: Coenagrionidae). Canadian
Journal of Zoology 67, 298-304.
Contreras-Garduno, J., Cordoba-Aguilar, A., Peralta-Vazquez, H., Jimenez-Cortes, J. G.,
Luna-Gonzalez, A., Campa-Cordova, A. I. 2008. Differences in immune ability
do not correlate with parasitic burden in two zygoptera species (Calopterygidae,
Coenagrionidae). Odonatologica 37, 111-118.
116
Cordero, C., Eberhard, W. G. 2005. Interaction Between Sexually Antagonistic Selection
and Mate Choice in the Evolution of Female Responses to Male Traits.
Evolutionary Ecology 19, 111-122.
Córdoba-Aguilar, A. 2003. Predicting mechanisms of sperm displacement based on
genital morphometrics in the Calopterygidae (Odonata). Journal of Insect
Behavior 16, 153-167.
Costa, J. M., Ravanello, C. T., Souza-Franco, G. M. 2008. The larva of Argia
croceipennis Selys (Zygoptera: Coenagrionidae). Odonatologica 37, 265-271.
Daigle, J. J. 1991. Argia garrisoni spec. nov. from Mexico (Zygoptera: Coenagrionidae).
Odonatologica 20, 337-342.
Daigle, J. J. 1995. Argia carlcooki spec. nov. from Mexico (Zygoptera: Coenagrionidae).
Odonatologica 24, 467-471.
De Marmels, J. 2007. Thirteen new Zygoptera larvae from Venezuela (Calopterygidae,
Polythoridae, Pseudostigmatidae, Platystictidae, Protoneuridae, Coenagrionidae).
Odonatologica 36, 27-51.
Eberhard, W. G. 1985. Sexual Selection and Animal Genitalia. Harvard University Press,
Cambridge, MA, USA.
Eberhard, W. G. 1986. Female Control: Sexual Selection by Cryptic Female Choice.
Princeton University Press, Princeton, NJ, USA.
Eberhard, W. G. 2004a. Male-female conflict and genitalia: failure to confirm predictions
in insects and spiders. Biological Reviews 79, 121-186.
117
Eberhard, W. G. 2004b. Rapid divergent evolution of sexual morphology: comparative
tests of antagonistic coevolution and traditional female choice. Evolution;
international journal of organic evolution 58, 1942-1970.
Edgar, R. C. 2004. MUSCLE: a multiple sequence alignment method with reduced time
and space complexity. BMC bioinformatics 5, 113.
Fincke, O. M. 1994. Female colour polymorphism in damselflies: failure to reject the null
hypothesis. Animal Behaviour 47, 1249-1266.
Fincke, O. M., Jödicke, R., Paulson, D. R., Schultz, T. D. 2005. The evolution and
frequency of female color morphs in Holarctic Odonata: why are male-like
females typically the minority. International Journal of Odonatology 8, 183-212.
Förster, S. 2001. The dragonflies of Central America exclusive of Mexico and the West
Indies. Gunnar Rehfeldt, Wolfenbüttel, Germany.
Fukatsu, T. 1999. Acetone preservation: a practical technique for molecular analysis.
Molecular Ecology 8, 1935-1945.
Garrison, R. W. 1994. A synopsis of the genus Argia of the United States with keys and
descriptions of new species, Argia sabino, A. leonorae, and A. pima (Odonata:
Coenagrionidae). Transactions of the American Entomological Society 120, 287-
368.
Garrison, R. W. 1996. A synopsis of the Argia fissa group, with descriptions of two new
species, A. anceps sp. n. and A. westfalli sp. n. (Zygoptera: Coenagrionidae).
Odonatologica 25, 31-47.
118
Garrison, R. W., von Ellenrieder, N. 2007. The true Argia difficilis Selys, 1865, with the
description of Argia yungensis sp. nov. (Odonata: Coenagrionidae). Transactions
of the American Entomological Society 133, 189-204.
Garrison, R. W., von Ellenrieder, N., Louton, J. A. 2010. Damselfly Genera of the New
World. Johns Hopkins University Press, Baltimore, MD, USA.
Gloyd, L. K. 1958. The dragonfly fauna of the Big Bend region of Trans-Pecos Texas.
Occasional Papers of the University of Michigan Museum of Zoology 658.
Gloyd, L. K. 1968a. The synonomy of Diargia and Hyponeura with the genus Argia
(Odonata: Coenagrionidae: Argiinae). The Michigan Entomologist 1, 271-274.
Gloyd, L. K. 1968b. The union of Argia fumipennis (Burmeister, 1839) with Argia
violacea (Hagen, 1861), and the recognition of three subspecies (Odonata).
Occasional Papers of the University of Michigan Museum of Zoology.
Goloboff, P. A., Farris, J. S., Nixon, K. C. 2008. TNT, a free program for phylogenetic
analysis. Cladistics 24, 774-786.
Gorb, S. N. 1998. Visual cues in mate recognition by males of the damslefly, Coenagrion
puella (L.) (Odonata: Coenagrionidae). Journal of Insect Behavior 11, 73-92.
Guillermo-Ferreira, R., Del-Claro, K. 2011. Territoriality and male-biased sexual size
dimorphism in Argia reclusa (Odonata: Zygoptera). acta ethologica 15, 101-105.
Hafernik, J. E., Garrison, R. W. 1986. Mating success and survival rate in a population of
damselflies: results at variance with theory? The American Naturalist 128, 353-
365.
119
Hamilton, L. D., Montgomerie, R. D. 1989. Population demography and sex ratio in a
neotropical damselfly (Odonata: Coenagrionidae) in Costa Rica. Journal of
Tropical Ecology 5, 159-171.
Harris, W. E., Forman, D. W., Battell, R. D., Battell, M. T., Nelson, A. K., Brain, P. F.
2011. Odonata colour: more than meets the eye? International Journal of
Odonatology 14, 281-289.
Herrera, M. S., Realpe, E., Salazar, C. 2010. A neotropical polymorphic damselfly shows
poor congruence between genetic and traditional morphological characters in
Odonata. Mol Phylogenet Evol 57, 912-917.
Hoekstra, J. D., Smith, R. L. 1999. Descriptions of the final instar larvae of Argia sabino
Garrison and Argia pima Garrison (Odonata: Coenagrionidae). Proceedings of the
Entomological Society of Washington 101, 887-896.
Kauppinen, J., Mappes, J. 2003. Why are wasps so intimidating: field experiments on
hunting dragonflies (Odonata: Aeshna grandis). Animal Behaviour 66, 505-511.
Kennedy, C. H. 1918. New species of Odonata from the southwestern United States. Part
I. Three new Argias. Canadian Entomologist 50, 256-261.
Kennedy, C. H. 1919a. A new species of Argia (Odonata). Canadian Entomologist 51,
17-18.
Kennedy, C. H. 1919b. The Phylogeny of the Zygoptera. Entomology. Cornell.
Kennedy, C. H. 1920a. Forty-two hitherto unrecognized genera and subgenera of
Zygoptera. The Ohio Journal of Science 21, 83-88.
120
Kennedy, C. H. 1920b. The phylogeny of the zygopterous dragonflies as based on the
evidence of the penes. The Ohio Journal of Science 21, 19-32.
Kiauta, B., Kiauta, M. A. J. E. 1980. Introduction to the cytotaxonomy of the odonate
genus Argia (Zygoptera: Coenagrionidae). Odonatologica 9, 35-56.
Logan, J. A. 1999. Extraction, polymerase chain reaction, and sequencing of a 440 base
pair region of the mitochondrial cytochrome oxidase I gene from two species of
acetone-preserved damselflies (Odonata: Coenagrionidae, Agrionidae).
Environmental Entomology 28, 143-147.
May, M. L. 1976. Physiological color change in New World damselflies (Zygoptera).
Odonatologica 5, 165-171.
McPeek, M. A., Shen, L., Torrey, J. Z., Farid, H. 2008. The tempo and mode of three-
dimensional morphological evolution in male reproductive structures. The
American Naturalist 171, E158-178.
Meurgey, F. 2009. Redescription of Argia concinna (Rambur), with a description of
Argia telesfordi spec. nov. from Grenada, West Indies (Zygoptera:
Coenagrionidae). Zootaxa 2272, 54-62.
Meurgey, F. 2011. Redescription of the larva of Argia concinna (Rambur) witht he
description of that of A. telesfordsi Muergey from the West Indies (Zygoptera:
Coenagrionidae). Odonatologica 40, 45-50.
Miller, M. A., Pfeiffer, W., Schwartz, T. 2010. Creating the CIPRES Science Gateway
for inference of large phylogenetic trees. Proceedings of the Gateway Computing
Environments Workshop (GCE) New Orleans, LA, USA.
121
Misof, B., Anderson, C. L., Hadrys, H. 2000. A Phylogeny of the Damselfly
Genus Calopteryx (Odonata) Using Mitochondrial 16S rDNA Markers. Mol
Phylogenet Evol 15, 5-14.
Nixon, K. C. 2000. WinClada. Nixon, K.C., Ithaca, New York, NY, USA.
Novelo-Gutiérrez, R. 1992. Biosystematics of the larvae of the genus Argia in Mexico
(Zygoptera: Coenagrionidae). Odonatologica 21, 39-71.
Novelo-Gutiérrez, R., Gómez-Anaya, J. A. 2006. A description of the larva of Argia
funcki (Selys, 1854) (Odonata : Zygoptera : Coenagrionidae). Proceedings of the
Entomological Society of Washington 108, 261-266.
O'Grady, E. W., May, M. L. 2003. A phylogenetic reassessment of the subfamilies of
Coenagrionidae (Odonata: Zygoptera). Journal of Natural History 37, 2807-2834.
Pritchard, G. 1982. Life-history strategies in dragonflies and the colonization of North
America by the genus Argia (Odonata: Coenagrionidae). Advances in
Odonatology 1, 227-241.
Rehn, A. C. 2003. Phylogenetic analysis of higher-level relationships of Odonata.
Systematic Entomology 28, 181-239.
Rowe, L., Arnqvist, G. 2002. Sexually antagonistic coevlution in a mating system:
combining experimental and comparative approaches to address evolutionary
processes. Evolution; international journal of organic evolution 56, 754- 767.
Sanchez-Guillen, R. A., Wellenreuther, M., Cordero-Rivera, A., Hansson, B. 2011.
Introgression and rapid species turnover in sympatric damselflies. BMC
evolutionary biology 11, 210.
122
Sherratt, T. N., Forbes, M. R. 2001. Sexual differences in coloration of Coenagrionid
damselflies (Odonata): a case of intraspecific aposematism? Animal Behaviour
62, 653-660.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P. 1994. Evolution,
weighting, and phylogenetic utility of mitochondrial gene sequences and a
compilation of conserved polymerase chain reaction primers. Annals of the
Entomological Society of America 87, 651-701.
Siva-Jothy, M. T., Hooper, R. E. 1996. Differential use of stored sperm during
oviposition in the damselfly Calopteryx splendens xanthostoma (Charpentier).
Behavioral Evology and Sociobiology 39, 389-393.
Stamatakis, A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic
analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688-
2690.
Tennessen, K. J. 2002. Argia rosseri sp. nov. from central Bolivia (Odonata:
Coenagrionidae). International Journal of Odonatology 5, 99-104.
Torre-Bueno, J. R. 1985. A Glossary of Entomology. New York Entomological Society,
New York, NY, USA.
Von Ellenrieder, N. 2007. The larva of Argia joergenseni Ris (Zygoptera:
Coenagrionidae). Odonatologica 36, 89-94.
Walker, E. M. 1953. The Odonata of Canada and Alaska. University of Toronto Press,
[Toronto].
123
Westfall, M. J. 1990. Descriptions of larvae of Argia munda Calvert, Argia plana
Calvert, Argia tarascana Calvert and Argia tonto Calvert (Zygoptera:
Coenagrionidae). Odonatologica 19, 61-70.
Westfall, M. J., May, M. L. 1996. Damselflies of North America. Scientific Publishers,
Gainsville, FL, USA.
124
Chapter 5 : Geographic Variation in Mitochondrial DNA and Reproductive
Morphology in Argia moesta
Introduction
In sexually reproducing animals, reproductive isolation among groups is the
foundation of the biological species concept (Mayr, 1942). Prezygotic reproductive
isolation is often attributed to the inability of copulation to occur between otherwise
similar or closely-related species because of mismatches in the primary and secondary
sexual structures (including genitalia and associated accessory structures). Observation of
species-specific morphology in some animal taxa led to a now classic hypothesis of
evolution that predates Darwinian thinking, "lock-and-key" species recognition (Dufour,
1844), or mechanical isolation. This hypothesis relies on the idea that genitalia vary between, but not within, species, and states that an exact match between male and female reproductive structures is required for successful copulation. Conversely, lack of a mechanical match constitutes a reproductive barrier. Such barriers are thought to be reinforced by natural selection at the time of speciation (McPeek et al., 2008) and upon subsequent contact between related, potentially hybridizing species (the latter situation is termed “reinforcement” or “reinforcing selection”: Howard, 1993). Terrestrial arthropods
125
are thought to have external morphology that changes little during the adult lifespan due
to the hardened cuticle that serves as exoskeleton. As such, mechanical isolation is
potentially an important hypothesis that explains some of the tremendous morphological
and taxonomic diversity of insects. Alternatively, one of several selective forces may act on reproductive phenotypes in such a way that intraspecific variation is high, whether by
female choice, male competition, antagonistic coevolution, or some combination thereof
(collectively, sexual selection). These areas of inquiry form the basis of major research
programs in evolutionary biology (e.g. Eberhard, 1985; Eberhard, 1986; Howard, 1993;
Fincke et al., 1997; Rowe and Arnqvist, 2002).
Both interspecific mechanical isolation and intraspecific sexual selection are
frequently invoked to explain reproductive phenotype variation among related taxa
(Eberhard, 1985). Discriminating among these competing paradigms of sexual character
evolution is difficult and requires a broad, comparative approach. The two offer various
alternative predictions regarding the variability of morphological structures that are involved in copulation. Mechanical isolation is an absolute criterion, whereby any male that meets the standard is acceptable for copulation, and all who fail are rejected. This threshold defines the borders of species, so confirmation of conspecific status must be rapid and reliable to avoid a reduction in fitness. When there are similar species whose mating behavior features scramble competition for access to mates, such as in geographical regions where sympatry among congeners is high, character displacement is expected to reinforce the efficacy of mechanical isolation. Thus, mechanical isolation makes two testable predictions:
126
1) closely related species should show greater differences in their sexual
morphology in sympatry than in allopatry, and
2) without such displacement, individuals should be relatively invariant across the
range of the species.
In contrast, sexual selection emphasizes discrimination among conspecifics only.
This is a kind of directional selection that has no necessary reference to other species.
There may be a fitness benefit achieved when testing the boundaries of the system. Thus, sexual selection makes two predictions that contrast with those of mechanical isolation:
1) closely related species should show no pattern in variation when in sympatry
versus allopatry, and
2) intraspecific geographic variation should be apparent as local preferences
evolve.
Clarification of the puzzle presented here poses two general challenges. One is that a robust phylogenetic hypothesis for species under study is necessary. A phylogenetic perspective is implicit in discussions of the origin and maintenance of complex mating biology (e.g. Fincke, 1997; Misof, 2002). A phylogenetic hypothesis allows candidate species groups that may show meaningful patterns of change in the sexual characters of both sexes to be identified. The second is that these lineages must then be intensely studied across their ranges in order to assess whether apparent
127 correlated change is constrained by phylogeny, shaped by sexual selection, or both. This chapter emphasizes this second approach, the study of a widespread species across its range from a phylogeographic and morphometric approach.
Variation in molecular markers should reveal populations that represent similar genetic history across a wide geographical region, and also differing genetic history within a more local area. Distinct evolutionary lineages within the species may be revealed by examining patterns of mtDNA variation across the species range. The goal is to compare morphological and genetic variation at both broad and fine geographic scales, and under differing degrees of sympatry. A widespread species for which mechanical isolation applies may exhibit greater morphological differences between populations that also differ genetically, because genetically distinct populations likely have experienced limited gene flow. If morphological variation does not match genetic variation either within or between populations, then the mechanical isolation hypothesis is not supported.
A critical initial step is to find populations that reflect slight, but detectable, differences in genetic background.
Damselflies have become model organisms for studies of sexual selection and morphological evolution due to their unique reproductive biology, relative abundance, and ease of study. Argia Rambur is a species-rich genus of large-bodied coenagrionid damselflies native to the Americas that inhabit open and sunny streams and rivers and adjacent riparian habitats. Argia moesta (Hagen) is a common and widespread species, ranging from southeastern Canada to at least the southern Mexico state of Jalisco
(Westfall and May, 1996). Although they are flying insects as adults, and flight frequency
128
is high, individuals do not fly far and generally remain close to their juvenile habitats, with limited up- or down-stream movement (Borror, 1934).
Throughout its range, A. moesta is sympatric to varying degrees with many other
species of Argia. Across the eastern United States and Canada, it is sympatric with no
more than six other Argia, whereas in other parts of its range, it can be sympatric with as
many as 22 congeners (Garrison, 1994). Closely-related and morphologically-similar
species of damselflies are known to attempt heterospecific copulation (Paulson, 1974;
Bick and Bick, 1981), and thus there is opportunity for mismatching during mating
attempts. Mechanical isolation predicts that the degree of morphological uniformity in
reproductive structures should correlate with the potential frequency of contact between
members of closely related congeners (Eberhard, 1985). It cannot be known whether
observed character differences in sympatic populations evolved in sympatry. By studying
a species that has many populations that differ in their degree of sympatric overlap with congeners across its range, it may be possible to tease apart this confounding effect. An excellent opportunity to fulfill this kind of test case is found in Argia moesta. Populations in different parts of its range may experience different selection pressures, including those that may act on reproductive morphology. If mechanical isolation operates, then there is more morphological space available to A. moesta when there are few congeners present, whereas genital morphology would have to be greatly restricted to perform recognition properly when there are many congeners present. Thus, morphological variance should be higher among populations in the eastern USA. By contrast, sexual selection requires no such relationship.
129
Argia moesta shows some limited morphological variation across its range, and females exhibit color polymorphism (Dunkle, 1990). In Florida, females have a black thoracic stripe that is apparently lacking in the rest of the species range (Dunkle, 1990).
This color variation led some authors to describe variants of moesta as the species intruda
Williamson and putrida (Hagen) (Westfall and May, 1996). In terms of gross morphology, A. moesta is most similar to another large species that is found in the southwest USA and northern Mexico, A. lugens (Hagen) (Westfall and May, 1996;
Abbott, 2005); moesta is recovered as sister to the strongly supported monophyletic species pair of lugens + funcki (Selys) in combined phylogenetic analyses (fig. 4.1).
There is also evidence that the morphology of male secondary sexual structures, such as the cerci and paraprocts (collectively, the “claspers” used to grasp females during copulation) may vary geographically (Figs. 5.1, 5.2), which is not consistent with the mechanical isolation hypothesis.
Study of intraspecific variation in a widespread species should provide an excellent case for testing hypotheses such as mechanical isolation in nature. This chapter presents the results of two approaches to assessing the intraspecific variation of A. moesta: 1) a morphometric study of the cerci and other primary and secondary sexual structures, and 2) a study of population genetic variation using two molecular markers.
The following hypotheses are tested:
Mechanical isolation: If variation is explained by mechanical isolation, A.
moesta must show relative uniformity across its range, or variation among
130
populations should reflect lines of descent that match isolation-by-distance
predictions of variation.
Sexual selection: If sexual selection produces novelty through competition
among conspecific rivals, then variation has no relationship with geography or
descent, or with the number of congeners in potential competition; some regions
should show greater difference due to differing intensity of sexual selection.
Both mechanical isolation and sexual selection operate differentially in
different populations: populations vary, but character displacement may canalize
variation in populations with more sympatric species bounding the morphospace,
limiting male variation; populations with few sympatric species are free to vary
more.
Materials and Methods
Taxon Sampling
Specimens of A. moesta from across North America were obtained from recent collections as well as loans and donations from the International Odonata Research
Institute (IORI; Gainesville, Florida, USA). A total of eight populations in the eastern and central United States, from New York, Ohio, central Texas (Kerr, Burnett, Coryell
131
counties), east Texas (Brazos county), Utah, and Florida are included (Table 5.2).
Generally, adult specimens were collected using aerial nets, submerged in acetone to kill and rapidly dry tissue for color preservation, and then dried and transferred to cellophane envelopes for storage. In a few cases freshly collected specimens were used that had been immediately deposited into 100% ethanol for long term storage.
All specimens were collected within the previous twenty years to maximize chances of successfully extracting mitochondrial DNA. Populations were chosen based on availability of multiple specimens (Table 5.1) and for which specimens for morphological analysis were available. Sampling for this study was limited by low success rates in extracting and amplifying DNA from dried museum specimens, but does include samples from a large representative area of the geographic range of the species.
DNA Sequences
Extraction of genomic DNA and amplification of the mtDNA ribosomal gene 16S by the polymerase chain reaction (PCR) follow the methods outlined in Caesar and
Wenzel (2009). Cytochrome oxidase I (COI) was amplified by PCR using the primers
COIF/COIR and the following reaction parameters: denaturation at 94°C for 2 min, hold
at 80ºC for 1 min (hot start), another denaturation at 94ºC for 2 min, 40 cycles of [94°C
for 1 min, 51°C for 1 min, extension at 65°C for 1 min], and final extension at 65°C for 6
min.
132
Sequences were generated using the commercial sequencing services offered by
the Plant-Microbe Genomics Facility at Ohio State University (Columbus, Ohio, USA)
and Beckman-Coulter Genomics (formerly Cogenics; Houston, TX, USA).
Electropherograms of sequences were edited using the software package Sequencher 4.1
(Gene Codes Corp., Ann Arbor, Michigan, USA). The Basic Local Alignment Search
Tool (BLAST; Altschul et al., 1990) tool of GenBank (National Center for Biotechnology
Information, Bethesda, MD, USA) was used to verify identity of sequences and eliminate
the possibility of contaminants or misidentified specimens. Sequences of 16S and COI
have been deposited at GenBank, accession numbers provided in Table 5.1.
Sequences were assembled into a data matrix using Mesquite (Maddison and
Maddison, 2010) and then aligned by ClustalW (Thompson et al., 1994) using 1:1 gap
opening: extension costs as implemented through the CIPRES portal (Miller et al., 2010).
Differences among sequences were minimal and alignment was straightforward for both gene regions.
Phylogenetic Analysis
Population genetic structure across part of the range of A. moesta was estimated by phylogenetic analysis of variation in two molecular markers. We used phylogenetic analysis to infer the relationships among 16S and COI haplotypes under the maximum parsimony (MP) and maximum likelihood (ML) optimality criteria. Mesquite (Maddison and Maddison, 2010) and WinClada (Nixon, 2000) were used to assemble morphological
133
and combined data matrices for phylogenetic analysis. Sequences were analyzed
separately in a parsimony framework (Fig. 5.3) by NONA and WinClada (Nixon, 2000),
and likelihood (Fig. 5.4) using Garli (Zwickl, 2006). A haplotype from Argia lugens
(Selys) was used to root the trees for outgroup comparison due to its close relationship
with A. moesta. Relative support for internal clades was assessed using the bootstrap
under standard parameters.
Morphological Analysis
Variation in right cercus morphology was quantified for males from different
populations. The cerci of male Odonata are part of the clasper apparatus used to grasp
females during the copulation process and subsequent tandem oviposition and are thus
considered to be secondary sexual characters potentially subject to the forces of sexual
selection. Cerci are paired structures of appendicular origin (Snodgrass, 1935; Torre-
Bueno, 1985) that attach dorsally and apically of the terminal abdominal segment ten,
and thus the right and left side are considered to be identical but mirrored structures
(McPeek et al., 2008; McPeek et al., 2009); choice of the right cercus was arbitrary. The cerci were emphasized here rather than the paraprocts (also part of the clasper complex) because they appear to be more variable across the genus than the paraprocts.
Specimens were chosen due to their availability in sufficient number from the material on hand for DNA extraction as well as the semi-destructive sampling necessary for three dimensional imaging by computer tomography (CT). The abdomen of each
134
specimen was removed at segment seven (approximately) and mounted in modeling clay
on a brass stem. Terminal abdominal segments were scanned by CT on a SkyScan 1172
high-resolution micro-CT scanner (SkyScan®, Kontich, Belgium). For each specimen,
scans were taken through 180º, rotating 0.7º per frame (averaging three frames) at a pixel
resolution of 2.5 µm (15.6 µm3 voxel resolution). Each scan represents a two dimensional
slice through the specimen, and scans were converted to digital images by Nrecon v.
1.4.4 (SkyScan®, Kontich, Belgium).
Image processing was done in the Ohio State University Sports Biomechanics
Laboratory (Department of Orthopaedics, College of Medicine, Columbus, Ohio, USA).
The stacks of digital scans were processed using AMIRATM v. 5.2 (Visage Imaging Inc.,
Andover, MA, USA). During image processing all voxels (3-D analog of pixels, individual points in two dimensional space that collectively form an image) associated with the right cercus of each specimen were identified and isolated from the total scan of the tenth abdominal segment and associated appendages. High-resolution triangular mesh surface models were constructed for each cercus, which was then reduced to 10, 000 triangles (5002 vertices) for computational ease.
Seven landmarks were manually positioned on the 3-D surfaces (Fig. 5.5). All cerci were standardized based on distance between landmarks to ensure that shape was the primary difference between specimens (and not size). Multivariate analysis of shape difference was performed using Spherical Harmonics Analysis as implemented by the
SPHARM package of code (Shen et al., 2009) in MatLab v. r2009b (The Mathworks,
Inc., Natick, MA, USA); SPHARM is available for download at
135 http://www.enallagma.com/spharm/php/. Results were then analyzed further by Principal
Component Analysis (PCA) to visualize the major axes of variation in cercus shape. The principal components are extracted from the spherical harmonic coefficients as part of the
SPHARM procedure implemented via Matlab (McPeek et al., 2011).
Results
Population structure/ Phylogenetic analysis
After sequencing, editing and alignment of 16S and COI, 519 base pairs of 16S and 640 base pairs of COI were included in data matrices for phylogenetic analysis.
Several distinct clusters are recovered from the phylogenetic analysis of sequences, and these reflect a combination of isolation by distance and geographic barriers. Based on the more extensive 16S data, three distinct metapopulations are identified: Northeast,
Western upland, and Gulf coastal plains (Figs. 5.3 & 5.4). A specimen from east Texas groups with those of Florida, and not nearer central Texas populations, which suggests that there may be a metapopulation that corresponds to the Gulf of Mexico coastal plain.
This distributional pattern matches that of several freshwater aquatic organisms (Avise,
1992). The results are similar for both MP and ML and for both genes examined.
136
Morphological Analysis
Figure 5.2 shows representative reconstructed cerci of different populations.
Overall variance in the shape of right cerci for A. moesta specimens is 3.8 X 10-4, which is higher than intraspecific variance of right cerci measured for populations of Enallagma species (McPeek et al., 2011) and comparable to the amount of variance measured in comparisons of multiple Argia species (discussed in Chapter 4). Morphometric data from
17 populations of A. moesta analyzed together with four other species of Argia that are sympatric with certain populations shows that A. moesta displays a great deal of variation
(Fig. 5.6). The cerci differ in the size and orientation of the medial tooth, the size and depth of the central scoop, and the opening of the central scoop as defined by the outer
(ventral) margin (Fig.5.2).
Discussion
The primary reasons for using A. moesta in this study is unpublished evidence that secondary sexual characters in males vary geographically, and the fact that the species is geographically widespread, but with varying degrees of sympatry with congeners across its range. This allows testing for the effects of sexual and reinforcement selection in this species. In turn, the observed patterns of variation in sexual morphology may reveal the relative role of character evolution in influencing speciation and shaping taxonomic diversity.
137
A widespread species that occurs in sympatry with multiple congeners should show little variation in sexual morphology across its range if the mechanical isolation hypothesis applies, because of increased opportunities for heterospecific pairing.
Morphological variation may reflect a form of character displacement by natural selection when different congeners are present at different parts of the range, driving genitalia in different directions in various parts of the species range. This also rejects mechanical isolation because the species is not stereotyped in morphology. But it does not necessarily reject sexual selection, as the driving force is not an increase in fitness via mate choice or heterosexual competition, but rather maintenance of species boundaries.
Further, if the mechanical isolation hypothesis does not apply, then species should show some kind of geographic variation in mitochondrial haplotypes simply by drift alone. In general, these patterns should correspond to expectations of isolation-by- distance mechanisms of gene flow restriction. If nested levels of phenotypic similarity do not relate to geographic distance, then perhaps selection (sexual or otherwise) is at work.
To test the hypotheses discussed above, similarity in morphospace for cerci as inferred by PCA was compared to lines of descent inferred from DNA data. Variation across different populations of A. moesta matches the variation found between randomly chosen congeners (Fig. 5.6). A. moesta spans the range of PC 2 (16% of variance) and most of PC 3 (13% of variance). According to these results, the mechanical isolation hypothesis can be rejected for A. moesta as the cerci are not uniform across populations.
Note that the cerci of Mexican populations of A. moesta are more similar to those of
138
populations with which they are not sympatric (near the origin of Fig. 5.6), and distant
from A. azula (a Mexican species), suggesting character displacement.
Inclusion of A. azula and the other Argia species, which are outside the cluster of
A. moesta, determines the axes of variation for the comparison shown in Fig. 5.6. Fig.
5.7, which shows results of PCA for A. moesta alone, shows that there is no clustering that corresponds to the metapopulations defined by DNA (Figs. 5.4, 5.5). On PC 1 (36% of variance), North Carolina spans nearly the entire range from extreme negative values
(among California sites) to the most positive value (Fig. 5.7). New York has two populations that are strongly positive, and one that is negative. For North Carolina and
New York, there are populations that are on each end of the PC 2 axis. Florida defines the
extreme values of PC2 (25% of variation). California sites are nearly coincident in the
upper left corner (with one North Carolina site) and Texas sites are both on the negative
extreme of PC 2. The prediction that morphological variation matches haplotype-defined metapopulations is rejected. The Northeast sites span most of the range; Florida defines
PC 2; one Texas site does not nest with Florida whereas it should on phylogeographic
grounds; and western sites include a North Carolina population. Again, strict mechanical
isolation fails in both predictions. Sexual selection is neither rejected nor strongly
supported by these preliminary results. Morphological data suggest that it may operate,
but the patterns of mitochondrial variation are ambiguous. Thus, it is possible that both
mechanisms operate for A. moesta, but to differing extents at different scales. This is
because the populations with more sympatric congeners (those from the southwest USA
represented by central Texas and California) show narrower variation whereas eastern
139 populations, with many fewer sympatric congeners, show greater variation. Thus, these secondary male sexual characters appear to reflect a combination of sexual selection for novelty, with canalization when sympatric congeners can apply greater selective pressure for more precise prezygotic isolation.
Phylogenetic analysis of DNA sequences/haplotypes attempts to reconstruct evolutionary history based on the assumption that a hierarchy exists. This may not apply for relationships within a species and for individual genes. A statistical networking approach may be useful to apply to these data in the future to attempt to further elucidate the recent evolutionary history of the populations in question. Furthermore, the expression of sexual traits can also be influenced by environmental variables as well as age (Song and Wenzel, 2008; Córdoba-Aguilar et al., 2010). Therefore, future studies of the morphology of adult damselflies may benefit from an approach where age since imaginal molt can be controlled, perhaps by utilizing laboratory-reared individuals.
It will be interesting to see the extent to which individual Western upland populations, which have a greater degree of congeneric sympatry, differ morphologically from Gulf coastal plain populations. The sample sizes here are not adequate to address such a finer scale question. There is uncertainty regarding the boundaries of populations in nature, particularly of potentially vagile species that have obligate aquatic and terrestrial life stages, so improved population sampling is needed to test this more thoroughly. These preliminary morphological data suggest that there should be quantifiable morphometric variation among these populations that also seem to show
140 genetic variation, which will allow testing of the mechanical isolation hypothesis for A. moesta at multiple geographic scales.
Aquatic habitats in the northeastern USA are generally much older in origin than those of the west and southeast. However, much of the northeast US was glaciated during the Pleistocene, and aquatic environments were at least temporarily unavailable for
Odonates. Using species of coenagrionid damselflies in the genus Enallagma, Turgeon and McPeek (2002) showed that an extensive radiation event occurred following the release of aquatic habitats as the Pleistocene ice receded in the northeastern USA.
However, unlike Enallagma, the radiation of Argia species appears to have been much earlier and occurred in and near the neotropics and subtropical deserts of North Mexico and the American southwest (Pritchard, 1982). A. moesta is not found in the far southern part of Florida or on any of the Caribbean islands. The same holds for most of the other 6 species of Argia that otherwise occur in eastern North America (Pritchard, 1982).
Conversely, Argia diversity is high in the arid regions of the southwest, where aquatic habitats are ephemeral and isolated. Thus, for Argia species in general, speciation may be driven more by habitat isolation and subsequent reinforcing selection, than by the actions of strong sexual selection alone. It will be useful to compare the results of this study with other sympatric congeneric species that are also widespread, such as A. translata, A. apicalis, A. tibialis, et al., or even other damselflies from different genera.
Adult life span of A. moesta is three weeks on average, with a maximum of about four weeks (Borror, 1934). They emerge throughout the late spring and summer months, and it is during this period when lateral dispersal among aquatic systems and over long
141
distances is likely. Dispersal of juveniles is limited to the linear stream habitats and they are not likely to move much over great distances, except in cases where flood events sweep individuals downstream. However, despite being relatively large flying insects as adults, their vagility appears to be somewhat limited as adults as well; they generally do not move more than approximately 228 meters (250 yards) from their juvenile aquatic habitats (Borror, 1934). It therefore makes sense that these animals have their geographic population structure influenced by hydrogeology rather than strict isolation by distance.
Three generalized causal explanations for observed patterns of primary and secondary sexual character variation exist: sexual selection, pleiotropy, and mechanical isolation. These three processes are not necessarily mutually exclusive, which is part of the reason attempts to reveal the relative influence of these are difficult. An integrated approach that combines the tools of evolutionary ecology, population genetics, and phylogenetic systematics represents the best way to test hypotheses explaining the role of sexual selection in evolution of sexual characters and the process of speciation.
This study intends to shed light on the role that morphological variation in primary and secondary sexual characters plays in contributing to population divergence and speciation in aquatic insects. A. moesta appears to have a combination of these processes operating on it at different scales, which may be a unique situation among
Odonata. This species has the potential for being an excellent model organism for various evolutionary and ecological studies. Some of the benefits of using this species include: its wide geographic distribution, limited vagility, obligate aquatic existence as juveniles, discrete life stages that can be separately studied, it is easy to identify and observe in situ,
142
and it is easily collected for manipulation and vouchering. Further studies of this species
are warranted to provide a stronger baseline for future work on understanding the
evolution of reproductive phenotypes in insects.
Conclusions
Argia moesta shows variation in the cercal morphology of males that is inconsistent with a strict model of mechanical isolation of species. Patterns of
morphological variation do not match the mtDNA population genetic structure of the
species. However, the variation in cercal morphology does seem to correspond to the
amount of congeneric sympatry, with greater variation in the part of the species range
that has fewer sympatric congeners. Therefore, the signature of weak mechanical
isolation combined with weak sexual selection seems to be best supported. Additional
data from populations elsewhere in the range of A. moesta are needed. It would also be good to sample more extensively from populations that are sympatric with A. lugens, a closely related species that has similar cercal morphology, overall body size, and ecological niche.
143
Table 5.1: Sampling data for specimens of A. moesta included in this study.
Population Locality Nearest Water Body Date Collected NY1 New York, Chemung Co. Chemung River 26 June 2001 NY2 New York, Lewis Co. Unknown 19 July 2001 NY3 New York, Schuyler Co. Watkins Glen SP 30 June 2001 NY5 New York, Ontario Co. unknown 7 August 2001 OH1 Ohio, Franklin Co. Scioto River 5 September 2008 OH2 Ohio, Knox Co. East Branch Creek 11 June 2005 TX1 Texas, Coryell Co. Lampasas River 23 June 2006 TX2 Texas, Burnet Co. Inks Lake 12 Sept 2008 TX3 Texas, Kerr Co. Guadalupe River 2 July 2005 TX4 Texas, Kimble Co. South Llano River 14 July 2001 East Texas Texas, Brazos Co. 20 June 2004 UT1 Utah, Emery Co. Green River 19 July 2001 OK1 Oklahoma, Comanche Co. unknown 17 July 2004 NJ1 New Jersey, Mercer Co. Stony Brook 9 June 1957 CA1 California, Imperial Co. East Highland Canal 28 July 1991 NC1 North Carolina, Burke, Co. Upper Creek 27 August 1994 NC2 North Carolina, Rutherford Co. Broad River 8 June 1998 FL1 Florida, Bradford Co. Santa Fe River 20 September 1980 FL2 Florida, Marion Co. Oklawaha River 6 April 2000 FL3 Florida, Calhoun Co. Juniper Creek 3 August 1970 FL6 Florida, Suwannee Co. Suwannee River 13 July 2007 FL7 Florida, Taylor Co. Econfina River 13 July 2007 Mex1 Mexico, Jalisco Lago de Chalapa 7 August 1968
144
Figure 5.1: Apparent geographic variation in cerci morphology (highlighted with line) of male A. moesta. From dorsal view. (FL- Florida; UT- Utah; NY- New York; TX- Texas).
Figure 5.2: Right cerci of select male A. moesta specimens from different populations, reconstructed from CT scans. These cerci are pictured from a ventro- medial angle.
145
Figure 5.3: Phylogeny of A. moesta populations based on 16S. MP and ML produce the same result. Colors indicate populations discussed in the text: northeast (red), central upland (green) and gulf (purple). See Table 5.1 for details about sampling location of specimens.
146
Figure 5.4: Phylogeny of A. moesta populations based on COI (MP tree, no ML analysis performed). See Table 5.1 for details about sampling location of specimens.
147
Figure 5.5: Right cercus of a male A. moesta from Texas with position of six of seven landmarks indicated by spheres (the seventh is placed on the opposite side of the cercus in this orientation).
148
male Argia cerci variation
0.02 cuprea TX1 0.015 CA1
0.01 translata emma 0.005 FL5 NC2 UT1 FL1 NY2 FL3 PC2 0 Mex ‐0.03 ‐0.02 ‐0.01 0 0.01 0.02 0.03 NC1 ‐0.005 CA1 NY1 NJ1
‐0.01 NY2 NY1 FL2 OH2‐0.015 azula
‐0.02 PC3
Figure 5.6: PCA of right cercus for Argia. cuprea, A. translata, A. emma, A. azula, and A. moesta populations from Texas, California, Utah, New York, New Jersey, North Carolina, Florida, Ohio and Mexico. See Table 5.1 for details about sampling location of specimens.
149
0.02
0.015 FL5 FL1 FL3 CA1 CA1 0.01 NC2 UT1 TX1 e NY2 0.005 explain
0 variance ‐0.025 ‐0.02 ‐0.015 ‐0.01 ‐0.005 0 0.005 0.01 0.015 0.02 of
‐0.005 35.8% ‐ TX2 Mex1 PC1 ‐0.01 NY1 NC1 NJ1 NY ‐0.015 OH2
‐0.02 FL2 ‐0.025
PC2‐ 24.8% of variance explained
Figure 5.7: PCA of same A. moesta populations and data as Fig. 5.6, but analyzed without other species. See Table 5.1 for details about sampling location of specimens.
150
References
Abbott, J. C. 2005. Dragonflies and Damselflies of Texas and the South-Central United
States : Texas, Louisiana, Arkansas, Oklahoma, and New Mexico. Princeton
University Press, Princeton, N.J., USA.
Altschul, S. F., Gish, W., Mysers, E. W., Lipman, D. J. 1990. Basic local alignment
search tool. Journal of Molecular Biology 215, 403-410.
Bick, G. H., Bick, J. C. 1981. Heterospecific pairing among Odonata. Odonatologica 10,
259-270.
Borror, D. J. 1934. Biological studies of Argia moesta Hagen (Odonata: Coenagrionidae)
by means of marking. The Ohio Journal of Science 34, 97-108.
Caesar, R. M., Wenzel, J. W. 2009. A phylogenetic test of classical species groups in
Argia (Odonata: Coenagrionidae). Entomologica Americana 115, 97-108.
Córdoba-Aguilar, A., López-Valenzuela, A., Brunel, O. 2010. Allometry in damselfly
ornamental and genital traits: solving some pitfalls of allometry and sexual
selection. Genetica 138, 1141-1146.
Dufour, L. 1844. Anatomie Generale des Dipteres. Ann. Sci. Nat. 1, 244-264.
Dunkle, S. W. 1990. Damselflies of Florida, Bermuda, and the Bahamas. Scientific
Publishers, Gainesville, Florida, USA.
Eberhard, W. G. 1985. Sexual Selection and Animal Genitalia. Harvard University Press,
Cambridge, MA, USA.
Eberhard, W. G. 1986. Female Control: Sexual Selection by Cryptic Female Choice.
Princeton University Press, Princeton, NJ, USA. 151 Fincke, O. M. 1997. Conflict resolution in the Odonata: implications for understanding
female mating patters and female choice. Biological Journal of the Linnaean
Society 60.
Fincke, O. M., Waage, J. K., Koenig, W. D. 1997. Natural and sexual selection
components of odonate mating patterns. In: Choe, J. C., Crespi, B. J. (Eds.), The
Evolution of Mating Systems In Insects and Arachnids. Cambridge University
Press, Cambridge, UK, pp. 58-74.
Garrison, R. W. 1994. A synopsis of the genus Argia of the United States with keys and
descriptions of new species, Argia sabino, A. leonorae, and A. pima (Odonata:
Coenagrionidae). Transactions of the American Entomological Society 120, 287-
368.
Howard, D. J. 1993. Reinforcement: origins, dynamics, and fate of an evolutionary
hypothesis. In: Harrison, R. G. (Ed.) Hybrid Zones and the Evolutionary Process.
Oxford University Press, NY, USA, pp. 46-69.
Maddison, W. P., Maddison, D. R. 2010. Mesquite: a modular system for evolutionary
analysis. .
Mayr, E. 1942. Systematics and the origin of species. Columbia University Press New
York NY, USA.
McPeek, M. A., Shen, L., Farid, H. 2009. The correlated evolution of three-dimensional
reproductive structures between male and female damselflies. Evolution;
international journal of organic evolution 63, 73-83.
152 McPeek, M. A., Shen, L., Torrey, J. Z., Farid, H. 2008. The tempo and mode of three-
dimensional morphological evolution in male reproductive structures. The
American Naturalist 171, E158-178.
McPeek, M. A., Symes, L. B., Zong, D. M., McPeek, C. L. 2011. Species recognition and
patterns of population variation in the reproductive structures of a damselfly
genus. Evolution; international journal of organic evolution 65, 419-428.
Miller, M. A., Pfeiffer, W., Schwartz, T. 2010. Creating the CIPRES Science Gateway
for inference of large phylogenetic trees. Proceedings of the Gateway Computing
Environments Workshop (GCE) New Orleans, LA, USA.
Misof, B. 2002. Diversity of Anisoptera (Odonata): Infering speciation processes from
patterns of morphological diversity. Zoology 105, 355-365.
Nixon, K. C. 2000. WinClada. Nixon, K.C., Ithaca, New York, NY, USA.
Paulson, D. R. 1974. Reproductive isolation in damselflies. Systematic Zoology 23, 40-
49.
Pritchard, G. 1982. Life-history strategies in dragonflies and the colonization of North
America by the genus Argia (Odonata: Coenagrionidae). Advances in
Odonatology 1, 227-241.
Rowe, L., Arnqvist, G. 2002. Sexually antagonistic coevlution in a mating system:
combining experimental and comparative approaches to address evolutionary
processes. Evolution; international journal of organic evolution 56, 754- 767.
Shen, L., Farid, H., McPeek, M. A. 2009. Modeling three-dimensional morphological
structures using spherical harmonics. Evolution; international journal of organic
evolution 63, 1003-1016. 153 Snodgrass, R. E. 1935. Principles of Insect Morphology. Cornell University Press, Ithaca,
NY, USA.
Song, H., Wenzel, J. W. 2008. Mosaic pattern of genital divergence in three populations
of Schistocerca lineata Scudder, 1899 (Orthoptera: Acrididae:
Cyrtacanthacridinae). Biological Journal of the Linnean Society 94, 289-301.
Thompson, J. D., Higgins, D. G., Gibson, T. J. 1994. CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
weighting, positions-specific gap penalties and weight matrix choice. Nucleic
Acids Research 22, 4673-4680.
Torre-Bueno, J. R. 1985. A Glossary of Entomology. New York Entomological Society,
New York, NY, USA.
Turgeon, J., McPeek, M. A. 2002. Phylogeographic analysis of a recent radiation of
Enallagma damselflies (Odonata: Coenagrionidae). Molecular Ecology 11.
Westfall, M. J., May, M. L. 1996. Damselflies of North America. Scientific Publishers,
Gainsville, FL, USA.
Zwickl, D. J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large
biological sequence datasets under the maximum likelihood criterion. The
University of Texas at Austin, Austin, Texas, USA.
154
Bibliography
Abbott, J. C. 2005. Dragonflies and Damselflies of Texas and the South-Central United
States : Texas, Louisiana, Arkansas, Oklahoma, and New Mexico. Princeton
University Press, Princeton, N.J., USA.
Alcock, J., Gwynne, D. 1991. Evolution of insect mating systems: the impact of
individual selectionist thinking. In: Bailey, W. J., Ridsill-Smith, J. (Eds.),
Reproductive Behaviour of Insects: Individuals and Populations. Chapman and
Hall, London, England, UK, pp. 10-41.
Altschul, S. F., Gish, W., Mysers, E. W., Lipman, D. J. 1990. Basic local alignment
search tool. Journal of Molecular Biology 215, 403-410.
Andres, J. A., Cordero-Rivera, A. 2000. Copulation duration and fertilization success in a
damselfly: an example of cryptic female choice? Animal Behaviour 59, 695-703.
Andres, J. A., Sanchez-Gullen, R. A., Cordero Rivera, A. 2000. Molecular evidence for
selection on female color polymorphism in the damselfly Ischnura graellsii.
Evolution; international journal of organic evolution 54, 2156-2161.
Arnqvist, G., Rowe, L. 2002a. Antagonistic coevolution between the sexes in a group of
insects. Nature 415, 787-789.
Arnqvist, G., Rowe, L. 2002b. Correlated evolution of male and female morphologies in
water striders. Evolution; international journal of organic evolution 56, 936-947. 155 Artiss, T., Schultz, T. R., Polhemus, D. A., Simon, C. 2001. Molecular phylogenetic
analysis of the dragonfly genera Libellula, Ladona, and Plathemis (Odonata:
Libellulidae) based on mitochondrial cytochrome oxidase I and 16S rRNA
sequence data. Mol Phylogenet Evol 18, 348-361.
Avise, J. C. 1992. Molecular population structure and the biogeographic history of a
regional fauna: a case history with lessons for conservation biology. Oikos 63, 62-
76.
Bailey, W. J., Ridsill-Smith, J. 1991. Reproductive Behaviour of the Insects: Individuals
and Populations. Chapman and Hall, London, UK.
Ballare, E. F., Ware, J. L. 2011. Dragons fly, biologists classify: an overview of
molecular odonate studies, and our evolutionary understanding of dragonfly and
damselfly (Insecta: Odonata) behavior. International Journal of Odonatology 14,
137-147.
Bergsten, J., Miller, K. B. 2007. Phylogeny of Diving Beetles Reveals a Coevolutionary
Arms Race between the Sexes. PLoS ONE 2, e522.
Bick, G. H., Bick, J. C. 1965a. Color variation and significance of color in reproduction
in the damselfly, Argia apicalis (Say)(Zygoptera: Coenagriidae (sic)). Canadian
Entomologist 97, 32-41.
Bick, G. H., Bick, J. C. 1965b. Demography and Behavior of the Damselfly Argia
apicalis (Say), (Odonata: Coenagrionidae). Ecology 46, 461-472.
Bick, G. H., Bick, J. C. 1968. Demography of the damselfly, Argia plana Calvert.
Proceedings of the Entomological Society of Washington 70, 197-203.
156 Bick, G. H., Bick, J. C. 1971. Localization, behavior, and spacing of unpaired males of
the damselfly Argia plana Calvert (Odonata: Coenagrionidae). Proceedings of the
Entomological Society of Washington 73, 146-152.
Bick, G. H., Bick, J. C. 1972. Substrate utilization during reproduction by Argia plana
Calvert and Argia moesta (Hagen) (Odonata: Coenagrionidae). Odonatologica 1,
3-9.
Bick, G. H., Bick, J. C. 1978. The significance of wing clapping in Zygoptera.
Odonatologica 7, 5-9.
Bick, G. H., Bick, J. C. 1981. Heterospecific pairing among Odonata. Odonatologica 10,
259-270.
Bick, J. C., Bick, G. H. 1982. Behavior of adults of dark-winged and clear-winged
subspecies of Argia fumipennis (Burmeister)(Zygoptera: Coenagrionidae).
Odonatologica 11, 99-107.
Borror, D. J. 1934. Biological studies of Argia moesta Hagen (Odonata: Coenagrionidae)
by means of marking. The Ohio Journal of Science 34, 97-108.
Bourret, A., McPeek, M. A., Turgeon, J. 2012. Regional divergence and mosaic spatial
distribution of two closely related damselfly species (Enallagma hageni and
Enallagma ebrium). J Evol Biol 25, 196-209.
Bremer, K. 1994. Branch support and tree stability. Cladistics 10, 295-304.
Bybee, S. M., Ogden, T. H., Branham, M. A., Whiting, M. F. 2008. Molecules,
morphology and fossils: a comprehensive approach to odonate phylogeny and the
evolution of the odonate wing. Cladistics 23, 1- 38.
157 Bybee, S. M., Zaspel, J. M., Beucke, K. A., Scott, C. H., Smith, B. W., Branham, M. A.
2010. Are molecular data supplanting morphological data in modern phylogenetic
studies? Systematic Entomology 35, 2-5.
Byers, C. J., Eason, P. K. 2009. Conspecifics and Their Posture Influence Site Choice and
Oviposition in the Damselfly Argia moesta. Ethology 115, 721-730.
Caesar, R. M., Gillete, N., Cognato, A. I. 2005. Population genetic structure of an
edaphic beetle (Ptiliidae)among late successional reserves within the Klamath-
Siskiyou ecoregion, California. Annals of the Entomological Society of America
98, 931-940.
Caesar, R. M., Wenzel, J. W. 2009. A phylogenetic test of classical species groups in
Argia (Odonata: Coenagrionidae). Entomologica Americana 115, 97-108.
Calvert, P. P. 1901. Odonata. Biologia Centrali Americana: Insecta Neuroptera. R.H.
Porter and Dulau Co., London, UK, pp. XX.
Carle, F. L. 1982. Evolution of the Odonate Copulatory Process. Odonatologica 11, 271-
286.
Carle, F. L., Kjer, K. M. 2002. Phylogeny of Libellula Linneaus (Odonata: Insecta).
Zootaxa 87, 1-18.
Carle, F. L., Kjer, K. M., May, M. L. 2008. Evolution of Odonata, with special reference
to Coenagrionoidea (Zygoptera). Arthropod Systematics and Phylogeny 66, 37-
44.
Chippendale, P. T., Dave, V. K., Whitmore, D. H., Robinson, J. V. 1999. Phylogenetic
Relationships of North American Damselflies of the Genus Ischnura (Odonata:
158 Zygoptera: Coenagrionidae) Based on Sequences of Three Mitochondrial Genes.
Mol Phylogenet Evol 11, 110-121.
Conrad, K. F. 1992. Relationships of larval phenology and imaginal size to male pairing
success in Argia vivida Hagen (Zygoptera: Coenagrionidae). Odonatologica 21,
335-342.
Conrad, K. F., Pritchard, G. 1988a. Female dimorphism and physiological colour change
in the damselfly Argia vivida Hagen (Odonata: Coenagrionidae). Canadian
Journal of Zoology 67, 298-304.
Conrad, K. F., Pritchard, G. 1988b. The reproductive behavior of Argia vivida Hagen: an
example of a female-control mating system (Zygoptera: Coenagrionidae).
Odonatologica 17, 179-186.
Conrad, K. F., Pritchard, G. 1990. Pre-oviposition mate-guarding and mating behaviour
of Argia vivida (Odonata: Coenagrionidae). Ecological Entomology 15, 363-370.
Conrad, K. F., Pritchard, G. 1992. An ecological classification of odonate mating
systems: the relative influence of natural, inter- and intra-sexual selection on
males. Biological Journal of the Linnaean Society 45, 255-269.
Contreras-Garduno, J., Córdoba-Aguilar, A., Peralta-Vazquez, H., Jimenez-Cortes, J. G.,
Luna-Gonzalez, A., Campa-Cordova, A. I. 2008. Differences in immune ability
do not correlate with parasitic burden in two zygoptera species (Calopterygidae,
Coenagrionidae). Odonatologica 37, 111-118.
Cordero, A. 1999. Forced copulations and female contact guarding at a high male density
in a calopterygid damselfly. Journal of Insect Behavior 12, 27-37.
159 Cordero, C., Eberhard, W. G. 2005. Interaction Between Sexually Antagonistic Selection
and Mate Choice in the Evolution of Female Responses to Male Traits.
Evolutionary Ecology 19, 111-122.
Cordero Rivera, A., Lorenzo Carballa, M. O., Utzeri, C., Vieira, V. 2005.
Parthenogenetic Ischnura hastata (Say), widespread in the Azores (Zygoptera:
Coenagrionidae). Odonatologica 34, 1-9.
Córdoba-Aguilar, A. 2003. Predicting mechanisms of sperm displacement based on
genital morphometrics in the Calopterygidae (Odonata). Journal of Insect
Behavior 16, 153-167.
Córdoba-Aguilar, A. 2009. Seasonal variation in genital and body size, sperm
displacement ability, female mating rate, and male harassment in two calopterygid
damselflies (Odonata: Calopterygidae). Biological Journal of the Linnaean
Society 96, 815-829.
Córdoba-Aguilar, A., López-Valenzuela, A., Brunel, O. 2010. Allometry in damselfly
ornamental and genital traits: solving some pitfalls of allometry and sexual
selection. Genetica 138, 1141-1146.
Córdoba-Aguilar, A., Raihani, G., Serrano-Meneses, M. A., Contreras-Garduño, J. 2009.
The lek mating system of Hetaerina damselflies (Insecta: Calopterygidae).
Behaviour 146, 189-207.
Córdoba-Aguilar, A., Uhía, E., Cordero-Rivera, A. 2003. Sperm competition in Odonata
(Insecta): the evolution of female sperm storage and rivals' sperm displacement.
Journal of Zoology 261, 381-398.
160 Costa, J. M., Ravanello, C. T., Souza-Franco, G. M. 2008. The larva of Argia
croceipennis Selys (Zygoptera: Coenagrionidae). Odonatologica 37, 265-271.
Daigle, J. J. 1991. Argia garrisoni spec. nov. from Mexico (Zygoptera: Coenagrionidae).
Odonatologica 20, 337-342.
Daigle, J. J. 1995. Argia carlcooki spec. nov. from Mexico (Zygoptera: Coenagrionidae).
Odonatologica 24, 467-471.
De Marmels, J. 2007. Thirteen new Zygoptera larvae from Venezuela (Calopterygidae,
Polythoridae, Pseudostigmatidae, Platystictidae, Protoneuridae, Coenagrionidae).
Odonatologica 36, 27-51.
Dijkstra, K. B., Groeneveld, L. F., Clausnitzer, V., Hadrys, H. 2007. The Pseudagrion
split: molecular phylogeny confrims the morphological and ecological dichotomy
of Africa's most diverse genus of Odonata (Coenagrionidae). International Journal
of Odonatology 10, 31-41.
Dufour, L. 1844. Anatomie Generale des Dipteres. Ann. Sci. Nat. 1, 244-264.
Dumont, H. J., Vierstraete, A., Vanfleteren, J. R. 2010. A molecular phylogeny of the
Odonata (Insecta). Systematic Entomology 35, 6-18.
Dunkle, S. W. 1990. Damselflies of Florida, Bermuda, and the Bahamas. Scientific
Publishers, Gainesville, Florida, USA.
Eberhard, W. G. 1985. Sexual Selection and Animal Genitalia. Harvard University Press,
Cambridge, MA, USA.
Eberhard, W. G. 1986. Female Control: Sexual Selection by Cryptic Female Choice.
Princeton University Press, Princeton, NJ, USA.
161 Eberhard, W. G. 2004a. Male-female conflict and genitalia: failure to confirm predictions
in insects and spiders. Biological Reviews 79, 121-186.
Eberhard, W. G. 2004b. Rapid divergent evolution of sexual morphology: comparative
tests of antagonistic coevolution and traditional female choice. Evolution;
international journal of organic evolution 58, 1942-1970.
Edgar, R. C. 2004. MUSCLE: a multiple sequence alignment method with reduced time
and space complexity. BMC bioinformatics 5, 113.
Falck, J., Johansson, F. 2000. Patterns in size, sex ratio and time at emergence in a south
Swedish population of Sympetrum sanguineum (Odonata). Aquatic Insects 22,
311-317.
Fincke, O. M. 1982. Lifetime mating success in a natrual population of the damselfly,
Enallagma hageni (Walsh) (Odonata: Coenagrionidae). Behavioral Ecology and
Sociobiology 10, 293-302.
Fincke, O. M. 1984. Sperm competition in the damselfly Enallagma hageni Walsh
(Odonata: Coenagrionidae): benefits of multiple mating to males and females.
Behavioral Ecology and Sociobiology 14, 235-240.
Fincke, O. M. 1992. Consequences of larval ecology for territoriality and reproductive
success of a neotropical damselfly. Ecology 73, 449-492.
Fincke, O. M. 1994. Female colour polymorphism in damselflies: failure to reject the null
hypothesis. Animal Behaviour 47, 1249-1266.
Fincke, O. M. 1997. Conflict resolution in the Odonata: implications for understanding
female mating patters and female choice. Biological Journal of the Linnaean
Society 60. 162 Fincke, O. M., Jödicke, R., Paulson, D. R., Schultz, T. D. 2005. The evolution and
frequency of female color morphs in Holarctic Odonata: why are male-like
females typically the minority. International Journal of Odonatology 8, 183-212.
Fincke, O. M., Waage, J. K., Koenig, W. D. 1997. Natural and sexual selection
components of odonate mating patterns. In: Choe, J. C., Crespi, B. J. (Eds.), The
Evolution of Mating Systems In Insects and Arachnids. Cambridge University
Press, Cambridge, UK, pp. 58-74.
Förster, S. 2001. The dragonflies of Central America exclusive of Mexico and the West
Indies. Gunnar Rehfeldt, Wolfenbüttel, Germany.
Fukatsu, T. 1999. Acetone preservation: a practical technique for molecular analysis.
Molecular Ecology 8, 1935-1945.
Garrison, R. W. 1994. A synopsis of the genus Argia of the United States with keys and
descriptions of new species, Argia sabino, A. leonorae, and A. pima (Odonata:
Coenagrionidae). Transactions of the American Entomological Society 120, 287-
368.
Garrison, R. W. 1996. A synopsis of the Argia fissa group, with descriptions of two new
species, A. anceps sp. n. and A. westfalli sp. n. (Zygoptera: Coenagrionidae).
Odonatologica 25, 31-47.
Garrison, R. W., von Ellenrieder, N. 2007. The true Argia difficilis Selys, 1865, with the
description of Argia yungensis sp. nov. (Odonata: Coenagrionidae). Transactions
of the American Entomological Society 133, 189-204.
Garrison, R. W., von Ellenrieder, N., Louton, J. A. 2010. Damselfly Genera of the New
World. Johns Hopkins University Press, Baltimore, MD, USA. 163 Gloyd, L. K. 1958. The dragonfly fauna of the Big Bend region of Trans-Pecos Texas.
Occasional Papers of the University of Michigan Museum of Zoology 658.
Gloyd, L. K. 1968a. The synonomy of Diargia and Hyponeura with the genus Argia
(Odonata: Coenagrionidae: Argiinae). The Michigan Entomologist 1, 271-274.
Gloyd, L. K. 1968b. The union of Argia fumipennis (Burmeister, 1839) with Argia
violacea (Hagen, 1861), and the recognition of three subspecies (Odonata).
Occasional Papers of the University of Michigan Museum of Zoology.
Goloboff, P. A., Farris, J. S., Nixon, K. C. 2008a. TNT, a free program for phylogenetic
analysis. Cladistics 24, 774-786.
Goloboff, P. A., Farris, J. S., Nixon, K. C. 2008b. TNT, a free program for phylogenetic
analysis. Cladistics 24, 774-786.
Gorb, S. N. 1998. Visual cues in mate recognition by males of the damslefly, Coenagrion
puella (L.) (Odonata: Coenagrionidae). Journal of Insect Behavior 11, 73-92.
Grether, G. F. 1996. Sexual selection and survival selection on wing coloration and body
size in the rubyspot damselfly Hetaerina americana. Evolution; international
journal of organic evolution 50, 1939-1948.
Grimaldi, D., Engel, M. 2005. Evolution of the Insects. Cambridge University Press, New
York, New York, USA.
Guillermo-Ferreira, R., Del-Claro, K. 2011. Territoriality and male-biased sexual size
dimorphism in Argia reclusa (Odonata: Zygoptera). acta ethologica 15, 101-105.
Hafernik, J. E., Garrison, R. W. 1986. Mating success and survival rate in a population of
damselflies: results at variance with theory? The American Naturalist 128, 353-
365. 164 Hamilton, L. D., Montgomerie, R. D. 1989. Population demography and sex ratio in a
neotropical damselfly (Odonata: Coenagrionidae) in Costa Rica. Journal of
Tropical Ecology 5, 159-171.
Harris, W. E., Forman, D. W., Battell, R. D., Battell, M. T., Nelson, A. K., Brain, P. F.
2011. Odonata colour: more than meets the eye? International Journal of
Odonatology 14, 281-289.
Hasegawa, E., Kasuya, E. 2006. Phylogenetic analysis of the insect order Odonata using
28S and 16S rDNA sequences: a comparison between data sets with different
evolutionary rates. Entomological Science 9, 55-66.
Herrera, M. S., Realpe, E., Salazar, C. 2010. A neotropical polymorphic damselfly shows
poor congruence between genetic and traditional morphological characters in
Odonata. Mol Phylogenet Evol 57, 912-917.
Hoekstra, J. D., Smith, R. L. 1999. Descriptions of the final instar larvae of Argia sabino
Garrison and Argia pima Garrison (Odonata: Coenagrionidae). Proceedings of the
Entomological Society of Washington 101, 887-896.
Hovmöller, R. 2005. Defining Ischnurinae.
Hovmöller, R., Johansson, F. 2004. A phylogenetic perspective on larval spine
morphology in Leucorrhinia (Odonata: Libellulidae) based on ITS1, 5.8S, and
ITS2 rDNA sequences. Mol Phylogenet Evol 30, 653-662.
Hovmöller, R., Pape, T., Kallersjö, M. 2002. The Palaeoptera Problem: Basal Pterygote
Phylogeny Inferred from 18S and 28S rDNA Sequences. Cladistics 18, 313-323.
165 Howard, D. J. 1993. Reinforcement: origins, dynamics, and fate of an evolutionary
hypothesis. In: Harrison, R. G. (Ed.) Hybrid Zones and the Evolutionary Process.
Oxford University Press, NY, USA, pp. 46-69.
Huelsenbeck, J. P. 1997. Is the Felsenstein zone a fly trap? Syst Biol 46, 69-74.
Kambhampati, S., Charlton, R. E. 1999. Phylogenetic relationship among Libellula,
Ladona and Plathemis (Odonata: Libellulidae) based on DNA sequence of
mitochondrial 16S rRNA gene. Systematic Entomology 24, 37-49.
Kauppinen, J., Mappes, J. 2003. Why are wasps so intimidating: field experiments on
hunting dragonflies (Odonata: Aeshna grandis). Animal Behaviour 66, 505-511.
Kennedy, C. H. 1918. New species of Odonata from the southwestern United States. Part
I. Three new Argias. Canadian Entomologist 50, 256-261.
Kennedy, C. H. 1919a. A new species of Argia (Odonata). Canadian Entomologist 51,
17-18.
Kennedy, C. H. 1919b. The Phylogeny of the Zygoptera. Entomology. Cornell.
Kennedy, C. H. 1920a. Forty-two hitherto unrecognized genera and subgenera of
Zygoptera. The Ohio Journal of Science 21, 83-88.
Kennedy, C. H. 1920b. The phylogeny of the zygopterous dragonflies as based on the
evidence of the penes. The Ohio Journal of Science 21, 19-32.
Kéry, M., Juillerat, L. 2004. Sex ratio estimation and survival analysis for Orthetrum
coerulescens (Odonata, Libellulidae). Canadian Journal of Zoology 82, 399-406.
Kiauta, B., Kiauta, M. A. J. E. 1980. Introduction to the cytotaxonomy of the odonate
genus Argia (Zygoptera: Coenagrionidae). Odonatologica 9, 35-56.
Kjer, K. M. 2004. Aligned 18S and Insect Phylogeny. Syst Biol 53, 506-514. 166 Kortello, A. D., Ham, S. J. 2009. Movement and habitat selection by Argia vivida
(Hagen) (Odonata, Coenagrionidae) in fuel-modified forest. Journal of Insect
Conservation 14, 133-140.
Leggot, M., Pritchard, G. 1986. Thermal preference and activity thresholds in populations
of Argia vivida (Odonata: Coenagrionidae) from habitats with different thermal
regimes. Hydrobiologia 140, 85-92.
Lin, C. P., Chen, M. Y., Huang, J. P. 2010. The complete mitochondrial genome and
phylogenomics of a damselfly, Euphaea formosa support a basal Odonata within
the Pterygota. Gene 468, 20-29.
Logan, J. A. 1999. Extraction, polymerase chain reaction, and sequencing of a 440 base
pair region of the mitochondrial cytochrome oxidase I gene from two species of
acetone-preserved damselflies (Odonata: Coenagrionidae, Agrionidae).
Environmental Entomology 28, 143-147.
Lorenzo-Carballa, M. O., Cordero-Rivera, A. 2009. Thelytokous parthenogenesis in the
damselfly Ischnura hastata (Odonata, Coenagrionidae): genetic mechanisms and
lack of bacterial infection. Heredity 103, 377-384.
Maddison, W. P., Maddison, D. R. 2010. Mesquite: a modular system for evolutionary
analysis. .
May, M. L. 1976. Physiological color change in New World damselflies (Zygoptera).
Odonatologica 5, 165-171.
Mayr, E. 1942. Systematics and the origin of species. Columbia University Press New
York NY, USA.
167 McPeek, M. A., Shen, L., Farid, H. 2009. The correlated evolution of three-dimensional
reproductive structures between male and female damselflies. Evolution;
international journal of organic evolution 63, 73-83.
McPeek, M. A., Shen, L., Torrey, J. Z., Farid, H. 2008. The tempo and mode of three-
dimensional morphological evolution in male reproductive structures. The
American Naturalist 171, E158-178.
McPeek, M. A., Symes, L. B., Zong, D. M., McPeek, C. L. 2011. Species recognition and
patterns of population variation in the reproductive structures of a damselfly
genus. Evolution; international journal of organic evolution 65, 419-428.
Meurgey, F. 2009. Redescription of Argia concinna (Rambur), with a description of
Argia telesfordi spec. nov. from Grenada, West Indies (Zygoptera:
Coenagrionidae). Zootaxa 2272, 54-62.
Meurgey, F. 2011. Redescription of the larva of Argia concinna (Rambur) with the
description of that of A. telesfordsi Muergey from the West Indies (Zygoptera:
Coenagrionidae). Odonatologica 40, 45-50.
Miller, M. A., Pfeiffer, W., Schwartz, T. 2010. Creating the CIPRES Science Gateway
for inference of large phylogenetic trees. Proceedings of the Gateway Computing
Environments Workshop (GCE) New Orleans, LA, USA.
Misof, B. 2002. Diversity of Anisoptera (Odonata): Infering speciation processes from
patterns of morphological diversity. Zoology 105, 355-365.
Misof, B., Anderson, C. L., Hadrys, H. 2000. A Phylogeny of the Damselfly
Genus Calopteryx (Odonata) Using Mitochondrial 16S rDNA Markers. Mol
Phylogenet Evol 15, 5-14. 168 Moody, D. 2002. Coenagrionidae: Narrow-winged damselflies. In: Glotzhober, R. C.,
McShaffrey, D. (Eds.), The Dragonflies and Damselflies of Ohio. Ohio Biological
Survey, Columbus, Ohio, USA, pp. 91-144.
Nixon, K. C. 2000. WinClada. Nixon, K.C., Ithaca, New York, NY, USA.
Novelo-Gutiérrez, R. 1992. Biosystematics of the larvae of the genus Argia in Mexico
(Zygoptera: Coenagrionidae). Odonatologica 21, 39-71.
Novelo-Gutiérrez, R., Gómez-Anaya, J. A. 2006. A description of the larva of Argia
funcki (Selys, 1854) (Odonata : Zygoptera : Coenagrionidae). Proceedings of the
Entomological Society of Washington 108, 261-266.
O'Grady, E. W., May, M. L. 2003. A phylogenetic reassessment of the subfamilies of
Coenagrionidae (Odonata: Zygoptera). Journal of Natural History 37, 2807-2834.
Ogden, T. H., Whiting, M. F. 2003. The problem with “the Paleoptera Problem:” sense
and sensitivity. Cladistics 19, 432-442.
Paulson, D. R. 1974. Reproductive isolation in damselflies. Systematic Zoology 23, 40-
49.
Pilgrim, E. M., Roush, S. A., Krane, D. E. 2002. Combining DNA sequences and
morphology in systematics: testing the validity of the dragonfly species
Cordulegaster bilineata. Heredity 89, 184-190.
Pilgrim, E. M., Von Dohlen, C. D. 2007. Molecular and morphological study of species-
level questions within the dragonfly genus Sympetrum (Odonata: Libellulidae).
Annals of the Entomological Society of America 100, 688-702.
169 Pritchard, G. 1982. Life-history strategies in dragonflies and the colonization of North
America by the genus Argia (Odonata: Coenagrionidae). Advances in
Odonatology 1, 227-241.
Pritchard, G. 1989. The roles of temperature and diapause in the life history of a
temperate-zone dragonfly: Argia vivida (Odonata:Coenagrionidae). Ecological
Entomology 14, 99-108.
Pritchard, G., Kortello, A. 1997. Roosting, perching, and habitat selection in Argia vivida
Hagen and Amphiagrion abbreviatum (Selys) (Odonata: Coenagrionidae), two
damselflies inhabiting geothermal springs. Canadian Entomologist 129, 733-743.
Querino, R. B., Hamada, N. 2009. An Aquatic Microhymenopterous Egg-Parasitoid of
Argia insipida Hagen in Selys (Odonata: Coenagrionidae) and Biological
Observations in the Central Amazon, Brazil. Neotropical Entomology 38, 346-
351.
Rach, J., DeSalle, R., Sarkar, I. N., Schierwater, B., Hadrys, H. 2008. Character-based
DNA barcoding allows discrimination of genera, species and populations in
Odonata. Proc. Roy. Soc. Lond. B. Biol. Sci. 275, 237-247.
Rehn, A. C. 2003. Phylogenetic analysis of higher-level relationships of Odonata.
Systematic Entomology 28, 181-239.
Robinson, J. V., Dickerson, J. E., Bible, D. R. 1983. The demographics and habitat
utilization of adult Argia sedula (Hagen) as determined by mark-recapture
analysis (Zygoptera: Coenagrionidae). Odonatologica 12, 167-172.
170 Rowe, L., Arnqvist, G. 2002. Sexually antagonistic coevlution in a mating system:
combining experimental and comparative approaches to address evolutionary
processes. Evolution; international journal of organic evolution 56, 754- 767.
Sanchez-Guillen, R. A., Wellenreuther, M., Cordero-Rivera, A., Hansson, B. 2011.
Introgression and rapid species turnover in sympatric damselflies. BMC
evolutionary biology 11, 210.
Shen, L., Farid, H., McPeek, M. A. 2009. Modeling three-dimensional morphological
structures using spherical harmonics. Evolution; international journal of organic
evolution 63, 1003-1016.
Sherratt, T. N., Forbes, M. R. 2001. Sexual differences in coloration of Coenagrionid
damselflies (Odonata): a case of intraspecific aposematism? Animal Behaviour
62, 653-660.
Shuster, S. M., Wade, M. J. 2003. Mating Systems and Strategies. Princeton University
Press, Princeton, New Jersey, USA.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P. 1994. Evolution,
weighting, and phylogenetic utility of mitochondrial gene sequences and a
compilation of conserved polymerase chain reaction primers. Annals of the
Entomological Society of America 87, 651-701.
Simon, S., Strauss, S., von Haeseler, A., Hadrys, H. 2009. A phylogenomic approach to
resolve the basal pterygote divergence. Mol Biol Evol 26, 2719-2730.
Sirot, L. K., Brockmann, H. J., Marnis, C., Muschett, G. 2003. Maintenance of a female-
limited polymorphism in Ischnura ramburi (Zygoptera: Coenagrionidae). Animal
Behaviour 66, 763-775. 171 Siva-Jothy, M. T., Hooper, R. E. 1996. Differential use of stored sperm during
oviposition in the damselfly Calopteryx splendens xanthostoma (Charpentier).
Behavioral Evology and Sociobiology 39, 389-393.
Snodgrass, R. E. 1935. Principles of Insect Morphology. Cornell University Press, Ithaca,
NY, USA.
Song, H., Bucheli, S. R. 2009. Comparison of phylogenetic signal between male genitalia
and non-genital characters in insect systematics. Cladistics 26, 23-35.
Song, H., Wenzel, J. W. 2008. Mosaic pattern of genital divergence in three populations
of Schistocerca lineata Scudder, 1899 (Orthoptera: Acrididae:
Cyrtacanthacridinae). Biological Journal of the Linnean Society 94, 289-301.
Stamatakis, A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic
analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688-
2690.
Steele, D. B., Siepielski, A. M., McPeek, M. A. 2011. Sexual selection and temporal
phenotypic variation in a damselfly population. J Evol Biol 24, 1517-1532.
Svensson, E. I., Kristoffersen, L., Oskarsson, K., Bensch, S. 2004. Molecular population
divergence and sexual selection on morphology in the banded demoiselle
(Calopteryx splendens). Heredity 93, 423-433.
Tennessen, K. J. 2002. Argia rosseri sp. nov. from central Bolivia (Odonata:
Coenagrionidae). International Journal of Odonatology 5, 99-104.
Thompson, J. D., Higgins, D. G., Gibson, T. J. 1994. CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
172 weighting, positions-specific gap penalties and weight matrix choice. Nucleic
Acids Research 22, 4673-4680.
Torre-Bueno, J. R. 1985. A Glossary of Entomology. New York Entomological Society,
New York, NY, USA.
Trautwein, M. D., Wiegmann, B. M., Beutel, R., Kjer, K. M., Yeates, D. K. 2012.
Advances in insect phylogeny at the dawn of the postgenomic era. Annual
Review of Entomology 57, 449-468.
Turgeon, J., McPeek, M. A. 2002. Phylogeographic analysis of a recent radiation of
Enallagma damselflies (Odonata: Coenagrionidae). Molecular Ecology 11.
Van Gossum, H., Mattern, M. 2008. A phylogenetic perspective on absence and presence
of a sex-limited polymorphism. Animal Biology 58, 257-273.
Von Ellenrieder, N. 2007. The larva of Argia joergenseni Ris (Zygoptera:
Coenagrionidae). Odonatologica 36, 89-94.
Waage, J. K. 1979. Dual Function of the Damselfly Penis: Sperm Removal and Transfer.
Science 203, 916-918.
Waage, J. K. 1984. Sperm Competition and the Evolution of Odonate Mating Systems.
In: Smith, R. L. (Ed.) Sperm Competition and the Evolution of Animal Mating
Systems. Academic Press, Inc., Orlando, FL, USA.
Waage, J. K. 1986. Evidence for widespread sperm displacement ability among
Zygoptera (Odonata) and the means for predicting its presence. Biological Journal
of the Linnean Society 28, 285-300.
Walker, E. M. 1953. The Odonata of Canada and Alaska. University of Toronto Press,
Toronto, Ontario, Canada. 173 Ware, J. L., May, M. L., Kjer, K. M. 2007a. Phylogeny of the higher Libelluloidea
(Anisoptera: Odonata): An exploration of the most speciose superfamily of
dragonflies. Mol Phylogenet Evol 45, 289-310.
Ware, J. L., May, M. L., Kjer, K. M. 2007b. Phylogeny of the higher Libelluloidea
(Anisoptera: Odonata): an exploration of the most speciose superfamily of
dragonflies. Mol Phylogenet Evol 45, 289-310.
Weekers, P. H., De Jonckheere, J. F., Dumont, H. J. 2001. Phylogenetic relationships
inferred from ribosomal its sequences and biogeographic patterns in
representatives of the genus Calopteryx (Insecta: Odonata) of the West
Mediterranean and adjacent West European zone. Mol Phylogenet Evol 20, 89-
99.
Westfall, M. J. 1990. Descriptions of larvae of Argia munda Calvert, Argia plana
Calvert, Argia tarascana Calvert and Argia tonto Calvert (Zygoptera:
Coenagrionidae). Odonatologica 19, 61-70.
Westfall, M. J., May, M. L. 1996. Damselflies of North America. Scientific Publishers,
Gainsville, FL, USA.
Wheeler, W. C., Whiting, M. F., Wheeler, Q. D., Carpenter, J. M. 2001. The Phylogeny
of the Extant Hexapod Orders. Cladistics 17, 113-169.
Zwickl, D. J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large
biological sequence datasets under the maximum likelihood criterion. The
University of Texas at Austin, Austin, Texas, USA.
174
Appendix A: Taxonomic information, collection records and GenBank accession
numbers for Argia and outgroup species used in phylogenetic analyses.
175
GenBank Taxon Authority Sampling Locality Collector Accession Number Calopteryx aequibilis Say, 1839 unknown GenBank AF170961
C. maculata (Beauvois, 1805) unknown GenBank AF170960
Hetaerina americana (Fabricius, 1798) unknown GenBank AF170951
Neoneura esthera Williamson, 1917 unknown GenBank AF170948
Ceriagrion nipponicum Asahina, 1967 unknown GenBank AB127067 Lestes alacer Hagen, 1861 USA: Arizona R. Caesar JX121132 Ischnura senegalensis (Rambur, 1842) Japan: Fukuoka GenBank AB127072 Pseudagrion nubicum Selys, 1876 Uganda F. Sibley JX121133 P. spernatum Hagen in Selys, Uganda F. Sibley JX121134 1881 Argia agrioides Calvert, 1895 USA: Oregon R. Caesar FJ592218 A. alberta Kennedy, 1918 USA: New México J. Abbott FJ592211 A. anceps Garrison, 1996 México: Hidalgo K. Tennessen FJ592233 A. apicalis (Say, 1839) USA: Ohio R. Caesar FJ592212 “A. azula” Not Applicable Honduras R. Caesar JX121170 A. barretti Calvert, 1902 USA: Texas K. Tennessen JX173251 A. calida (Hagen, 1861) México K. Tennessen JX121146 A. chelata Calvert, 1902 Costa Rica L. Hamilton JX121171 A. clausseni Selys, 1865 JX121174 A. concinna (Rambur, 1842) Guadeloupe F. Sibley JX121160 A. croceipennis Selys, 1865 JX121175 A. cuprea (Hagen, 1861) USA: Texas T. Gallucci FJ592227 A. cupraurea Calvert, 1902 Ecuador W. Mauffray JX121152 A. difficilis Selys, 1865 Ecuador: Sucumbíos K. Jackson JX121138 A. dives Förster, 1914 Ecuador W. Mauffray JX121150 “A. duida” Not Applicable Venezuela: Bolivar R. Garrison JX121173 “A. dunklei” Not Applicable Ecuador J. Daigle JX121149 A. eliptica Selys, 1865 Belize S. Dunkle JX121144 “A. elongata” Not Applicable Nicaragua J. Abbott JX121137 A. emma Kennedy, 1915 USA: California C. Barrett FJ592228 A. euphorbia Fraser, 1946 Brazil M. Westfall JX121145 A. extranea (Hagen, 1861) México: Sonora R. Behrstock FJ592231 A. fraudatricula Förster, 1914 Bolivia K. Tennessen JX121158 A. frequentula Calvert, 1907 Honduras R. Caesar JX121140 176 GenBank Taxon Authority Sampling Locality Collector Accession Number A. fumigata Hagen in Selys, Brazil M. Westfall JX121156 1865 A. fumipennis atra (Burmeister, 1839) USA: Florida K. Holt FJ592230 A. f. fumipennis (Burmeister, 1839) USA: Tennessee S. Dunkle JX121136 A. f. violacea (Burmeister, 1839) USA: Ohio R. Caesar FJ592232 A. funcki (Selys, 1854) México: Sonora D. Paulson FJ592197 A. sp. “g-3” Not applicable Ecuador K. Tennessen JX121179 A. garrisoni Daigle, 1991 México: Tamaulipas R. Behrstock FJ592213 A. gaumeri Calvert, 1907 México S. Dunkle JX121141 A. gerhardi Calvert, 1909 Ecuador J. Daigle JX121165 A. hamulata Fraser, 1946 Bolivia W. Mauffray JX121157 A. harknessi Calvert, 1899 México: Sonora D. Paulson FJ592199 A. herberti Calvert, 1902 México: Morelos W. Mauffray JX121147 A. hinei Kennedy, 1918 USA: Texas J. Abbott FJ592207 A. huanacina Förster, 1914 Bolivia W. Mauffray JX121167 A. immunda (Hagen, 1861) USA: Texas A. Cognato FJ592214 A. indicatrix Calvert, 1902 Ecuador J. Daigle JX121162 A. infrequentula Fraser, 1946 Ecuador K. Tennessen JX121166 A. insipida Hagen in Selys, Trinidad M. May JX121161 1865 A. jocosa Hagen in Selys, Ecuador W. Mauffray JX121151 1865 A. joergenseni Ris, 1913 Bolivia L. Stange JX121155 A. johanella Calvert, 1907 Nicaragua W. Mauffray JX121163 A. jujuya Ris, 1913 Argentina T. Donnelly JX121178 A. kokama Calvert, 1909 Ecuador Mauffray JX121164 A. lacrimans (Hagen, 1861) USA: Arizona R. Behrstock FJ592216 A. leonorae Garrison, 1994 USA: Texas R. Behrstock FJ592226 A. lilacina Selys, 1865 Bolivia W. Mauffray JX121139 A. limitata Navás, 1924 Ecuador K. Tennessen JX121153 A. lugens (Hagen, 1861) USA: Arizona R. Caesar FJ592215 A. medullaris Hagen in Selys, Ecuador J. Daigle JX121142 1865 A. sp. “mini-blue” Not applicable México K. Tennessen JX121135 A. modesta Selys, 1865 Brazil R. Garrison JX121172 A. moesta (Hagen, 1861) USA: Texas A. Cognato FJ592229 A. munda Calvert, 1902 USA: Arizona R. Caesar FJ592223 A. nahuana Calvert, 1902 USA: Texas T. Gallucci FJ592225 A. sp. nov. Not applicable México: Sonora D. Paulson FJ592198 177 GenBank Taxon Authority Sampling Locality Collector Accession Number A. oculata Hagen in Selys, México: Tamaulipas R. Behrstock FJ592221 1865 A. oenea Hagen in Selys, México: San Luis R. Behrstock FJ592217 1865 Potosi A. orichalcea Hagen in Selys, Trinidad J. Abbott JX121148 1865 A. pallens Calvert, 1902 USA: Arizona W. Mauffray FJ592224 A. pima Garrison, 1994 USA: Arizona J. Daigle FJ592208 A. plana Calvert, 1902 USA: Texas J. Abbott FJ592196 A. pulla Hagen in Selys, Nicaragua: Jinotega J. Abbott FJ592222 1865 A. reclusa Selys, 1865 Bolivia K. Tennessen JX121159 A. rhoadsi Calvert, 1902 México: San Luis R. Behrstock FJ592206 Potosi A. sabino Garrison, 1994 USA: Arizona J. Daigle FJ592202 A. sedula (Hagen, 1861) USA: Oklahoma H. Song FJ592209 A. talamanca Calvert, 1907 Ecuador F. Sibley JX121169 A. tamoyo Calvert, 1909 Bolivia N. Araujo JX121176 A. tarascana Calvert, 1902 USA: Arizona R. Caesar FJ592200 A. tezpi Calvert, 1902 Honduras: Francisco S. Dunkle FJ592220 Morazan A. tibialis (Rambur, 1842) USA: Ohio R. Caesar FJ592203 A. tonto Calvert, 1902 USA: Arizona R. Caesar FJ592204 A. translata Hagen in Selys, USA: Texas A. Cognato FJ592210 1865 A. ulmeca Calvert, 1907 México: Tamaulipas R. Behrstock FJ592205 A. variabilis Selys, 1865 México K. Tennessen JX121143 A. variegata Förster, 1914 Ecuador J. Daigle JX121168 A. vivida Hagen in Selys, USA: California J. Abbott FJ592201 1865 A. westfalli Garrison, 1996 México: Tamaulipas R. Behrstock FJ592219
178
Appendix B: List of Morphological Characters with Comments
179 Character 1. Thorax and head with metallic copper-red coloration (imagos): absent (0),
present (1). This condition is also associated with copper-red to red eyes for specimens in
vivo (imagos.) Species with this coloration are often referred to as being associated
together in the “metallics” group. While pigmentation is generally not a very useful
character for damselflies, as it is often variable within species, this condition is largely a
result of structural coloration and is invariant within species.
Character 2. Mesepisternal tubercles (females): absent (0), reduced (1), prominent (2).
See Fig. 2.1.
Character 3. Posterior lobes of mesostigmal plates (females): absent (0), broad and flange-like (1), elongate and finger-like (2). See Fig. 2.1.
Character 4. Mesothoracic pits (females): absent (0), shallow (1), deep (2). This character has been discussed in very limited context in the literature, but it has been suggested that it might be informative for phylogenetics (Gloyd, 1958). Here we code it for the first time and show that it is useful.
Character 5. Hairs lining mesothoracic pits (females): absent (0), sparse (1), dense (2).
Character 6. Mesepisternal pits costate (females): absent (0), present (1).
180 Character 7. Pronotal pits (females): absent (0), shallow (1), deep (2). This character is
not utilized in keys or discussed much in the literature, but seems to be variable enough
within Argia to be useful. Indeed, this region corresponds to the placement of the dorso- posterior potion of the male paraprocts during tandem linkage and copulation (see Fig.
2.1.)
Character 8. Shape of cerci (males): entire (0), bifid (1), trifid (2). Cerci are a secondary
sexual character, utilized as part of the clasping process during copulation. The cerci
contact the female mesostigmal plates and mesepisternal tubercules when linked in
copula and may be part of the mechanism by which females recognize and evaluate
males.
Character 9. Shape of paraprocts (males): entire (0), bifid (1), trifid (2).
Character 10. Lateral gills with marginal fringe of stout setae (larvae): present (0), absent
(1).
Character 11. Overall body size: small (0), medium (1), large (2); nonadditive. The size
of individuals may be related to nutrition, seasonality or generation in bivoltine
populations and thus may vary slightly within a species, but the general pattern of relative
overall body size does provide useful phylogenetic signal. Additionally, this character
serves as a reliable proxy for other such measures as forewing length.
181 Character 12. Pale coloration on abdominal tergite 8 (male): absent (0), present (1), present only in apical half (2); nonadditive. The coloration of the terminal abdominal tergites may serve as a signal for species or sexual identity. This character may vary slightly with age but is nevertheless apparently invariant within a species.
Character 13. Pale coloration on abdominal tergite 9 (male): absent (0), present (1), present only in apical half (2); non-additive.
Character 14. Pale coloration on abdominal tergite 10 (male): absent (0), present (1), present only in apical half (2); non-additive.
Character 15. Length of cerci relative to paraprocts (male): longer (0), same (1), shorter
(2); non-additive.
Character 16. Length of inferior (ventral) lobe of paraprocts relative to superior (dorsal): longer (0), same (1), shorter (2); non-additive.
Character 17. Prominent subapical denticles on tergum of abdominal segment 10: absent
(0), present (1); non-additive.
Character 18. Lateral margin of abdominal segment 10 with prominent notch: absent (0), present (1); non-additive. This notch is adjacent to the cerci and appears to allow for
182 movement of the cerci, presumably when grasping females for tandem linkage and
copulation.
Character 19. Condition of dorsal cleft on abdominal tergite 10: absent (0), moderate (1), deep (2); non-additive.
Character 20. Tori elevated on ridge: absent (0), present (1); additive.
Character 21. Distance between tori relative to width of torus: same (0), twice (1), triple
(2), quadruple or more (3), less (4); non-additive.
Character 22. Overall shape of tori: rounded (0), elongate/transverse (1), reduced (2); non-additive.
Character 23. Epiproct (male): reduced (0), moderate (1), prominent (2); non-additive.
Character 24. Epiproct color (male): pale (0), dark (1); non-additive.
Character 25. Epiproct shape (male): entire (0), bifid (1), trifid (2); additive.
Character 26. Cercus shape (male)- apical lobe and apical tooth similar in size and closely approximated: not (0), yes (1); additive.
183 Character 27. (from previous character)- apical tooth and apical lobe approximately
parallel in orientation, directed posteriorly in vivo: not (0), yes (1); additive.
Character 28. Cercus shape (male)- medial lobe very pronounced, moved apically, with
ridge extending to lateral margin: no (0), yes (1); additive.
Character 29. Cerci with ventral cavity deep and well defined, bending around apical
tooth in “C” shape: no (0), yes (1); additive.
Character 30. Apical tooth of cerci located within the ventral cavity/sinus instead of
along the apical margin: no (0), yes (1); additive.
Character 31. Apical tooth of cercus distinctly smaller than apical lobe: no (0), yes (1); additive.
Character 32. Overall shape of cercus lanceolate: no (0), yes (1); non-additive;
Character 33. Border of central ventral cavity of cercus not well- defined: no (0), yes (1); non-additive.
Character 34. Central ventral cavity of cercus with broad opening at medial margin basally: no (0), yes (1); non-additive.
184 Character 35. Overall shape of cercus spatulate, medial margin not curled dorsally forming cavity; rectangular: no (0), yes (1); non-additive.
185
Appendix C: Morphological Data matrix used in Chapter 4
186
Characters (See Appendix B for Descriptions) 1 2 3 4 5 6 7 8 9 10 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 Taxon Hetaerina ------0 - 0 0 ------americana Calopteryx ------0 - 0 0 ------aequabilis Calopteryx ------0 - 0 0 ------maculata Lestes alacer ------0 - 0 0 ------Ischnura ------0 - 0 0 ------senegalensis
187 Ceriagrion ------0 - 0 0 ------nipponicum Neoneura ------0 - 0 0 ------esthera Pseudagrion ------0 - 0 0 ------nubicum Pseudagrion ------0 - 0 0 ------spernatum funcki 0 0 2 1 2 - 1 1 0 - 2 0 2 2 1 1 1 1 0 0 1 0 1 1 2 ------lugens 0 1 2 2 1 0 2 1 0 0 2 0 0 0 0 2 0 1 1 0 0 0 0 1 2 0 - 0 0 - 0 0 0 0 0 moesta 0 2 2 2 2 0 1 1 0 0 2 0 1 1 0 2 0 1 1 1 3 0 2 0 2 0 - 0 0 - 0 0 0 0 0 mini-blue 0 ------1 2 - 1 1 2 2 0 1 0 0 2 0 0 0 0 1 ? 0 - 0 0 - 0 0 0 0 0 oculata 0 0 1 1 0 0 2 1 1 - 1 1 2 0 0 1 0 0 0 1 2 1 0 1 0 0 - 0 0 - 0 0 0 0 0 extranea 0 1 0 1 - 0 1 1 2 1 0 1 2 2 0 0 0 0 1 1 1 0 1 1 1 0 - 0 0 - 0 0 0 1 0 plana 0 1 1 1 2 0 2 0 1 1 1 1 2 2 0 1 0 0 1 0 0 0 1 0 2 0 - 0 0 - 0 0 0 1 0 vivida 0 2 1 1 1 0 0 0 1 1 1 1 2 2 0 1 0 0 1 0 0 1 1 1 1 0 - 0 0 - 0 0 0 0 0 elongata 0 ------0 1 - 1 1 2 2 0 0 0 0 1 1 4 ? 0 1 ? 0 - 0 0 - 0 0 0 0 0 immunda 0 0 0 1 0 0 1 1 1 1 1 1 2 2 1 1 0 0 2 0 0 0 1 0 1 0 - 0 0 - 0 0 0 0 0 westfalli 0 1 1 1 2 0 0 0 2 - 1 1 2 2 1 2 0 0 1 1 0 1 1 1 1 0 - 0 0 - 1 1 0 0 0 187 Characters (See Appendix B for Descriptions) 1 2 3 4 5 6 7 8 9 10 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 Taxon lacrimans 0 - 1 0 0 0 1 1 1 0 1 1 2 2 1 2 0 1 1 1 1 1 2 1 2 0 - 0 0 - 1 1 0 0 0 tonto 0 0 1 0 0 0 1 1 2 0 1 1 2 2 1 2 0 1 1 0 0 1 2 0 2 1 1 0 0 - 0 0 0 1 0 difficilis 0 - - - - - 2 0 1 - 1 1 2 2 1 0 0 0 0 1 0 2 0 1 1 0 - 0 0 - 0 0 0 0 0 lilacina 0 ------0 0 - 0 1 2 0 1 1 0 0 2 0 3 2 0 1 ? 0 - 0 0 - 0 0 0 0 0 frequentula 0 ------0 2 - 0 1 2 2 0 2 0 0 0 0 4 1 0 0 1 0 - 0 0 - 0 0 0 0 1 gaumeri 0 ------1 2 - 0 1 2 2 0 1 0 0 0 1 4 1 1 0 1 0 - 0 0 - 0 0 0 0 0 pulla 0 0 0 0 0 0 1 1 2 1 0 1 2 2 1 1 0 0 1 0 4 1 1 1 1 0 - 0 0 - 0 0 0 0 1 medullaris 188 0 ------0 2 - 1 1 2 0 0 1 0 0 0 1 0 1 1 1 2 0 - 0 0 - 0 0 0 0 0
variabilis 0 ------0 1 - 1 1 2 2 1 1 0 0 1 1 0 1 1 1 1 0 - 0 0 - 0 0 0 1 0 eliptica 0 ------1 1 - 1 1 2 1 0 0 0 0 1 1 0 1 0 1 - 0 - 0 0 - 0 0 0 0 0 euphorbia 0 ------1 1 - 1 0 0 0 0 0 0 0 1 1 0 0 2 1 1 1 1 0 0 - 0 0 0 0 0 calida 0 ------1 1 - 1 0 2 2 0 1 0 0 1 1 0 0 1 1 2 0 - 0 0 - 0 0 0 0 0 ulmeca 0 1 0 1 0 0 2 1 1 0 1 1 2 2 0 0 0 0 2 0 1 0 2 0 1 1 - 0 0 - 0 0 0 0 0 garrisoni 0 0 2 0 0 0 1 1 1 - 1 1 2 2 0 1 0 0 1 0 0 0 1 1 0 0 - 0 0 - 0 0 0 0 0 herberti 0 1 1 1 - - - 1 2 - 1 1 2 2 0 1 0 1 0 1 1 0 0 1 - 0 - 0 0 - 0 0 0 0 0 orichalcea 1 ------1 1 - 1 1 2 2 1 1 0 1 1 0 1 0 2 0 0 1 0 0 0 - 0 0 0 0 0 dunklei 1 ------0 1 - 1 1 2 2 0 0 0 1 1 0 1 0 1 1 1 0 - 0 0 - 0 0 0 0 0 cuprea 1 2 2 1 1 0 2 1 1 0 1 0 2 2 0 0 0 1 1 0 1 0 1 1 1 0 - 0 0 - 0 0 0 0 0 oenea 1 0 2 1 1 0 2 1 1 0 1 1 2 2 0 0 0 0 1 0 1 0 2 0 2 1 0 0 0 - 0 0 0 0 0 dives 1 ------1 1 - 1 2 2 2 0 0 0 1 0 0 1 0 2 1 0 1 0 0 0 - 0 0 0 0 0 jocosa 1 ------1 1 - 1 1 1 1 0 0 0 1 0 0 1 0 1 1 0 0 - 0 0 - 0 0 0 0 0 cupraurea 1 ------1 1 - 1 1 2 2 0 0 0 1 1 0 1 0 1 1 0 1 0 0 0 - 0 0 0 0 0 limitata 1 ------1 1 - 1 1 1 1 0 1 0 1 1 0 1 0 1 1 0 0 - 0 0 - 0 0 0 0 0 188 Characters (See Appendix B for Descriptions) 1 2 3 4 5 6 7 8 9 10 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 Taxon sedula 0 0 1 0 1 0 2 0 1 1 0 1 2 2 0 0 0 0 1 1 4 1 1 0 1 0 - 0 0 - 0 0 0 0 1 tezpi 0 2 2 1 1 0 1 1 1 0 1 0 1 2 0 0 0 0 2 0 0 0 1 0 0 0 - 0 0 - 0 0 0 0 0 translata 0 2 2 2 1 0 2 0 1 0 1 0 1 0 0 0 0 0 1 0 1 0 1 1 0 0 - 0 0 - 0 0 0 0 0 harknessi 0 ------1 1 - 1 1 2 1 0 2 0 0 2 0 1 - 2 0 0 0 - 0 0 - 0 0 0 0 0 joergenseni 1 ------1 1 - 1 1 2 2 0 0 1 0 1 0 3 0 2 1 0 1 0 0 0 - 0 0 0 0 0 fumigata 0 ------1 1 - 0 2 1 0 1 0 0 1 2 1 1 - 1 1 1 1 0 0 0 - 1 1 0 0 0 0 ------1 1 - 1 1 2 0 - 1 0 0 2 1 2 0 2 1 1 0 - 0 0 - 0 0 0 0 0 189 hamulata fraudatricula 0 ------1 1 - 1 0 2 1 1 1 0 0 ------0 - 0 0 - 0 0 0 0 0
reclusa 0 ------0 1 - 1 1 2 2 0 1 0 0 1 1 1 0 1 1 1 0 - 0 0 - 0 0 0 1 0 concinna 0 ------1 1 - 1 1 2 2 0 2 0 1 2 0 4 1 0 1 - 1 - 0 0 - 0 0 0 0 0 insipida 0 ------1 1 - 0 1 2 1 0 0 0 0 0 0 3 0 2 0 1 0 - 0 0 - 0 0 0 0 0 indicatrix 0 ------1 1 - 0 0 2 0 - 2 0 0 2 - 4 1 1 1 0 0 - 0 0 - 0 0 0 0 0 johanella 0 ------0 1 - 0 1 2 2 0 0 0 0 2 - 4 1 1 1 1 0 - 0 0 - 0 0 0 0 0 g 3 0 ------0 1 - 1 1 2 0 0 0 0 0 0 - 4 1 0 - - 0 - 0 0 - 0 0 0 0 0 kokama 0 ------0 1 - 0 1 2 0 0 0 0 0 0 1 4 1 0 1 - 0 - 0 0 - 0 0 0 0 0 gerhardi 0 ------0 1 - 0 1 2 0 0 0 0 0 0 1 4 1 0 - - 0 - 0 0 - 1 1 1 1 0 jujuya 0 ------0 1 - 0 1 2 2 1 1 0 1 2 0 4 1 0 0 1 0 - 0 0 - 1 1 1 1 0 infrequentul 0 ------0 2 - 0 1 2 2 1 1 0 0 2 1 4 1 2 0 1 0 - 0 0 - 1 0 1 1 0 a huanacina 0 ------1 2 - 0 1 2 2 0 0 0 0 2 1 4 - 1 1 0 0 - 0 0 - 1 1 1 1 0 fumipennis 0 ------1 1 - 1 1 2 2 0 1 0 0 1 1 4 1 2 1 2 0 - 1 1 1 0 0 0 0 0 fumipennis fumipennis 0 1 2 1 2 0 1 1 1 1 1 1 2 2 0 1 0 0 2 1 4 1 2 1 2 0 0 1 1 1 0 0 0 0 0 atra fumipennis 0 1 2 1 2 0 1 1 1 1 1 1 2 2 0 1 0 0 1 1 4 1 2 0 2 0 0 1 1 1 0 0 0 0 0 violacea
189 Characters (See Appendix B for Descriptions) 1 2 3 4 5 6 7 8 9 10 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 Taxon pallens 0 0 1 0 0 0 1 1 1 1 1 1 2 2 0 1 0 1 2 0 4 1 2 0 0 0 - 1 1 1 0 0 0 0 0 variegata 0 ------1 1 - 1 1 2 0 1 1 0 0 1 - 0 1 1 1 0 0 - 0 0 - 0 0 0 0 0 talamanca 0 ------0 0 - 1 1 2 0 1 - 0 0 0 0 0 1 0 1 0 0 - 0 0 - 0 0 0 1 0 azula 0 ------0 1 - 1 1 2 2 1 2 0 1 1 1 0 1 0 1 0 0 - 0 0 - 1 1 0 0 0 chelata 0 ------1 1 - 2 1 2 2 1 0 0 1 0 0 1 0 0 1 0 0 - 0 0 - 0 0 0 0 0 bipunctulata 0 ------0 1 - 0 1 2 2 1 1 0 1 1 0 4 1 2 0 1 0 - 1 1 0 0 0 0 0 0 0 2 2 2 1 1 1 0 1 1 1 1 2 2 0 1 1 0 2 1 4 2 1 0 1 0 0 0 0 - 0 0 0 0 0
190 emma munda 0 0 - - - 1 - 0 1 0 1 1 2 2 0 1 0 1 1 - 1 0 0 1 0 0 - 0 0 - 0 0 0 0 0
sabino 0 1 1 1 1 0 2 0 1 - 1 1 2 2 1 2 0 0 1 1 0 0 2 0 2 0 - 0 0 - 0 0 0 0 0 pima 0 0 1 - - 0 - 1 1 - 1 1 2 2 0 2 0 1 0 0 0 1 1 0 0 0 - 0 0 - 0 0 0 0 0 hinei 0 0 2 0 0 0 2 1 1 1 0 1 2 2 0 2 0 0 2 0 0 - 2 0 1 0 0 1 0 0 0 0 0 0 0 agrioides 0 1 2 0 0 0 1 1 1 1 0 1 2 2 0 1 0 0 1 0 2 0 2 0 0 0 - 1 0 0 0 0 0 0 0 alberta 0 0 0 0 0 0 0 0 1 0 0 1 2 2 1 2 0 0 2 1 0 - 1 1 1 0 - 0 0 - 0 0 0 0 1 leonorae 0 0 0 - - 0 - 1 1 - 0 1 2 2 0 0 0 1 1 - 4 1 2 0 1 0 - 1 1 1 0 0 0 0 0 nahuana 0 1 1 0 0 0 1 1 1 1 0 1 2 2 0 2 0 1 1 - 4 1 2 0 1 0 0 1 0 0 0 0 0 0 0 rhoadsi 0 0 2 2 1 0 1 0 1 1 1 1 2 2 0 0 0 1 2 0 4 1 1 0 1 0 0 0 0 - 0 0 0 0 0 apicalis 0 1 0 0 0 0 1 1 1 0 0 1 2 2 0 0 0 0 1 1 - 0 0 1 1 0 - 0 0 - 0 0 0 0 0 tibialis 0 0 0 0 0 0 0 1 1 0 1 0 2 2 0 1 0 0 1 1 1 0 1 1 2 0 - 0 0 - 0 0 0 0 0 barretti 0 ------1 1 - 1 1 2 1 0 0 0 0 1 1 1 0 2 0 1 1 0 0 0 - 0 0 0 0 0 modesta ------0 - 0 0 - 0 0 0 0 0 duida ------0 - 0 0 - 0 0 0 0 0 clausseni ------0 - 0 0 - 0 0 0 0 0 croceipennis ------0 - 0 0 - 0 0 0 0 0 190 Characters (See Appendix B for Descriptions) 1 2 3 4 5 6 7 8 9 10 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 Taxon tamoyo 0 ? ? ? ? ? ? 0 1 ? 1 2 2 2 1 1 0 1 1 0 3 0 2 0 1 0 - 0 0 - 0 0 0 0 0 tarascana 0 2 2 1 1 0 1 1 1 0 1 1 2 2 1 2 0 0 1 0 0 1 2 0 0 0 - 0 0 - 0 0 0 0 0 anceps 0 1 1 0 0 0 0 0 0 0 1 1 2 2 0 2 0 0 1 1 0 1 0 1 0 0 - 0 0 - 1 1 0 0 0
191
191