DOCSLIB.ORG

First Record of Marine Phytoplankton, Picochlorum Maculatum in the Southeastern Coast of India

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
First Record of Marine Phytoplankton, Picochlorum Maculatum in the Southeastern Coast of India Indian Journal of Geo Marine Sciences Vol. 46 (04), April 2017, pp. 791-796 First record of marine phytoplankton, Picochlorum maculatum in the Southeastern coast of India Dinesh Kumar, S1. S. Ananth1, P. Santhanam1*, K. Kaleshkumar2 & R. Rajaram2 1Marine Planktonology & Aquaculture Lab., 2DNA Barcoding and Marine Genomics Lab., Department of Marine Science, School of Marine Sciences, Bharathidasan University, Tiruchirappalli- 620 024, Tamil Nadu, India. * [E-mail: [email protected], [email protected]] Received 20 October 2014 ; revised 02 January 2015 The marine phytoplankton Picochlorum maculatum (Chlorophyta:Trebouxiophyceae) is recorded for the first time in the Southeastern coast of India. In this study, marine phytoplankton were collected at Muthukkuda mangrove waters, Tamil Nadu, Southeast coast of India which was then isolated, purified and identified with rDNA sequencing. Recurrence component analysis of marine phytoplankton P. maculatum indicated that the peptides were composed of Beta structure, comprising alpha-helix, extended strand and random coil. The number of amino acids and chemical properties from the marine microalgae P. maculatum are calculated and having composition of Neutral (82.69%), Acidic (10.72%) and Basic (6.57%) amino acids. This species may be introduced by way of shipping and other transport mechanisms where organisms are inadvertently moved out of their home range, e.g., ballast water exchange. [Keywords: Microalgae, Picochlorum maculatum, Genetic Distance, Open Reading Frame, Poly A signals] Introduction The genus Picochlorum maculatum was in Indian coastal waters. There are five Picochlorum established by Henley et. al.1 based on Nannochloris were reported in species level from Japan maculta Butcher, 1952. The currently accepted name (Picochlorum atomus, Picochlorum eukaryotum, P. of the species is Picochlorum link type continued maculatum, Picochlorum oculatum) by Henley et al1. based on Nannochloris Butcher, 1952. The size of P. maculatum also reported in Japan between 2001 small cell is 1.5 to 3 microns diameter and making and 2003 by Yamamoto et al 2, 3. In the present paper tough to morphology identification. In the marine P.maculatum, reported for the first time from Indian habitat, there are 5 species (and intraspecific) names coastal waters. Also confirmed by molecular studies were deposited in the database at present, of which 3 viz., Open Reading Frames (ORFs), Polyadenylation have been flagged as currently accepted signals, Genetic distance analyses and found the gene taxonomically. Picochlorum is green algae or prediction. chlorophyta, already reported 16 species (Picochlorum atomus, Picochlorum eukaryotum, Materials and Methods Picochlorum maculatum, Picochlorum oculatum, Collection, isolation and purification of microalgae Picochlorum oklahomense, Picochlorum sp. The water sample was collected from the EGEMACC41, Picochlorum sp. HM1, Picochlorum Muthukuda region of Palk Bay (Latitude. 9o 51’ 48’’ sp. NIES-1270, Picochlorum sp. RCC1034, N; Longitude 79o 7’ 15’’ E), Tamil Nadu, Picochlorum sp. RCC115, Picochlorum sp. RCC289, Southeastern coast of India. The microalgae were Picochlorum sp. RCC944, Picochlorum sp. RCC945, isolated using agar plating and serial dilution Picochlorum sp. S1b, Picochlorum sp. UTEX 2378, techniques according to Robert4. The mixed cultures Picochlorum sp. UTEX 2491) under this genera in contained different species of microalgae were diluted worldwide but except India. No reports are available in 1/10 dilution series with sterile Walne medium5, on the occurrence of Picochlorum maculatum so far and prepared using filtered/sterilized seawater and 0.1 792 INDIAN J. MAR. SCI., VOL. 46, NO. 04, APRIL 2017 mL of appropriate dilutions was spread on Walne agar Basionym Nannochloris maculata R. W. Butcher medium plates. Homotypic Nannochloris maculata R. W. Butcher, synonym 1952 DNA extraction and amplification Current Picochlorum maculatum Henley et Genomic DNA isolation from green algae were status al., 2004 done according to Smoker and Barnum6 with slight modifications. PCR amplification was performed for the purified DNA by using ss5 (5'GGTTGATCCTGCCAGTAGTCATATGCTTG3') and ss3 (5' GATCCTTCCGCAGGTTCACCTACGG AAACC-3) primers. Sequencing was done with amplified samples with respective forward primers and sequence was submitted to GenBank via BankIt submission tool. Fig. 1—Microscopic photograph of Picochlorum maculatum Phylogenetic and sequence analyses The evolutionary distances of algae were computed 7 Cells are green, spherical or oval, with a diameter by the Maximum Composite Likelihood method and of 2.5 microns, ability to grow in moist soil or water, are in the units of the number of base substitutions per either saline or fresh. One nucleus, one mitochondrion site and it was computed in MEGA 6 software. The and one lateral chloroplast were present and of genetic distance and open reading frames were 7 8 pyrenoid and flagella are absent. Chloroplast predicted according to Tamura et al. and Chen et al . pigments included chlorophyll a and b. Reproduction The poly A signals were predicted by using standard 9 by autosporulation, leading to two or more daughter method described by Liu et al . The nucleotide cells; sexual reproduction is unknown. sequence of microalga translated in to protein sequences by using TranSeq and secondary structure The evolutionary history was inferred and was predicted by the method of Garnier et al10. Amino optimal tree with sum of branch length is shown acid predictions were carried out by using ExPASy in Figure 2. The P. maculatum sequences were web server11. initially compared with the nucleotide data base using BLASTn and matched with the nucleotide sequences Results of Prasinoderma sp., Nannochlorum sp., The genomic DNA of Picochlorum sp. PSDK01 Nannochloris maculata, Nannochloris atomus, was extracted and electro eluted in the agarose gel. Picochlorum sp., Picochlorum oklahomensis. The Approximately 917 bp of amplified locus of 18S mitochondrial cytochrome b sequences of P. rDNA was observed. All amplified fragments were maculatum consist of two open reading frames sequenced and analyzed against NCBI database. It (ORFs) as shown in Figure 3. was clearly observed that the sequences have a high percentage similarity which was approximately 98% with P. maculatum, complete genome (Accession No: KJ754560). Thus based on the analyses, it can be concluded that the isolated strain was identified as P. maculatum (Figure 1). The following are the systematics and characteristic features of the species. Empire EUKARYOTA Kingdom PLANTAE Phylum CHLOROPHYTA Class TREBOUXIOPHYCEAE Order CHLORELLALES Family CHLORELLALESINCERTAE SEDIS Genus NANNOCHLORIS Fig. 2—Evolutionary relationships of marine microalga Species MACULATA Picochlorum maculatum (KJ754560) DINESH KUMAR et al.: FIRST RECORD OF MARINE PHYTOPLANKTON, PICOCHLORUM MACULATUM 793 The identified functional coding regions occur in the -ce genetic relationship. The numbers of amino acids frame -1 and -3 (between the residues of 755-856, and chemical properties from the marine microalga P. 786-914). Polyadenylation signal from the P. maculatum are calculated (Table 3) and having maculatum are predicted and shown in the Table 1, composition of Neutral (82.69%), Acidic (10.72%) which play a major role in the gene expressions. Poly and Basic (6.57%) amino acids. The theoretical pI A signals in the position of 750, 585, 752, 770, 600, determined that the in particular pH the protein 739 and 554 (AATACA, TCGTAG, TACATT, sequences have not the electrical charges. Negatively CACGAT, GGGTGG, CCTACG, AGCTCC) were and positively charged residues may change the predicted for P. maculatum (Figure 4). transmembrane helices which depend upon the amount of charged particles present in the sequence. The secondary structure of P. maculatum consists 13.49% of A-helix, 29.41% of extended strand and 57.09% of random coil. Table 1—Polyadenylation signals (poly A) from the sequences of Picochlorum maculatum S. Sequence Start Sequence Score Prediction No. length position Fig. 3—The mt Cytochrome b sequences of marine microalga 1. 917 544 AGCTCC 0.01740 Positive Picochlorum maculatum: P. maculatum consists two open reading 2. 917 585 TCGTAG 0.85125 Positive frames (ORFs) 3. 917 600 GGGTGG 0.29131 Positive 4. 917 739 CCTACG 0.22563 Positive 5. 917 750 AATACA 0.32251 Positive 6. 917 752 TACATT 0.60990 Positive 7. 917 770 CACGAT 0.55106 Positive Discussion In the present investigation, the nucleotide sequences of marine phytoplankton P. maculatum are initially compared with nucleotide database in NCBI (BLASTn) website which resulted that the sequences are maximum identical of the comparison within the genus. Evolutionary relationships among multiple modes of cell division in the genus Nannochloris (chlorophyta) exposed by genome size, actin gene multiplicity and phylogeny (Yamamoto and Nozaki, 2001). Yamamota et al.3 have studied the relationship between the mother cell and their generations and found 98% of similarity with their parents and other similar cultures. Each sequence of the 18S rRNA genes is not completely the same for heterogeneity or contamination of the original culture. Misra et al.14 analyzed gene mining and metabolic pathway for maximum biofuel production from microalgae, during molecular evolution of lipid biosynthetic pathway in microalgae and confirm the close evolutionary proximity between the Streptophyte and Chlorophyte Fig. 4—The sequence of Picochlorum maculatum about
Load more

Recommended publications
  • 2019 Project Peer Review
    Functional Characterization of Cellular Metabolism U.S. Department of Energy (DOE) Bioenergy Technologies Office (BETO) 2019 Project Peer Review Advanced Algal Systems Scott Twary March 5, 2019 This presentation does not contain any proprietary, confidential, or otherwise restricted information Managed by Triad National Security, LLC for the U.S. Department of Energy’s NNSA LA-UR-19-20466 Goal Statement Goal Design an integrated strain improvement platform utilizing environmental, epigenetic, and genetic factors for targeted advances with rapid, comprehensive phenotyping leading to greater understanding of these modifications. Outcomes & Relevance Define the genetic pathway regulating nitrogen (N) sensing and signaling to produce an improved algae line with faster production due to rapid N assimilation and potentially uncouple N stress induction of lipid accumulation. Novel capability development • Integrated strain improvement strategy • Expanded suite of flow cytometry physiological assays • CRISPR/Cas genome engineering toolbox for Nannochloropsis salina • Epigenetic profiling and specific gene responses to environmental stress • EpiEffector modification and regulation of genome Los Alamos National Laboratory 3/05/19 | 2 Quad Chart Overview Barriers addressed Timeline: Ongoing Project Aft‐C. Biomass Genetics and • Current merit review period: Development: • October 1, 2017-September 30, 2020 • 33% complete Creation of novel integrated strain improvement methods and new tool applications. Total FY 17 FY 18 Total Costs Pre Costs Costs Planned Objective FY17** Funding (FY 19-Project To integrate flow cytometry, End Date) epigenome regulation, and genome engineering for elucidation of N DOE 2,200 K 650 K 1,100 K 1,334 K stress sensing and signaling and Funded application towards novel line improvement strategies Project Cost N/A End of Project Goal Share* An improved algae line with increased productivity over 30% of baseline.
    [Show full text]
  • Neoproterozoic Origin and Multiple Transitions to Macroscopic Growth in Green Seaweeds
    Neoproterozoic origin and multiple transitions to macroscopic growth in green seaweeds Andrea Del Cortonaa,b,c,d,1, Christopher J. Jacksone, François Bucchinib,c, Michiel Van Belb,c, Sofie D’hondta, f g h i,j,k e Pavel Skaloud , Charles F. Delwiche , Andrew H. Knoll , John A. Raven , Heroen Verbruggen , Klaas Vandepoeleb,c,d,1,2, Olivier De Clercka,1,2, and Frederik Leliaerta,l,1,2 aDepartment of Biology, Phycology Research Group, Ghent University, 9000 Ghent, Belgium; bDepartment of Plant Biotechnology and Bioinformatics, Ghent University, 9052 Zwijnaarde, Belgium; cVlaams Instituut voor Biotechnologie Center for Plant Systems Biology, 9052 Zwijnaarde, Belgium; dBioinformatics Institute Ghent, Ghent University, 9052 Zwijnaarde, Belgium; eSchool of Biosciences, University of Melbourne, Melbourne, VIC 3010, Australia; fDepartment of Botany, Faculty of Science, Charles University, CZ-12800 Prague 2, Czech Republic; gDepartment of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742; hDepartment of Organismic and Evolutionary Biology, Harvard University, Cambridge, MA 02138; iDivision of Plant Sciences, University of Dundee at the James Hutton Institute, Dundee DD2 5DA, United Kingdom; jSchool of Biological Sciences, University of Western Australia, WA 6009, Australia; kClimate Change Cluster, University of Technology, Ultimo, NSW 2006, Australia; and lMeise Botanic Garden, 1860 Meise, Belgium Edited by Pamela S. Soltis, University of Florida, Gainesville, FL, and approved December 13, 2019 (received for review June 11, 2019) The Neoproterozoic Era records the transition from a largely clear interpretation of how many times and when green seaweeds bacterial to a predominantly eukaryotic phototrophic world, creat- emerged from unicellular ancestors (8). ing the foundation for the complex benthic ecosystems that have There is general consensus that an early split in the evolution sustained Metazoa from the Ediacaran Period onward.
    [Show full text]
  • Lateral Gene Transfer of Anion-Conducting Channelrhodopsins Between Green Algae and Giant Viruses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.15.042127; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 5 Lateral gene transfer of anion-conducting channelrhodopsins between green algae and giant viruses Andrey Rozenberg 1,5, Johannes Oppermann 2,5, Jonas Wietek 2,3, Rodrigo Gaston Fernandez Lahore 2, Ruth-Anne Sandaa 4, Gunnar Bratbak 4, Peter Hegemann 2,6, and Oded 10 Béjà 1,6 1Faculty of Biology, Technion - Israel Institute of Technology, Haifa 32000, Israel. 2Institute for Biology, Experimental Biophysics, Humboldt-Universität zu Berlin, Invalidenstraße 42, Berlin 10115, Germany. 3Present address: Department of Neurobiology, Weizmann 15 Institute of Science, Rehovot 7610001, Israel. 4Department of Biological Sciences, University of Bergen, N-5020 Bergen, Norway. 5These authors contributed equally: Andrey Rozenberg, Johannes Oppermann. 6These authors jointly supervised this work: Peter Hegemann, Oded Béjà. e-mail: [email protected] ; [email protected] 20 ABSTRACT Channelrhodopsins (ChRs) are algal light-gated ion channels widely used as optogenetic tools for manipulating neuronal activity 1,2. Four ChR families are currently known. Green algal 3–5 and cryptophyte 6 cation-conducting ChRs (CCRs), cryptophyte anion-conducting ChRs (ACRs) 7, and the MerMAID ChRs 8. Here we 25 report the discovery of a new family of phylogenetically distinct ChRs encoded by marine giant viruses and acquired from their unicellular green algal prasinophyte hosts.
    [Show full text]
  • Neoproterozoic Origin and Multiple Transitions to Macroscopic Growth in Green Seaweeds
    bioRxiv preprint doi: https://doi.org/10.1101/668475; this version posted June 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Neoproterozoic origin and multiple transitions to macroscopic growth in green seaweeds Andrea Del Cortonaa,b,c,d,1, Christopher J. Jacksone, François Bucchinib,c, Michiel Van Belb,c, Sofie D’hondta, Pavel Škaloudf, Charles F. Delwicheg, Andrew H. Knollh, John A. Raveni,j,k, Heroen Verbruggene, Klaas Vandepoeleb,c,d,1,2, Olivier De Clercka,1,2 Frederik Leliaerta,l,1,2 aDepartment of Biology, Phycology Research Group, Ghent University, Krijgslaan 281, 9000 Ghent, Belgium bDepartment of Plant Biotechnology and Bioinformatics, Ghent University, Technologiepark 71, 9052 Zwijnaarde, Belgium cVIB Center for Plant Systems Biology, Technologiepark 71, 9052 Zwijnaarde, Belgium dBioinformatics Institute Ghent, Ghent University, Technologiepark 71, 9052 Zwijnaarde, Belgium eSchool of Biosciences, University of Melbourne, Melbourne, Victoria, Australia fDepartment of Botany, Faculty of Science, Charles University, Benátská 2, CZ-12800 Prague 2, Czech Republic gDepartment of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742, USA hDepartment of Organismic and Evolutionary Biology, Harvard University, Cambridge, Massachusetts, 02138, USA. iDivision of Plant Sciences, University of Dundee at the James Hutton Institute, Dundee, DD2 5DA, UK jSchool of Biological Sciences, University of Western Australia (M048), 35 Stirling Highway, WA 6009, Australia kClimate Change Cluster, University of Technology, Ultimo, NSW 2006, Australia lMeise Botanic Garden, Nieuwelaan 38, 1860 Meise, Belgium 1To whom correspondence may be addressed. Email [email protected], [email protected], [email protected] or [email protected].
    [Show full text]
  • Comparing Relative Rates of Molecular Evolution Between Freshwater and Marine Eukaryotes
    ORIGINAL ARTICLE doi:10.1111/evo.13000 Do saline taxa evolve faster? Comparing relative rates of molecular evolution between freshwater and marine eukaryotes T. Fatima Mitterboeck,1,2,3 Alexander Y. Chen,1,2 Omar A. Zaheer,1,2 EddieY.T.Ma,1,2,4 and Sarah J. Adamowicz1,2 1Biodiversity Institute of Ontario, University of Guelph, Guelph, Ontario N1G 2W1, Canada 2Department of Integrative Biology, University of Guelph, Guelph, Ontario N1G 2W1, Canada 3E-mail: [email protected] 4School of Computer Science, University of Guelph, Guelph, Ontario N1G 2W1, Canada Received June 8, 2015 Accepted June 28, 2016 The major branches of life diversified in the marine realm, and numerous taxa have since transitioned between marine and freshwaters. Previous studies have demonstrated higher rates of molecular evolution in crustaceans inhabiting continental saline habitats as compared with freshwaters, but it is unclear whether this trend is pervasive or whether it applies to the marine environment. We employ the phylogenetic comparative method to investigate relative molecular evolutionary rates between 148 pairs of marine or continental saline versus freshwater lineages representing disparate eukaryote groups, including bony fish, elasmobranchs, cetaceans, crustaceans, mollusks, annelids, algae, and other eukaryotes, using available protein-coding and noncoding genes. Overall, we observed no consistent pattern in nucleotide substitution rates linked to habitat across all genes and taxa. However, we observed some trends of higher evolutionary rates within protein-coding genes in freshwater taxa—the comparisons mainly involving bony fish—compared with their marine relatives. The results suggest no systematic differences in substitution rate between marine and freshwater organisms.
    [Show full text]
  • Diapositive 1
    1 Diversity and ecology of green microalgae in marine systems: 2 an overview based on 18S rRNA sequences 3 4 Margot Tragin1, Adriana Lopes dos Santos1, Richard Christen2, 3, Daniel Vaulot1* 5 1 Sorbonne Universités, UPMC Univ Paris 06, CNRS, UMR 7144, Station Biologique, Place 6 Georges Teissier, 29680 Roscoff, France 7 2 CNRS, UMR 7138, Systématique Adaptation Evolution, Parc Valrose, BP71. F06108 Nice 8 cedex 02, France 9 3 Université de Nice-Sophia Antipolis, UMR 7138, Systématique Adaptation Evolution, Parc 10 Valrose, BP71. F06108 Nice cedex 02, France 11 12 13 * corresponding author : [email protected] 14 Revised version : 28 March 2016 15 For Perspectives in Phycology 16 17 Tragin et al. - Marine Chlorophyta diversity and distribution - p. 2 18 Abstract 19 Green algae (Chlorophyta) are an important group of microalgae whose diversity and ecological 20 importance in marine systems has been little studied. In this review, we first present an overview of 21 Chlorophyta taxonomy and detail the most important groups from the marine environment. Then, using 22 public 18S rRNA Chlorophyta sequences from culture and natural samples retrieved from the annotated 23 Protist Ribosomal Reference (PR²) database, we illustrate the distribution of different green algal 24 lineages in the oceans. The largest group of sequences belongs to the class Mamiellophyceae and in 25 particular to the three genera Micromonas, Bathycoccus and Ostreococcus. These sequences originate 26 mostly from coastal regions. Other groups with a large number of sequences include the 27 Trebouxiophyceae, Chlorophyceae, Chlorodendrophyceae and Pyramimonadales. Some groups, such as 28 the undescribed prasinophytes clades VII and IX, are mostly composed of environmental sequences.
    [Show full text]
  • UNDERSTANDING the GENOMIC BASIS of STRESS ADAPTATION in PICOCHLORUM GREEN ALGAE by FATIMA FOFLONKER a Dissertation Submitted To
    UNDERSTANDING THE GENOMIC BASIS OF STRESS ADAPTATION IN PICOCHLORUM GREEN ALGAE By FATIMA FOFLONKER A dissertation submitted to the School of Graduate Studies Rutgers, The State University of New Jersey In partial fulfillment of the requirements For the degree of Doctor of Philosophy Graduate Program in Microbial Biology Written under the direction of Debashish Bhattacharya And approved by _________________________________________________ _________________________________________________ _________________________________________________ _________________________________________________ New Brunswick, New Jersey January 2018 ABSTRACT OF THE DISSERTATION Understanding the Genomic Basis of Stress Adaptation in Picochlorum Green Algae by FATIMA FOFLONKER Dissertation Director: Debashish Bhattacharya Gaining a better understanding of adaptive evolution has become increasingly important to predict the responses of important primary producers in the environment to climate-change driven environmental fluctuations. In my doctoral research, the genomes from four taxa of a naturally robust green algal lineage, Picochlorum (Chlorophyta, Trebouxiphycae) were sequenced to allow a comparative genomic and transcriptomic analysis. The over-arching goal of this work was to investigate environmental adaptations and the origin of haltolerance. Found in environments ranging from brackish estuaries to hypersaline terrestrial environments, this lineage is tolerant of a wide range of fluctuating salinities, light intensities, temperatures, and has a robust photosystem II. The small, reduced diploid genomes (13.4-15.1Mbp) of Picochlorum, indicative of genome specialization to extreme environments, has resulted in an interesting genomic organization, including the clustering of genes in the same biochemical pathway and coregulated genes. Coregulation of co-localized genes in “gene neighborhoods” is more prominent soon after exposure to salinity shock, suggesting a role in the rapid response to salinity stress in Picochlorum.
    [Show full text]
  • Supporting Information
    Supporting Information Méheust et al. 10.1073/pnas.1517551113 S-Gene Expression Analysis extracellular domain. This novel protein is found only in green Given that the analysis using dozens of algal and protist genomic algae and plants, and may play a role in responding to salt stress. datasets showed that homologs of all of the S genes are expressed, For S genes present in the diatom Phaeodactylum tricornutum, we asked whether some of them might be differentially expressed we used RNA-seq data from ref. 30 that compared cultures in response to stress. This question was motivated by two ob- grown under control and nitrogen (N)-depleted conditions. This servations: (i) The composite genes entered eukaryote nuclear analysis showed that out of six families present in this alga (2, 1, genomes via primary endosymbiosis, and therefore they may still 28, 20, 35, 61), three are differentially expressed under N stress retain ancient cyanobacterial functions even when fused to novel (28, 35, 61). One of these is family 28, which encodes an domains, and (ii) many of the S genes are redox enzymes or N-terminal bacterium-derived, calcium-sensing EF-hand domain encode domains involved in redox regulation, and therefore their fused, intriguingly, to a cyanobacterium-derived region with sim- roles may involve sensing and/or responding to cellular stress ilarity to the plastid inner-membrane proten import component resulting from the oxygen-evolving photosynthetic organelle. To Tic20, which acts as a translocon channel. This fused protein may + address this issue, we inspected RNA-seq data from organisms use Ca2 as a signal for protein import, and is found in several that encoded particular S genes that had either been generated stramenopile (brown algal) species.
    [Show full text]
  • Characterization of a Lipid-Producing Thermotolerant Marine Photosynthetic Pico-Alga in the Genus Picochlorum (Trebouxiophyceae)
    European Journal of Phycology ISSN: (Print) (Online) Journal homepage: https://www.tandfonline.com/loi/tejp20 Characterization of a lipid-producing thermotolerant marine photosynthetic pico-alga in the genus Picochlorum (Trebouxiophyceae) Maja Mucko , Judit Padisák , Marija Gligora Udovič , Tamás Pálmai , Tihana Novak , Nikola Medić , Blaženka Gašparović , Petra Peharec Štefanić , Sandi Orlić & Zrinka Ljubešić To cite this article: Maja Mucko , Judit Padisák , Marija Gligora Udovič , Tamás Pálmai , Tihana Novak , Nikola Medić , Blaženka Gašparović , Petra Peharec Štefanić , Sandi Orlić & Zrinka Ljubešić (2020): Characterization of a lipid-producing thermotolerant marine photosynthetic pico-alga in the genus Picochlorum (Trebouxiophyceae), European Journal of Phycology, DOI: 10.1080/09670262.2020.1757763 To link to this article: https://doi.org/10.1080/09670262.2020.1757763 View supplementary material Published online: 11 Aug 2020. Submit your article to this journal Article views: 11 View related articles View Crossmark data Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=tejp20 British Phycological EUROPEAN JOURNAL OF PHYCOLOGY, 2020 Society https://doi.org/10.1080/09670262.2020.1757763 Understanding and using algae Characterization of a lipid-producing thermotolerant marine photosynthetic pico-alga in the genus Picochlorum (Trebouxiophyceae) Maja Muckoa, Judit Padisákb, Marija Gligora Udoviča, Tamás Pálmai b,c, Tihana Novakd, Nikola Mediće, Blaženka Gašparovićb, Petra Peharec Štefanića, Sandi Orlićd and Zrinka Ljubešić a aUniversity of Zagreb, Faculty of Science, Department of Biology, Rooseveltov trg 6, 10000 Zagreb, Croatia; bUniversity of Pannonia, Department of Limnology, Egyetem u. 10, 8200 Veszprém, Hungary; cDepartment of Plant Molecular Biology, Agricultural Institute, Centre for Agricultural Research, Brunszvik u.
    [Show full text]
  • Выбор Подхода При Идентификации Почвенных Коккоидных Зеленых Микроводорослей (Trebouxiophyceae, Chlorophyta) © 2018 Г
    Бюллетень Почвенного института им. В.В. Докучаева. 2018. Вып. 93 УДК 631.466.3 ВЫБОР ПОДХОДА ПРИ ИДЕНТИФИКАЦИИ ПОЧВЕННЫХ КОККОИДНЫХ ЗЕЛЕНЫХ МИКРОВОДОРОСЛЕЙ (TREBOUXIOPHYCEAE, CHLOROPHYTA) © 2018 г. А. Д. Темралеева*, С. В. Москаленко, Е. А. Портная Институт физико-химических и биологических проблем почвоведения РАН, Россия, 142290 Пущино, ул. Институтская, 2 * http://orcid.org/0000-0002-3445-0507 е-mail: [email protected] Описываются морфологический и молекулярно-генетический подходы, использованные при идентификации зеленых микроводорослей класса Trebouxiophyceae из коллекции ACSSI. В бурой полупустынной и кашта- новой почвах были обнаружены водоросли Muriella terrestris, в погребен- ной лугово-каштановой почве – Edaphochlorella mirabilis. Еще 3 штамма являются новыми неописанными таксонами: ACSSI 014 – новый вид рода Watanabea, изолированный из серой лесной почвы и имеющий пиреноид с крахмальной обверткой в отличии от типового вида, и ACSSI 104 и 144 – Nannochloris-подобный род, представители которого найдены в солонце и каштановой почве и обладают скудными морфологическими признаками. Показано, что ни один критерий в отдельности: морфологический или иной признак, вычисление генетических дистанций, анализ и сравнение вторичной структуры ITS2, поиск компенсаторных замен и молекулярных подписей – не позволяет надежно классифицировать таксоны. В связи с чем необходимо использовать полифазный подход в систематике водорос- лей, особенно при идентификации таксонов с простой клеточной морфо- логией, которые часто встречаются в почвах. Ключевые слова: дистанции, молекулярные подписи, 18S рРНК, вторич- ная структура ITS2, ACSSI DOI: 10.19047/0136-1694-2018-93-105-120 ВВЕДЕНИЕ Почвенные водоросли – разнообразная группа фототрофных микроорганизмов, обитающих на поверхности и в толще почвы и отражающих ее генезис и состояние (Штина и др., 1998). Про- и эу- кариотические водоросли являются неотъемлемым компонентом почвенной микрофлоры и выполняют важные функции накопления 105 Бюллетень Почвенного института им.
    [Show full text]
  • (Trebouxiophyceae, Chlorophyta), a Green Alga Arises from The
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.901074; this version posted November 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Chroococcidiorella tianjinensis, gen. et sp. nov. (Trebouxiophyceae, 2 Chlorophyta), a green alga arises from the cyanobacterium TDX16 3 Qing-lin Dong* & Xiang-ying Xing 4 Department of Bioengineering, Hebei University of Technology, Tianjin, 300130, China 5 *Corresponding author: Qing-lin Dong ([email protected]) 6 Abstract 7 All algae documented so far are of unknown origin. Here, we provide a taxonomic 8 description of the first origin-known alga TDX16-DE that arises from the 9 Chroococcidiopsis-like endosymbiotic cyanobacterium TDX16 by de novo organelle 10 biogenesis after acquiring its green algal host Haematococcus pluvialis’s DNA. TDX16-DE 11 is spherical or oval, with a diameter of 2.0-3.6 µm, containing typical chlorophyte pigments 12 of chlorophyll a, chlorophyll b and lutein and reproducing by autosporulation, whose 18S 13 rRNA gene sequence shows the highest similarity of 99.7% to that of Chlorella vulgaris. 14 However, TDX16-DE is only about half the size of C. vulgaris and structurally similar to C. 15 vulgaris only in having a chloroplast-localized pyrenoid, but differs from C. vulgaris in that 16 (1) it possesses a double-membraned cytoplasmic envelope but lacks endoplasmic 17 reticulum and Golgi apparatus; and (2) its nucleus is enclosed by two sets of envelopes 18 (four unit membranes). Therefore, based on these characters and the cyanobacterial origin, 19 we describe TDX16-DE as a new genus and species, Chroococcidiorella tianjinensis gen.
    [Show full text]
  • Trebouxiophyceae, Chlorophyta), with Establishment Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.901074; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Chroococcidiorella tianjinensis, gen. et sp. nov. (Trebouxiophyceae, 2 Chlorophyta), a green alga arises from the cyanobacterium TDX16 3 Qing-lin Dong and Xiang-ying Xing 4 Department of Bioengineering, Hebei University of Technology, Tianjin, 300130, China 5 Corresponding author: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.901074; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 6 ABSTRACT 7 We provide a taxonomic description of the first origin-known alga TDX16-DE that arises from 8 the Chroococcidiopsis-like endosymbiotic cyanobacterium TDX16 by de novo organelle 9 biogenesis after acquiring its green algal host Haematococcus pluvialis’s DNA. TDX16-DE is 10 spherical or oval, with a diameter of 2.9-3.6 µm, containing typical chlorophyte pigments of 11 chlorophyll a, chlorophyll b and lutein and reproducing by autosporulation, whose 18S rRNA 12 gene sequence shows the highest similarity of 99.8% to that of Chlorella vulgaris. However, 13 TDX16-DE is only about half the size of C. vulgaris and structurally similar to C. vulgaris only 14 in having a chloroplast-localized pyrenoid, but differs from C. vulgaris in that (1) it possesses a 15 double-membraned cytoplasmic envelope but lacks endoplasmic reticulum and Golgi apparatus; 16 and (2) its nucleus is enclosed by two sets of envelopes (four unit membranes).
    [Show full text]