fBooy nvriyo tAdes M,NrhHuh tAdesK1 9ST, KY16 Andrews St Haugh, North BMS, Andrews, St UK. of University Biology, of rti m oehrwt M nnua trafficking neural Prescott R. in Alan SMN with snRNP together core SmB the protein implicates proteomics quantitative Time-resolved ARTICLE RESEARCH ß 812 2013 November 30 Accepted 2013; June 30 Received pathological specific spinal 1 the whether al., condition unclear et currently Lefebvre neurodegenerative 1995; is al., the It et inherited been 1997). (Lefebvre (SMA) has the atrophy process SMN muscular of in This levels complex lowered 2006). because result the neurons) al., attention onto considerable motor et of core subject (survival Battle Sm the by SMN Sm- of (reviewed the the Assembly onto requires snRNA. assembled the snRNA is 3 of proteins the site Sm of binding core 5 trimming of the and ring snRNA heptameric of the hypermethylation in of RNAs events including cap nuclear early occur where small maturation cytoplasm the the snRNP nucleus, into the exported transcription in are their (snRNAs) II Following complex polymerase the 2011). a RNA al., stages With by have et nuclear Fischer snRNPs and pre-mRNA. by cytoplasmic U (reviewed involving from splicing biogenesis for introns of snRNP, required pathway U6 of spliceosome of the splicing exception of by and components U5 removal essential U4, U2, are U1, snRNPs, U6 spliceosomal uridine-rich five The INTRODUCTION protein neuron motor of Survival atrophy, muscular SMN, Spinal Vesicles, snRNPs, protemics, SILAC WORDS: KEY in roles diverse metabolism. more play RNA might cellular that role some a and play biogenesis which snRNP of in some vesicles, that related protein-trafficking propose of levels We family mobility. cellular a and represent SmB morphology the these their on splicing for SmB dependent mobile and are mature SMN which of highly cells, or neural identified in assembled vesicles We newly time- use either snRNPs. associate we that with proteins Here, identify preferentially unknown. to are proteomics quantitative biogenesis resolved snRNP of cytoplasmic the stages of organization physical the of Details muscular (SMA). SMN for spinal atrophy of condition, neurodegenerative Insufficiency required snRNP. inherited the the is to in complex proteins results Sm protein core the neuron) of motor addition (survival particular, SMN In cytoplasm. the the cell in place the take of that nucleus stages the key including in but ending and beginning process, complex a is ribonucleoproteins) nuclear (small snRNPs splicing of biogenesis The ABSTRACT Ato o orsodne([email protected]) correspondence for 8M5, *Author K1H ON Ottawa, Road, Smyth 451 Ottawa, Canada. of University Biology, Systems olg fLf cecs nvriyo ude udeD15H UK. 5EH, DD1 Dundee Dundee, of University Sciences, Life of College 04 ulse yTeCmayo ilgssLd|Junlo elSine(04 2,8287doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal | Ltd Biologists of Company The by Published 2014. 3 eateto ellradMlclrMdcn n taaIsiueof Institute Ottawa and Medicine Molecular and Cellular of Department 1 lxnr Bales Alexandra , 9 2 onJames John , n.Adtoal,a Additionally, end. 2 School 1 ar Trinkle-Mulcahy Laura , 9 otesRAdrn sebyo h nN sunknown. In cytoplasmic debate. is SMN-rich of snRNP subject of the a role been of and has assembly the identity accumulations 2003), during proteins the Sm al., snRNA Furthermore, of et addition the Sleeman the of 1998; to organization al., and and location (Liu et cellular SMN cytoplasm, Pellizzoni mutant the 2007; or in SMN Gall, SMN overexpressing and/or cells in proteins made primarily Sm been of have reports motor accumulations for numerous of roles Although uncharacterized, spinal snRNP cells. yet neural splicing as in for predominantly other, SMN in capacity defects decreased affect by or a maturation by which caused are SMA, neurons, in defects aebe rpsdt lyarl nsRPasml,whereas assembly, snRNP in 2007), role Gall, a and play (Liu to SMN proposed and been have snRNAs contain which bodies, set fclua N eaoim h m-adSMN-rich and by SmB- disrupted differentiation, The neural several during metabolism. upregulated in are involved RNA vesicles are cellular they of that suggesting aspects SmB, stages. and other SMN constituents distinct their than Unexpectedly, in heterogeneous SMN. be two novel to and appear of vesicles SmB these these family in a enriched at revealed vesicles, data snRNPs cytoplasmic with these of by combined informed interactomes then Investigations was the in 2002), comparisonof acids facilitate al., to amino spectrometry mass This different et and by purification lysine. affinity labeling (Ong containing and isotope (SILAC) arginine stable media culture acids as by amino culture known achieved essential technique, tissue the was of in FP–SmB) isotopes cells expressing stably culturing mature FP-tagged (lines versus snRNPs FP–SmB) snRNPs with assembled newly transfected FP–tagged (transiently containing cells we of Differential SMA, labeling approach. to proteomic quantitative relevance time-resolved in a potential used biogenesis, of snRNP stages splicing cytoplasmic of particular stages different of spliceosomes 2011). organization Lamond, active splicing and to in Spector recruited by stored (reviewed are be these required they to that when which believed assumed the from into are is re-imported speckles snRNPs it been has but Mature snRNP the out, nucleus. or after carried where added exactly proteins are are known proteins the not stages contains is these it each snRNP Again, how to U1 U1C). specific and example, proteins U170K (for U1A, additional snRNP of of number involves class a snRNPs of of addition maturation the Further the where partially modified. (CB) imported, is the body Once snRNA Cajal function. core, core the nucleus. in the protein neuron transiently into accumulate Sm snRNPs imported motor the is for snRNP of assembled assembly required local the the Todd in mRNAs role 2010a; the Following proposed al., a of et with in 2006), Todd al., translation 2005; et 2001; implicated al., Zhang al., 2010b; et et al., Sharma 2011; been et Jablonka 2011; al., 2011; al., al., et have et et Fallini Peter Hubers 2010; 2002; proteins, al., Simard, and et Sm Fan (Fallini mRNAs lack of localization some to in reported cells, cases neural mammalian in structures SMN-rich nodrt isc h oeua ehnssadsubcellular and mechanisms molecular the dissect to order In 3 n uihE Sleeman E. Judith and 2, Drosophila * ,U

Journal of Cell Science u rvosaayi fteslcn nN auainpathway maturation snRNP splicing the of and analysis time-dependent previous a Our in snRNPs preferential made manner the newly concentration-independent enables and SmB mature protein of snRNP labeling core the of Expression RESULTS highly are implicatin and neurites, SmB of in expression mobile reduced or SMN of overexpression ARTICLE RESEARCH h M ope) n ebr ftePM5cytoplasmic PRMT5 the of members other 1). (Table and and complex methylation complex), of proteins (members SMN proteins gemin snRNP the the of of several groups non-Sm and key SMN factors, include Other splicing screen. which, identified the of of U7 of proteins Detection sensitivity low-abundance processing. one the the RNA histone and of confirms in core Lsm11 U6 role the a snRNP plays in which SmB splicing snRNP, to with of present addition is core Lsm11, of In the five family, protein form 2008). Sm) (like which Lsm al., the we complex, of members Sm et core six identified the of (Trinkle-Mulcahy members six remaining cells the identifying reagents same HeLa the using in established previously proteome’ ‘bead the in presence their of because contaminants likely deemed were which by 1B). GFP-Trap assessed (Fig. (Chromotek) high-affinity beads the carried was agarose the was isolation harvesting using The protein S1). out before Fig. material YFP–SmB immediately (supplementary cells the microscopy fluorescence subcellular of whereas The before speckles. nuclear 2003), hours, transiently distribution in 24 accumulated cells al., after had snRNPs the harvested from the et and isolated of YFP–SmB (Sleeman with were version transfected snRNPs SmB assembled YFP-tagged protein newly non- a snRNP of cell expressing a core elimination from constitutively isolated ready were line the snRNPs Mature and and contaminants. mature specific snRNPs between the assembled proteins of interacting newly comparison of quantitative and distribution a relative allows purification which affinity stable labeling, differential an isotope involving strategy adopted (AP/MS) we spectrometry mass biogenesis, stages different snRNP in involved of complexes snRNPs about splicing information mature gain and To assembled the newly in of differences interactomes identifies proteomics time-resolved the Quantitative processing assessed before be analysis. immediately proteomic to microscopy for snRNPs cells cell tagged live of maturity using Sm Importantly the tagged present. fluorescently enables mature, of snRNPs use proteins are the assembled approach, snRNPs experimental newly our FP-tagged few for expres- assembled a of stably only cells majority newly with In the of 1A). mature FP–SmB, (Fig. localized nucleus sing snRNPs differently assembled the in newly into results and This import expressing monitored. the pre-existing snRNPs constitutively CFP– and expressing of cells constitutively This cells SmB, HeLa localization with snRNPs. fused cell. be the can splicing YFP–SmB the influence for within not maturation snRNPs of does pathway pathway this S1), (Sleeman a Fig. material speckles (supplementary defines reaching 2007) Sleeman before 2001; al., proteins snRNPs et Sm into the splicing the assembled Because in 1999). forming are before snRNPs Lamond, to and splicing cytoplasm, (Sleeman prior mature speckles the bodies of in localization Cajal steady-state diffusely in Sm detected transiently expressed accumulating first newly that are revealed proteins proteins Sm FP-tagged using hstm-eovdsre dniidattlo 4 rtis 5 of 152 proteins, 344 of total a identified screen time-resolved This hmi h ahlg fSMA. of pathology the in them g H egn ojgtdto conjugated reagent enwdl eotdt akS rtis edn othe to leading proteins, Sm lack have to These 2006). al., reported et Zhang widely Todd 2010b; 2005; al., al., et been et Todd Sharma 2010a; 2011; 2010; also al., al., al., et et have et Peter (Fallini granules 2001; cells al., SMN-rich neural et of Jablonka 2007). cytoplasm Gall, the in and detected been Liu 2010; al., in SMN implicated et snRNPs, in been overexpressing have containing maturation complex snRNP SMN cells U-bodies splicing the whereas of in members 2003), and reported SMN al., been et have (Sleeman proteins SMN Sm containing and accumulations cytoplasmic SH-SY5Y cells, line HeLa the cell In in neuroblastoma structures human punctate of mobile neurites highly forms SmB FP-tagged eosrtn ocuieyfrtefrttm htF-agdSm FP-tagged interactome, that protein non-snRNP time Sm first other the of the in and for number present conclusively Sm also large demonstrating and are the a enriched factors were chosen Importantly, splicing highly interactors proteins. most the snRNP snRNP The below mature significant. fell abundant not still therefore Although was it protein. ( highly cells snRNPs), transfected threshold bait most transiently assembled from YFP–SmB the down (newly pulled the expected, was by more was As slightly (normalized protein protein 2B). (Fig. enriched particular weight) that all molecular for of be intensities measure summed can identified the assembled abundance versus directly peptides ratios relative newly these about plotting newly ratios versus by information added (H) with and H:M mature snRNPs, co-purify log (M) with (purple) enrichment The relative factors snRNPs. larger transport factors a assembled whereas splicing of snRNPs, mature non-snRNP with number Sm samples, enriched more although are both are (orange) example, (green) in proteins For snRNP enriched other 2A). clearly interaction several (Fig. differences and key pools (yellow) identifies highlights proteins two and clearly the novel, and between snRNPs known newly both M:L) versus partners, H:L) (log (log mature assembled with background above proteins ntesre,fligjs usd h hehl eiigproteins snRNPs. defining assembled threshold newly potential the with outside interacting of just preferentially falling identified are screen, also SMA. was the of (DYNCILI2) assembly in pathology chain intermediate molecular snRNP particular light the Dynein of with of understanding in associated was stages importance usually vesicles Early are coatomer snRNP trafficking interest. which and reticulum of gamma, protein, heavy endoplasmic and motor stages dynein physical beta of associated early the identification proteins microtubule the the about a cytoplasm, chain: known of the of in is dynamics number assembly little a and in and Because snRNPs organization new 2007) cytoplasm. of new trafficking newly of (Sleeman, the the targeting in the bodies involved the have potentially in in Cajal we proteins role which to highly a Crm1, have snRNPs more include to demonstrated enriched also Cajal previously sample prominent Proteins snRNP Sleeman their 2001). 2006; assembled Shpargel, by is and al., evidenced Matera This 2008; et as al., highly sample. et is cells, (Kaiser maturation bodies assembled HeLa snRNP in that newly suggestion active the the a with in show consistent they that enrichment indicating are axis, proteins the slight Sm below slightly of and or methylation near complex in plotted SMN involved be the complex to PRMT5 including known the maturation proteins snRNP the of in also Most involved are spliceosome. but the snRNPs, into splicing into recruited assembled only not are proteins ietcmaio ftedge fercmn fdetected of enrichment of degree the of comparison Direct ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal . o bv rblwtemda o :)and H:M) log median the below or above log 1 Drosophila g hmes(Cauchi chambers egg 813

Journal of Cell Science EERHARTICLE RESEARCH agdSBi h ua erbatm elln,SH-SY5Y. line, cell 814 mCherry- neuroblastoma of human distribution the SMA cytoplasmic in for the significance SmB investigate its tagged to and us cells of neural led stages neural-specific in cytoplasmic of alternative maturation importance snRNP in potential The involved SMN. an for are which intensity roles between they Maximum Y CBs. that and as th X well suggestion to points as confined indicating asterisk) iv, are (cyan snRNPs in speckles (YFP–tagged) shown in imported is CFP–SmB antibodies newly C with using that and tagged confirmed demonstrates A,B snRNPs is profile in steady-state body intensity seen exp of Cajal The cells 0.2 presence constitutively v. the of fused cell the in of projections the shown the despite identity of is In asterisk), The view CFP–SmB fusion. (green (arrow). Enlarged and after CB body iii). YFP–SmB hour Cajal in of 1 the signal profile fixed to (white intensity and localize SMN glycol YFP–SmB and polyethylene with coilin using tagged to fused snRNPs (ii) imported CFP–SmB newly and CFP–SmB, (i) YFP–SmB expressing constitutively 1. Fig. el sebe YPSB rnin)admtr YPSB tbe piigsnRNPs. splicing stable) (YFP–SmB, mature and transient) (YFP–SmB, assembled newly A piigsRP a elbldi iedpnetmne oietf el sebe essmtr opee.HL ellines cell HeLa complexes. mature versus assembled newly identify to manner time-dependent a in labeled be can snRNPs Splicing (A) m etostruhtesml.Saebr 10 bar: Scale sample. the through sections m m .()Dsg fteqatttv fiiyioaineprmnscmaigteitrcoe of interactomes the comparing experiments isolation affinity quantitative the of Design (B) m. yols Fg ) yolsi tutrswr o bevdin 2012), observed the not within were al., structures structures Cytoplasmic SH-SY5Y et punctate 3). (Fig. moving, the (Clelland cytoplasm rapidly in small, background mCherry–SmB revealed neuroblastoma expressing stably human SHY5mCherrySmB line, the of cell microscopy fluorescence Time-lapse ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal ressing e

Journal of Cell Science Maturation piigfactors Splicing Transport te nN proteins snRNP Other al .Dsrbto fitrcosbtenmtr n el aesnRNPs made newly and mature between interactors of Distribution 1. Table ARTICLE RESEARCH otne overleaf Continued s proteins Lsm proteins Sm protein) (bait GFP–SmB 8X5GMN 3 GEMIN6 Q8WXD5 167SN 5 SMN1 Q16637 9Q1WR71 .904 .7M M 0.17 0.17 0.48 0.29 0.19 0.03 2 12 28 GEMIN7 WDR77 PRMT5 Q9H840 Q9BQA1 O14744 656SNRP1 SYNCRIP O60506 515CN1 8 CLNS1A P54105 095SR11 SFRS1 Q07955 148S32306 .915 M 1.56 2.29 0.68 1 3 SFRS10 SF3A2 P62995 Q15428 184S332 SF3A3 Q12874 9M4PP1 1 PRPF19 Q9UMS4 950TP311.85 1 TNPO3 Q9Y5L0 149S31505 .820 M M M 2.05 2.21 2.23 2.58 2.66 2.89 0.59 0.07 0.02 2 5 8 9 BCAS2 SF3A1 SART3 SF3B2 O75934 Q15459 Q15020 Q13435 427DN1I 1.31 1 DYNC1LI2 O43237 996SF 1 SYF2 O95926 817NP321.55 2 NUP93 Q8N1F7 153SW 1 SNW1 Q13573 9I9XO 1.31 2 XPO7 Q9UIA9 001UA11 U2AF1 Q01081 194KN1303 .902 M 0.26 0.99 0.15 0.32 1 3 KPNA4 KPNB1 O00629 Q14974 5G9UP98 USP39 Q53GS9 011NB11 NCBP1 Q09161 059SRB 014 .322 M M 2.26 2.28 4.43 4.66 1.41 2.03 2 10 15 SNRPC SNRPB2 SNRPA1 P09234 P08579 P09661 002STN 2 SPTBN1 Q01082 061SR7 .833 .8M M M 2.68 M 2.71 M M 2.80 M 2.81 2.85 3.34 2.86 4.49 2.91 4.30 4.09 0.28 4.47 4.40 1.24 3.56 0.90 0.81 1.11 0.80 9 0.47 1 14 85 29 U1SNRNPBP 96 17 SNRP70 28 SNRPA Q16560 PRPF8 EFTUD2 P08621 ASCC3L1 P09012 WDR57 Q6P2Q9 Q15029 DDX23 O75643 Q96DI7 Q9BUQ8 8E6GMN .50.06 0.17 0.95 0.57 3 2 5 SPTAN1 GEMIN5 GEMIN4 Q13813 Q8TEQ6 P57678 996PP62 .843 .0M M M M 2.60 2.67 M 2.76 M 2.82 2.84 4.37 2.85 2.84 3.36 3.12 3.57 1.08 3.34 0.37 0.30 0.56 0.42 0.41 8 21 2 8 9 14 6 PRPF31 PRPF6 NHP2L1 PRPF4 Q8WWY3 SART1 O94906 PRPF3 P55769 CD2BP2 O43172 O43290 O43395 O95400 9H6DX070.25 7 DDX20 Q9UHI6 nPo Gene UniProt 933LM .028 .3M M M M 2.23 M 2.27 2.53 2.62 M 2.62 M M 2.85 M 1.15 2.96 M 3.25 2.20 2.53 2.89 M 2.53 3.44 2.64 0.30 0.64 2.67 1.95 0.45 4.51 0.25 3.94 4.49 0.53 2 5.13 2 0.63 5.01 3 1.75 0.34 1.41 0.87 1 1 1.54 3 2.51 2.42 LSM4 4 3.38 LSM2 4.20 5 LSM11 4 5 LSM5 Q9Y4Z0 LSM3 2 Q9Y333 LSM8 P83369 8 SNRPD3 Q9Y4Y9 18 11 SNRPD1 P62310 SNRPE O95777 SNRPF P62318 SNRPG P62314 SNRPD2 P62304 SNRPB P62306 P62308 GFP P62316 P14678 Q9U6Y5 183SP 0.04 1 SIP1 O14893 934SRP3 STRAP Q9Y3F4 peptides no. Total ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal lgM:L) (log Immature 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 0.65 0.63 .602 0.08 0.26 0.26 0.85 .203 .0M 0.50 0.37 0.22 0.79 0.98 .417 .3M 1.83 1.70 0.14 .418 .6M 1.86 1.83 1.64 .612 .1M 1.91 1.28 0.26 .328 .3M 2.53 2.83 0.03 .323 .3M 1.93 2.30 0.23 .900 .5M 0.55 0.04 0.79 .714 .1M 1.51 1.47 0.27 0.44 .617 .1M 2.11 1.76 0.36 .614 .2M 1.62 1.46 0.46 .826 .7M 2.47 2.60 2.38 .414 .6M 1.86 1.47 0.54 .515 .0M 1.70 1.58 0.25 .325 .5M 2.15 2.52 0.03 0.48 2 2 2 2 2 2 2 2 2 2 2 2 2 2 lgH:L) (log Mature 0.72 0.55 .802 M 0.24 0.28 .103 M 0.33 0.31 .104 M 0.43 0.41 0.22 1.15 0.29 0.12 .805 M 0.58 0.46 0.08 0.13 0.03 0.29 2 2 2 2 2 2 2 2 2 2 2 2 2 2 lgHM Pref H:M) (log Comparison 0.24 0.03 .4I 2.04 1.84 1.64 1.62 1.53 1.03 0.57 0.53 0.44 1.73 1.69 0.26 ------815

Journal of Cell Science n oa ubro etdsdtce.Tefl aae spoie ssplmnaymtra al S1. Table material supplementary gen numbers, as accession provided UniProt is are here dataset listed full Also italics. The in detected. shown peptides are both of was with number compariso enriched H:M equally total Direct log was Proteins expression. and indicated. H:M their is log M:L) if median snRNPs (log snRNPs the (I) experiment transient immature of this or or class In (M) ratios. H:L) particular H:M (log a log their with stable by more either determined is enriched following snRNPs down made SIL newly pulled Log and experiment. YFP–SmB mature AP/MS with for quantitative enrichment our shown in are YFP–SmB with background co-purifying above as identified enrichment proteins of classes specific highlighting dataset Annotated al .continued 1. Table ARTICLE RESEARCH 816 chain coatomer the of heavy subunits two transport dynein and for microtubules, responsible complex, identified along motor cargo molecular screen a of of SILAC part (DYNHCI), initial in Our complex coatomer the vesicles and cytoplasmic dynein with interacts mCherry–SmB to adjacent found size. were similar vesicles of these structures cases, some granular d In nm 4). 50 (Fig. electron around outline of is vesicles transmission and signal in mCherry–SmB confocal the found resulting that subsequent revealed the images of microscope for electron alignment spatial processed Careful microscopy. cells with microscopy, from confocal selected Cells by microscopy. imaged were electron SHY5mCherry–SmB and line confocal correlative info out th carried in structural mCherry–SmB of detailed distribution gain To mCherry–SmB containing identifies microscopy vesicles electron distinctive and fluorescence confocal Correlative an cells. The play neural structures they mature 1). that in cytoplasmic suggests role Movie cells from important of differentiated material in mobility SmB cells and containing supplementary the al., prominence and within Differentiated manner increased et 3 bi-directional SmB-containing (Fig. 2000). a (Clelland in prominent neurites rapidly al., neurites showed moving structures extensive et SHY5mCherrySmB observations). of leads (RA) line Encinas (BDNF) acid unpublished production factor 2009; retinoic the (our neurotrophic using mCherry brain-derived to cells 2012) to by SH-SY5Y fused followed al., of (SFRS1)] Differentiation et 1 serine/ as factor known (Clelland [also splicing ASF/SF2 factor arginine-rich or splicing U170K protein non-snRNP U1-snRNP-specific the the expressing stably cells Transport ieSYmhrym eeicbtdwt RFP-Trap the with confirm incubated To were complexes, 1). protein from Table SHY5mCherrySmB lysates two newly Whole-cell line these out. and carried with and were 2 immunoprecipitations SmB preferentially (Fig. between interacting interactions SmB proteins expressed as vesicles, ed n h sltdpoen sdfrwsenbo analysis blot and western DYNHCI for against used proteins antibodies isolated with agarose the unconjugated and or beads (Chromotek) beads agarose conjugated c O and COP b O,ascae ihCOPI-trafficking with associated COP, mto bu h cytoplasmic the about rmation 472RNP 2.72 1 RANBP2 P49792 961NP0 2.00 7 NUP205 Q92621 5R5NP8 1.70 5 NUP188 Q5SRE5 568CP172.27 7 COPB1 P53618 452XO 2.14 6 XPOT O43592 669SC1112.20 1 SEC61A1 P61619 968CP 2.43 2 COPG Q9Y678 6N5MOG11.84 1 MYO1G Q6ZNK5 500CEL524 0.04 2.13 2.44 11 5 XPO1 CSE1L O14980 P55060 nPo Gene UniProt 124DN112 2.06 22 DYNC1H1 Q14204 ertso HS5 el,we cells, SH-SY5Y of neurites e aee ihasihl irregular slightly a with iameter c O.Bt fthese of Both COP. . o wyfo h ein rf rfrnilyerce.Slcieercmn ihete mature either with enrichment Selective enriched. preferentially Pref, median. the from away log 1 H - peptides no. Total oiiyo h m eils(i.6) ocnimta the that stained confirm were cells To 6C). effective, (Fig. 6A). been phalloidin (Fig. had with vesicles treatment D SmB mobility cytochalasin the cytochalasin their of with mobility reduced microfilaments SmB actin dramatically irregular of D(2 larger, Inhibition and of 6A). formation (Fig. 6B) the (Fig. in resulted vesicles hours) 3 for Fg A.Dsuto fmcouue ihncdzl (30 nocodazole with microtubules of Disruption 6A). (Fig. rfikn ihmxmmvlcte fu o2.5 microtubule to up of of velocities characteristic maximum movement with with vesicles, vesicles the trafficking treatment saltatory cells, protein control after In showed and dynamics. Sm cytoskeletal before imaged of the identified inhibitors were microscopy investigate SHY5mCherrySmB time-lapse newly line To using expressed from the cells microtubules. newly differentiated with of that interact time- trafficking suggested our proteins in screen motor, Sm microtubule proteomic a dynein, resolved of identification microtubules The on move vesicles SmB tie ihBDP-8 Fg CD upeetr material supplementary 5C,D; 4). (Fig. and structures 3 BODIPY-488 lipid-rich Movies small with and vesicles stained mCherry–SmB the between fluor (4 incubatin the Further membrane with by of 2). SHY5mCherry–SmB type obtained Movie a was are material structures vesicle mCherry–SmB supplementary the that and evidence 5B (Fig. vesicles og ewr n nolsi eiuu rvee ySu and with Szul by associated (reviewed the reticulum is within endoplasmic transport and complex retrograde network to Golgi coatomer linked normally the vesicles, COPI Because 5A). mCherry–SmB (Fig. with co-immunoprecipitated proteins endogenous Cer–m tutrsrpeetasbe fGFP– of subset a represent time- structures t transiently resulting the mCherry–SmB The then and cells. line living was in cell this mCherrySmB in expressed observations). GFP-Trap_A (unpublished using an Immunoprecipitation spectrometric e first 2002). mass by We al., followed cytoplasm. et the (Presley within vesicles GFP-tagged SHY1GFP mCherry–SmB line, COPI cell of SH-SY5Y an localization to established the respect addressed next with we 2011), Sztul, O soitdwt te ebr fteCP complex COPI the of members other with associated COP m /l 6hus.Tm-as mgn hwdcolocalization showed imaging Time-lapse hours). 16 g/ml, m /lfr25hus i o le h perneor appearance the alter not did hours) 2.5 for g/ml ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal e lgM:L) (log Immature O agf rmPelyan Presley from gift (a COP 2 2 2 2 2 2 2 2 2 2 lgH:L) (log Mature 2.05 0.53 0.48 0.24 0.20 2.00 0.21 0.60 0.40 0.11 2 as eune niaeta the that indicate sequences lapse ifrnitdclsfo line from cells differentiated g lsscnimdta h GFP– the that confirmed alysis ofursetpoen imaged proteins fluorescent wo .7.Poen eecniee obe to considered were Proteins 0.873. setlpdde BODIPY-488 dye, lipid escent e Lippencott-Schwartz) d O,sal expressing stably COP, 2 2 2 2 2 2 2 2 2 2 2 lgHM Pref H:M) (log Comparison Crto demonstrating ratios AC .3I 3.23 .7I 2.87 .4I 2.54 .4I 2.54 .3I 2.43 .8I 2.38 .9I 2.29 .4I 2.24 .0I 2.20 .9I I 2.19 2.14 n rti names protein and e e COP-tagged frelative of n m m/second m M

Journal of Cell Science EERHARTICLE RESEARCH rfrnilywt ihrmtr rnwymd nNs pcfcpoencassaehglgtd sidctdi h e.()Po flgHMrto(r enriched 1. ratio proteins Table H:M indicating in Med log thresholds, prot presented MW). of are of are protein Plot lines enrichment, enrichment for (B) red indicate relative key. normalized Dashed Arrows their the intensity line. of quadrant. in peptide red summary right indicated (summed the a upper as abundance by and the highlighted, relative indicated in proteins, are versus is fall classes YFP–SmB) clu ratio both protein expressed contaminants H:M with Specific transiently Potential log equally snRNPs. versus YFP–SmB). enriched made stably expressed proteins newly with transiently whereas or enrichment with 1:1) mature background ratio either above snRNPs. (SILAC with (enrichment made 0 preferentially ratio newly ratio M:L versus log log mature a versus of around YFP–SmB) interactomes expressed the stably of with comparison Quantitative 2. Fig. ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal A lto o : ai ercmn bv background above (enrichment ratio H:L log of Plot (A) . o rmtemda.Vle o h highlighted the for Values median. the from log 1 elative eins ian 817 ster

Journal of Cell Science EERHARTICLE RESEARCH M pert ti ifrn yolsi rnlsadshow and 818 detect granules cytoplasmic to different used stain antibodies to primary appear different we SMN Furthermore, that structures. observed lipid-based the also are reinforces This they detergents S2). that using Fig. conclusion material cells (supplementary the solvents of they or cells, permeabilization fixed on However, in disrupted visible proteins. clearly were were Sm vesicles vesicles, and SmB for the SmB gemin2 used although the SMN, were of of SHY5mCherrySmB line immunodetection contents from the cells contain investigate to differentiated demonstrated COPI To not the proteins. were with al., but and Sm et 2011) 2006) Todd al., al., et (SMN) et 2010; (Peter Zhang other al., complex 2010b; neuron et al., with (Fallini et motor association Todd complex 2010a; SMN partial survival the showed in of the members granules granules contain mobile These identified that protein. have cells studies recent neural of factor transport number the A or other factors and ti splicing complex the other CRM1 of SMN not duration the but 2-minute of proteins the members Sm in SMN, structures contain arrowed vesicles the dis by SmB more followed are trajectories 0.5 that the (arrows) deconvolved show SmB three of panels of accumulations bottom projections cytoplasmic the intensity show in Maximum cells cells. tracks sequence. The BDNF. neuroblastoma blue by human The followed in cells. acid seen differentiated retinoic are with structures differentiated and SmB-containing undifferentiated mobile Highly 3. Fig. m m z scin.Saebr:10 bars: Scale -sections. m1(i.7;splmnaymtra oi )showed but vesicles, 6) mCherry–SmB Movie the of material subset a supplementary with colocalization GFP– 7D; and (Fig. 5) with Movie material SmD1 supplementary GFP– fixed and 7A,B). 7C Fig. neurites (Fig. in or Gemin2 and mCherry– body with cell colocalized the near GFP–SMN live, vesicles in 6). SmB supplementary and either 7; 5 P-bodies. (Fig. Movies imaged permeabilized material with not were colocalized but paraformaldehyde structures cells determine SmB-rich to Transfected 1) the mRNA (decapping whether We factors. GFP–DCP1A transport represents included represents ASF/SF2 also CRM1 and proteins; factors splicing snRNP other non-Sm U5snRNP events; represents SmD1 maturation and 100K snRNP gemin2 with SMN, associated screen. proteins the SILAC are the from in proteins identified representative classes to of constructs versions GFP-tagged plasmid express with transfected were SHY5mCherrySmB cells same the S3). in Fig. together material used (supplementary when colocalization partial only ocruvn hs ehia ifclis el rmline from cells difficulties, technical these circumvent To ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal ielpeiae fclsfo ieSHY5mCherrySmB line from cells of images Time-lapse m .Seas upeetr aeilMve1. Movie material supplementary also See m. me-lapse ic nthe in tinct

Journal of Cell Science EERHARTICLE RESEARCH eeso Cer–m rti hnse nutasetdcells untransfected in seen higher contained than vesicles [0.23 also protein than The they mCherry–SmB mobile Furthermore, of significant less vesicles. 8). levels and (Fig. a larger cells cytoplasmic control were cells showed in cells mCherry–SmB that these GFP–SMN in the observed vesicles of of we levels above, disruption high described experiments expressing the of In dynamics the and vesicles morphology SmB the the both affect SMN of levels Altered degradation. mRNA in involved P-body-associated are be structures to likely these of not are that so absence indicates P-bodies screen, not the SILAC the with from factors together spliceosome DCP1A, colocalization of and lack with the whereas vesicles, maturation SmB to current the appear snRNP in important not with be does CRM1 of nucleus. agreement the within stages in place taking assembly later is ASF/SF2 of and absence are, models The clear. 100K which not are U5snRNP vesicles vesicles, SmB of the the of assembly. rest snRNP the of for of roles proportion sites The cytoplasmic a the as Gemin2 in implicated with therefore, vesicles, present mobile the SmD1 of that core suggests and the This form vesicles. SMN SmB and the SmB but with colocalize accumulations, and not cytoplasmic mCherry–SmB did 7G) these showed (Fig. the 7H) GFP–CRM1 with (Fig. Both colocalize GFP–DCP1A 7E). (Fig. not vesicles did cytoplasmic GFP– and 7F) 7E) (Fig. (Fig. SmB 100K ASF/SF2 snRNP between GFP–U5 seen contrast, that By SMN. than and complete less i (asterisk was size colocalization similar the of structures granular to adjacent found are are they wit structures instances, reference some mCherry–SmB In of The F). points TEM. in structural arrowhead by 10 E, clear analysis and bars: to ultrastructural D adjacent in detailed (arrows structures for appearance fluorescent mCherry–SmB. chosen vesicular Selected containing were (A–C). vesicles arrowheads) cells distinctive and SH-SY5Y identifies (arrows differentiated microscopy in electron vesicles and mCherry–SmB fluorescence Correlative 4. Fig. 6 .5 (mean 0.05% m AC;20n (D–F). nm 200 (A–C); m 6 ... fttlclua mCherrySmB cellular total of s.e.m.) ie ramn ihLB ncnrs odpeino SmB, of depletion to contrast in LMB, SmB cell same with of the in Treatment result B leptomycin line. direct assembly with assembly snRNP a snRNP reduced inhibiting of was by consequence indirect it an whether or nuclear depletion this investigated in of nature we increase striking and the marked result, to nuclear a Owing accumulations GFP–SMN. with GFP–SMN both containing together bodies of of cytoplasm loss CB/gems. the complete loss from the by nuclear in the SmB resulted to in of cells Reduction results addition GFP–SMN. number protein, SMN cytoplasmic in small of GFP–SMN a structures in Reduction of GFP–SMN cytoplasmic of levels accumulation of high the cell in relatively This resulting 8E). (Fig. expresses 2009) constitutively al., line to line to et cell (Clelland siRNA SH-SY5Y addition GFP–SMN an used in expressing their we SmB of formation, for investigate amount vesicle the further reduce required SmB To for is maturation. by requirements vesicles snRNP the PRMT5 Methylation early vesicles. cytoplasmic PRMT5 by during the snRNAs proteins abolish SmB of not Sm did of of 2009) depletion al., loss et Furthermore, (Clelland the in 8D). (Fig. their result of cells however, regulation in result the that present sequences SMN in in siRNA using of SHY5mCherrySmB, and amount line the from vesicles of the formation Reduction the composition. of in instrumental dynamics is protein and SMN 3.79 the cells; that Student’s control suggesting in GFP–SMN; vesicles in overexpressing found is signal , 0 elto fSN(llade l,21)ddnot, did 2012) al., et (Clelland SMN of depletion 70% ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal , 0n ndaee n aea have and diameter in nm 50 ofcliae showing images Confocal t -test, P , , 6 0.05, 0 nthese in 60% .%i cells in 1.9% i h cell the hin ) Scale F). n n , 5 75% 11], 819

Journal of Cell Science EERHARTICLE RESEARCH ugssta m a e oei h omto and formation the in nuclear role 820 key in a increase structures. has cytoplasmic strongly no SMN-rich result of SmB maintenance but unexpected that This cytoplasm, suggests GFP–SMN. GFP–SMN-rich the of of number accumulations large in a of structures appearance the in resulted salse ehiu oietf rtisivle ndifferent have in we involved YFP, proteins with identify tagged to SmB technique protein a established snRNP core the Using dissect to pathways used biological be complex can proteomics quantitative Time-resolved DISCUSSION ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal etos cl as 10 bars: Scale sections. eosrtsclclzto fthe of colocalization overlay) demonstrates on green and panels GFP– expressing constitutively in cells overlay) SH-SY5Y on magenta and panels (left mCherry–SmB of Transient expression vesicles. COPI of a subset with control. colocalizes beads mCherry–SmB the (B) in not but sample, RFP-Trap_A the in respectively) ( sizes expected the and to DYNCHI antibodies with blots of duplicate Probing sample. in RFP-Trap_A seen the enrichment strong a control and beads lane the in with detected fraction, none unbound the in remains mCherry–SmB A of lane. amount ‘input’ the small in seen appropriate kD) the (59 of size band single a reagent with RFP-Trap_A the using mCherry– SmB of pull-down of efficiency the demonstrates panel left The SmB. mCherry– with co-immunoprecipitate and DYNHCI Endogenous (A) vesicles. cytoplasmic in coatomer complex the and dynein with interacts mCherry–SmB 5. Fig. ois2–4. Movies material supplementary also 0.5 three of projection maximum intensity C, focus; of planes single B,D, (arrowheads). SmB mCherry– containing not structures stained some with with stained BODIPY-488 structures the of a subset represent structures that SmB-rich apparent the is it cells, the differentiated In (arrows). signals the two of colocalization partial show cells differentiated and undifferentiated Both overlay). on green and panels dye (middle lipid BODIPY-488 the with on stained magenta overlay) and panels (left SmB mCherry– expressing cells constitutively (D) differentiated and (C) Undifferentiated lipophilic BODIPY-488. the dye with stain vesicles SmB mCherry– (C,D) structures. genuine mobile are these that minutes, confirming 2 of period imaging the throughout This persists panel. colocalization left top outlined the section in the of an view shows enlarged panel right The (arrows). structures cytoplasmic in proteins two c O hw ad of bands shows COP e O (middle COP , 5 n 8kD, 98 and 450 m .See m. c m COP m z -

Journal of Cell Science EERHARTICLE RESEARCH bevdi h neatmsrfetdfeetsae fsnRNP differences of stages that different reflect confirming the interactomes in the targeting enriched interactome, in in was observed body, role expressed Cajal a the has newly to which Importantly, snRNPs CRM1, sample. imported snRNP gemin factor expressed newly the of export newly of nuclear the majority number in the the a seen and of was expressed SMN proteins, enrichment newly including of an factors, that processing contrast, with By non-snRNP compared of SmB. when of enrichment interactome snRNPs the clear in mature snRNPs. proteins a snRNP-specific splicing and showed factors of splicing screen pathway biogenesis SILAC complex Our the of stages Nucl (arrows). Stainin studies cells. time-lapse the 0.2 SH-SY5Y for deconvolved in used treatment of cytoskeleton D projection actin plo cytochalasin intensity of the velocities, duration Maximum disrupts the track (blue). treatment by disrupted maximum DAPI D is and Cytochalasin cytoskeleton actin Mean (C) the (arrows). that vesicle. confirms vesicles single (green) clustered a enlarged by shows taken sequence veloci track lapse The the cells. represents control line untreated coloured and n nocodazole each D, time, cytochalasin against with plotted mean treated is cells points of groups time representative between in vesicles microtubules. mCherrySmB on of move movements vesicles SmB 6. Fig. 5 5.()mhrym eilsaeelre n lsee nncdzl-rae el.Mxmmitniypoeto ftre0.5 three of projection intensity Maximum cells. nocodazole-treated in clustered and enlarged are vesicles mCherrySmB (B) 75). 6 ... hwn leainwt yohlsnDtetet u infcn eraefloigncdzl ramn towyAOAts ihTukey with test ANOVA (two-way treatment nocodazole following decrease significant a but treatment, D cytochalasin with alteration no show s.e.m., A ooaoe u o yohlsnD irpstemblt fmhrySBvsce.Gahclrpeettosof representations Graphical vesicles. mCherry–SmB of mobility the disrupts D, cytochalasin not but Nocodazole, (A) m m z scin hog h ape cl as 10 bars: Scale sample. the through -sections fctpamcYPSBi h el xrse sample. both expressed with newly SmB of the interaction in the amounts higher of YFP–SmB of Confirmation consequence cytoplasmic a simply of not are and biogenesis a h oeta orva nomto bu h relationships the about information reveal to potential M:L the log against H:L has log plotting by seen of protein grouping of classes the different whereas spliceosomes, active proteins into incorporated Sm are FP-tagged that the demonstrates in interactomes factors are splicing YFP–SmB non-snRNP demonstrates overexpression. of transient SmB number a a SmB of expressing of identification The result expressing transiently a not by stably and relevant biologically identified lines interactions cell that in DYNHCI ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal m m. z scin rmarpeettv time- representative a from -sections iaecutrtie with counterstained are ei ihPhalloidin with g yo h vesicles the of ty tdas tted c O and COP post-test, 821

Journal of Cell Science EERHARTICLE RESEARCH YY eeldhgl oiesrcue.Ipraty these Importantly, and 822 structures. distribution mobile SH- cytoplasmic line, highly cell the neuroblastoma revealed the SY5Y, of in heavy mCherry–SmB dynein Examination of protein dynamics motor 1. molecular newly the chain with was preferentially associate SmB to expressed found proteins the Among in microtubules on cells vesicles neural COPI-associated with colocalizes SmB graph. clearly left the top of the is section in proteins snRNP spliceosomal which major the (SNRNP35), from separate snRNP U1SNRNPBP U11-U12 minor the protein of position associated the is respect this particular Of in screens. interest similar and this in identified proteins between irtbls h dniiainof identification along transported The are they microtubules. cells that in with confirmed movement nocodazole associated their with motion treated of cessation saltatory The movement the trafficking. the showed microtubule of of structures using Analysis be these cells. might differentiated of they neural suggests in cells This importance BDNF. in particular by prominent followed acid more retinoic were structures ftecaoe ope,dmntae htteetoproteins two these that demonstrated complex, coatomer SH- the an expressing of in constitutively cytoplasmic line mCherry–SmB the cell of characterize SY5Y Expression expressed to further. us newly structures led of SmB and interactome unexpected the was the in SmB trafficking in vesicle reticulum, with endoplasmic associated usually complex COPI ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal P (ANOVA; significant statistically 49.9 GFP–Gemin2, containing also cles ois5ad6 ecnaeof Percentage 6. and 5 Movies S2, Fig. material supplementary 10 bar: Scale sections. Single (arrows). the vesicles with SmB colocalize however, not, do These (arrowheads). accumulations cytoplasmic show (H) GFP– DCP1A and (G) (arrows). GFP–CRM1 cells Both the in vesicles of SmB presence the despite vesicles, cytoplasmic in do accumulate (F) not GFP–ASF/SF2 and (E) 100K GFP–U5snRNP (arrows). SmB vesicles with colocalization also some fusions show GFP as expressed SmD1 protein (D) Sm the and (C) protein, gemin2 complex neurites SMN in The and (B). (A) body cell the both near (arrows) vesicles in in green overlay) and (middle overlay) SMN in and magenta and (top SmB between colocalization of degree high a demonstrates line SHY5mCherrySmB from cells in GFP–SMN DCP1A. or ASF/SF2, CRM1 100K, U5snRNP not SmD1 but and gemin2 SMN, contain vesicles mCherry–SmB 7. Fig. 12.78 GFP–SmD1, containing also vesicles mCherry–SmB s.e.m.); 98.48 is SMN ing contain- also vesicles mCherry–SmB , 0.05, 6 6 .9.Teedfeecsare differences These 9.79%. c .4;mhrySBvesi- mCherry–SmB 3.94%; O,amme fthe of member a COP, n 5 e O,aohrmember another COP, 30). 6 xrsinof Expression .2 (mean 1.52% m .Sealso See m. z - 6

Journal of Cell Science EERHARTICLE RESEARCH oehrwt hi xrm estvt oetato with extraction to sensitivity extreme lipids. their in rich cells with be to of Together structures BODIPY-488 staining SmB-containing dye the whereas lipophilic demonstrates the structures, with mobile mCherry–SmB expressing the in colocalize 8. Fig. e etpg o legend. for page next See otiigsrcue r oe ls flpdrc vesicle confocal lipid-rich Correlative of complex. SmB- class coatomer the novel the a that with for are associated paraformaldehyde suggests structures with strongly containing fixed this when immunofluorescence, alcohol or detergents ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal 823

Journal of Cell Science n m1 lhuhGmn n m1apa olclz ool a several only from to work Previous localize vesicles. to SMN-rich and appear SmB- SmD1 the the of and and subset Gemin2 Gemin2 SMN with although colocalization both SmD1, some contain and show detected also have They complex. we coatomer that vesicles SmB its The beyond SMN for role gr cell-specific to mRNAs trafficking in involved ooaiigwt F–M i n re noely.Single overlay). (arrows) on structures green and cytoplasmic (ii large GFP–SMN in with found colocalizing is overlay in and (i) magenta mCherry–SmB GFP–SMN. of expressing loss transiently in SHY5mCherrySmB results structures. with SmB cytoplasmic vesicles endogenous enlarged SMN-rich of in reduction results whereas mobility, GFP–SMN low of Overexpression 8. Fig. ARTICLE RESEARCH 824 an demonstrated mRNA with also and 2011) complex al., coatomer the et with (Peter encoding 2006). SMN al., reports et Sharma of Zhang 2011; 2010b; these association al., al., et et of Todd components Peter 2010a; al., 2001; One snRNP et al., the Todd any et 2005; of of al., Jablonka et members 2010; absence al., other apparent et and the (Fallini protein in SMN complex the Gall, potential SMN containing and a cells (Liu as ha maturation neural reports identified several snRNP contrast, been of By stages have 2007). been snRNP cytoplasmic protein, have for SMN containing location SMN, the structures and including proteins cytoplasmic factors, In processing other documented. and of components number SMA? structures and A cytoplasmic processing other snRNP to in relate implicated vesicles SmB do 2012). How al., et (Ting of in cells analysis complex NSC34 Golgi microscopic motor-neuron-like the mouse electron with associated recent structures with size. SMN-containing similar consistent a of is structures granular This appear to adjacent vesicles immediately the be of to some Interestingly, consistent vesicles. is that lipid-rich that with morphology reveals have microscopy structures SmB-containing electron the transmission and fluorescence signal. cytoplasmic to small addition 10 a in bars: contain (arrows) Scale which accumulations LMB), nuclear large (no of a cells number show when untreated LMB) (arrowheads) control, hours GFP–SMN with (16 of compared B accumulations leptomycin cytoplasmic with of cells treated siSmB, number with line result same the the to or contrast from nuclear In no SMN. show of (siSMN) accumulations SMN cytoplasmic reduce to (arrowhead). sequences with accumulations transfected cytoplasmic Cells some and (arrows) accumulations luciferase targeting sequences cytoplasmic siRNA ( no with but transfected (arrows) Cells GFP–SMN accumulations. of numbers large accumulations contain nuclear (siSmB) SMN- of expression of with SmB transfected reduce loss to SHY10GFPSMN in sequences line results siRNA from SmB Cells targeting of structures. duplexes Depletion cytoplasmic siGLO-labelled (E) rich of arrows). use (siGLO, the D by cyclophilin evidenced as cells) of eils(ros.Teefcec ftaseto a xrml ih( high extremely was transfection of efficiency The PRMT5 (arrows). or ( vesicles (siSMN) duplexes SMN non-targeting SHY5mCherrySmB reduce or line to (siPRMT5) from sequences Cells siRNA PRMT5. with or transfected SMN of levels reduced Student’s plotted (unpaired velocities, by track reduced maximum mean point. significantly and as time are Mean each velocities GFP–SMN. at track of imaging maximum overexpression dual-color and for mean required is Both a time course (C) by the time taken to GFP–SMN-expressing track owing the the longer of represents duration line points Total coloured time vesicle. each between single time, vesicles the against of plotted and velocity is GFP–SMN The expressing cells. cells control in untransfected of vesicles representation mCherrySmB Graphical of (B) movements sequence. time-lapse representative a 2 ecnrl hwteepce atr fasalnme fnuclear of number small a of pattern expected the show control) ve 6 b ... r infcnl erae yepeso fGFP–SMN of expression by decreased significantly are s.e.m., atn ugsigta h M-otiigsrcue are structures SMN-containing the that suggesting -actin, m m. Drosophila t -test, n 5 9.()SBvsce ess nclswith cells in persist vesicles SmB (D) 89). U ois otiigsRA,Sm snRNAs, containing bodies, ‘U’ , A nifrnitdcl rmline from cell Undifferentiated (A) 2 whcnsadrpeetanerve- a represent and cones owth eietfe tutrsi various in structures identified ve oei piigsRPassembly. snRNP splicing in role ecnrl oti eetbeSmB detectable contain control) ve z scin from -sections . 90% oetal te ra fRAmetabolism. cytoplasmic RNA of and of family trafficking areas a RNA other assembly, of potentially ribonucleoprotein components in core involved are vesicles SMN and SmB that Others assembl (SRP) assembly. Sm exa particle snRNP other recognition for splicing and roles, in 2011), different involved al., have be et might to (Zhang likely core addition are snRNA the the for proteins to responsible proteins be of Sm to vesicles family of known The is a components. which core of al., SMN-positive as Gemin2, suggestive SmB et containing is and Fallini of this SMN by with data, vesicles, (reviewed new subset related types our cell with a neural Combined of 2012). with number a in colocalize structures snRNP the machinery of members other assembly and Gemin2 that demonstrated has groups m,tgte ihSD,hsbe mlctdi the in implicated been has of localization SmD3, important with developmentally proteins together Sm for functions SmB, of range expanding An ebr fteS rti aiyo fteSNcomplex, SMN the snRNP other of in involved with or are vesicles these family colocalize of all protein not that the unlikely Sm it did making in the vesicles of SMN SMN-rich members the implicates of and many further however, SmB- Surprisingly, This in metabolism. usually involved snRNP cytoplasmic, line. gems and splicing nuclear and cell both CBs structures, of separate this formation the of in the coilin place SMN, of seen in containing proteins structure complex body results Sm the Cajal it and a where on of 2009), formation al., SMN the et in (Clelland of cells almost SH-SY5Y overexpression in of also nucleus of reminiscent large, constitutively highly structures is effect of This with SmB. abnormal the lines of effect amount These substantial striking, The a cell forming. recruit 2012). is structures in al., immobile mCherry–SmB GFP–SMN et expressing Fallini of axonal of translation by local overexpression and evidence transport (reviewed the increasing in is mRNAs SMN are for There SmB role vesicles. a and these for SMN are both of that these components clear that functions key however, of or is, function vesicles It analysis their neurons. understand within forms further fully to Clearly, required and is vesicles microtubules. DYNCH1 that on demonstrated with trafficked have al., interacts We number 2011). et a SmB Fisher, Dupuis, of and and Hirokawa Banks pathologies Eschbach by 2008; the by (reviewed in in conditions (reviewed neurodegenerative implicated trafficking of dynein established microtubule with well 2010), dynein-based is of neurons importance neurodegeneration in The dynein by trafficking Cytoplasmic mlctdi eoeaeRApoesn Tn ta. 2012). been al., recently et have (Tang proteins processing RNA Sm telomerase yeast, and in Fu in 2006; implicated and Collins, RNA and 2007), telomerase (Fu with cells Collins, mammalian interact in in to scaRNAs integrity demonstrated and granule been have germ SmB of maintenance elegans the in involved Drosophila h ahlg fSAwehro o htptooyi ikdto linked is pathology that of not or formation assembly. whether in snRNP the SMA it for of implicating pathology cells, vital neural the is in structures SmB cytoplasmic that SMN-rich We demonstrated 2004). now al., et have Valentin-Hansen has encoded by proteins, chromosomally (reviewed for LSm RNAs cofactor regulatory and general Sm a as both implicated of Hfq, been origin protein beyond Sm-like evolutionary RNAs bacterial likely of The the regulation splicing. and pre-mRNA in processing of role the number its in expanding SmB an for demonstrate roles data these together, Taken Bre ta. 02.Asbe fS rtisincluding proteins Sm of subset A 2002). al., et (Barbee ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal Gnavze l,21)adS rtisaealso are proteins Sm and 2010) al., et (Gonsalvez pei RAtafcigo signal or trafficking mRNA in mple Pazne l,21) epropose We 2013). al., et (Piazzon y oskar RAin mRNA C.

Journal of Cell Science ftasrpinwti h ulu,i fkyimportance. key of is nucleus, site neurons, the their from motor within distance transcription as some of such at mRNAs, transport cells, of by RNP translation in local cells importance of where particular in pathways caused of on defects are converge that the SMN that of suggest levels data lowered our 2012), al., et HS5 el sn eiocai n DFwscridotas hours. 16 to out for 2 added ng/ml carried was at 100 Technologies) was medium (Life BODIPY-488 assays BDNF culture heterokaryon 2001). were and al., as et 2009), acid (Sleeman al., et retinoic (Clelland previously using described cells SH-SY5Y SH- Lamond. I. GFP– 200 A. expressing with 2003). from stably gift al., lines a from cell et was gift SY5Y previously 100K a Sleeman pGFP–U5snRNP was 2008) Shav-Tal. 1998; expressing described al., Y. et al., (Aizer lines et pGFP–DCP1A been Lippencott-Schwartz. Sleeman cell have 2009; SH-SY5Y pGFP– al., GFP–SMN stable et (Clelland and and CFP–SmB expressing mCherry–SmB lines and instructions. cell manufacturer’s HeLa YFP– stable the pGFP–ASF, to pCFP–SmB, according pYFP–SmB, (Qiagen) Effectene using omnmtto eni M,i nbet oaieto localize to unable is SMA, most in the 7, seen exon lacking mutation protein shown SMN common has human work GFP-tagged previous Interestingly, structures that cells. SMN-containing neural to in analogous identified in mRNAs, both and of implicated formation trafficking vesicles the to cytoplasmic analogous determine of maturation, SMN snRNP family a and levels of SmB relative mobility of the that expression suggest of data our Importantly, maturation. ARTICLE RESEARCH eesot,U)o nOypsDlaiinR irsoe(Applied 37 microscope at RT DeltaVision maintained Olympus Precision), an on glass UK) Scientific, Segensworth, (Solent 40-mm-diameter incubator environmental an on within an (Zeiss) to chamber transferred grown open were Coverslips appropriate. were as transfected cells and coverslips microscopy, live-cell For analysis image and Microscopy in cultured were Cells ATCC. 37 from at FBS were 10% cells with DMEM SH-SY5Y and culture HeLa cell and lines Cell METHODS AND MATERIALS cargo vesicular of in mis-splicing role a of have documentation to a Taken in proposed transport, recent pathways. is which trafficking the Stasimon, and with processing interlinked together closely mRNA the an of highlights cells nature neurites neural in in SMN vesicles trafficking in trafficking SmB mRNA of involvement in The is hypothesis. SMN alternative attractive for it role this, snRNP SMA, a as in Despite ubiquitous making seen as symptoms 2008). motor-neuron-specific process the al., a with in assembly et defect a Zhang reconcile to 2007; difficult al., SMN et of Gabanella models pre- several in in and (Ba documented repertoire patterns snRNP cellular splicing the mRNA maturation, in snRNP both splicing the alterations during assembling snRNAs with in onto role ring well-established protein a defect? Sm has trafficking a complex or SMN splicing a The pathology: SMA in for implications proposed The 2012). axons al., a et within (Fallini providing trafficking integrity SMA of and the vesicles, defects models localization and to trafficking proteins RNA SmB key and cytoplasmic in are SMN the of 2003). SmB between link al., and family mechanistic SMN et a that (Zhang of shown neurons have chick We in structures cytoplasmic ae at taken 0.5 ue ta. 09 olsaee l,21;Cmine l,2010; al., et Campion 2011; al., et Boulisfane 2009; al., et ¨umer m pcn o eovlto,100 deconvolution, for spacing m e O Pelye l,20)wsagf rmJ rse n J. and Presley J. from gift a was 2002) al., et (Presley COP , m eoditrasuigsingle using intervals second 1 /lG1 Rce olwn rnfcin ifrnito of Differentiation transfection. following (Roche) G418 g/ml Drosophila m /loengtadlpoyi LB at (LMB) B leptomycin and overnight g/ml oe fSA(mahe l,21;Lotti 2012; al., et (Imlach SMA of model ˚ ˚ ih5 CO 5% with C ,5 CO 5% C, Drosophila 6 2 e rnfcin eecridout carried were Transfections . O eedrvdb selection by derived were COP z scin rthree or -sections A13 betv.Exposure objective. 1.35 NA 2 ielpeiae were images Time-lapse . ois n nthe in and bodies, U z scin at -sections eer-ie n25 ltrleyei .Mccdlt ufrp 7.2 Cells pH optics. buffer cacodylate DIC OsO 0.1M 1% using in in grid post-fixed glutaraldehyde and CELLocate 2.5% in the re-fixed on were located and collected aaomleyei B n mgdo nLM0 confocal 4% LSM700 an in objectives. on fixed 1.46 imaged were 40 NA and the Apochromat (Eppendorf) using PBS coverslips microscope in CELLocate paraformaldehyde on microscopy Cells electron and confocal Correlative xrsigYPSBwr noe ypsaigi eimcontaining medium in [ passaging by ‘heavy’ containing encoded stably were medium cells HeLa YFP–SmB in Sigma-Aldrich). expressing passaging (R0K0; stably as L-lysine by cells and encoded L-arginine out HeLa ‘light’ were 2008). carried GFP al., free were et expressing (Trinkle-Mulcahy experiments described AP/MS previously SILAC-based Quantitative immunoprecipitation SILAC Quantitative CAAUGACAGUAGAGGGACC. AGGCUGUACAUAGU, CCGUA- CCC- GCAUAUUGAUUACAGGAUG, of ACAAGGAAGAGGUACU, mixture a SmB, CGAAAUAGCUGACACACUA; UGGCACAACUU- CCGGACUU, CAACAGAGA- SMN: CCAAGUGACCGUAGUCUCA, of UCCUAUGAUU, mixture were a B, PRMT5, used luciferase, cyclophilin GGAAAGACUGUUCCAAAAA; targeting Sequences targeting control positive control transfection. UAAGGCUAUGAAGAGAUAC; negative after CAGUGGAAAGUUGGGGACA, hours fluorescence 48 for paraformaldehyde with fixed microscopy for or lyzed blotting western were by Cells instructions. assay manufacturer’s the (Lipocalyx to green according viromer GmbH) using Scientific) (Thermo siRNAs with lines cell appropriate the transfecting by achieved was expression protein of Reduction LAS- knockdown Fujifilm siRNA a using imaged and system. Healthcare) imaging (GE carried 3000 Plus was ECL Detection with 1:20,000). goat to out (Pierce, conjugated immunoblotting. 1:500); were (HRP) antibodies peroxidase (Chromotek, Secondary horseradish for 1:200). anti-RFP Cruz, (Santa nitrocellulose mAb DYNHCI Healthcare) rat to anti- were polyclonal GE transferred used by and Antibodies (Hybond-C+, separated NP40, v/v were Invitrogen) 1% samples membranes NaCl; inhibitors) (Novex, mM protease 150 and SDS-PAGE 7.5; with NaDOC pH w/v hours Tris-HCl, 2 0.5% mM with for (50 washes were five buffer incubated Following lysates RIPA beads. then agarose beads cell or (Chromotek) agarose total RFP–Trap_A with mCherry–SmB, overnight To 2003). containing cleared al., et complexes (Sleeman previously isolate described as prepared were immunoblotting Lysates and Immunoprecipitation lysates, of Preparation oohrclsi h I mg n E mgswr ae rmalthe all from taken were images TEM and sectioned, with image DIC stained relationship serially the their in were from and cells identified Sections region other were to cells. cells trimmed the Fluorescent the only. and was citrate through in lead resin, section cells the embedded every required on collecting and stubs impression the resin grid alcohol the containing CELLocate from in removed the were leaving dehydrated Coverslips (Sigma). resin were Durcupan Coverslips buffer. etoscletdutltewoeo h elhdbe mgd tcsof images. Stacks cross-correlated imaged. TEM and been (Perkin-Elmer) the had Volocity with cell into the imported of were whole images the until collected sections eegnrtduigPim (GraphPad). Prism4 analyses images statistical using and of generated charts Bar were overlays CS4. Photoshop and Adobe using Montages made were Precision). generated (Applied by were profiles Volocity SoftWorx Line using size. using in and quantified intensity their signals were by vesicles mCherry–SmB objects identifying cytoplasmic Volocity. and in cells manually whole giving Elmer). tracked (Perkin exposures software were Volocity using with Vesicles generated was movies sample Deconvolution and 4500. out entire and carried 3000 between the of intensities through pixel maximum microscopy, taken cell fixed were For intensities spacing 750. pixel and maximum 500 giving second, between 1.0 of and 0.2 between were times 13 ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal C/ 15 ]-riiead[ and N]L-arginine c O SnaCu,120 n oylnlrbi anti- rabbit polyclonal and 1:250) Cruz, (Santa COP 4 6 ih15 oimfroynd ncacodylate in ferrocyanide sodium 1.5% with lnNola A13ad100 and 1.3 NA Plan-Neofluar 13 Z C/ 15 tcso loecn el were cells fluorescent of stacks ]-yie(1K;Cambridge (R10K8; N]L-lysine z scin f0.2 of -sections 6 alpha- 825 m m

Journal of Cell Science AGA n 6(TGTCGACC n AACGCTTCACG- and (CTCGCTTCGGCAGCACA U6 TCGATGCGTGGAGTG- and to GACGGA) primers and using PCR (ATCGCTTCTCGGCCTTTTGGCT for templates U2 as used manufacturer’s were RevertAid the cDNAs and The to instructions. primers according Scientific) hexamer (Thermo random transcriptase using reverse synthesis treated cDNA then instructions were for manufacturer’s used samples the to The according (Invitrogen) instructions. DNase manufacturer’s with (Qiagen) RNAeasy the using to preparation RNA according total for used fraction isolated ietdfrM nlss sdsrbdpeiul (Trinkle-Mulcahy previously described RIPA trypsin- ice-cold as and 2008). with analysis, SDS-PAGE al., times 1D et MS by four for separated washed eluted, digested beads were Proteins the buffer. and removed then asgn o asi eimcnann mdu’[ by ‘medium’ containing encoded medium were in cells days Parental 7 for MA). passaging Andover, Laboratories, Isotope ARTICLE RESEARCH 826 Pre-cleared hours (Roche). 2 for 4 cocktail (Chromotek) at GFP-Trap_A inhibitor with incubated mM were protease lysates 2 protein SDS, complete (v/ (w/v) 1% 0.1% plus deoxycholate, NaCl, after sodium M EDTA hours (w/v) 0.5 24 1% 7.5, P-40, lyzed pH Nonidet Tris-HCl, v) and mM pYFP–SmB 50 ice-cold with using transfected transfection were cells HeLa Immunoprecipitation RNA were samples 1:20,000). of gel. sets dilution same Both CLx. the (LI-COR, Odyssey on LI-COR 800CW analyzed a using IRDye imaged were anti-rabbit Blots goat anti-GFP and polyclonal rabbit an 680RD Secondary and 1:500). 1:500) dilution agarose dilution (Abcam, out (Abcam, the carried was anti-Sm with detection Y12 and Subsequent together using beads. lysate antibody SDS-PAGE pre-cleared TMG of by and ng beads separated 10 control sample. total were each mg for protein 2 to input control. unbound as as conjugated used beads was anti-2,2,7-trimethylguanosine agarose lysate with cell using NA02A), (Millipore 2003) beads agarose the al., published with previously as et parallel out in carried (Sleeman harvested was were Immunoprecipitation 2003) sample. and hour al., from pYFP–SmB cells 24 et sample, (Sleeman with line E1 cell transfected stable YFP–SmB the were line For cells transfection. after HeLa hours sample, 24 harvested hour 24 the For snRNPs intact of Immunoprecipitation S1. the Table material via supplementary identified as environmental provided proteins common is and (minus database) http://maxquant.org decoy dataset and per full Peptide peptides. as The 2 unique contaminants 0.01. was and was count razor FDR ratio on protein Minimum based Lys8. was and Lys4, quantification Arg10 and and were Arg6 labels were SILAC labels SILAC heavy methionine Medium a acetylation. of as N-terminal oxidation and were cysteine modifications Variable of modification. carboxyamidomethylation criteria fixed following allowed), The cleavages 2011). al., tolerance missed et peptide Cox used: 2009; Andromeda al., were the et and (Cox v1.1.1.14 engine quantification software search and MaxQuant duty entries) searching using each 87,061 Database performed v3.68; in trap. were database ion ions IPI linear five human LTQ top the the the (against in and MS/MS for resolution selected 60,000 analyze cycle to at 0.1% set scans was acetonitrile, survey Orbitrap The the 5% 2008). previously al., as et in IL) (Trinkle-Mulcahy described Rockford, (prepared LTQ-Orbitrap (ThermoElectron, an system digest on spectrometer LC-MS by mass tryptic analyzed was water) the in acid trifluoroacetic of aliquot analysis An data and spectrometry Mass 4 at hour 1 for Germany) Martinsried, (Chromotek, mut fec xrc eeicbtdwt GFP-Trap_A with incubated were affinity extract For protein each total (Eppendorf). equivalent SmB, of Biophotometer YFP-tagged and a amounts GFP free using of purification measured were eehretdadetat rprdb oiaigi IAbfe and buffer RIPA in Cells sonicating harvesting. by 2800 before prepared at centrifuging immediately extracts and CBs in harvested in diffuse YFP–SmB were be accumulation of to some microscopy, distribution fluorescence with by subcellular determined, with The was transfected samples hours. these transiently 24 then for and YFP–SmB (R6K4) [4,4,5,5-D4]L-lysine and ˚ rwt grs ed,wse ortmswt yi ufradthe and buffer lysis with times four washed beads, agarose with or C g o 0mntsa 4 at minutes 10 for 5 0ppm,tysna h nye(two enzyme the as trypsin p.p.m., 10 ioiswr otat-os IRDye anti-mouse goat were tibodies ˚ .Ttlpoenconcentrations protein Total C. ˚ .Etat were Extracts C. 13 ]L-arginine C TM ATGG)sRA IT.TerslatPRpout were products PCR (NBS). SafeView resultant containing gel agarose The 1% a on (IDT). electrophoresed snRNAs AATTTGCGT) aaySpotAad hswr a upre npr yteRylSceyvaa via Society Royal J.E.S. the to by part Investigator Fellowship in New Research supported (CIHR) University was work Research This Health Award. of Support Salary Institutes Canadian a holds L.T.M. Funding interests. of conflict no declare authors The interests manuscript. Competing the prepared and data analyzed figures, related all experiments the designed blot generated concept, Western and original and purification the affinity to with imaging, helped out up and carried came experiments, figures JES and manuscript. LTM tables final data. related the analyzing the edit and generated acquiring data, data with AP/MS analyzing assisted the and JJ analyzed acquiring article. with the assisted drafting AB with manuscript. and final the and edit images to microscopy light/electron helped correlative the interpreted and acquired ARP contributions Author antibody. MANSMA1 for UK) Proteomics Oswestry, and Hospital, Orthopaedic MS of (RJAH (BSRC analysis MS Botting for C. Andrews) St and of Fuszard University Facility, Dundee, M. of 100K; (University pU5snRNP Lamond for I. UK) A. pGFP-DCP1A; for p Israel) for University, Quebec) (Bar-Ilan University, (McGill (NIH, Presley Lippencott-Schwartz J. J. and support; Bethesda) technical Institute for Research Facility) Hospital Core (Ottawa Proteomics Puente Lawrence thank authors The Acknowledgements abe .A,Lbi,A .adEas .C. T. Evans, and L. A. Lublin, A., M. S. E. Barbee, Fisher, and T. Y. Shav-Tal, G. and Banks, H. R. Singer, N., Sonenberg, W., L. Ler, Y., Brody, A., Aizer, References at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.137703/-/DC1 online available material Supplementary material Supplementary apo,Y,Ne,H,Gsa,T,Srt .adBron,R. Bordonne, and J. Soret, T., Gostan, H., Neel, R. Y., Bordonne, Campion, and J. Soret, H., Neel, F., Rage, M., Choleza, N., Boulisfane, Z., Zhang, J., Mouaikel, Ba K., C. Lau, F., Lotti, J., Yong, M., Kasim, J., D. Battle, aci .J,SnhzPld,L n i,J L. J. Liu, and L. Sanchez-Pulido, J., R. Cauchi, aln,C,Bsel .J n osl,W. Rossoll, and J. G. Bassell, C., Fallini, L. Dupuis, and J. Eschbach, Encinas,M.,Iglesias,M.,Liu,Y.,Wang,H.,Muhaisen,A.,Cena,V.,Gallego,C.and Mann, and V. J. Olsen, A., R. Scheltema, A., Michalski, N., Neuhauser, J., Cox, E. J. Sleeman, and B. A. Bales, E. K., J. A. Sleeman, Clelland, and J. Burza, L., Oram, P., N. Kinnear, K., A. Clelland, o,J,Mtc . igr . aaa,N,Slah . le,J .adMn,M. Mann, and V. J. Olsen, M., Selbach, N., Nagaraj, M., Hilger, I., Matic, J., Cox, ue,D,Le . ihlo,G,Dve,J . akno,N . Murray, J., N. Parkinson, L., J. Davies, G., Nicholson, S., Lee, D., ¨umer, 20) h yaiso amla oytasot seby and assembly, transport, body neurodegeneration. P understanding mammalian of vivo. in dynamics disassembly The (2008). eet fU2tp nrn nlmhbat eie rmatp M patient. SMA splicing I type differential a from generates derived Genet. lymphoblasts assembly Mol. in Hum. introns tri-snRNP U12-type of minor defects of Impaired model mouse (2011). a in K. Talbot, pathology of and feature E. atrophy. late K. muscular a Davies, spinal are O., events Ansorge, splicing H., Alternative T. Gillingwater, M., L. G. Dreyfuss, RNPs. and for machine L. Wan, K., Han, embryogenesis. elegans C. during localization granule Biol. germ in proteins piigdfcsi .pmecryn ernall fteSria fMotor of Survival the of allele degron a carrying pombe gene. S. Neuron in defects splicing utrdpiaymtrnuost td rti oaiain rfikn,and trafficking, localization, protein study to neurons function. motor primary cultured Ther. Pharmacol. factor- cells. neurotrophic differentiated, neuron-like fully human to dependent, rise gives factor neurotrophic brain-derived X. J. Comella, environment. M. bodies. U of components are Res. Gemin5 Cell and Exp. Gemin3, Gemin2, proteins complex 20) rcia ud oteMxun opttoa ltomfrSILAC- for platform computational MaxQuant the proteomics. to quantitative guide based practical spinal A in (2009). defects splicing for mechanism differentiating a atrophy. provide in muscular snRNPs architecture mature nuclear of mobility of regulator key a cells. is neuroblastoma protein SMN The 21) nrmd:appiesac nieitgae noteMaxQuant the into integrated engine search peptide a Andromeda: (2011). 12 1502-1506. , o.Neurodegener. Mol. ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal .Poem Res. Proteome J. 20) eunilteteto HS5 el ihrtni cdand acid retinoic with cells SH-SY5Y of treatment Sequential (2000). MOJ. EMBO 316 130 .Cl Sci. Cell J. 20 2354-2364. , odSrn ab yp un.Biol. Quant. Symp. Harb. Spring Cold o.Bo.Cell Biol. Mol. 641-648. , Traffic 348-363. , 29 LSGenet. PLoS 1817-1829. , 10 21) yolsi yeni neurodegeneration. in dynein Cytoplasmic (2011). 5 125 1585-1598. , 17. , a.Protoc. Nat. 10 20) yolsi yencudb e to key be could dynein Cytoplasmic (2008). 2626-2637. , 1794-1805. , eoeBiol. Genome .Neurochem. J. 19 20) h M ope:a assembly an complex: SMN The (2006). 4154-4166. , 5 e1000773. , 21) ihefcec rnfcinof transfection High-efficiency (2010). 20) oe ucinfrteSm the for function novel A (2002). 4 698-705. , 21) hne nintranuclear in Changes (2012). e O-F ellns .Morris G. lines; cell COP-GFP 9 75 214. , 991-1003. , 21) rspiaSMN Drosophila (2010). e O-F;Y Shav-Tal Y. COP-GFP; 71 313-320. , 21) Specific (2010). (2009). (2009). Curr.

Journal of Cell Science eeve . ult . i,Q,Brrny . lrot . unc,A., Munnich, O., Clermont, S., Bertrandy, Q., Liu, P., Burlet, S., Lefebvre, L., Viollet, P., Burlet, O., Clermont, S., M. Reboullet, Dundr, L., and Burglen, S., V. Lefebvre, R. Intine, E., T. Kaiser, and M. Sendtner, B., Wirth, D., Buhler, S., Wiese, M., Bandilla, S., D. B. Jablonka, McCabe, and L. Pellizzoni, F., Lotti, J., B. Choi, S., E. Beck, L., W. Imlach, G. Sanchez, J., Timbers, J., Laframboise, H., Valderrama-Carvajal, L., Hubers, ioaa . ia .adTnk,Y. Tanaka, G. and A. S. Matera, and Niwa, K. N., Praveen, Hirokawa, Y., Wen, K., T. Rajendra, B., G. Gonsalvez, ee,C . vn,M,Taaih,V,TngciIhgk,N,Bc,I,Kolpak, I., Bach, N., Taniguchi-Ishigaki, V., Thayanithy, M., Evans, G. J., C. Dreyfuss, Peter, and B. Charroux, N., Kataoka, L., Pellizzoni, aael,F,Bthah .E,Siv,L,Crsii . uge,A .and H. A. Burghes, C., Carissimi, L., Saieva, E., M. Butchbach, F., Gabanella, n,S . lge,B,Kacmrv,I,Kitne,D . te,H., Steen, B., D. Kristensen, I., Kratchmarova, B., Blagoev, E., S. Ong, u .adClis K. Collins, and D. Fu, aea .G n hagl .B. K. Shpargel, and W., Jiao, G. L., A. K. Matera, Darrick, L., Hao, S., E. Beck, L., Saieva, L., W. Imlach, F., Lotti, G. J. Gall, and L. J. Liu, u .adClis K. Collins, and A. D. Fu, Chari, and C. Englbrecht, U., Fischer, R. L. Simard, and L. W. Fan, Rossoll, and J. G. Bassell, C., Fallini, Bassell, and W. Rossoll, H., R. Singer, V., Silani, Y., Su, H., Zhang, C., Fallini, ARTICLE RESEARCH rti ee nsia uclratrophy. muscular spinal J. in Melki, level al. protein and et G. atrophy-determining M. Dreyfuss, muscular Zeviani, spinal P., a of Millasseau, gene. characterization C., and Cruaud, Identification B., Benichou, atrophy. body. subnuclear muscular spinal in and development Genet. during Mol. SIP1 interactor its Drosophila. U. Fischer, in function circuit sensory-motor for required 151 is SMN (2012). defects. neuronal atrophy-like 553-579. muscular spinal rescue J. Cote, and rnpr ehnssadrlsi ri ucin eeomn,addisease. mRNA and development, oskar function, facilitating brain in by roles Neuron and fate mechanisms cell transport germ specify proteins localization. Sm (2010). . asl,G . osl,W,Lro,C . a,Z .e al. et Z. Z. Bao, L., C. Lorson, W., Rossoll, pre- J., in G. product, Bassell, gene A., disease atrophy muscular spinal splicing. the mRNA SMN, for function uclrarpysvrt n rfrnilyafc usto spliceosomal of subset a affect preferentially and snRNPs. severity atrophy muscular L. Pellizzoni, utr,SLC sasml n cuaeapoc oepeso proteomics. expression to approach accurate and Proteomics Cell. simple Mol. a as SILAC, culture, M. Mann, and A. Pandey, dniisfcosivle ntlmrs ignssadtlmr length telomere and biogenesis telomerase in involved regulation. factors identifies ln h N pipeline. RNP the function. along circuit al. motor et for D. essential B. event McCabe, E., splicing C. U12 Beattie, Z., G. Mentis, bodies. USA P Sci. with Acad. associate and Natl. ribonucleoproteins nuclear small uridine-rich hr nqeseiiiyo mpoenassociation. protein Sm of specificity unique a share ribonucleoproteins. nuclear small differentiation neuronal during development. maturation and neuromuscular and outgrowth neurite regulation. in mRNA axonal mRNA in SMN poly(A) of role of localization regulates axons. neuron and motor HuD primary protein mRNA-binding J. G. 427-439. , 21) h uvvlo oo ern(M)poenitrcswt the with interacts protein (SMN) neuron motor of survival The (2011). Cell 68 LSONE PLoS 610-638. , 80 o.Cell Mol. 20) orglto fsria fmtrnuo SN rti and protein (SMN) neuron motor of survival of Co-regulation (2001). Development 10 155-165. , 21) u neat ihsria oo ernpoenadcan and protein neuron motor survival with interacts HuD (2011). 20) ioulorti sebydfcscreaewt spinal with correlate defects assembly Ribonucleoprotein (2007). 497-505. , Cell Science u.Ml Genet. Mol. Hum. 20) ua eoeaeadCjlbd ribonucleoproteins body Cajal and telomerase Human (2006). 28 95 2 104 1 e921. , 20) oisaectpamcsrcue htcontain that structures cytoplasmic are bodies U (2007). 773-785. , 615-624. , 376-386. , 20) uiiaino ua eoeaecomplexes telomerase human of Purification (2007). ur pn elBiol. Cell Opin. Curr. 11655-11659. , 20) uvvlmtrnuo SN rti:rl in role protein: (SMN) neuron motor Survival (2002). 137 322 20) tbeiooelbln yaioaisi cell in acids amino by labeling isotope Stable (2002). .Neurosci. J. 19) orlto ewe eeiyadSMN and severity between Correlation (1997). 2341-2351. , 1713-1717. , ie nedsi.Rv RNA Rev. Interdiscip. Wiley 20) upn N:ncerbodybuilding nuclear RNA: Pumping (2006). 11 1605-1614. , 21) oeua oosi neurons: in motors Molecular (2010). a.Genet. Nat. ri Res. Brain 21) pnlmsua toh:the atrophy: muscular Spinal (2012). 31 21) ignsso spliceosomal of Biogenesis (2011). 3914-3925. , 20) env omto fa of formation novo De (2008). 18 317-324. , 21) nSMN-dependent An (2012). ee Dev. Genes 1462 16 Cell 265-269. , u.Ml Genet. Mol. Hum. 81-92. , 151 19) novel A (1998). 2 440-454. , 718-731. , 20 531-536. , 21) The (2011). (1995). Hum. Proc. Cell 20 , hn,R,S,B . i . og . lsvc . a,L n ryus G. Dreyfuss, and L. Wan, T., Glisovic, J., Yong, P., Li, R., B. So, R., Zhang, pco,D .adLmn,A I. A. Lamond, and L. Lamond, D. and Spector, C. S. Ogg, R., A. Prescott, L., Trinkle-Mulcahy, E., J. Sleeman, I. A. Lamond, and P. Ajuh, E., J. Sleeman, I. A. Lamond, and E. J. Sleeman, J. Sleeman, C., and Ampe, D. A., C. R. Sewry, T., Phair, L. Thanh, D., T., L. E. Hao, Siggia, A., Lambrechts, C., A., Sharma, A. Pfeifer, H., T. Ward, F., J. Presley, hn,Z,Lti . ita,K,Yui,I,Wn . ai,M n ryus G. Dreyfuss, and M. Kasim, L., Wan, I., Younis, K., Dittmar, F., Lotti, Z., Zhang, J. G. Bassell, and H. R. Singer, H., Wichterle, W., Rossoll, J. L., G. Xing, Bassell, H., and Zhang, H. R. Singer, M., S. Shenoy, D., Hong, F., Pan, L., H. Zhang, M., C. F. Udesen, and Boisvert, M. Eriksen, R., P., Valentin-Hansen, Urcia, W., Y. Lam, S., Boulon, L., Trinkle-Mulcahy, J. P. Young, and H. Stebbings, J., D. Shaw, R., Morse, G., A. Todd, lea,J,Lo,C . ltn,M,Kev,J .adLmn,A I. A. Lamond, and P. J. Kreivi, M., Platani, E., C. Lyon, J., Sleeman, Besse, J., Soret, A., Mereau, M., Dodre, S., Lefebvre, F., Schlotter, N., Piazzon, ag . ann . lnhte .adBuan P. Baumann, and M. Blanchette, R., Kannan, W., Tang, E. Sztul, and T. Szul, od .G,Mre . hw .J,MGne,S,Sebns .adYoung, and H. Stebbings, S., McGinley, J., D. Shaw, R., Morse, G., A. S. Todd, Lin-Chao, and H. Li, M., H. Hsieh-Li, C., H. Liu, L., H. Wen, H., C. Ting, 21) tutr fakyitreit fteSNcmlxrvasGemin2’s reveals complex SMN assembly. the snRNP of in intermediate function key crucial a of Structure (2011). eaiu nvivo. in behaviour I. A. nucleus. mammalian the in snRNPs splicing of cytoplasmic cells. neurite-like nerve in cultured profilin and of gemins extensions E. with protein G. (SMN) Morris, neurons motor and H. A. Burghes, transport. membrane Golgi in role and J. Lippincott-Schwartz, nNsadwdsra eet nsplicing. of in repertoire the defects neurons. in widespread perturbations and motor tissue-specific snRNAs causes of deficiency cones SMN (2008). growth and processes with neuronal SMN Neurosci. protein J. to neuron of motor traffic of role survival Gemins the the of and complexes Multiprotein protein (2006). neuron motor survival localization. the cytoplasmic in of exon-7 transport Active transactions. (2003). RNA in player key a Hfq: H. protein Leonhardt, U., proteomes. bead Rothbauer, and S., spectrometry mass Swift, A., al. N. et Morrice, F., Vandermoere, nacstefraino aa oiscnann 8-olnadSMN. and p80-coilin containing bodies Cajal Sci. of formation the enhances nucleoli and protein. bodies fluorescent green coiled the to Res. snRNPs, fusions protein splicing snRNP using revealed between maturation interactions snRNP Dynamic nuclear a suggesting speckles, before pathway. bodies coiled with recognition signal the of level state al. steady et and C. biogenesis particle. the within Branlant, in R., neuron complex Bordonne, SMN motor M., survival Barkats, A., with moves and binds axons. complex vesicle COPI N ignssivle eunilbnigb madLmcomplexes. Lsm and Sm by binding sequential involves biogenesis RNA (Bethesda) Physiology yols fnuoa el nvitro. in cells neuronal of cytoplasm J. P. from absent are components the body complexes. Cajal SMN-cytoplasmic to Core granules: Linked SMN-neurite of Is Analysis SMN Protein Disease Atrophy Network. Muscular Golgi Spinal The (2012). 484 eset Biol. Perspect. 260-264. , 114 21b.SN ei2adGmn soit ihbt-ci RAi the in mRNA beta-actin with associate Gemin3 and Gemin2 SMN, (2010b). 243 20) aa oypoen M n olnso ifrnildynamic differential show Coilin and SMN proteins body Cajal (2003). 20) dniyn pcfcpoenitrcinprnr sn quantitative using partners interaction protein specific Identifying (2008). u.Ml Genet. Mol. Hum. 4407-4419. , uli cd Res. Acids Nucleic 290-304. , ur Biol. Curr. ora fCl cec 21)17 1–2 doi:10.1242/jcs.137703 812–827 127, (2014) Science Cell of Journal 20) euaoyrl o R1i h ut-ietoa trafficking multi-directional the in CRM1 for role regulatory A (2007). 26 8622-8632. , 2011 LSONE PLoS .Cl Sci. Cell J. 000646. , 9 21) OI n OItafca h RGliinterface. ER-Golgi the at traffic COPI and COPII (2011). 1065-1074. , 26 20) iscino OIadAf yaisi vivo in dynamics Arf1 and COPI of Dissection (2002). 348-364. , 20 7 41 1701-1711. , e51826. , ice.Bohs e.Commun. Res. Biophys. Biochem. 116 1255-1272. , 21) ula speckles. Nuclear (2011). 2039-2050. , 19) el sebe nNsassociate snRNPs assembled Newly (1999). x.Cl Res. Cell Exp. .Neurosci. J. 20) oefrcmlxso uvvlof survival of complexes for role A (2005). .Ml Biol. Mol. J. Cell Nature 146 .Cl Biol. Cell J. 20) nN rti expression protein snRNP (2001). Cell 384-395. , 417 o.Microbiol. Mol. .Cl Sci. Cell J. 23 401 20) h atra Sm-like bacterial The (2004). 133 309 187-193. , 6627-6637. , 681-689. , 21) mlcto fthe of Implication (2013). 585-600. , 185-197. , 183 223-239. , 21) Telomerase (2012). 120 odSrn Harb. Spring Cold 51 1540-1550. , 397 1525-1533. , 479-485. , x.Cell Exp. (2010a). (1998). Nature .Cell J. 827

Journal of Cell Science