DOCSLIB.ORG

Phylogenetic Relationships of the Bumblebee Subgenus Pyrobombus (Hymenoptera: Apidae) Inferred from Mitochondrial Cytochrome B and Cytochrome Oxidase I Sequences

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic Relationships of the Bumblebee Subgenus Pyrobombus (Hymenoptera: Apidae) Inferred from Mitochondrial Cytochrome B and Cytochrome Oxidase I Sequences Research Collection Journal Article Phylogenetic Relationships of the Bumblebee Subgenus Pyrobombus (Hymenoptera: Apidae) Inferred from Mitochondrial Cytochrome B and Cytochrome Oxidase I Sequences Author(s): Koulianos, Stella Publication Date: 1999 Permanent Link: https://doi.org/10.3929/ethz-b-000422490 Originally published in: Annals of the Entomological Society of America 92(3), http://doi.org/10.1093/aesa/92.3.355 Rights / License: In Copyright - Non-Commercial Use Permitted This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use. ETH Library SYSTEMATICS Phylogenetic Relationships of the Bumblebee Subgenus Pyrobombus (Hymenoptera: Apidae) Inferred from Mitochondrial Cytochrome B and Cytochrome Oxidase I Sequences STELLA KOULIANOS Experimental Ecology, ETH Zu¨ rich, ETH Zentrum NW, 8092 Zu¨ rich, Switzerland Ann. Entomol. Soc. Am. 92(3): 355Ð358 (1999) ABSTRACT Traditionally, the genus Bombus (Apidae: Apinae: Bombini) is divided into several subgenera. This study derives an approximation of the relationships between 10 species of the subgenus Pyrobombus (from both Europe and North America), B. lapidarius L. and B. sichelii Radoszkowski from the subgenus Melanobombus, and B. terrestris L. from the subgenus Bombus s. str., by comparing the mitochondrial cytochrome b and cytochrome oxidase I (COI) genes. Although bootstrap values for deep branches are mostly low, the sequences show signiÞcant phylogenetic signal, low homoplasy, and all trees share some patterns that are consistent with those from other phylogenetic studies on bumblebees. These results show that the subgeneric names Pyrobombus and Melanobombus do not accurately reßect phylogeny, and therefore it would seem wise to revise the existing system into monophyletic species-groups or even ignore the subgeneric names altogether. KEY WORDS Pyrobombus, bumblebees, cytochrome b, cytochrome oxidase I, mitochondrial DNA, phylogeny BUMBLEBEES OF THE subgenus Pyrobombus (Apidae: The current study provides a comparison of the Apinae: Bombini: Bombus) are Holarctic. Pyrobombus mitochondrial cytochrome b and cytochrome oxidase is the largest subgenus of Bombus, comprising of .40 I (COI) genes from 10 Pyrobombus species (from both species (Williams 1994), and accounts for almost half Europe and North America), B. lapidarius and B. sich- of the North American fauna. Like all bumblebees, elii Radoszkowski from the subgenus Melanobombus, species of this subgenus are morphologically very sim- and B. terrestris L. from the subgenus Bombus s. str., to ilar (Williams 1985, 1994), and this has resulted in derive an approximation of the relationships among much confusion about species deÞnitions because these species. Tetragona dorsalis Friese (Apidae: Api- they are also highly polymorphic with respect to coat nae: Meliponini), identiÞed as the sister group to the color (Scholl et al. 1995). Pyrobombus, however, has Bombini by several independent studies (Cameron been found to be heterogeneous with respect to en- 1991, 1993; Sheppard and McPheron 1991; Koulianos zymes (Pekkarinen et al. 1979, Pamilo et al. 1987, et al. 1999), and Apis mellifera L. (Apidae: Apinae: Scholl et al. 1995) and male marking pheromones Apini) (Crozier and Crozier 1993) were used as out- (Svensson 1979). groups. The close relationship of Pyrobombus to the subge- nus Melanobombus has been established by both mor- Materials and Methods phological (Plowright and Stephen 1973) and molec- Total DNA was extracted from part of the thorax or ular (Pamilo et al. 1987, Pedersen 1996) studies. from 2 legs of single individuals of 10 Pyrobombus Pyrobombus has been found to be paraphyletic by an species (Table 1), B. lapidarius, B. sichelii, and the extensive morphological study using wing venation by outgroup T. dorsalis using a modiÞcation of the pro- Plowright and Stephen (1973) and a molecular study, tocol of Edwards and Hoy (1993), as in Koulianos et which only included 2 Pyrobombus species, by Ped- al. (1999). ersen (1996). These 2 studies show a close association A 716-bp fragment of the cytochrome b gene was between B. lapidarius L. (Melanobombus) and the ampliÞed from these bees (excluding T. dorsalis, for Pyrobombus species B. bimaculatus Cresson and B. which the sequence was already available, see Table pratorum L. There is, however, evidence to the con- 1) using 2 oligonucleotide primers [CATTATT(G/ trary (i.e., no association between B. pratorum and B. A)TCC(T/A)AATATTGA(A/T)ATTGC and ATTA lapidarius) from the morphology of the penis valve CACCTCCTAATTTATTAGGAAT] (59 ends corre- (Williams 1985). Plowright and StephensÕs (1973) sponding to positions 11168 and 11884, respectively, in study also separated 6 species from the main Pyrobom- Crozier and Crozier [1993]), and Taq polymerase bus cluster and grouped these with species belonging (Promega, Wallisellen, Switzerland) in a Perkin Elmer to Bombus s. str. (Rotkreuz, Switzerland) Cetus thermal cycler for 40 0013-8746/99/0355Ð0358$02.00/0 q 1999 Entomological Society of America 356 ANNALS OF THE ENTOMOLOGICAL SOCIETY OF AMERICA Vol. 92, no. 3 Table 1. List of taxa used Table 2. Pairwise distances calculated according to Tajima and Nei (1984) for the combined cytochrome b and COI sequences Pyrobombus Bombus lapponicus (F.) B. jonellus (Kirby) 2345678910 B. hypnorum (L.) B. pratorum (L.) 1 0.14 0.12 0.11 0.12 0.11 0.14 0.12 0.12 0.13 B. monticola Smith (COI only) 2 Ñ 0.11 0.12 0.11 0.10 0.11 0.11 0.12 0.13 B. frigidus (Smith) (cyt b only) 3 Ñ 0.07 0.08 0.08 0.10 0.09 0.09 0.12 B. bifarius (Cresson) 4 Ñ 0.07 0.07 0.09 0.07 0.09 0.11 B. ternarius (Say) 5 Ñ 0.07 0.11 0.08 0.09 0.12 B. flavifrons (Cresson) 6 Ñ 0.09 0.06 0.08 0.10 B. huntii (Greene) (COI only) 7 Ñ 0.09 0.10 0.13 Melanobombus B. lapidarius (L.) 8 Ñ 0.09 0.12 B. sichelii Radoszkowski 9 Ñ 0.12 Bombus s. str. B. terrestris (L.) Outgroups Tetragona dorsalis ziegleri (Friese) 1, B. terrestris; 2, B. lapidarius; 3, B. sichelii; 4, B. jonellus; 5, B. Apis mellifera (L.) hypnorum; 6, B. lapponicus; 7, B. pratorum; 8, B. ternarius; 9, B. flavi- frons; 10, B. bifarius. Apis mellifera sequences are from Crozier and Crozier (1993) (GenBank accession #L06178); B. hypnorum, B. terrestris, and B. lapidarius COI sequences are from Pedersen (1996) (GenBank ac- combined sequences were compared with estimate cession #L26569-70, 73); and B. terrestris and T. dorsalis cytochrome the phylogenetic relationships among the species in- b sequences are from Koulianos et al. (in press) (GenBank accession cluded in this study and to assess the phylogenetic #AF002721, 25). informativeness of these sequences. All new se- quences have been deposited in GenBank and are cycles under the following conditions: denaturation at accessible by the numbers AF066969Ð72, 84Ð85, 89, 928C for 1 min, annealing at 408C for 1 min, and ex- 91, AF077918Ð19, and AF084908Ð17. tension at 728C for 1 min. A 521-bp fragment of the Pairwise distances from the combined sequences COI gene was also ampliÞed from these bees (exclud- ranged from 0.06 to 0.14 (Table 2). The distance be- ing those already sequenced by Pedersen [1996]; see tween B. sichelii and the Pyrobombus species B. jonel- Table 1 again) using primers AP-L-2176 and AP-H- lus Kirby, B. hypnorum L., and B. lapponicus F. was as 2650, and conditions in Pedersen (1996). All products low or lower than comparisons within the Pyrobombus were puriÞed using the Wizard polymerase chain re- subgenus. In general, the largest distances were ob- action (PCR) Preps DNA PuriÞcation System (Pro- tained by comparing B. terrestris, B. lapidarius, and B. mega). bifarius Cresson to each other and any other species. One individual per species was sequenced in both The distance between B. lapponicus and B. monticola directions from the puriÞed double-stranded PCR Smith calculated from the COI sequences alone was product, by Microsynth GmbH (Bulgach, Switzer- 0.006, .10-fold smaller than all other comparisons. land). This suggests that B. monticola and B. lapponicus are Sequence information was aligned by eye. Diver- not 2 separate species, contrary to evidence from mor- gence between bumblebee species (d) was estimated phology, behavior, and male marking pheromones by the method of Tajima and Nei (1984). Parsimony (Svensson 1979). analyses were carried out separately on the cyto- Parsimony analysis of the cytochrome b gene chrome b and COI sequences, as well as on the com- yielded 133 informative characters, 2 most-parsimo- bined sequences using PAUP 4.0 d64 (Swofford, per- nious trees, a skewness value of g1 521.26 (P , 0.01), sonal communication) and a branch and bound and a homoplasy index of 0.08. Analysis of the COI search. Support for the nodes was estimated by 1,000 gene yielded 51 informative characters, 12 most-par- bootstrap replications using Seqboot, Dnapars, and simonious trees, a skewness value of g1 520.44 (P , Consense in PHYLIP 3.57c (Felsenstein 1995). Max- 0.01), and a homoplasy index of 0.06. Analysis of the imum likelihood analyses were performed using PAUP combined sequences yielded 175 informative charac- 4.0 d64 and corrected with an estimated shape param- ters, 1 most-parsimonious tree, a skewness value of g1 eter of the gamma distribution. 521.32 (P , 0.01), and a homoplasy index of 0.05. For each of the data partitions, PAUP 4.0 d64 was The skewness values show that the cytochrome b, used to evaluate the strength of the phylogenetic sig- COI, and combined sequences all contain highly sig- nal by performing skewness tests (Hillis and Huelsen- niÞcant nonrandom structure which is likely to reßect beck 1992) using 10,000 randomly selected trees, and phylogenetic signal. The topology based on the anal- to assess the impact of character homoplasy by re- ysis of the COI region showed the lowest average weighting characters based on their rescaled consis- bootstrap values and the lowest homplasy index, tency indices and reanalyzing them with parsimony.
Load more

Recommended publications
  • Following the Cold
    Systematic Entomology (2018), 43, 200–217 DOI: 10.1111/syen.12268 Following the cold: geographical differentiation between interglacial refugia and speciation in the arcto-alpine species complex Bombus monticola (Hymenoptera: Apidae) BAPTISTE MARTINET1 , THOMAS LECOCQ1,2, NICOLAS BRASERO1, PAOLO BIELLA3,4, KLÁRA URBANOVÁ5,6, IRENA VALTEROVÁ5, MAURIZIO CORNALBA7,JANOVE GJERSHAUG8, DENIS MICHEZ1 andPIERRE RASMONT1 1Laboratory of Zoology, Research Institute of Biosciences, University of Mons, Mons, Belgium, 2Research Unit Animal and Functionalities of Animal Products (URAFPA), University of Lorraine-INRA, Vandoeuvre-lès-Nancy, France, 3Faculty of Science, Department of Zoology, University of South Bohemia, Ceskéˇ Budejovice,ˇ Czech Republic, 4Biology Centre of the Academy of Sciences of the Czech Republic, v.v.i., Institute of Entomology, Ceskéˇ Budejovice,ˇ Czech Republic, 5Academy of Sciences of the Czech Republic, Institute of Organic Chemistry and Biochemistry, Prague, Czech Republic, 6Faculty of Tropical AgriSciences, Department of Sustainable Technologies, Czech University of Life Sciences, Prague, Czech Republic, 7Department of Mathematics, University of Pavia, Pavia, Italy and 8Norwegian Institute for Nature Research, Trondheim, Norway Abstract. Cold-adapted species are expected to have reached their largest distribution range during a part of the Ice Ages whereas postglacial warming has led to their range contracting toward high-latitude and high-altitude areas. This has resulted in an extant allopatric distribution of populations and possibly to trait differentiations (selected or not) or even speciation. Assessing inter-refugium differentiation or speciation remains challenging for such organisms because of sampling difficulties (several allopatric populations) and disagreements on species concept. In the present study, we assessed postglacial inter-refugia differentiation and potential speciation among populations of one of the most common arcto-alpine bumblebee species in European mountains, Bombus monticola Smith, 1849.
    [Show full text]
  • The Conservation Management and Ecology of Northeastern North
    THE CONSERVATION MANAGEMENT AND ECOLOGY OF NORTHEASTERN NORTH AMERICAN BUMBLE BEES AMANDA LICZNER A DISSERTATION SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY GRADUATE PROGRAM IN BIOLOGY YORK UNIVERSITY TORONTO, ONTARIO September 2020 © Amanda Liczner, 2020 ii Abstract Bumble bees (Bombus spp.; Apidae) are among the pollinators most in decline globally with a main cause being habitat loss. Habitat requirements for bumble bees are poorly understood presenting a research gap. The purpose of my dissertation is to characterize the habitat of bumble bees at different spatial scales using: a systematic literature review of bumble bee nesting and overwintering habitat globally (Chapter 1); surveys of local and landcover variables for two at-risk bumble bee species (Bombus terricola, and B. pensylvanicus) in southern Ontario (Chapter 2); identification of conservation priority areas for bumble bee species in Canada (Chapter 3); and an analysis of the methodology for locating bumble bee nests using detection dogs (Chapter 4). The main findings were current literature on bumble bee nesting and overwintering habitat is limited and biased towards the United Kingdom and agricultural habitats (Ch.1). Bumble bees overwinter underground, often on shaded banks or near trees. Nests were mostly underground and found in many landscapes (Ch.1). B. terricola and B. pensylvanicus have distinct habitat characteristics (Ch.2). Landscape predictors explained more variation in the species data than local or floral resources (Ch.2). Among local variables, floral resources were consistently important throughout the season (Ch.2). Most bumble bee conservation priority areas are in western Canada, southern Ontario, southern Quebec and across the Maritimes and are most often located within woody savannas (Ch.3).
    [Show full text]
  • Colour Patterns, Distribution and Food Plants of the Asian Bumblebee
    Colour patterns, distribution and food plants of the Asian bumblebee Bombus bicoloratus (Hymenoptera: Apidae) Guiling Ding, Shiwen Zhang, Jiaxing Huang, Muhammad Naeem, Jiandong An To cite this version: Guiling Ding, Shiwen Zhang, Jiaxing Huang, Muhammad Naeem, Jiandong An. Colour patterns, distribution and food plants of the Asian bumblebee Bombus bicoloratus (Hymenoptera: Apidae). Apidologie, Springer Verlag, 2019, 50 (3), pp.340-352. 10.1007/s13592-019-00648-1. hal-02569077 HAL Id: hal-02569077 https://hal.archives-ouvertes.fr/hal-02569077 Submitted on 11 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Apidologie (2019) 50:340–352 Original article * INRA, DIB and Springer-Verlag France SAS, part of Springer Nature, 2019 DOI: 10.1007/s13592-019-00648-1 Colour patterns, distribution and food plants of the Asian bumblebee Bombus bicoloratus (Hymenoptera: Apidae) 1 2 1 1 1 Guiling DING , Shiwen ZHANG , Jiaxing HUANG , Muhammad NAEEM , Jiandong AN 1Key Laboratory for Insect-Pollinator Biology of the Ministry of Agriculture and Rural Affairs, Institute of Apicultural Research, Chinese Academy of Agricultural Sciences, Beijing 100093, China 2Gansu Institute of Apiculture, Tianshui 741022 Gansu, China Received 11 November 2018 – Revised 13 February 2019 – Accepted 19 March 2019 Abstract – Bombus bicoloratus is an important pollinator of wild flowers in the oriental region.
    [Show full text]
  • Tracking Plant Phenology and Pollinator Diversity Across Alaskan National Parks a Pilot Study
    National Park Service U.S. Department of the Interior Natural Resource Stewardship and Science Tracking Plant Phenology and Pollinator Diversity Across Alaskan National Parks A Pilot Study Natural Resource Report NPS/AKRO/NRR—2021/2291 ON THE COVER Clockwise from top left: A. Mocorro Powell collecting pollinators in Denali NPP; long-horned beetle on common yarrow; K. Fuentes scoring phenophases on common yarrow in Klondike Gold Rush NHP; bumble bee on fireweed NPS/Jessica Rykken Tracking Plant Phenology and Pollinator Diversity Across Alaskan National Parks A Pilot Study Natural Resource Report NPS/AKRO/NRR—2021/2291 Jessica J. Rykken National Park Service Denali National Park and Preserve PO Box 9 Denali Park, AK 99755 August 2021 U.S. Department of the Interior National Park Service Natural Resource Stewardship and Science Fort Collins, Colorado The National Park Service, Natural Resource Stewardship and Science office in Fort Collins, Colorado, publishes a range of reports that address natural resource topics. These reports are of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Report Series is used to disseminate comprehensive information and analysis about natural resources and related topics concerning lands managed by the National Park Service. The series supports the advancement of science, informed decision-making, and the achievement of the National Park Service mission. The series also provides a forum for presenting more lengthy results that may not be accepted by publications with page limitations. All manuscripts in the series receive the appropriate level of peer review to ensure that the information is scientifically credible, technically accurate, appropriately written for the intended audience, and designed and published in a professional manner.
    [Show full text]
  • Assessing Bumble Bee Diversity, Distribution, and Status for the Michigan Wildlife Action Plan
    Assessing Bumble Bee Diversity, Distribution, and Status for the Michigan Wildlife Action Plan Prepared By: Logan M. Rowe, David L. Cuthrell, and Helen D. Enander Michigan Natural Features Inventory Michigan State University Extension P.O. Box 13036 Lansing, MI 48901 Prepared For: Michigan Department of Natural Resources Wildlife Division 12/17/2019 MNFI Report No. 2019-33 Suggested Citation: Rowe, L. M., D. L. Cuthrell., H. D. Enander. 2019. Assessing Bumble Bee Diversity, Distribution, and Status for the Michigan Wildlife Action Plan. Michigan Natural Features Inventory, Report Number 2019- 33, Lansing, USA. Copyright 2019 Michigan State University Board of Trustees. MSU Extension programs and materials are open to all without regard to race, color, national origin, gender, religion, age, disability, political beliefs, sexual orientation, marital status or family status. Cover: Bombus terricola taken by D. L. Cuthrell Table of Contents Abstract ........................................................................................................................................................ iii Introduction .................................................................................................................................................. 1 Methods ........................................................................................................................................................ 2 Museum Searches ....................................................................................................................................
    [Show full text]
  • 1 Checklist of the Bumble Bees of British Columbia Rob Cannings
    Checklist of the Bumble Bees of British Columbia Rob Cannings, Royal BC Museum (revised July 2011). Family Apidae: Subfamily Apinae: Tribe Bombini, Genus Bombus Bumble bees are large or medium sized bees conspicuously marked with yellow and black hairs, sometimes with additional red or white hairs. Most of the species collect pollen but those in the subgenus Psithyrus live as social parasites in the nests of other Bombus species. The genus is distributed in North and South America, in Eurasia and from the Philippines to western Indonesia. Some species have been introduced to other places, such as New Zealand and Australia. The following list of 32 known British Columbia species is assembled from various publications and museum collections. The list will probably be changed as more specimens are examined and should be considered preliminary. The taxonomy used is that of Natural History Museum (London) (Williams 2008), a fine, up-to-date systematic summary of the bumblebees of the world, although I have maintained B. occidentalis separate from B. terricola. Psithyrus has long been considered a genus separate from Bombus but most authorities now place it as a subgenus in Bombus; the four species in BC are listed separately for convenience. Except for Psithyrus, none of the subgenera often used in Bombus classification are included in this list. A few synonyms are listed (indents) to indicate the fate of some familiar names, especially those noted in Buckell (1951), Milliron (1973a, b) and Hurd (1979). Bombus impatiens Cresson, a common species from eastern North America, as of 2011 is an established alien species in the Lower Mainland.
    [Show full text]
  • The Type Material of Swedish Bees (Hymenoptera, Apoidea) I
    Ent. Tidskr. 128 (2007) Type material of Swedish bees The type material of Swedish bees (Hymenoptera, Apoidea) I. L. ANDERS NILSSON Nilsson, L.A.: The type material of Swedish bees (Hymenoptera, Apoidea) I. [Typmaterial av svenska bin (Hymenoptera, Apoidea) I.] – Entomologisk Tidskrift 128 (4): 167-181. Uppsala, Sweden 2007. ISSN 0013-886x. Sweden with Carl von Linné is the cradle of Systematics and therefore also the origin of a disproportionate part of the taxonomic type material. Bees are no exception. This report is the first part of an examination, including taxonomic revision, of the actual, re- puted or potential bee type material of Swedish origin. Focus is on the status, type locality, present condition, depository and history. Here, a total of 20 original specific taxa have been studied. Lectotypes are designated for 13 whereby it is stated that seven epithets are valid (bold), viz. Andrena cincta Nylander 1848, A. clypearis Nylander 1848, A. subopaca Nylander 1848, Coelioxys temporalis Nylander 1848, Colletes suecica Aurivillius 1903, Halictus sexnotatulus Nylander 1852, Heriades breviuscula Nylander 1848, Kirbya mel- anura Nylander 1852, Megachile apicalis Nylander 1848 which replacement name Mega- chile analis Nylander 1852 has the same type, Nomada cincticornis 1848, N. obtusifrons Nylander 1848, Prosopis armillata Nylander 1848 and Rhophites halictulus Nylander 1852. Especially, Kirbya melanura is found to be a senior synonym of Cilissa wankowiczi Radoszkowski 1891. The valid name of the species is Melitta melanura (Nylander) and its type locality the island of Gotland in the Baltic. L. Anders Nilsson, Department of Plant Ecology, Evolutionary Biology Centre, Uppsala University, Villavägen 14, SE-752 36 Uppsala, Sweden, E-mail: anders.nilsson@ebc.
    [Show full text]
  • Ancient Rapid Radiations of Insects: Challenges for Phylogenetic Analysis
    ANRV330-EN53-23 ARI 2 November 2007 18:40 Ancient Rapid Radiations of Insects: Challenges for Phylogenetic Analysis James B. Whitfield1 and Karl M. Kjer2 1Department of Entomology, University of Illinois, Urbana, Illinois 61821; email: jwhitfi[email protected] 2Department of Ecology, Evolution and Natural Resources, Rutgers University, New Brunswick, New Jersey 08901; email: [email protected] Annu. Rev. Entomol. 2008. 53:449–72 Key Words First published online as a Review in Advance on diversification, molecular evolution, Palaeoptera, Orthopteroidea, September 17, 2007 fossils The Annual Review of Entomology is online at ento.annualreviews.org Abstract by UNIVERSITY OF ILLINOIS on 12/18/07. For personal use only. This article’s doi: Phylogenies of major groups of insects based on both morphological 10.1146/annurev.ento.53.103106.093304 and molecular data have sometimes been contentious, often lacking Copyright c 2008 by Annual Reviews. the data to distinguish between alternative views of relationships. Annu. Rev. Entomol. 2008.53:449-472. Downloaded from arjournals.annualreviews.org All rights reserved This paucity of data is often due to real biological and historical 0066-4170/08/0107-0449$20.00 causes, such as shortness of time spans between divergences for evo- lution to occur and long time spans after divergences for subsequent evolutionary changes to obscure the earlier ones. Another reason for difficulty in resolving some of the relationships using molecu- lar data is the limited spectrum of genes so far developed for phy- logeny estimation. For this latter issue, there is cause for current optimism owing to rapid increases in our knowledge of comparative genomics.
    [Show full text]
  • Diversity of Pollinator Communities in Eastern Fennoscandia and Eastern Baltics Results from Pilot Monitoring with Yellow Traps in 1997 - 1998
    1 The Ei nnish Envi ron ment 44 NATURE AND NATURAL RESOURCES Guy Söderman Diversity of pollinator communities in Eastern Fennoscandia and Eastern Baltics Results from pilot morntorrng with Yellow traps in 1997 - 1998 1 / •--1 4 -- . Ö . O4 FINNISH ENVIRONMENT INSTITUTE The Finnish Environment 355 Diversity of pollinator communities in Eastern Fennoscandia and Eastern Baltics Results from pilot monitoring with Yellow traps in 1997 - 1998 HELSINKI 1999 . .. .. .. .. ... ...... .. .. FINNISH ENVIRONMENT INSTITUTE ISBN 952-I 1-0579-8 ISSN 1238-73 12 Cover phota: Reima Leinonen (Bombus Iucorum) Maps: Estonian Envimnment lnformation Centre Makeup: Pikseri]ulkaisupalvelut Oy Edita Ab Helsinki 1999 0 The Finnish Environment 355 Contents ...... 1 Introduction . ...... 5 2 i1ethods and t.,Iaterial . 7 3 Groups, Ecology and Behaviour ofPollinators 9 4 Threatened Species 1 1 5 Results frorn Conparative Tests 12 6 Species Composition, Distribution and Abundance 16 6.1 Social Bees (Apidae) 16 6.2 Solitary Bees (Apoidea, other families) 28 6.3 Social Wasps (Vespfdae) 30 6.4 Solitary Wasps (Eumenidae) 32 6.5 Hoverfties (Syrphfdae) 33 6.6 Other Groups 37 7 Relation between Captures and Natural Fauna 39 7.1 Within-Species Relations 39 7.2 Between-Spedes Relatfons 39 8 Diversity andAssociated Features of the Fauna 42 8.1 Quantitative Aspects of Pollfnator Diversfty 42 8.2 Qualftative Aspects of Pollinator Diversity 45 8.3 1ffects of Land Use 47 9 Discussion and Conclusions 49 9.1 Yellow-trapping as a Monitoring Technfque 49 9.2 Changes in the fauna and Species Abundancy 50 10 Acknoi.vledgeiiients 5 1 1 1 Literature 52 Ilnnexes 55 TheFinnshEnvironment355 0 0 .
    [Show full text]
  • Mating Frequency and Genetic Colony Structure of the Neotropical Bumblebee Bombus Wilmattae (Hymenoptera: Apidae)
    Mating frequency and genetic colony structure of the neotropical bumblebee Bombus wilmattae (Hymenoptera: Apidae) Anett Huth-Schwarz, Adolfo León, Rémy Vandame, Robin Moritz, F. Kraus To cite this version: Anett Huth-Schwarz, Adolfo León, Rémy Vandame, Robin Moritz, F. Kraus. Mating frequency and genetic colony structure of the neotropical bumblebee Bombus wilmattae (Hymenoptera: Apidae). Apidologie, Springer Verlag, 2011, 42 (4), pp.519-525. 10.1007/s13592-011-0038-4. hal-01003571 HAL Id: hal-01003571 https://hal.archives-ouvertes.fr/hal-01003571 Submitted on 1 Jan 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Apidologie (2011) 42:519–525 Original article * INRA, DIB-AGIB and Springer Science+Business Media B.V., 2011 DOI: 10.1007/s13592-011-0038-4 Mating frequency and genetic colony structure of the neotropical bumblebee Bombus wilmattae (Hymenoptera: Apidae) 1 2 3 1 Anett HUTH-SCHWARZ , Adolfo LEÓN , Rémy VANDAME , Robin F. A. MORITZ , 1 F. Bernhard KRAUS 1Institut für Biologie, Martin-Luther-Universität Halle-Wittenberg, Hoher Weg 4, 06099 Halle/Saale, Germany 2Universidad de Ciencias y Artes de Chiapas, Tuxtla Gutiérrez, Chiapas, Mexico 3El Colegio de la Frontera Sur, San Cristóbal de las Casas, Chiapas, Mexico Received 20 May 2010 – Revised 14 September 2010 – Accepted 23 September 2010 Abstract – So far, nearly all studies concerning the mating frequency of bumblebees have been conducted with temperate species, showing that single mating seems to be the predominant pattern in bumblebees.
    [Show full text]
  • Os Nomes Galegos Dos Insectos 2020 2ª Ed
    Os nomes galegos dos insectos 2020 2ª ed. Citación recomendada / Recommended citation: A Chave (20202): Os nomes galegos dos insectos. Xinzo de Limia (Ourense): A Chave. https://www.achave.ga /wp!content/up oads/achave_osnomesga egosdos"insectos"2020.pd# Fotografía: abella (Apis mellifera ). Autor: Jordi Bas. $sta o%ra est& su'eita a unha licenza Creative Commons de uso a%erto( con reco)ecemento da autor*a e sen o%ra derivada nin usos comerciais. +esumo da licenza: https://creativecommons.org/ icences/%,!nc-nd/-.0/deed.g . 1 Notas introdutorias O que cont n este documento Na primeira edición deste recurso léxico (2018) fornecéronse denominacións para as especies máis coñecidas de insectos galegos (e) ou europeos, e tamén para algúns insectos exóticos (mostrados en ám itos divulgativos polo seu interese iolóxico, agr"cola, sil!"cola, médico ou industrial, ou por seren moi comúns noutras áreas xeográficas)# Nesta segunda edición (2020) incorpórase o logo da $%a!e ao deseño do documento, corr"xese algunha gralla, reescr" ense as notas introdutorias e engádense algunhas especies e algún nome galego máis# &n total, ac%éganse nomes galegos para 89( especies de insectos# No planeta téñense descrito aproximadamente un millón de especies, e moitas están a"nda por descubrir# Na )en"nsula * érica %a itan preto de +0#000 insectos diferentes# Os nomes das ol oretas non se inclúen neste recurso léxico da $%a!e, foron o xecto doutro tra allo e preséntanse noutro documento da $%a!e dedicado exclusivamente ás ol oretas, a!ela"ñas e trazas . Os nomes galegos
    [Show full text]
  • Integrative Taxonomy of an Arctic Bumblebee Species Complex
    Zoological Journal of the Linnean Society, 2019, XX, 1–23. With 7 figures. applyparastyle “fig//caption/p[1]” parastyle “FigCapt” Integrative taxonomy of an arctic bumblebee species Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zlz041/5557776 by guest on 31 August 2019 complex highlights a new cryptic species (Apidae: Bombus) BAPTISTE MARTINET1*, THOMAS LECOCQ1,2, NICOLAS BRASERO1, MAXENCE GERARD1, KLÁRA URBANOVÁ4, IRENA VALTEROVÁ3,4, JAN OVE GJERSHAUG5, DENIS MICHEZ1 and PIERRE RASMONT1 1University of Mons, Research Institute of Biosciences, Laboratory of Zoology, Place du Parc 20, 7000 Mons, Belgium 2Université de Lorraine, INRA, URAFPA, F-54000 Nancy, France 3Academy of Sciences of the Czech Republic, Institute of Organic Chemistry and Biochemistry, Flemingovo nám 2, CZ-166 10 Prague, Czech Republic 4Czech University of Life Sciences, Faculty of Tropical AgriSciences, Department of Sustainable Technologies, Kamýcká 129, CZ-165 21 Prague, Czech Republic 5Norwegian Institute for Nature Research, PO Box 5685 Sluppen, NO-7485 Trondheim, Norway Received 21 November 2017; revised 12 February 2019; accepted for publication 24 April 2019 Bumblebees have been the focus of much research, but the taxonomy of many species groups is still unclear, especially for circumpolar species. Delimiting species based on multisource datasets provides a solution to overcome current systematic issues of closely related populations. Here, we use an integrative taxonomic approach based on new genetic and eco-chemical datasets to resolve the taxonomic status of Bombus lapponicus and Bombus sylvicola. Our results support the conspecific status of B. lapponicus and B. sylvicola and that the low gradual divergence around the Arctic Circle between Fennoscandia and Alaska does not imply speciation in this species complex.
    [Show full text]