Quality-Control Mechanisms Targeting Translationally Stalled and C-Terminally Extended Poly(GR) Associated with ALS/FTD

Quality-control mechanisms targeting translationally stalled and C-terminally extended poly(GR) associated with ALS/FTD

Shuangxi Lia, Zhihao Wua, Ishaq Tantraya,YuLia, Songjie Chenb, Jason Dongc, Steven Glynnd, Hannes Vogela, Michael Snyderb, and Bingwei Lua,1

aDepartment of Pathology, Stanford University School of Medicine, Stanford, CA 94305; bDepartment of Genetics, Stanford University School of Medicine, Stanford, CA 94305; cElectrical Engineering and Computer Sciences, University of California, Berkeley, CA 94305; and dDepartment of Biochemistry and Cell Biology, Stony Brook University, Stony Brook, NY 11794

Edited by Lily Yeh Jan, University of California, San Francisco, CA, and approved August 26, 2020 (received for review March 24, 2020) Maintaining the fidelity of nascent peptide chain (NP) synthesis is in translation termination activity (6–8). In response, the con- essential for proteome integrity and cellular health. Ribosome- served ribosome-associated quality control (RQC) complex is associated quality control (RQC) serves to resolve stalled transla- recruited to stalled ribosomes to target the aberrant translation tion, during which untemplated Ala/Thr residues are added C ter- products and the template mRNAs for degradation. Studies in minally to stalled peptide, as shown during C-terminal Ala and Thr yeast showed that NPs on stalled ribosomes can be modified addition (CAT-tailing) in yeast. The mechanism and biological ef- while still attached to 60S subunits, in a C-terminal Ala and Thr fects of CAT-tailing–like activity in metazoans remain unclear. Here addition (CAT-tailing) process (9). So far CAT-tailing has been we show that CAT–tailing-like modification of poly(GR), a dipep- studied mainly using artificial substrates and under conditions tide repeat derived from amyotrophic lateral sclerosis with fronto- that interfere with the degradation of the stalled NPs. The temporal dementia (ALS/FTD)-associated GGGGCC (G4C2) repeat physiological role of CAT-tailing in the context of intact RQC expansion in C9ORF72, contributes to disease. We find that pol- remains unsettled. It may induce the heat-shock response (10), y(GR) can act as a mitochondria-targeting signal, causing some push lysine residues of stalled NPs out of the ribosome exit poly(GR) to be cotranslationally imported into mitochondria. How- tunnel (11), or drive degradation of stalled NPs on and off the ever, poly(GR) translation on mitochondrial surface is frequently ribosomes (12). Recent studies in yeast and metazoans empha- – stalled, triggering RQC and CAT-tailing like C-terminal extension sized the importance of RQC and CAT-tailing–like process in (CTE). CTE promotes poly(GR) stabilization, aggregation, and tox- maintaining mitochondrial function by protecting the integrity of Drosophila icity. Our genetic studies in uncovered an important nuclear-encoded mitochondrial proteins that are cotranslation- role of the mitochondrial protease YME1L in clearing poly(GR), ally imported (7, 13). Since failure in the timely removal of CAT- revealing mitochondria as major sites of poly(GR) metabolism. tailed proteins can cause proteotoxicity in yeast (14–16), and Moreover, the mitochondria-associated noncanonical Notch sig- defective RQC is linked to neurodegeneration in mouse mutants naling pathway impinges on the RQC machinery to restrain pol- (17, 18) and PD models (7), it is important to elucidate the y(GR) accumulation, at least in part through the AKT/VCP axis. The conserved actions of YME1L and noncanonical Notch signaling in animal models and patient cells support their fundamental in- Significance volvement in ALS/FTD. Amyotrophic laterosclerosis (ALS) is a rapidly progressing C9-ALS/FTD | ribosome-associated quality control | CAT-tailing | YME1L | neurological disease that robs patients’ motor functions. De- Notch spite intensive research, molecular events that initiate the disease are poorly understood. Expansion of G4C2 repeats in the C9orf72 gene causes ALS with frontotemporal dementia, berrant protein aggregation manifesting failed cellular one of the most common forms of ALS. Increasing evidence protein homeostasis (proteostasis) is a defining feature of A suggests that dipeptides translated from G4C2 repeat tran- age-related neurodegenerative diseases (1, 2). These hallmark scripts, especially the arginine-containing poly(GR) and pol- aggregates include amyloid plaque in Alzheimer’s disease, Lewy y(PR), are particularly toxic. We found that translation of body in Parkinson’s disease (PD), neurofibrillary tangle in poly(GR) can occur on mitochondrial surface and is frequently tauopathies, poly-Q aggregate in Huntington’s diseas, and TDP- stalled, triggering ribosome-associated quality control and 43 aggregate in amyotrophic laterosclerosis (ALS). While ge- C-terminal extension, which promote poly(GR) aggregation netic mutations associated with the familial forms of diseases and toxicity. Genetic studies uncovered conserved roles of may cause protein misfolding and thus promote protein aggre- mitochondrial protease YME1L and noncanonical Notch sig- gation, less well understood is how the protein aggregates form naling in restraining poly(GR), offering insights into disease in the sporadic cases, which account for more than 90% of the pathogenesis and targets for therapeutic intervention. disease and which do not contain the familial mutations.

Previous studies have focused heavily on aberrant folding and Author contributions: S.L., Z.W., I.T., and B.L. designed research; S.L., Z.W., I.T., Y.L., S.C., posttranslational modifications of fully synthesized, mature J.D., S.G., H.V., and B.L. performed research; M.S. contributed new reagents/analytic tools; proteins in mediating protein aggregation in aging or age-related S.L., Z.W., I.T., Y.L., S.C., J.D., S.G., H.V., and B.L. analyzed data; and S.L. and B.L. wrote diseases (3). Nevertheless, ubiquitination and degradation of the paper. nascent peptides (NPs) still associated with ribosomes is a The authors declare no competing interest. widespread phenomenon, indicating that quality control happens This article is a PNAS Direct Submission. early in the life cycle of cellular proteins (4, 5). During NP Published under the PNAS license. synthesis, the translating ribosomes could be stalled by a number 1To whom correspondence may be addressed. Email: [email protected]. of factors, including mRNA defects, strong mRNA secondary This article contains supporting information online at https://www.pnas.org/lookup/suppl/ structures, insufficient supply of aminoacyl-tRNAs, electrostatic doi:10.1073/pnas.2005506117/-/DCSupplemental. interaction between NPs and the ribosome exit tunnel, or deficit First published September 21, 2020.

25104–25115 | PNAS | October 6, 2020 | vol. 117 | no. 40 www.pnas.org/cgi/doi/10.1073/pnas.2005506117 Downloaded by guest on October 2, 2021 regulation and function of RQC and CAT-tailing in disease Fig. S1D), indicating specificity of YME1L regulation of pol- settings. However, the CAT-tailing–like C-terminal extension y(GR). Although most of the studies described above were done (CTE) of stalled NPs, the compositions of the CTEs, and the in male flies, female flies showed similar phenotypes and pol- pathological consequences of such CTE in disease settings have y(GR) regulation by YME1L (SI Appendix, Fig. S1E). Moreover, not been accessible for investigation due to the lack of identified manipulation of a number of other mitochondrial proteases, CAT-tailed substrates in metazoans, except in the case of the including Lon and Rhomboid, did not affect poly(GR) level (SI mitochondrial complex-I 30-kDa protein in the context of Appendix, Fig. S1F), demonstrating specificity of YME1L regu- PD (7). lation of poly(GR). Expansion of G4C2 repeats in the 5′-UTR of C9ORF72 is the We further confirmed the YME1L effect on poly(GR) in most common genetic cause of ALS with frontotemporal de- mammalian cells. Flag-GR80 accumulated to higher levels in mentia (C9-ALS/FTD). A number of mechanisms have been put YME1L knockout HEK293 cells generated by CRISPR-Cas9 forward to explain the pathogenesis of G4C2 repeat expansion (Fig. 1E), a phenotype that was rescued by WT YME1L but (19, 20), including C9ORF72 haplo-insufficiency, toxicity asso- not a catalytically inactive YME1L-E543Q (Fig. 1F). Conversely, ciated with sense and antisense RNA foci, or proteotoxicity in- overexpression YME1L-GFP or YME1L-Flag dramatically reduced by dipeptide repeat (DPR) proteins (GA, GP, GR, PA, duced GR80 level (Fig. 1 G and H), whereas YME1L-E543Q- PR) translated from G4C2 repeat-carrying sense and antisense Flag failed to do so (Fig. 1H). In C9-ALS/FTD patient fibro- transcripts in all six possible reading frames. Increasing evidence blasts containing expanded G4C2 repeats, poly(GR) but not emphasizes the pathogenic contribution of DPRs, with arginine- poly(GA) level was reduced by YME1L cDNA and elevated by containing poly(GR) and poly(PR) exhibiting particular cyto- YME1L small-interfering RNA (siRNA) transfections (SI Ap- toxicity (19–22). Despite intensive recent efforts, how the ex- pendix, Fig. S1G). Mitochondrial defects (swelling, vacuolization, pression of the poly(GR) protein causes cellular toxicity remains and loss of cristae) seen in patient fibroblasts were also rescued unclear, and even less is known about cellular mechanisms that by YME1L-OE (SI Appendix, Fig. S1H). These results implicate protect against such toxicity. Here we report a mechanism of mitochondria as major sites of poly(GR) toxicity and YME1L, a poly(GR) toxicity that involves its translational stalling and CTE key regulator of poly(GR) metabolism. on the mitochondrial surface. We also describe cellular quality- We next tested whether YME1L might regulate poly(GR) control mechanisms protecting against poly(GR) toxicity un- abundance by targeting it for degradation. Using an in vitro covered through genetic analysis in Drosophila models and system that recapitulates the ATP-dependent protease activity of shown to be conserved in mammalian settings. Our results offer YME1L (45), we found that WT YME1L but not a catalytically the initial insights into the regulation of RQC by cellular sig- inactive YME1L was able to degrade Flag-GR80. In contrast, NEUROSCIENCE naling pathways regulating development and metabolism, and YME1L failed to degrade a similarly prepared mitochondrial highlight the pathogenic role of defective RQC in linking mito- protein (Flag-C-I30), demonstrating substrate specificity of chondrial dysfunction and proteostasis failure. YME1L toward GR80 (Fig. 1 I and J). Thus YME1L, a mitochondrial i-AAA protease, protects against the build-up and Results toxicity of poly(GR). Genetic Identification of YME1L as a Conserved Regulator of Poly(GR) Abundance. Drosophila has been an excellent model organism for Poly(GR) Is Cotranslationally Imported into Mitochondria. Next we investigating pathogenic mechanisms of human diseases, and a investigated how poly(GR) ended up in mitochondria to cause large body of work has been done on C9-ALS/FTD–related toxicity. GR80 may be synthesized in the cytosol and imported models in Drosophila (23–39). To elucidate the pathogenic into mitochondria through the TOM complex. Import of mechanism of poly(GR), we used transgenic Drosophila nuclear-encoded proteins often involves a mitochondrial tar- expressing N-terminally Flag-tagged GR80 repeats (Flag-GR80) geting sequence (MTS) rich in positively charged amino acids (40). When expressed in the muscle under Mhc-Gal4 control, and other structural information, such as α-helical conformation Flag-GR80 caused prominent toxicity manifested as flightless (46). MTS mimicry by the poly(GR) may engage the TOM flies with held up or droopy wing posture (Fig. 1A), resembling complex and lead to GR80 import into mitochondria. The TOM the phenotype caused by mitochondrial dysfunction and flight complex has also been shown to interact with MTS newly muscle degeneration seen in PINK1 mutant flies (41–43). Con- emerging from the exit tunnel, leading to recruitment of NP and sistent with a mitochondrial toxicity of GR80 (40), in a candidate associated mRNP/ribosome to mitochondria outermembrane gene-based genetic modifier screen (SI Appendix, Table S1), we (MOM) (47). Although GR80 could be found broadly in the identified the mitochondrial intermembrane space ATPase as- cytosol including the nucleus, ∼60% of GR80 protein was found sociated with diverse cellular activities (i-AAA) protease to colocalize with mitochondria (SI Appendix, Fig. S2A). Im- YME1L, a major regulator of mitochondrial protein quality portantly, a portion of GR80 mRNA was present on percoll control (44). Overexpression of YME1L (YME1L-OE) rescued gradient-purified mitochondria (Fig. 2A), consistent with GR80 GR80-induced wing posture phenotype, whereas YME1L RNAi engaging in cotranslational import. To further test this idea, we had the opposite effect (Fig. 1A and SI Appendix, Fig. S1A). purified mitochondria from HEK293 cells or fly muscle Importantly, YME1L-OE dramatically reduced, whereas expressing Flag-GR80, and then treated them with hydroxyl- YME1L RNAi increased Flag-GR80 protein level (Fig. 1B). amine (HA), which releases NP from translating ribosomes (48), GR80 mRNA level was not affected (Fig. 1C), consistent with including MOM-associated ribosomes (49). Flag-GR80, but not YME1L regulating poly(GR) at the protein level. Upon YME1L mitochondrial proteins Tom40 or C-I30, was efficiently released RNAi, GR80 formed more prominent puncta colocalizing with from mitochondria by HA, supporting that it is translated on mitochondria (Fig. 1D). Examination of flight muscle mito- MOM (Fig. 2B). Treatment with puromycin, an antibiotic that chondria using the mito-GFP or mito-RFP reporter (Fig. 1D and resembles the 3′ end of aminoacylated tRNA, is another method SI Appendix, Fig. S1B) or by electron microscopy (SI Appendix, used to terminate translation and release NP (50). We found that Fig. S1C) showed that Flag-GR80 caused severe defects (swollen puromycin treatment could also release some GR80 from mito- or round-shaped mitochondria with marked vacuolization), chondria (Fig. 2C). We also used an MS2-binding site (bs)-tagged which were rescued by YME1L-OE (SI Appendix, Fig. S1 B and poly(GR) mRNA reporter and MS2-GFP to track the localization C). Notably, YME1L did not affect the level of two other C9- of the mRNA. GR80-MS2-bs mRNA exhibited partial mitochon- ALS/FTD-associated DPRs—poly(PR) and poly(GA)—which drial localization (Fig. 2D). These results, together with GR80 were localized primarily to nonmitochondrial sites (SI Appendix, interaction with Tom40 (Fig. 2E), the constituent of the import

Li et al. PNAS | October 6, 2020 | vol. 117 | no. 40 | 25105 Downloaded by guest on October 2, 2021 Fig. 1. YME1L negatively regulates poly(GR) expression and toxicity. (A–C) Effects of YME1L overexpression (OE) or RNAi (RI) on wing-posture (A) and GR80 protein (B) and mRNA (C) expression in Mhc-Gal4 > Flag-GR80 flies. Examples of normal and droopy wing posture are shown in A.(D) Immunostaining showing increased GR80 accumulation on mitochondria (labeled with mito-GFP) after YME1L-RI. Compared to control flies, Flag-GR80 flies showed regions devoid of mito-GFP (arrows), which was exacerbated by YME1L-RI. (E and F) Immunoblots showing the effect of CRISPR-mediated YME1L knockdown on Flag- GR80 expression in HEK293T cells (E) and rescue with WT or E543Q forms of YME1L (F). Cotransfected GFP serves as control for transfection efficiency in this and subsequent figures. (G and H) Effect of cotransfection of YME1L-GFP, or Flag tagged YME1L, and YME1L-E543Q on Flag-GR80 expression in HEK293T cells. (I and J) In vitro YME1L protease activity assay using hexYME1L as protease and Flag-GR80 or Flag-C-I30 as substrates. **P < 0.01 and ***P < 0.001 in one-way ANOVA test followed by SNK test plus Bonferroni correction (multiple hypotheses correction); N.S., nonsignificant. Values under the Flag- GR80 blots indicate normalized levels relative to control in this and all subsequent figures. Western blots represent at least two biological repeats.

channel (46), indicate that poly(GR) is cotranslationally imported. (52), but we also pretreated cells with homoharringtonine The engagement of GR80 with Tom40 may also explain why HA (HHT). HHT treatment inhibits new initiating events while and puromycin treatment only resulted in partial release of GR80 allowing active/elongating ribosomes to run off (53), resulting in from MOM (Fig. 2 B and C). labeling of stalled NPs by puromycin in the presence of emetin (52). Intriguingly, while global translation was sensitive to HHT, Stalled Translation of Poly(GR) mRNA on Mitochondrial Surface. mitochondria-associated GR80 was not (SI Appendix, Fig. S2 B Given that GR80 is positively charged, and that electrostatic and C), and nascent Flag-GR80 on MOM was translationally interaction between positively charged amino acidss in NP and stalled, as shown by its puromycinylation in the presence of negatively charged amino acids lining the ribosome exit tunnel emetin (SI Appendix, Fig. S2C). can cause ribosome stalling (51), we further hypothesized that To further test the idea of translational stalling of GR80 and the translation of GR80 mRNA on MOM is frequently stalled, to estimate the approximate length of GR repeats required for possibly explaining the difficulty in detecting long poly(GR) from ribosome stalling, we transfected HEK293 cells with Flag-(GR) patient cells or tissues by standard SDS/PAGE/Western blot. To n-GFP constructs expressing different-lengthed GR repeats test this idea, we repeated treatment of cells with puromycin, flanked by N-terminal Flag tag and C-terminal GFP tag (SI − which can be incorporated into elongating as well as stalled NPs Appendix, Fig. S2D). Detection of Flag and GFP+ full-length

25106 | www.pnas.org/cgi/doi/10.1073/pnas.2005506117 Li et al. Downloaded by guest on October 2, 2021 Fig. 2. Stalled translation of poly(GR) mRNA on mitochondria. (A) RT-PCR analysis of Percoll gradient-purified mitochondrial fractions from GR80 transgenic fly muscle showing the presence of GR80 mRNA (Left) and GR80 mRNA levels in total and mitochondrial fractions (Right). Mitochondrial-encoded mtCo-1 and cytosolic tubulin serve as positive and negative controls. (B and C) Release of Flag-GR80 NP by HA (B) or puromycin (C) treatment of mitochondria purified from GR80-expressing HEK293 cells or fly muscle. Untreated samples (control), and the supernatant (HA-release) or mitochondrial pellet (HA-remaining) of HA-treated samples were analyzed. (D) HEK293 cells transfected with MS2-bs or GR60-MS2-bs reporter constructs were costained for the cotransfected MS2- GFP that binds to MS2-bs, and the mitochondrial marker Tom20. (E) Immunoblots showing co-IP between Flag-GR80 and Tom40, and the preferential binding of Flag-GR80 to Rpl3 over Rps6. NEUROSCIENCE proteins produced from these constructs revealed a gradual re- but not 40S (Fig. 2D), depicted a picture of active quality control of peat length-dependent decrease of translation efficiency, with a ribosome-stalled poly(GR) anchored to MOM by TOM (SI Appen- dramatic decrease of translation efficiency occurring when more dix,Fig.S3C). than 67 GR repeats was expressed (SI Appendix, Fig. S2D). Since Next, we examined the in vivo effect of cotranslational quality the ribosome exit tunnel only accommodates a linear peptide of control, since GR80 also associated with RQC factors in the fly roughly 35-amino acids long, the longer GR peptide required to muscle (Fig. 3D). Overexpression of Pelo and ABCE1, induce ribosome stalling suggested that electrostatic interactions ribosome-splitting factors needed for RQC (8), resulted in dra- within the tunnel was not sufficient to induce stalling, and that matic reduction of GR80 level (Fig. 3E). Overexpression of fly interaction of poly(GR) with factors outside of the tunnel was homologs of core components of RQC (Ltn1, valosin-containing involved. For example, interaction with certain mitochondrial protein [VCP]), involved in degradation of stalled NPs (6–8), proteins may slow down the cotranslational import of GR80 and also dramatically reduced GR80 level (Fig. 3F). Conversely, cause stalled translation. Supporting this notion, GR80 inter- RNAi of Ltn1, VCP1, Pelo, or ABCE1 boosted GR80 level acted with Tom40 of the TOM/TIM complex (Fig. 2E). (Fig. 3 F and G). RNAi of RQC factors also promoted GR80 aggregate formation in the cytosol or associated with mito- Activation of RQC on MOM by Poly(GR). Ribosome stalling activates chondria (SI Appendix, Fig. S3D), whereas overexpression re- cotranslational quality-control mechanisms that target aberrant moved such aggregates (Fig. 3H). Correlating with effects on or incompletely synthesized/folded NPs for degradation. The GR80 level, overexpression of the RQC factors rescued GR80- first step toward resolving stalled ribosome is separation of 40S induced wing-posture defect, while their knockdown exacerbated and 60S subunits, with the NPs still present in a peptidyl-tRNA/ that (Fig. 3I). These results support the notion that the RQC 60S complex, forming a substrate for the RQC machinery. pathway is normally involved in restraining the expression of Consistent with RQC playing a physiological role in regulating poly(GR). To test the specificity of the RQC effect, we examined mitochondrial homeostasis, RQC factors were found constitu- FTD-related tau. The expression level of tau was not significantly tively present in the mitochondrial fraction of control and GR80- affected by genetic manipulations of RQC factors (SI Appendix, expressing HEK293 cells (SI Appendix, Fig. S3A) or fly muscle Fig. S3E), suggesting that the RQC pathway preferentially (SI Appendix, Fig. S3B). In the mitochondrial fraction, GR80 affects GR80. associated with 60S and certain RQC factors, and this interaction was weakened by RNase treatment, suggesting the interactions CAT-Tailing-like CTE of Poly(GR). CAT-tailed substrates escaping were partially mediated by RNA (Fig. 3A). Ribosome-stalled the quality-control system can accumulate and form aggregates NPs are modified by a nontemplated, 40S-independent CAT- (14–16). Remarkably, we found that unlike the other RQC fac- tailing process catalyzed by Tae2 in yeast (9). We found that bind- tors whose RNAi resulted in accumulation of GR80, as shown ing of RQC factor Clbn/NEMF, the metazoan homologs of Tae2, to above, RNAi of fly or mammalian Tae2 homolog (Clbn/NEMF) GR80 mRNA could be detected by RNA-immunoprecipitation (IP) decreased GR80 level (Fig. 4 A and B). Anisomycin treatment, assays in HEK293 cells (Fig. 3B)orflymuscle(Fig.3C). We note that which can inhibit CAT-tailing in vitro (54) and in vivo (7), the GR80 mRNA bound to Clbn/NEMF could be stalled GR80 showed similar but somewhat stronger effect (Fig. 4C), pre- mRNAs still bound to 60S before their degradation by the RNA sumably because the Clbn/NEMF RNAi effect was not complete quality-control machinery, or GR80 mRNA associated with 80S and (SI Appendix, Fig. S4A) and thus not as potent as anisomycin in polysomes, as previous studies showed that yeast Clbn/NEMF inhibiting CAT-tailing. Clbn/NEMF RNAi or anisomycin treat- counterpart Tae2 can associate with 80S and polysomes (13). These ment led to not only reduced GR80 level but also removal of results, together with the associationofGR80withTom40and60S some slightly higher molecular weight smear signals (Fig. 4 A–C),

Li et al. PNAS | October 6, 2020 | vol. 117 | no. 40 | 25107 Downloaded by guest on October 2, 2021 Fig. 3. RQC of poly(GR) in fly tissues and mammalian cells. (A) Co-IP assays using extracts treated with or without RNase A to test the role of RNA in fa- cilitating interactions between Flag-GR80 and the RQC factors. (B and C) RNA-IP assays showing binding of NEMF (B)orClbn(C)toGR80 mRNA in HEK293T (B) or fly muscle (C) samples. Bar graphs show quantification of GR80 mRNA level in IP samples. ***P < 0.001 in Student’s t test. (D) Immunoblots showing co-IP between Flag-GR80 and RQC factors in fly muscle. (E–G) Immunoblots showing effects of overexpression or knockdown of RQC factors on Flag-GR80 level in fly muscle. (H) Immunostaining showing effects of overexpressing various RQC factors on Flag-GR80 level on muscle mitochondria. (I) Quantification showing effects of altered activities of RQC factors on GR80-induced wing posture phenotype. *P < 0.05 and **P < 0.01 in one-way ANOVA test followed by SNK test plus Bonferroni correction. Western blots represent at least two biological repeats.

presumably reflecting the elimination of CAT-tails. Conversely, decreased poly(GR) level (SI Appendix, Fig. S4C). Thus steady- Clbn-OE increased the relative proportion of poly(GR) smear state poly(GR) level is positively correlated with a CAT- signals (Fig. 4D). RNAi of a fly homolog of Vms1, a stress- tailing–like process in fly tissues and patient fibroblasts. responsive mitochondrial RQC factor that cleaves peptidyl- To test the CAT-tailing model further, we examined the role tRNA bond and thus antagonizes CAT-tailing–like activity (13, of Ala- or Thr-tRNA synthetase (AARS or TARS) that are also 55–58), increased GR80 smear signal and total GR80 abundance required for CAT-tailing–like CTE in Drosophila and mamma- (Fig. 4E). Overexpression of mammalian Vms1 (ANKZF1) had lian cells (7). AARS and TARS RNAi significantly reduced the opposite effect (SI Appendix, Fig. S4B). In C9-ALS/FTD fi- GR80 level, including the higher molecular weight smear signal broblasts, ANKZF1 RNAi increased, whereas NEMF RNAi (Fig. 4F), its aggregation (Fig. 4G), and muscle toxicity (SI

25108 | www.pnas.org/cgi/doi/10.1073/pnas.2005506117 Li et al. Downloaded by guest on October 2, 2021 NEUROSCIENCE

Fig. 4. CAT-tailing–like CTE of ribosome-stalled poly(GR). (A and B) Immunoblots showing effects of Clbn or NEMF RNAi on Flag-GR80 level in fly muscle (A) or HEK293 cells (B). (C) Immunoblots and immunostaining showing effect of anisomycin on Flag-GR80 level in HEK293T cells. (D–F) Immunoblots showing effects of Clbn-OE (D) or RNAi of fly Vms1 (E) and various ARSs (F) on Flag-GR80 level in fly muscle. (G) Immunostaining showing effects of RNAi of various ARSs on Flag-GR80 associated with muscle mitochondria. (H) Immunoblots showing effect of IARS RNAi on Flag-GR80 level in fly muscle. (I–K) MS/MS spectra of the parent ion of peptides generated by collision-induced dissociation fragmentation. Matched peptide sequence entries from the custom-built database were shown below each spectrum. The blue and yellow vertical lines in the MS spectra represent “y” and “b” ions, respectively, found in the BY matches. The BY matches are fragment ions found in the high-energy data that suggest a particular identification for a given precursor ion found in the low-energy data.

Appendix, Fig. S4D). Interestingly, isoleucyl tRNA synthsetase Further supporting this notion, we found that a fraction of (IARS) RNAi had similar effect (Fig. 4 G and H and SI Ap- poly(GR) from HEK293T cells or fly muscle tissue was present pendix, Fig. S4D), and like AARS and TARS RNAi, IARS RNAi in SDS-resistant aggregates that were stuck in the stacking gel effectively rescued GR80-induced mitochondrial morphology during SDS/PAGE (SI Appendix, Fig. S4F), and that poly(GR) defect (SI Appendix, Fig. S4E). The slightly stronger effect of containing an artificial CAT-tail (GR71-AT15) formed prom- IARS RNAi on GR80 toxicity than AARS or TARS RNAi might inent aggregates on mitochondria on its own. As expected, be due to stronger knockdown of IARS mRNA level by the GR71-AT15 level was not affected by NEMF RNAi or aniso- transgene line used (SI Appendix, Fig. S4A). The specificity of mycin treatment (SI Appendix, Fig. S4G). Moreover, while a the A/T/I ARS effect was shown by the lack of effect of the other Flag-GR11 protein was undetectable under conditions that ARSs tested (Fig. 4F). Thus AARS/TARS, and possibly select allowed Flag-GR80 detection, presumably due to its short length other ARSs (e.g., IARS), appear to be involved in CAT- and inability to induce CAT-tailing, artificially CAT-tailed Flag- tailing–like CTE, and such modification confers stabilization, GR11-AT16 was readily detectable and it formed SDS-resistant aggregation, and toxicity of GR80. aggregates (SI Appendix, Fig. S4H).

Li et al. PNAS | October 6, 2020 | vol. 117 | no. 40 | 25109 Downloaded by guest on October 2, 2021 To further test the CAT-tailing hypothesis, we performed full-length Notch was without effect on Notch regulation of GR80 mass spectrometry of Flag-GR80 purified from Mhc-Gal4 > (SI Appendix,Fig.S5B). Flag-GR80 flies by denaturing IP. Based on in vivo ARS re- Full-length Notch has been shown to be present on muscle quirements, we assumed that A/T/I might be the preferred amino mitochondria, where Notch, PINK1, and mechanistic target of acids added to the C terminus of GR repeats, and we built rapamycin (mTORC)2 are known to constitute a mitochondria- custom libraries with variations of A/T/I-containing CTEs. Our associated noncanonical Notch pathway, acting by influencing search of tandem mass spectra against the databases identified the phosphorylation and activity of the mTORC2 substrate AKT GR peptides with A/T/I-containing CTEs and spectra matching (60). We found that key components of this pathway, AKT – the collision-induced dissociation fragments of the peptides (Fig. 5 A C) and PINK1 (SI Appendix, Fig. S5 C and D), were as (Fig. 4 I–K and SI Appendix, Fig. S4I). effective as Notch in restraining GR80. Consistent with these genes operating in a common pathway, the effect of Notch in The Noncanonical Notch Signaling Pathway Restrains Poly(GR) Expression inhibiting GR80 was abolished by knocking down mTORC2 in Flies. We sought to gain further insight into the in vivo regulation component Rictor or AKT (Fig. 5 C and E). of poly(GR) RQC through analysis of genetic modifiers isolated The AKT-VCP Axis Mediates the Effect of Noncanonical Notch Signaling from the screen that also led to YME1L (SI Appendix,TableS1). on Poly(GR). We next explored the relationship between non- The strongest modifier we uncovered was Notch, whose over- canonical Notch signaling and the RQC/CAT-tailing process. By expression resulted in the most complete suppression of GR80 manipulating individual RQC components, we found that VCP toxicity (Fig. 5A). This was correlated with diminished GR80 level RNAi showed prominent effect in blocking the effect of Notch on (Fig. 5B and SI Appendix,Fig.S5A), and full restoration of mito- GR80 (Fig. 5 F and G), suggesting that VCP is a key mediator of chondrial morphology (Fig. 5C). Although Notch is best known to noncanonical Notch signaling. Since VCP protein level was not act through conserved nuclear factors, such as mastermind (Mam) affected by Notch (Fig. 5H), we considered posttranslational and Suppressor of Hairless [Su(H)], to regulate transcription via modification of VCP by noncanonical Notch signaling and tested canonical Notch signaling (59), Su(H) and Mam were not required the potential role of AKT. We found robust physical interaction for the inhibition of GR80 by Notch (Fig. 5D). Consistently, over- betweenAKTandVCP(Fig.6A). Chemical activation of AKT expression of just Notch intracellular domain (NICD), which is with SC79 (61) increased VCP phosphorylation at consensus critically involved in canonical Notch signaling, was not as effective AKT-target sites, whereas inhibition of AKT with small-molecule as full-length Notch in inhibiting GR80 expression, whereas dele- inhibitors of AKT (AKTi) (62) had the opposite effect (Fig. 6B), tion of the Su(H)-interacting CDC10 repeats from the NICD of suggesting that VCP is a genuine AKT substrate. Consistent with

Fig. 5. Negative regulation of poly(GR) expression and toxicity by noncanonical Notch signaling in fly muscle. (A) Quantification of effect of Notch-OE or AKT-OE on GR80-induced wing posture defect. (B) Immunoblots showing effect of Notch-OE or AKT-OE on Flag-GR80 and Clbn expression. (C) TEM images showing effects of Notch-OE or AKT-OE, or Notch-OE + AKT-RI, on GR80-induced mitochondrial morphology defect. Arrows mark mitochondria. Insets show zoom-in view of selected areas of interest (yellow squares). GR-80 caused swelling and loss of cristae and electron-dense material, phenotypes rescued by Notch-OE or AKT-OE. AKT-RI blocked the Notch-OE effect. Magnification: 5×.(D) Immunoblots showing lack of effect of Su(H) RNAi or OE of dominant- negative Mam [Man(H)] on the inhibition of Flag-GR80 expression by Notch-OE. (E and F) Immunoblots showing the effects of RNAi of AKT or Rictor (E), or VCP RNAi (F) on the inhibition of Flag-GR80 expression by Notch-OE. (G) Quantification of effect of VCP RNAi on the suppression of GR80-induced wing posture defect by Notch-OE. (H) Immunoblots assessing effect of Notch-OE on endogenous VCP or Clbn expression. *P < 0.05; ***P < 0.001.

25110 | www.pnas.org/cgi/doi/10.1073/pnas.2005506117 Li et al. Downloaded by guest on October 2, 2021 VCP being a key downstream effector of AKT, VCP RNAi also (Fig. 6F). These results support the notion that AKT acts as an attenuated the inhibitory effect of AKT-OE on GR80 toxicity in upstream kinase that positively regulates the activity of VCP. fly muscle (Fig. 6 C and D). In HEK293T cells, overexpression of Intriguingly, in addition to VCP, Clbn was also regulated by Notch1, one of the four mammalian Notch homologs, reduced Notch signaling. Clbn protein level was significantly increased in Flag-GR80 level, an effect blocked by small-molecule inhibitors of GR80 fly muscle, an effect abolished by Notch-OE or AKT-OE VCP (VCPi) (SI Appendix,Fig.S6A). Treatment of HEK293T (Fig. 5 B and H). Although the detailed mechanisms of Clbn up- cells with ATK activator SC79 (SI Appendix,Fig.S6B and C) also regulation by GR80 and its subsequent down-regulation by reduced Flag-GR80 level, whereas AKTi and VCPi increased Notch/AKT remain to be delineated, it appeared that VCP was Flag-GR80 level (SI Appendix,Fig.S6D). The observed effect of involved (SI Appendix, Fig. S6G). Thus, through activation of VCP and inhibition of Clbn, noncanonical Notch signaling pre- SC79 on GR80 expression was specific and dependent on AKT vents the build-up of CAT-tailed poly(GR). Regulation of GR80 activity, as AKTi treatment (SI Appendix,Fig.S6E)orknockdown expression by the Notch/AKT/VCP axis and the RQC pathway is SI Appendix F of AKT isoforms by RNAi ( ,Fig.S6 )blockedthe observed in female flies as well (SI Appendix, Fig. S6 H–J). SC79 effect. We also tested the specificity of the noncanonical Notch sig- We next examined the biochemical relationship between VCP naling and RQC/CAT-tailing pathways in regulating the ex- and AKT. VCP contains multiple potential AKT phosphoryla- pression of C9-ALS/FTD–associated DPRs. For reasons unclear tion sites. Two adjacent sites (S745 and S747) had previously to us, GA80 and PR80 proteins were undetectable by standard been implicated in phospho-regulation by AKT (63, 64). We Western blots. We therefore resorted to immunostaining to de- found that a phospho-mimetic form of VCP (VCP-S745/747D) tect these proteins upon genetic manipulations of RQC factors. was more active than VCP-WT in reducing GR80 expression, We found that whereas GA80 was not affected by the various whereas the nonphosphorylatable form (VCP-S745/747A) was manipulations, PR80 responded to altered activities of Notch/AKT/ inactive (Fig. 6E). Moreover, unlike VCP-WT, whose activity VCP, but not Clbn (Fig. 6 G and H and SI Appendix,Fig.S6K was inhibited by AKTi, VCP-S745/747D was resistant to AKTi and L). The mechanism of PR80 regulation by Notch/AKT/VCP NEUROSCIENCE

Fig. 6. The AKT-VCP axis mediates the effects of noncanonical Notch signaling on poly(GR) expression and toxicity. (A) Immunoblots showing co-IP between VCP and AKT. (B) Immunoblots showing the effect of SC79 and AKTi on VCP phosphorylation at consensus AKT target site(s) in HEK293T cells. (C) Immu- noblots showing effects of VCP RNAi on the inhibition of Flag-GR80 expression by AKT-OE. (D) Quantification of effect of VCP RNAi on the suppression of GR80-induced wing posture defect by AKT-OE. (E and F) Immunoblots showing the effects of VCP-WT, VCP-S745/747D, and VCP-S745/747A on Flag-GR80 protein level (E), and the effects of VCP-WT and VCP-S745/747D in the presence of AKTi (F). (G and H) Immunostaining showing the effect of Notch, AKT, VCP, and YME1L OE on the levels of Flag-GA80 (G) and Flag-PR80 (H) in fly muscle. Bar graphs show quantification of Flag-GA80 and Flag-PR80 immunofluorescent signals. *P < 0.05, **P < 0.01, and ***P < 0.001 in one-way ANOVA test followed by SNK test plus Bonferroni correction.

Li et al. PNAS | October 6, 2020 | vol. 117 | no. 40 | 25111 Downloaded by guest on October 2, 2021 but not Clbn is currently unknown. YME1L-OE had no effect on Mitochondrial dysfunction is also intimately associated with ag- GA80 or PR80 level (Fig. 6 G and H). ing and age-related diseases (2). How these hallmarks of disease We also tested whether the YME1L and the Notch/RQC are connected at the mechanistic level is not well defined. In this pathways identified from the muscle-based genetic screens work study we show that poly(GR) is cotranslationally imported into similarly in neuronal settings to regulate poly(GR). We used the mitochondria and its translation is frequently stalled, leading to photoreceptors as a neuronal system to test genetic interactions. CAT-tailing–like modification and aggregation. We identify mi- Our results indicate that the genetic interactions detected in fly tochondrial YME1L as a key factor in poly(GR) metabolism and muscle are largely preserved in the photoreceptors (SI Appendix, noncanonical Notch signaling as a key pathway regulating the Fig. S7). RQC and CAT-tailing of poly(GR). These results not only syn- thesize a new model connecting defective RQC/CAT-tailing with Noncanonical Notch Signaling Regulates Poly(GR) in C9-ALS/FTD Patient proteostasis failure and mitochondrial dysfunction, two patho- Cells. We further examined the effect of the noncanonical Notch logical hallmarks of neurodegenerative diseases and other age- signaling pathway in regulating poly(GR) expression in a more related diseases, but also identify other players regulating this physiologically relevant setting using C9-ALS/FTD patient fibro- process (SI Appendix, Fig. S9). The mechanism of mitochondrial blasts. Overexpressing noncanonical Notch pathway genes (Notch, dysfunction caused by poly(GR) is beginning to emerge. A recent AKT) or RQC factor (VCP) significantly reduced poly(GR) level study showed that poly(GR) can interact with components of the (Fig. 7A) and restored mitochondrial morphology (Fig. 7B). On mitochondrial contact site and cristae organizing system the other hand, AKTi or VCPi treatment increased poly(GR) (MICOS), altering MICOS dynamics and intrasubunit interac- level (Fig. 7C). Moreover, we found that poly(GR) was enriched tions (66). It is likely that poly(GR) interaction with other mi- in the mitochondrial fraction in C9-ALS/FTD patient cells, and tochondrial proteins, such as ATP5A1 (67), also contributes to SC79 treatment significantly reduced that (Fig. 7D), accompanied its mitochondrial toxicity. by restoration of mitochondrial morphology (Fig. 7B). As reported Quality control starts when NPs are still associated with ri- previously (65), C9-ALS/FTD patient fibroblasts exhibited ele- bosomes. Our finding of frequent ribosome stalling associated vated mitochondrial membrane potential (MMP) compared to with poly(GR) translation offers one explanation of translational cells from control subjects (SI Appendix,Fig.S8A). The increased stress associated with poly(GR) (68). Our results support the MMP in C9-ALS fibroblasts is likely due to the alteration and model of positively charged poly(GR) mimicking MTS and tightening of cristae junctions caused by poly(GR), thereby directing nascent poly(GR) and the ribosome/mRNP complex to impairing mitochondrial ion homeostasis, as reported in a recent MOM, causing stalled translation in a GR length-dependent publication (66). Overexpression of Notch and AKT rescued the manner, presumably facilitated by poly(GR) interaction with MMP defect in patient fibroblasts (SI Appendix, Fig. S8B), and mitochondrial factors such as Tom40. This may explain the other conditions that reduced poly(GR) level, such as YME1L- poly(GR) length (∼67 GR) required to induced translational OE (SI Appendix,Fig.S8C), also lowered MMP; thus, it is likely stalling. Although shorter GR may not be able to induce stalled that Notch and AKT acted through poly(GR) to regulate MMP in translation, they could still cause cytotoxicity by other mecha- patient cells. nisms, including alteration of nucleolar function (31). It is also possible that delivering of nascent poly(GR)/ribosome/mRNP Discussion complex to MOM represents a cellular attempt to use mito- Proteostasis failure increases with aging and is a common feature chondria and mitochondrial protein quality-control machinery to of age-related diseases. Not surprisingly, RQC—an important handle aggregating proteins, as previously shown in yeast (69). In step in proteostasis control—is linked to neurodegeneration. either case, inefficient resolution of stalled ribosomes on MOM

Fig. 7. Regulation of poly(GR) expression by noncanonical Notch signaling in C9-ALS/FTD patient fibroblasts. (A) Dot blots showing the effect of genetic manipulation of Notch and VCP on poly(GR) expression in C9-ALS/FTD patient fibroblasts. (B) TEM showing the effect of genetic manipulation or chemical treatment on mitochondrial morphology in patient fibroblasts. Arrows mark mitochondria. Insets show zoom-in view of selected areas of interest (yellow squares). The swelling and loss of electron-dense material and cristae structure was rescued by SC79 treatment or OE of Notch and AKT. Magnification: 5×.(C) Dot blots showing the effect of VCPi and AKTi treatment on poly(GR) level in C9-ALS/FTD patient fibroblasts. (D) Dot blots showing the enrichment of poly(GR) in the mitochondria of patient fibroblasts and the effect of SC79 treatment on poly(GR) level. Dot blots represent at least two biological repeats.

25112 | www.pnas.org/cgi/doi/10.1073/pnas.2005506117 Li et al. Downloaded by guest on October 2, 2021 will led to CAT-tailing–like CTE and accumulation and aggre- collected/raised in one vial and 3 ∼ 4 independent vials were counted gation of CAT-tailed poly(GR), which can either enter mito- per genotype. chondria to disrupt mitochondrial homeostasis or be released from MOM to form cytosolic aggregates and cause proteotoxic Immunostaining. For immunostaining analysis of adult fly muscles, 7- to 10-d-old male flies raised at 25 °C were analyzed. Images shown were rep- stress. One could also envision that ribosome-stalled GR80 may resentative of at least five individuals for each genotype. Briefly, fly thoraxes sequester RQC factors away from their normal cellular sub- were dissected and quickly washed with 1× PBS and fixed with 4% formal- strates, creating a deficiency of cellular RQC activity, which may dehyde in 1× PBS for 20 min at room temperature. After fixation, muscle also lead to neurodegeneration (17, 18). Besides identifying tissues were blocked with 1× PBS containing 5% normal goat serum for poly(GR) as the first disease-causing protein that is subjected to 30 min. Indicated primary antibodies were added and incubated overnight CAT-tailing–like CTE modification, this study further empha- at 4 °C. After three steps of washing with 1× PBST containing 0.1% Triton X- sizes the essential role of RQC to mitochondrial proteome in- 100, each for 15 min at room temperature, Alexa Fluor 568-conjugated and tegrity and organelle homeostasis (7, 13). Alexa Fluor 488-conjugated second antibodies (1:500, Molecular Probes) and Drosophila Alexa Fluor 633 Phalloidin (1:500, Invitrogen, A22284) were mixed with tis- Through genetic analysis in models, we identified sues for 2 h at room temperature and subsequently washed and mounted in two mechanisms, mediated by noncanonical Notch signaling and SlowFade Gold buffer (Invitrogen). YME1L, in the quality control of poly(GR) at the cotranslational For immunohistochemical analysis in mammalian cells, cells were cultured and posttranslational levels. Although by necessity the Dro- on ethanol-cleaned cover glasses. After washing with 1×PBS three times and sophila models for studying the toxicity of individual DPRs in- fixing with 4% formaldehyde in 1× PBS for 30 min at room temperature, variably involve overexpression, the fact that we could validate cells were washed and permeabilized with 1× PBS containing 0.25% Triton the roles of Notch and YME1L in patient fibroblasts strongly X-100 for 15 min. The fixed samples were subsequently blocked with 1× PBS supports the relevance of our findings to human disease condi- containing 5% normal goat serum and incubated for 1 h at room temper- tions. Future studies will explore the specific features in pol- ature followed by incubation with primary antibodies at 4 °C overnight. After washing, samples were incubated with Alexa Fluor 488-, 594-, and y(GR) that make it a substrate for YME1L and possible 633-conjugated secondary antibodies (1:500; Molecular Probes). interplay between the noncanonical Notch and YME1L pathways. The mechanisms by which Clbn is up-regulated when Generation of YME1L Knockout HEK293 Cell Lines. To perform lentiviral CRISPR/ poly(GR) is expressed, and how this is blocked by Notch and Cas9-mediated knockout manipulation (73), single-guide RNA (sgRNA) se- VCP, also warrant further study. quences with a minimal number of off-target sites in human YME1L gene Other important issues regarding the role of RQC in C9-ALS/ were selected and insert into the LentiCRISPR vector. sgRNA sequences are as FTD remain: For example, the cross-talk between RQC and follows: YME1L-KO-1-5: 5′CACCGTAAAGACTTACCTCACTGCT3′; YME1L-KO-1- 3: 5′AAACAGCAGTGAGGTAAGTCTTTAC3′; YME1L-KO-2-5: 5′CACCGCTCTTC NEUROSCIENCE mitochondrial functional state, as mitochondrial stress can di- ′ ′ rectly influence the RQC machinery (7); the general role of GTT CTGCTGCTATT3 ; YME1L-KO-2-3: 5 AAACAATAGCAGCAGAACGAAGAG C3′; YME1L-KO-3-5: 5′CACCGGCAGAACGAAGAGAATCAGA3′; YME1L-KO-3-3: mitochondrial dysfunction in ALS/FTD, as previous studies have 5′AAACTCTGATTCTCTTCGTTCTGCC3′. To establish YME1L KO HEK293T cell implicated a pathogenic role of defective mitochondria in ALS lines, LentiCRISPR-YME1L constructs with different sgRNAs were transfected (70, 71); the relationship between RQC/CAT-tailing and stress with the packaging plasmids pVSVg and psPAX2 into HEK293(F)T cells. granule formation, a process broadly implicated in the patho- Seventy-two hours posttransfection, viral supernatant was collected to infect genesis of C9-ALS/FTD and other diseases (72). Future studies HEK293T cells, followed by puromycin (1 μg/mL) selection. Several batches of addressing these questions will offer new insights into ALS knockout cell pool were picked and confirmed by immunostaining and pathogenesis. Western blot with YME1L antibody. Materials and Methods Mammalian Cell Culture. HEK293T cells (ATCC) were cultured under standard conditions (1× DMEM, 5% FBS, 5% CO , 37 °C). HEK 293T cell transfections Drosophila Genetics. The fly stocks were obtained from the following sources: 2 were performed using Lipofectamine 3000 (cat#: L3000015, Invitrogen), and UAS-Flag-GR80, UAS-Flag-GA80, UAS-Flag-PR80, and GMR-Gal4 > Flag-GR80; siRNA knockdown experiments were performed using Lipofectamine RNAi- Gal80ts (Fen-Biao Gao, University of Massachusetts, Worcester, MA), MAX reagent (cat#: 13778150, Invitrogen), according to manufacturer’sin- UAS-mito-GFP (William Saxton, University of California at Santa Cruz, Santa structions. Briefly, HEK293T cells and patient fibroblast cells were Cruz, CA), UAS-YME1L-GFP (Hong Xu, NIH, Bethesda, MD), UAS-VCP (Paul transfected with lipofectamine RNAiMAX reagent according to standard Taylor, St. Jude Children’s Hospital, Memphis, TN), UAS-Notch-V5 (Mark protocol. After 72-h transfection, cells were washed with warm PBS, fol- Fortini, NIH, Bethesda, MD), PINK1B9 (Jongkeong Chung, Seoul National lowed by lysis and Western blot analysis. Invitrogen siRNAs used for indi- University, Seoul, Republic of Korea), UAS-Clbn (Xiaolin Bi, Dalian Medical vidual genes are as follows: siCON (cat#: 12935-400), siNEMF (HSS113541, University, Dalian, China), UAS-Tau (Mel Feany, Harvard Medical School, HSS113540), siYME1L (cat#: AM16708), siVCP (HSS111263, HSS111264), Δ Harvard, MA), UAS-Notch-NICD, and UAS-Notch- cdc10 (Ed Giniger, NIH, siANKZF1 (HSS123962), siAKT1 (VHSS40082), siAKT2 (VHS41339), siAKT3 Bethesda, MD). The YME1L RNAi (#51752), UAS-Pelo (#68150), ABCE1 RNAi (cat#: AM51331). C9-ALS/FTD patient fibroblasts, and matched control fi- (#31601), ABCE1-EP (#27945), Ltn-EP (#30116), Ltn RNAi (#41866), Clbn RNAi broblasts were described previously ( 74) and kindly provided by Aaron (#62402), Vms1 RNAi (#62861), IARS RNAi (#58176), UAS-AKT (#8191), AKT Gitler (Stanford University, Stanford, CA). RNAi (#31701), Rictor RNAi (#31527), Su(H) RNAi (#28900), UAS-Mam(H) Drugs and their concentrations used in cell culture studies are: Anisomycin (#26673), CG6512 RNAi (#50524), CG6512 RNAi (#34343), Lon RNAi (#34586), (A9789, Sigma; 50 μM); AKT activator sc79 (S7863, Selleckchem; 2 μM); AKT Rhomboid-7 RNAi (#35617), and Rhomboid-7 RNAi (#67309) fly stocks were inhibitor MK-2206 (S1078; Selleckchem; 2 μM); VCP inhibitor NMS-873 (cat#: obtained from the Bloomington Drosophila Stock Center. VCP RNAi S7285, Selleckchem; 1 μM); Puromycin (P9620, Sigma; 100 μM); Emetine (v24354), Pelo RNAi (v34770), AARS RNAi (v17171), TARS RNAi (V7752), DARS (E2375, Sigma; 200 μM); HHT (H0635, Sigma; 5 μM). MMP of C9-ALS/FTD RNAi (v7750), YARS RNAi (v105615), LARS RNAi (v45048), SARS RNAi patient fibroblasts was measured using Image-iT TMRM reagent (Invitrogen, (v41928), VARS RNAi (v21782), CARS RNAi (v45611), FARS RNAi (v107079), cat# I34361) following the manufacturer’s instructions. and MARS RNAi (v106493) stocks were purchased from the Vienna Dro- sophila Resource Center Stock Center. Other stocks were generated in our Puromycin Labeling of Stalled NPs. HEK293T cells transfected with pcDNA- laboratory. Flag-GR80 were treated with puromycin (100 μM, Sigma) and emetine (200 Fly stocks were raised at room temperature and crosses were performed μM, Sigma) at 37 °C for 5 min before harvesting. Cells were then placed on with standard procedures. In general, flies were raised at 25 °C and with 12/ ice, washed with cold HBS, and subjected to mitochondrial purification. To 12-h dark/light cycles. Fly food was prepared according to the standard re- preferentially label stalled NPs, cells were treated with HHT (5 μM; Tocris ceipt (water, 17 L; agar, 93 g; cornmeal, 1,716 g; brewer’s yeast extract, 310 Bioscience) for 10 min to prevent new translation initiation and to allow g; sucrose, 517 g; dextrose, 1,033 g). Unless otherwise indicated, male flies at active ribosomes to run off before the addition of puromycin/emetine. NPs 1 to 2 wk of age were used for the experimental procedures. on MOM were subjected to Western blot or IP analysis. For in vitro puro- For all wing posture assays, 7-d-old male flies were visually scored and all mycin labeling of NPs on MOM, purified mitochondria were suspended in

of the experimental groups were aged at 25 °C. Around 20 male flies were 10 mM Tris (pH 7.4), 400 mM KCl, 3 mM MgCl2, and 2 μM biotin-linked

Li et al. PNAS | October 6, 2020 | vol. 117 | no. 40 | 25113 Downloaded by guest on October 2, 2021 puromycin (Jena Bioscience). Puromycylation reactions were performed at standard PCR thermal cycling protocol. Calculated data were collected using 37 °C for 90 min, and postreaction, biotin-puromycin labeled NPs were pu- StepOne software V2.3. Data were exported into Excel and further pro- rified with Pierce Neutravidin agarose beads and subjected to further cessed for quantification and statistical analysis. Relative mRNA levels shown analysis. in the graph were normalized by actin. Relative GR80 mRNA levels shown in the RNA-IP graph were normalized by Tfam. RT-PCR. For RT-PCR analysis, total RNAs were extracted from HEK293T cells or fly thoraces by using the RNeasy Minikit (Qiagen), followed by cDNA syn- Quantification and Statistical Analysis. All analyses were performed with SPSS thesis using the iScript cDNA synthesis kit (Bio-Rad). For RT-PCR analysis of fly (IBM). Error bars represent SD. For pair-wise comparisons, we used two-tailed muscle samples, 7-d-old male flies were used. For RT-PCR analysis of GR80 Student’s t test. For comparing multiple groups, we used a one-way ANOVA expression in HEK293T cells, RNAs were extracted after 72 h posttransfection test followed by Student Newman–Keuls test (SNK test) plus Bonferroni with pcDNA3-Flag-GR80 plasmid. correction (multiple hypotheses correction). Images and Western blots Sequences of RT-PCR primers used in fly studies are as follows: GR80 sense: 5′GGATTACAAGGACGACGACGAT3′; GR80 antisense: 5′ATTCCACCACTGCTC- shown were representatives of three independent repeats. Quantification of CCATTC3′; Actin42A sense: 5′TCTTACTGAGCGCGGTTACAG3′; Actin42A an- signal intensity on immunoblots for normalization was performed using NIH tisense: 5′ATGTCGCGCACAATTTCAC3′; α-Tubulin sense: 5′CGTATACGCTCT- ImageJ. For wing posture analysis, three groups were used, with each group CTGAGTCAGACCTC3′; α-Tubulin antisense: 5′GCAGACCGGTGCACTGATCGG- n = 15. For qRT-PCR analysis, seven flies were used to extract RNA, followed CCAGC3′; Tfam sense: 5′GGCTCAGGTGGATCGATAAG3′; Tfam antisense: 5′- by cDNA transcription and qRT-PCR. Three biological repeats were per- GAGTGGCACCAAAAGACCAC3′;YME1Lsense5′-GAGTCGGCCACACAGATCG- formed. For the quantification of GA, PR, and TMRM intensity, three inde- 3′; YME1L antisense 5′-GAGAAGAGCGGACGAAGAAGA -3′; Clbn sense 5′-GCG pendent experiments were performed, with five technical repeats used for CAAGACGCAGCAGACG-3′; Clbn antisense 5′-TCTGCTGGGCATCTCTTC-CTCC-3′; each genotype. IARS sense 5′-CTAGAGCGGAACGACGTGTG-3′;IARSantisense5′TCAAAGATA- ′ ′ ′ TTTTCGTGTCGCCA-3 ; AARS sense 5 -GCACATCTATGTTCACTC-GTCC-3 ;AARS Data Availability. All study data are included in the main text and SI Appendix. antisense 5′-CCAGTTTCCCAGCATTTCAAAG-3′;TARSsense5′-AGGGTCTCGCTG- ′ ′ ′ ACAACAC-3 ; and TARS antisense 5 -GCAGGGTGCAGTTTC-CCTC-3 . ACKNOWLEDGMENTS. We thank Drs. William Saxton, Fen-Biao Gao, Paul Sequences of RT-PCR primers used in mammalian cell studies are: GR80 Taylor, Hong Xu, Xiaolin Bi, the Vienna Drosophila RNAi Center, FlyORF, and ′ ′ ′ sense: 5 ATGGATTACAAGGACGACGACGAT3 ; GR80 antisense: 5T-ACACC the Bloomington Drosophila Stock Center for fly stocks; Drs. Fen-Biao Gao ACTCAGACAATGCGATGC3′; GAPDH sense: 5′AGAAGGCTGGGGCTCATTTG3′; and Luke Wiseman for plasmids; Xiaolin Bi for antibody; Dr. Aaron Gitler for and GAPDH-antisense: 5′AGGGGCCATCCACAGTCTTC3′. C9-amyotrophic lateral sclerosis with frontotemporal dementia patient fi- For qRT-PCR, RNA was purified using RNeasy mini kit (Qiagen), and sub- broblasts and discussions; Jennifer Gaunce for maintaining flies and provid- jected to reverse transcription using the iScript cDNA synthesis kit (Bio-Rad). ing technical support; and members of the B.L. laboratory for discussions. cDNA templates were mixed with PowerUp SYBR Green Master Mix (Applied This work was supported by NIH Grants R01NS083417, R01NS084412, and Biosystems) and detected by StepOnePlus real-time PCR system according to R01AR0748750 (to B.L.), and R01GM115898 (to S.G.).

1. C. L. Klaips, G. G. Jayaraj, F. U. Hartl, Pathways of cellular proteostasis in aging and 22. Y. Yuva-Aydemir, S. Almeida, F. B. Gao, Insights into C9ORF72-related ALS/FTD from disease. J. Cell Biol. 217,51–63 (2018). Drosophila and iPSC models. Trends Neurosci. 41, 457–469 (2018). 2. Y. Hou et al., Ageing as a risk factor for neurodegenerative disease. Nat. Rev. Neurol. 23. Z. Xu et al., Expanded GGGGCC repeat RNA associated with amyotrophic lateral 15, 565–581 (2019). sclerosis and frontotemporal dementia causes neurodegeneration. Proc. Natl. Acad. 3. A. Ciechanover, P. Brundin, The ubiquitin proteasome system in neurodegenerative Sci. U.S.A. 110, 7778–7783 (2013). diseases: Sometimes the chicken, sometimes the egg. Neuron 40, 427–446 (2003). 24. S. Mizielinska et al., C9orf72 repeat expansions cause neurodegeneration in Dro- 4. S. Duttler, S. Pechmann, J. Frydman, Principles of cotranslational ubiquitination and sophila through arginine-rich proteins. Science 345, 1192–1194 (2014). quality control at the ribosome. Mol. Cell 50, 379–393 (2013). 25. D. Yang et al., FTD/ALS-associated poly(GR) protein impairs the Notch pathway and is 5. F. Wang, L. A. Durfee, J. M. Huibregtse, A cotranslational ubiquitination pathway for recruited by poly(GA) into cytoplasmic inclusions. Acta Neuropathol. 130, 525–535 – quality control of misfolded proteins. Mol. Cell 50, 368 378 (2013). (2015). 6. C. A. P. Joazeiro, Mechanisms and functions of ribosome-associated protein quality 26. K. Zhang et al., The C9orf72 repeat expansion disrupts nucleocytoplasmic transport. – control. Nat. Rev. Mol. Cell Biol. 20, 368 383 (2019). Nature 525,56–61 (2015). 7. Z. Wu et al., MISTERMINATE mechanistically links mitochondrial dysfunction with 27. B. D. Freibaum et al., GGGGCC repeat expansion in C9orf72 compromises nucleocy- – proteostasis failure. Mol. Cell. 75, 835 848.e8 (2019). toplasmic transport. Nature 525, 129–133 (2015). 8. O. Brandman, R. S. Hegde, Ribosome-associated protein quality control. Nat. Struct. 28. H. Tran et al., Differential toxicity of nuclear RNA foci versus dipeptide repeat pro- Mol. Biol. 23,7–15 (2016). teins in a Drosophila model of C9ORF72 FTD/ALS. Neuron 87, 1207–1214 (2015). 9. P. S. Shen et al., Protein synthesis. Rqc2p and 60S ribosomal subunits mediate mRNA- 29. A. S. Burguete et al., GGGGCC microsatellite RNA is neuritically localized, induces independent elongation of nascent chains. Science 347,75–78 (2015). branching defects, and perturbs transport granule function. eLife 4, e08881 (2015). 10. O. Brandman et al., A ribosome-bound quality control complex triggers degradation 30. S. Boeynaems et al., Drosophila screen connects nuclear transport genes to DPR pa- of nascent peptides and signals translation stress. Cell 151, 1042–1054 (2012). thology in c9ALS/FTD. Sci. Rep. 6, 20877 (2016). 11. K. K. Kostova et al., CAT-tailing as a fail-safe mechanism for efficient degradation of 31. K. H. Lee et al., C9orf72 dipeptide repeats impair the assembly, dynamics, and func- stalled nascent polypeptides. Science 357, 414–417 (2017). tion of membrane-less organelles. Cell 167, 774–788.e17 (2016). 12. C. S. Sitron, O. Brandman, CAT tails drive degradation of stalled polypeptides on and 32. S. Perry, Y. Han, A. Das, D. Dickman, Homeostatic plasticity can be induced and ex- off the ribosome. Nat. Struct. Mol. Biol. 26, 450–459 (2019). pressed to restore synaptic strength at neuromuscular junctions undergoing ALS- 13. T. Izawa, S. H. Park, L. Zhao, F. U. Hartl, W. Neupert, Cytosolic protein Vms1 links related degeneration. Hum. Mol. Genet. 26, 4153–4167 (2017). ribosome quality control to mitochondrial and cellular homeostasis. Cell 171, 33. R. Simone et al., G-quadruplex-binding small molecules ameliorate C9orf72 FTD/ALS 890–903.e18 (2017). pathology in vitro and in vivo. EMBO Mol. Med. 10,22–31 (2018). 14. Y. J. Choe et al., Failure of RQC machinery causes protein aggregation and proteo- 34. T. G. Moens et al., Sense and antisense RNA are not toxic in Drosophila models of toxic stress. Nature 531, 191–195 (2016). – 15. R. Yonashiro et al., The Rqc2/Tae2 subunit of the ribosome-associated quality control C9orf72-associated ALS/FTD. Acta Neuropathol. 135, 445 457 (2018). 35. W. Xu, J. Xu, C9orf72 dipeptide repeats cause selective neurodegeneration and cell- (RQC) complex marks ribosome-stalled nascent polypeptide chains for aggregation. autonomous excitotoxicity in Drosophila glutamatergic neurons. J. Neurosci. 38, eLife 5, e11794 (2016). – 16. Q. Defenouillère et al., Rqc1 and Ltn1 prevent C-terminal alanine-threonine tail 7741 7752 (2018). (CAT-tail)-induced protein aggregation by efficient recruitment of Cdc48 on stalled 36. T. G. Moens et al., C9orf72 arginine-rich dipeptide proteins interact with ribosomal 60S subunits. J. Biol. Chem. 291, 12245–12253 (2016). proteins in vivo to induce a toxic translational arrest that is rescued by eIF1A. Acta – 17. J. Chu et al., A mouse forward genetics screen identifies LISTERIN as an E3 ubiquitin Neuropathol. 137, 487 500 (2019). ligase involved in neurodegeneration. Proc. Natl. Acad. Sci. U.S.A. 106, 2097–2103 37. R. Lopez-Gonzalez et al., Partial inhibition of the overactivated Ku80-dependent DNA (2009). repair pathway rescues neurodegeneration in C9ORF72-ALS/FTD. Proc. Natl. Acad. Sci. 18. R. Ishimura et al., RNA function. Ribosome stalling induced by mutation of a CNS- U.S.A. 116, 9628–9633 (2019). specific tRNA causes neurodegeneration. Science 345, 455–459 (2014). 38. A. Berson et al., Drosophila Ref1/ALYREF regulates transcription and toxicity associ- 19. J. P. Taylor, R. H. Brown Jr., D. W. Cleveland, Decoding ALS: From genes to mecha- ated with ALS/FTD disease etiologies. Acta Neuropathol. Commun. 7, 65 (2019). nism. Nature 539, 197–206 (2016). 39. H. He et al., Amyotrophic lateral sclerosis-associated GGGGCC repeat expansion 20. T. F. Gendron, L. Petrucelli, Disease mechanisms of C9ORF72 repeat expansions. Cold promotes Tau phosphorylation and toxicity. Neurobiol. Dis. 130, 104493 (2019). Spring Harb. Perspect. Med. 8, a024224 (2018). 40. R. Lopez-Gonzalez et al., Poly(GR) in C9ORF72-related ALS/FTD compromises mito- 21. R. Balendra, A. M. Isaacs, C9orf72-mediated ALS and FTD: Multiple pathways to dis- chondrial function and increases oxidative stress and DNA damage in iPSC-derived ease. Nat. Rev. Neurol. 14, 544–558 (2018). motor neurons. Neuron 92, 383–391 (2016).

25114 | www.pnas.org/cgi/doi/10.1073/pnas.2005506117 Li et al. Downloaded by guest on October 2, 2021 41. J. Park et al., Mitochondrial dysfunction in Drosophila PINK1 mutants is com- 58. M. C. J. Yip et al., Mechanism for recycling tRNAs on stalled ribosomes. Nat. Struct. plemented by parkin. Nature 441, 1157–1161 (2006). Mol. Biol. 26, 343–349 (2019). 42. I. E. Clark et al., Drosophila pink1 is required for mitochondrial function and interacts 59. R. Kopan, M. X. Ilagan, The canonical Notch signaling pathway: Unfolding the acti- genetically with parkin. Nature 441, 1162–1166 (2006). vation mechanism. Cell 137, 216–233 (2009). 43. Y. Yang et al., Mitochondrial pathology and muscle and dopaminergic neuron de- 60. K. S. Lee et al., Roles of PINK1, mTORC2, and mitochondria in preserving brain tumor- generation caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc. Natl. forming stem cells in a noncanonical Notch signaling pathway. Genes Dev. 27, Acad. Sci. U.S.A. 103, 10793–10798 (2006). 2642–2647 (2013). 44. T. MacVicar, T. Langer, OPA1 processing in cell death and disease—The long and short 61. H. Jo et al., Small molecule-induced cytosolic activation of protein kinase Akt rescues – of it. J. Cell Sci. 129, 2297 2306 (2016). ischemia-elicited neuronal death. Proc. Natl. Acad. Sci. U.S.A. 109, 10581–10586 45. H. Shi, A. J. Rampello, S. E. Glynn, Engineered AAA+ proteases reveal principles of (2012). proteolysis at the mitochondrial inner membrane. Nat. Commun. 7, 13301 (2016). 62. H. Hirai et al., MK-2206, an allosteric Akt inhibitor, enhances antitumor efficacy by 46. W. Neupert, J. M. Herrmann, Translocation of proteins into mitochondria. Annu. Rev. standard chemotherapeutic agents or molecular targeted drugs in vitro and in vivo. – Biochem. 76, 723 749 (2007). Mol. Cancer Ther. 9, 1956–1967 (2010). 47. C. Lesnik, A. Golani-Armon, Y. Arava, Localized translation near the mitochondrial 63. J. B. Klein et al., Akt-mediated valosin-containing protein 97 phosphorylation regu- outer membrane: An update. RNA Biol. 12, 801–809 (2015). lates its association with ubiquitinated proteins. J. Biol. Chem. 280, 31870–31881 48. D. R. Ziehr, J. P. Ellis, P. H. Culviner, S. Cavagnero, Production of ribosome-released (2005). nascent proteins with optimal physical properties. Anal. Chem. 82, 4637–4643 (2010). 64. F. Vandermoere et al., The valosin-containing protein (VCP) is a target of Akt sig- 49. V. A. Gold, P. Chroscicki, P. Bragoszewski, A. Chacinska, Visualization of cytosolic ri- naling required for cell survival. J. Biol. Chem. 281, 14307–14313 (2006). bosomes on the surface of mitochondria by electron cryo-tomography. EMBO Rep. 65. E. Onesto et al., Gene-specific mitochondria dysfunctions in human TARDBP and 18, 1786–1800 (2017). C9ORF72 fibroblasts. Acta Neuropathol. Commun. 4, 47 (2016). 50. M. R. Adelman, D. D. Sabatini, G. Blobel, Ribosome-membrane interaction. Nonde- 66. S. Li et al., Altered MICOS morphology and mitochondrial ion homeostasis contribute structive disassembly of rat liver rough microsomes into ribosomal and membranous to poly(GR) toxicity associated with C9-ALS/FTD. Cell Rep. 32, 107989 (2020). components. J. Cell Biol. 56, 206–229 (1973). 67. S. Y. Choi et al., C9ORF72-ALS/FTD-associated poly(GR) binds Atp5a1 and compro- 51. J. Lu, C. Deutsch, Electrostatics in the ribosomal tunnel modulate chain elongation – rates. J. Mol. Biol. 384,73–86 (2008). mises mitochondrial function in vivo. Nat. Neurosci. 22, 851 862 (2019). 52. T. E. Graber et al., Reactivation of stalled polyribosomes in synaptic plasticity. Proc. 68. Y. J. Zhang et al., Poly(GR) impairs protein translation and stress granule dynamics in Natl. Acad. Sci. U.S.A. 110, 16205–16210 (2013). C9orf72-associated frontotemporal dementia and amyotrophic lateral sclerosis. Nat. – 53. R. M. Tujebajeva, D. M. Graifer, G. G. Karpova, N. A. Ajtkhozhina, Alkaloid homo- Med. 24, 1136 1142 (2018). harringtonine inhibits polypeptide chain elongation on human ribosomes on the step 69. L. Ruan et al., Cytosolic proteostasis through importing of misfolded proteins into – of peptide bond formation. FEBS Lett. 257, 254–256 (1989). mitochondria. Nature 543, 443 446 (2017). 54. B. A. Osuna, C. J. Howard, S. Kc, A. Frost, D. E. Weinberg, In vitro analysis of RQC 70. J. Deng et al., FUS interacts with HSP60 to promote mitochondrial damage. PLoS activities provides insights into the mechanism and function of CAT tailing. eLife 6, Genet. 11, e1005357 (2015). e27949 (2017). 71. P. Wang et al., TDP-43 induces mitochondrial damage and activates the mitochondrial 55. R. Verma et al., Vms1 and ANKZF1 peptidyl-tRNA hydrolases release nascent chains unfolded protein response. PLoS Genet. 15, e1007947 (2019). from stalled ribosomes. Nature 557, 446–451 (2018). 72. V. H. Ryan, N. L. Fawzi, Physiological, pathological, and targetable membraneless

56. O. Zurita Rendón et al., Vms1p is a release factor for the ribosome-associated quality organelles in neurons. Trends Neurosci. 42, 693–708 (2019). NEUROSCIENCE control complex. Nat. Commun. 9, 2197 (2018). 73. L. Cong et al., Multiplex genome engineering using CRISPR/Cas systems. Science 339, 57. K. Kuroha, A. Zinoviev, C. U. T. Hellen, T. V. Pestova, Release of ubiquitinated and 819–823 (2013). non-ubiquitinated nascent chains from stalled mammalian ribosomal complexes by 74. N. J. Kramer et al., Spt4 selectively regulates the expression of C9orf72 sense and ANKZF1 and Ptrh1. Mol. Cell. 72, 286–302.e8 (2018). antisense mutant transcripts. Science 353, 708–712 (2016).

Li et al. PNAS | October 6, 2020 | vol. 117 | no. 40 | 25115 Downloaded by guest on October 2, 2021