DOCSLIB.ORG

Chip-Seq and Functional Analysis of the SOX2 Gene in Colorectal Cancers

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chip-Seq and Functional Analysis of the SOX2 Gene in Colorectal Cancers View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Xiamen University Institutional Repository OMICS A Journal of Integrative Biology Volume 14, Number 4, 2010 ª Mary Ann Liebert, Inc. DOI: 10.1089/omi.2010.0053 ChIP-seq and Functional Analysis of the SOX2 Gene in Colorectal Cancers Xuefeng Fang,1,2 Wei Yu,2 Lisha Li,2 Jiaofang Shao,2 Na Zhao,2 Qiyun Chen,2 Zhiyun Ye,3 Sheng-Cai Lin,3 Shu Zheng,1 and Biaoyang Lin2,4,5 Abstract SOX2 is an HMG box containing transcription factor that has been implicated in various types of cancer, but its role in colorectal cancers (CRC) has not been studied. Here we show that SOX2 is overexpressed in CRC tissues compared with normal adjacent tissues using immunohistochemical staining and RT-PCR. We also observed an increased SOX2 expression in nucleus of colorectal cancer tissues (46%, 14/30 cases vs. 7%, 2/30 adjacent tissues). Furthermore, knockdown of SOX2 in SW620 colorectal cancer cells decreased their growth rates in vitro cell line, and in vivo in xenograft models. ChIP-Seq analysis of SOX2 revealed a consensus sequence of wwTGywTT. An integrated expression profiling and ChIP-seq analysis show that SOX2 is involved in the BMP signaling pathway, steroid metabolic process, histone modifications, and many receptor-mediated signaling pathways such as IGF1R and ITPR2 (Inositol 1,4,5-triphosphate receptor, type 2). Introduction showed that OCT4 and SOX2 could be used to generate in- duced pluripotent stem cells from human cord blood. olorectal cancer is the second most common malig- SOX2 is also overexpressed in several cancers including Cnancy in cancer patients and cause of cancer-related gastric cancer, breast cancer, pancreatic cancer, pulmonary mortality (Wiesner et al., 2003). The SOX (SRY-like HMG box) nonsmall cell carcinomas, lung squamous cell carcinomas, gene family represents a family of transcriptional factors neuroendocrine carcinomas (Gure et al., 2000; Hussenet et al., characterized by the presence of a conserved HMG (high 2010; Li et al., 2004; Rodriguez-Pinilla et al., 2007; Sanada et al., mobility group) box in their genes. Thus far, 20 SOX genes 2006; Wang et al., 2009a). However, the role of SOX2 in co- have been identified in humans and mice, and they can be lorectal cancer cells has not been studied. Only one study divided into 10 subgroups on the basis of sequence similarity suggested that levels of SOX2 could be used, together with and genomic organization (Schepers et al., 2002). SOX genes two other stem cell markers CD133 and OCT4, for predic- bind to the minor groove in DNA to control diverse devel- tion of distant recurrence and poor prognosis of rectal cancer opmental processes and play critical roles in cell fate deter- patients treated with preoperative CRT (Saigusa et al., 2009). mination, differentiation, and proliferation (Schepers et al., In this study, we have carried out analysis of SOX2 expres- 2002). Recently, Takahashi et al. showed that SOX2 is a key sion in colorectal cancer tissues and found that it is over- transcription factor that can induce pluripotency in both expressed in the cancerous tissues compared to normal mouse and human somatic cells (Li et al., 2004; Takahashi adjacent tissues. We also carried out in vitro and in vivo et al., 2007; Takahashi and Yamanaka, 2006). Importantly, functional analysis of SOX2 by knocking down SOX2 ex- SOX2 is one of the four factors (OCT4, SOX2, NANOG, and pression SW620 colorectal cancer cells. Furthermore, we LIN28) that can reprogram human somatic cells to pluripotent characterized the SOX2 response program in colorectal cancer stem cells that exhibit the essential characteristics of embry- cells through an integrative analysis of expression profiling onic stem (ES) cells (Yu et al., 2007). Giorgetti et al. (2009) also and ChIP-seq data. 1Cancer Institute (Key Laboratory of Cancer Prevention and Intervention, China National Ministry of Education), The Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang, People’s Republic of China. 2Systems Biology Division, Zhejiang–California International Nanosystems Institute (ZCNI), Zhejiang University, 268 Kaixuan Road, Hangzhou, Zhejiang, People’s Republic of China. 3Key Laboratory of Ministry of Education for Cell Biology and Tumor Cell Engineering, School of Life Sciences, Xiamen University, Fujian, People’s Republic of China. 4Swedish Medical Center, Seattle, Washington. 5Department of Urology, University of Washington, Seattle, Washington. 369 370 FANG ET AL. Materials and Methods Cell proliferation assays and cell cycle analysis Cell culture, lentiviral transduction, and transfection Cell proliferation was analyzed using the MTT assay kits (Millipore, Billerica, MA) according to the manufacturer’s SW620, SW480, HT29, CACO2, RKO, and HCT116 colo- protocol. For cell cycle analysis, cells were harvested and rectal cancer cell lines were obtained from American Type washed with PBS, followed by fixation with 70% ethanol Culture Collection (Manassas, VA). MISSION shRNA Lenti- overnight at 48C. After washing with PBS twice, the cells were viral Particles for SOX2 knockdown and MISSION Nontarget resuspended in PBS containing 50 mg/mL propidium iodide shRNA control transduction particles were purchased from and 10 mg/mL RNase A for 30 min at room temperature in Sigma-Aldrich (St. Louis, MO). The SOX2 target sequences for the dark. Samples were analyzed for DNA content by a flow shRNA are: CCGGCAGCTCGCAGACCTACATGAACTCG cytometer (BD Bioscience, San Jose, CA). The cell-cycle phases AGTTCATGTAG GTCTGCGAGCTGTTTTT and CCGGCTG were analyzed using CELLQuest software (Becton Dickinson, CCGAGAATCCATGTATATCTCGAGATATACATGGATTC San Jose, CA) (Tseng et al., 2009). TCGGCAGTTTTT. SW620 cell stably expressing siRNAs were generated by transduction with the virus particles followed by Apoptosis analysis selection using puromycin. Apoptotic cells were quantified using Annexin V-FITC Immunoblot and immunohistochemistry (IHC) analysis apoptosis detection kit (BD Pharmingen, San Diego, CA). The The SOX2 (ab59776) antibody (Abcam Inc., Cambridge, number of apoptotic cells was analyzed by flow cytometry MA) was used for both analyses. For immunoblot analysis, (Ex ¼ 488 nm; Em ¼ 530 nm) (Cho et al., 2008). some 20 mg of total cellular protein was loaded per lane, separated by 4–12% SDS-polyacrylamide gel electrophoresis, Soft agar colony formation assay and then transferred to nitrocellulose (Invitrogen, Carlsbad, For Soft agar colony formation assay, cells were trypsinized CA) by electroblotting. and counted. 10,000 cells were seeded in six-well plates. After We used the IHC services provided by Superchip, Inc. 2 weeks of growth, colonies with a diameter greater than (Sanford, FL), including antibody optimization, IHC staining, 4 mm were counted. Experiments were performed in qua- pathological reading, and scoring by experienced patholo- druplicates (Foltz et al., 2006; Lee et al., 2010). gists. Primary antibodies for SOX2 were diluted at 1:250 for IHC. Secondary antibody was used at 1:200 dilution. For Microarray isotype control antibodies, rabbit IgG (Cat# 0111-01, Southern Biotech, Birmingham, AL) (5 mg/mL) was used at 1:25 dilu- Total RNA was extracted from cells expressing SOX2 tion. Colorectal cancer tissue array (Lot ID: OD-CT-DgCol03) silencing or nonsilencing shRNA with Trizol (Invitrogen) and from Superchip, Inc. (Superchip, Shanghai, China) was used followed by further purification step using RNeasy (Qiagen, for IHC. Individual tissue samples were arrayed in duplicate Valencia, CA). RNA quality was determined with the Agilent cores. The tissue array core diameter is 1.5 mm and the core Bioanalyzer (Palo Alto, CA). Affymetrix U133 plus2 arrays thickness is 5 mm. were used. Microarray hybridization was performed as we The scoring criteria contain two parameters: percentage of described previously (Lin et al., 2009). Genes that showed positive cell population, and staining intensities. For per- more than a twofold change were considered differentially centage of positive cell population, the categories are: 0 ¼ 0%; expressed. 1 ¼ 1 to 25%; 2 ¼ 26 to 50%; 3 ¼ 51 to 75%; 4 ¼ 76–100%. The staining intensities were scored as: ¼negative staining; þ¼ Chromatin immunoprecipitation (ChIP)-sequencing weak staining intensity; þþ¼medium staining intensity; About 3Â106 SW620 cells were used for ChIP according to þþþ¼strong staining intensity. the manufacturer’s instruction (Millipore, Bedford, MA, EZ- Magna ChIPÔ A). Antibodies used for Chip included SOX2 Wound-healing migration assay (ab59776, Abcam, Cambridge, MA) and normal IgG (SC-2027, About 1.2 million cells were seeded into six-well plates and Santa Cruz, CA). Briefly, cells were fixed by crosslinking with incubated at 378C with 5% CO2 until confluent. Wounding 1% fresh formaldehyde. The fixed cells were resuspended in was introduced to the monolayer of cells by scraping the lysis buffer. Nuclei were collected and resuspended in nuclei surface with a sterile pipette tip. The healing process was lysis buffer. Samples were sonicated on ice to the length of examined at 72 h later and recorded with a Canon S 80 digital 200–500 bp. A total of 5mg antibody and 50 mL Dynal protein G camera with a microscope adapter. beads were incubated for 2 h at 48C. Sonicated chromatin were incubated with the protein G-antibody complex over- Xenograft studies night at 4 8C. Precipitated immunocomplex was treated with proteinase K for 2 h at 658C, and DNA was purified Qiagen Some 2Â104 Cells were
Load more

Recommended publications
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Retinoic Acid Induced 1 Gene Analysis in Humans and Zebrafish
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2009 RETINOIC ACID INDUCED 1 GENE ANALYSIS IN HUMANS AND ZEBRAFISH Bijal Vyas Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Medical Genetics Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/1901 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. © Bijal Akshay Vyas, 2009 All Rights Reserved RETINOIC ACID INDUCED 1 GENE ANALYSIS IN HUMANS AND ZEBRAFISH A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by BIJAL AKSHAY VYAS Bachelor of Biology North Carolina State University, 2007 Director: SARAH H. ELSEA Associate Professor, Department of Human and Molecular Genetics Department of Pediatrics Virginia Commonwealth University Richmond, Virginia August, 2009 Acknowledgement I would like to thank all the people who have supported and motivated me throughout my graduate studies. I had the great opportunity to work in Dr. Sarah Elsea‘s lab and I sincerely thank her for her willingness to help, patience and encouraging me after my failed experiments. I am also greatly thankful to Dr. Jim Lister for guiding and helping me every step of the way in finishing my zebrafish project. I also thank my third committee member, Dr. Andrew Davies for his project consultations, helpful alternatives and encouragement.
    [Show full text]
  • New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology
    Cancer Research and Treatment 2003;35(4):304-313 New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology Yong-Wan Kim, Ph.D.1, Min-Je Suh, M.S.1, Jin-Sik Bae, M.S.1, Su Mi Bae, M.S.1, Joo Hee Yoon, M.D.2, Soo Young Hur, M.D.2, Jae Hoon Kim, M.D.2, Duck Young Ro, M.D.2, Joon Mo Lee, M.D.2, Sung Eun Namkoong, M.D.2, Chong Kook Kim, Ph.D.3 and Woong Shick Ahn, M.D.2 1Catholic Research Institutes of Medical Science, 2Department of Obstetrics and Gynecology, College of Medicine, The Catholic University of Korea, Seoul; 3College of Pharmacy, Seoul National University, Seoul, Korea Purpose: This study utilized both mRNA differential significant genes of unknown function affected by the display and the Gene Ontology (GO) analysis to char- HPV-16-derived pathway. The GO analysis suggested that acterize the multiple interactions of a number of genes the cervical cancer cells underwent repression of the with gene expression profiles involved in the HPV-16- cancer-specific cell adhesive properties. Also, genes induced cervical carcinogenesis. belonging to DNA metabolism, such as DNA repair and Materials and Methods: mRNA differential displays, replication, were strongly down-regulated, whereas sig- with HPV-16 positive cervical cancer cell line (SiHa), and nificant increases were shown in the protein degradation normal human keratinocyte cell line (HaCaT) as a con- and synthesis. trol, were used. Each human gene has several biological Conclusion: The GO analysis can overcome the com- functions in the Gene Ontology; therefore, several func- plexity of the gene expression profile of the HPV-16- tions of each gene were chosen to establish a powerful associated pathway, identify several cancer-specific cel- cervical carcinogenesis pathway.
    [Show full text]
  • AIRE Is a Critical Spindle-Associated Protein in Embryonic Stem Cells Bin Gu1, Jean-Philippe Lambert2, Katie Cockburn1, Anne-Claude Gingras2,3, Janet Rossant1,3*
    RESEARCH ARTICLE AIRE is a critical spindle-associated protein in embryonic stem cells Bin Gu1, Jean-Philippe Lambert2, Katie Cockburn1, Anne-Claude Gingras2,3, Janet Rossant1,3* 1Program in Developmental and Stem Cell Biology, Hospital for Sick Children, Toronto, Canada; 2Lunenfeld-Tanenbaum Research Institute at Mount Sinai Hospital, Toronto, Canada; 3Department of Molecular Genetics, University of Toronto, Toronto, Canada Abstract Embryonic stem (ES) cells go though embryo-like cell cycles regulated by specialized molecular mechanisms. However, it is not known whether there are ES cell-specific mechanisms regulating mitotic fidelity. Here we showed that Autoimmune Regulator (Aire), a transcription coordinator involved in immune tolerance processes, is a critical spindle-associated protein in mouse ES(mES) cells. BioID analysis showed that AIRE associates with spindle-associated proteins in mES cells. Loss of function analysis revealed that Aire was important for centrosome number regulation and spindle pole integrity specifically in mES cells. We also identified the c-terminal LESLL motif as a critical motif for AIRE’s mitotic function. Combined maternal and zygotic knockout further revealed Aire’s critical functions for spindle assembly in preimplantation embryos. These results uncovered a previously unappreciated function for Aire and provide new insights into the biology of stem cell proliferation and potential new angles to understand fertility defects in humans carrying Aire mutations. DOI: 10.7554/eLife.28131.001 *For correspondence: janet. [email protected] Introduction Competing interests: The Self-renewal capability, defined as the ability of cells to proliferate while sustaining differentiation authors declare that no potential, is one of the defining features of stem cells (Martello and Smith, 2014).
    [Show full text]
  • Downloaded from [266]
    Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes.
    [Show full text]
  • Genes in a Refined Smith-Magenis Syndrome Critical Deletion Interval on Chromosome 17P11.2 and the Syntenic Region of the Mouse
    Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Article Genes in a Refined Smith-Magenis Syndrome Critical Deletion Interval on Chromosome 17p11.2 and the Syntenic Region of the Mouse Weimin Bi,1,6 Jiong Yan,1,6 Paweł Stankiewicz,1 Sung-Sup Park,1,7 Katherina Walz,1 Cornelius F. Boerkoel,1 Lorraine Potocki,1,3 Lisa G. Shaffer,1 Koen Devriendt,4 Małgorzata J.M. Nowaczyk,5 Ken Inoue,1 and James R. Lupski1,2,3,8 Departments of 1Molecular & Human Genetics, 2Pediatrics, Baylor College of Medicine, 3Texas Children’s Hospital, Houston, Texas 77030, USA; 4Centre for Human Genetics, University Hospital Gasthuisberg, Catholic University of Leuven, B-3000 Leuven, Belgium; 5Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario L8S 4J9, Canada Smith-Magenis syndrome (SMS) is a multiple congenital anomaly/mental retardation syndrome associated with behavioral abnormalities and sleep disturbance. Most patients have the same ∼4 Mb interstitial genomic deletion within chromosome 17p11.2. To investigate the molecular bases of the SMS phenotype, we constructed BAC/PAC contigs covering the SMS common deletion interval and its syntenic region on mouse chromosome 11. Comparative genome analysis reveals the absence of all three ∼200-kb SMS-REP low-copy repeats in the mouse and indicates that the evolution of SMS-REPs was accompanied by transposition of adjacent genes. Physical and genetic map comparisons in humans reveal reduced recombination in both sexes. Moreover, by examining the deleted regions in SMS patients with unusual-sized deletions, we refined the minimal Smith-Magenis critical region (SMCR) to an ∼1.1-Mb genomic interval that is syntenic to an ∼1.0-Mb region in the mouse.
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • The Role of Structural Disorder in Cell Cycle Regulation, Related Clinical Proteomics, 5 Disease Development and Drug Targeting
    Review The role of structural disorder in cell cycle regulation, related clinical proteomics, 5 disease development and drug targeting Expert Rev. Proteomics 12(3), 000–000 (2015) 10 1 AQ2 Agnes Tantos , Understanding the molecular mechanisms of the regulation of cell cycle is a central issue in Lajos Kalmar2 and molecular cell biology, due to its fundamental role in the existence of cells. The regulatory Peter Tompa*1,2 circuits that make decisions on when a cell should divide are very complex and particularly subtly balanced in eukaryotes, in which the harmony of many different cells in an organism is 1 Institute of Enzymology, Research essential for life. Several hundred proteins are involved in these processes, and a great deal of 15 Centre for Natural Sciences of the Hungarian Academy of Sciences, studies attests that most of them have functionally relevant intrinsic structural disorder. Budapest, Hungary Structural disorder imparts many functional advantages on these proteins, and we discuss it 2 VIB Department of Structural Biology, in detail that it is involved in all key steps from signaling through the cell membrane to Vrije Universiteit Brussel, Brussels, Belgium regulating transcription of proteins that execute timely responses to an ever-changing *Author for correspondence: environment. 20 [email protected] KEYWORDS: cancer . cell-cycle . checkpoint . post-translational modification . protein disorder . signal transduction 25 of proteins are able to fulfill important func- Cell cycle: the cornerstone of tions without possessing a stable three- multicellular life dimensional structure [3,4]. These proteins, Every postembryonic eukaryotic cell goes termed intrinsically disordered proteins or through the distinct phases of cell cycle, regions (IDPs/IDRs), participate in many reg- G1, S, G2 and M.
    [Show full text]
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Identification of Candidate Genes and Pathways Associated with Obesity
    animals Article Identification of Candidate Genes and Pathways Associated with Obesity-Related Traits in Canines via Gene-Set Enrichment and Pathway-Based GWAS Analysis Sunirmal Sheet y, Srikanth Krishnamoorthy y , Jihye Cha, Soyoung Choi and Bong-Hwan Choi * Animal Genome & Bioinformatics, National Institute of Animal Science, RDA, Wanju 55365, Korea; [email protected] (S.S.); [email protected] (S.K.); [email protected] (J.C.); [email protected] (S.C.) * Correspondence: [email protected]; Tel.: +82-10-8143-5164 These authors contributed equally. y Received: 10 October 2020; Accepted: 6 November 2020; Published: 9 November 2020 Simple Summary: Obesity is a serious health issue and is increasing at an alarming rate in several dog breeds, but there is limited information on the genetic mechanism underlying it. Moreover, there have been very few reports on genetic markers associated with canine obesity. These studies were limited to the use of a single breed in the association study. In this study, we have performed a GWAS and supplemented it with gene-set enrichment and pathway-based analyses to identify causative loci and genes associated with canine obesity in 18 different dog breeds. From the GWAS, the significant markers associated with obesity-related traits including body weight (CACNA1B, C22orf39, U6, MYH14, PTPN2, SEH1L) and blood sugar (PRSS55, GRIK2), were identified. Furthermore, the gene-set enrichment and pathway-based analysis (GESA) highlighted five enriched pathways (Wnt signaling pathway, adherens junction, pathways in cancer, axon guidance, and insulin secretion) and seven GO terms (fat cell differentiation, calcium ion binding, cytoplasm, nucleus, phospholipid transport, central nervous system development, and cell surface) which were found to be shared among all the traits.
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]