View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Xiamen University Institutional Repository OMICS A Journal of Integrative Biology Volume 14, Number 4, 2010 ª Mary Ann Liebert, Inc. DOI: 10.1089/omi.2010.0053 ChIP-seq and Functional Analysis of the SOX2 Gene in Colorectal Cancers Xuefeng Fang,1,2 Wei Yu,2 Lisha Li,2 Jiaofang Shao,2 Na Zhao,2 Qiyun Chen,2 Zhiyun Ye,3 Sheng-Cai Lin,3 Shu Zheng,1 and Biaoyang Lin2,4,5 Abstract SOX2 is an HMG box containing transcription factor that has been implicated in various types of cancer, but its role in colorectal cancers (CRC) has not been studied. Here we show that SOX2 is overexpressed in CRC tissues compared with normal adjacent tissues using immunohistochemical staining and RT-PCR. We also observed an increased SOX2 expression in nucleus of colorectal cancer tissues (46%, 14/30 cases vs. 7%, 2/30 adjacent tissues). Furthermore, knockdown of SOX2 in SW620 colorectal cancer cells decreased their growth rates in vitro cell line, and in vivo in xenograft models. ChIP-Seq analysis of SOX2 revealed a consensus sequence of wwTGywTT. An integrated expression profiling and ChIP-seq analysis show that SOX2 is involved in the BMP signaling pathway, steroid metabolic process, histone modifications, and many receptor-mediated signaling pathways such as IGF1R and ITPR2 (Inositol 1,4,5-triphosphate receptor, type 2). Introduction showed that OCT4 and SOX2 could be used to generate in- duced pluripotent stem cells from human cord blood. olorectal cancer is the second most common malig- SOX2 is also overexpressed in several cancers including Cnancy in cancer patients and cause of cancer-related gastric cancer, breast cancer, pancreatic cancer, pulmonary mortality (Wiesner et al., 2003). The SOX (SRY-like HMG box) nonsmall cell carcinomas, lung squamous cell carcinomas, gene family represents a family of transcriptional factors neuroendocrine carcinomas (Gure et al., 2000; Hussenet et al., characterized by the presence of a conserved HMG (high 2010; Li et al., 2004; Rodriguez-Pinilla et al., 2007; Sanada et al., mobility group) box in their genes. Thus far, 20 SOX genes 2006; Wang et al., 2009a). However, the role of SOX2 in co- have been identified in humans and mice, and they can be lorectal cancer cells has not been studied. Only one study divided into 10 subgroups on the basis of sequence similarity suggested that levels of SOX2 could be used, together with and genomic organization (Schepers et al., 2002). SOX genes two other stem cell markers CD133 and OCT4, for predic- bind to the minor groove in DNA to control diverse devel- tion of distant recurrence and poor prognosis of rectal cancer opmental processes and play critical roles in cell fate deter- patients treated with preoperative CRT (Saigusa et al., 2009). mination, differentiation, and proliferation (Schepers et al., In this study, we have carried out analysis of SOX2 expres- 2002). Recently, Takahashi et al. showed that SOX2 is a key sion in colorectal cancer tissues and found that it is over- transcription factor that can induce pluripotency in both expressed in the cancerous tissues compared to normal mouse and human somatic cells (Li et al., 2004; Takahashi adjacent tissues. We also carried out in vitro and in vivo et al., 2007; Takahashi and Yamanaka, 2006). Importantly, functional analysis of SOX2 by knocking down SOX2 ex- SOX2 is one of the four factors (OCT4, SOX2, NANOG, and pression SW620 colorectal cancer cells. Furthermore, we LIN28) that can reprogram human somatic cells to pluripotent characterized the SOX2 response program in colorectal cancer stem cells that exhibit the essential characteristics of embry- cells through an integrative analysis of expression profiling onic stem (ES) cells (Yu et al., 2007). Giorgetti et al. (2009) also and ChIP-seq data. 1Cancer Institute (Key Laboratory of Cancer Prevention and Intervention, China National Ministry of Education), The Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang, People’s Republic of China. 2Systems Biology Division, Zhejiang–California International Nanosystems Institute (ZCNI), Zhejiang University, 268 Kaixuan Road, Hangzhou, Zhejiang, People’s Republic of China. 3Key Laboratory of Ministry of Education for Cell Biology and Tumor Cell Engineering, School of Life Sciences, Xiamen University, Fujian, People’s Republic of China. 4Swedish Medical Center, Seattle, Washington. 5Department of Urology, University of Washington, Seattle, Washington. 369 370 FANG ET AL. Materials and Methods Cell proliferation assays and cell cycle analysis Cell culture, lentiviral transduction, and transfection Cell proliferation was analyzed using the MTT assay kits (Millipore, Billerica, MA) according to the manufacturer’s SW620, SW480, HT29, CACO2, RKO, and HCT116 colo- protocol. For cell cycle analysis, cells were harvested and rectal cancer cell lines were obtained from American Type washed with PBS, followed by fixation with 70% ethanol Culture Collection (Manassas, VA). MISSION shRNA Lenti- overnight at 48C. After washing with PBS twice, the cells were viral Particles for SOX2 knockdown and MISSION Nontarget resuspended in PBS containing 50 mg/mL propidium iodide shRNA control transduction particles were purchased from and 10 mg/mL RNase A for 30 min at room temperature in Sigma-Aldrich (St. Louis, MO). The SOX2 target sequences for the dark. Samples were analyzed for DNA content by a flow shRNA are: CCGGCAGCTCGCAGACCTACATGAACTCG cytometer (BD Bioscience, San Jose, CA). The cell-cycle phases AGTTCATGTAG GTCTGCGAGCTGTTTTT and CCGGCTG were analyzed using CELLQuest software (Becton Dickinson, CCGAGAATCCATGTATATCTCGAGATATACATGGATTC San Jose, CA) (Tseng et al., 2009). TCGGCAGTTTTT. SW620 cell stably expressing siRNAs were generated by transduction with the virus particles followed by Apoptosis analysis selection using puromycin. Apoptotic cells were quantified using Annexin V-FITC Immunoblot and immunohistochemistry (IHC) analysis apoptosis detection kit (BD Pharmingen, San Diego, CA). The The SOX2 (ab59776) antibody (Abcam Inc., Cambridge, number of apoptotic cells was analyzed by flow cytometry MA) was used for both analyses. For immunoblot analysis, (Ex ¼ 488 nm; Em ¼ 530 nm) (Cho et al., 2008). some 20 mg of total cellular protein was loaded per lane, separated by 4–12% SDS-polyacrylamide gel electrophoresis, Soft agar colony formation assay and then transferred to nitrocellulose (Invitrogen, Carlsbad, For Soft agar colony formation assay, cells were trypsinized CA) by electroblotting. and counted. 10,000 cells were seeded in six-well plates. After We used the IHC services provided by Superchip, Inc. 2 weeks of growth, colonies with a diameter greater than (Sanford, FL), including antibody optimization, IHC staining, 4 mm were counted. Experiments were performed in qua- pathological reading, and scoring by experienced patholo- druplicates (Foltz et al., 2006; Lee et al., 2010). gists. Primary antibodies for SOX2 were diluted at 1:250 for IHC. Secondary antibody was used at 1:200 dilution. For Microarray isotype control antibodies, rabbit IgG (Cat# 0111-01, Southern Biotech, Birmingham, AL) (5 mg/mL) was used at 1:25 dilu- Total RNA was extracted from cells expressing SOX2 tion. Colorectal cancer tissue array (Lot ID: OD-CT-DgCol03) silencing or nonsilencing shRNA with Trizol (Invitrogen) and from Superchip, Inc. (Superchip, Shanghai, China) was used followed by further purification step using RNeasy (Qiagen, for IHC. Individual tissue samples were arrayed in duplicate Valencia, CA). RNA quality was determined with the Agilent cores. The tissue array core diameter is 1.5 mm and the core Bioanalyzer (Palo Alto, CA). Affymetrix U133 plus2 arrays thickness is 5 mm. were used. Microarray hybridization was performed as we The scoring criteria contain two parameters: percentage of described previously (Lin et al., 2009). Genes that showed positive cell population, and staining intensities. For per- more than a twofold change were considered differentially centage of positive cell population, the categories are: 0 ¼ 0%; expressed. 1 ¼ 1 to 25%; 2 ¼ 26 to 50%; 3 ¼ 51 to 75%; 4 ¼ 76–100%. The staining intensities were scored as: ¼negative staining; þ¼ Chromatin immunoprecipitation (ChIP)-sequencing weak staining intensity; þþ¼medium staining intensity; About 3Â106 SW620 cells were used for ChIP according to þþþ¼strong staining intensity. the manufacturer’s instruction (Millipore, Bedford, MA, EZ- Magna ChIPÔ A). Antibodies used for Chip included SOX2 Wound-healing migration assay (ab59776, Abcam, Cambridge, MA) and normal IgG (SC-2027, About 1.2 million cells were seeded into six-well plates and Santa Cruz, CA). Briefly, cells were fixed by crosslinking with incubated at 378C with 5% CO2 until confluent. Wounding 1% fresh formaldehyde. The fixed cells were resuspended in was introduced to the monolayer of cells by scraping the lysis buffer. Nuclei were collected and resuspended in nuclei surface with a sterile pipette tip. The healing process was lysis buffer. Samples were sonicated on ice to the length of examined at 72 h later and recorded with a Canon S 80 digital 200–500 bp. A total of 5mg antibody and 50 mL Dynal protein G camera with a microscope adapter. beads were incubated for 2 h at 48C. Sonicated chromatin were incubated with the protein G-antibody complex over- Xenograft studies night at 4 8C. Precipitated immunocomplex was treated with proteinase K for 2 h at 658C, and DNA was purified Qiagen Some 2Â104 Cells were