DOCSLIB.ORG

Microrna-889 Promotes Cell Proliferation in Colorectal Cancer by Targeting DAB2IP

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Microrna-889 Promotes Cell Proliferation in Colorectal Cancer by Targeting DAB2IP European Review for Medical and Pharmacological Sciences 2019; 23: 3326-3334 MicroRNA-889 promotes cell proliferation in colorectal cancer by targeting DAB2IP Y. XIAO1, Z.-H. LI1, Y.-H. BI2 1Laboratory Medicine, Daqing Oilfield General Hospital, Daqing, China. 2Department of Oncology, Qingdao Municipal Hospital, Qingdao, China. Yan Xiao and Zhihong Li contributed equally to this work Abstract. – OBJECTIVE: Colorectal cancer the 5-year overall survival rate for stage I-II CRC (CRC) remains one of the most frequent lethal patients was approximately 90%. However, for malignant tumors worldwide. The correlation stage III patients, it was 60%, while which for between miR-889 expression and CRC progres- stage IV patients was only 8%3. Surgical resec- sion has not been well identified in the recent tion remains the main choice for CRC treatment, literature. Here, we aim to detect the role and mechanism of miR-889 in CRC. and chemotherapy is also suitable for patients 4 PATIENTS AND METHODS: First, miRNA RT- who cannot undergo surgery with stage III-IV . PCR (Real Time-Polymerase Chain Reaction) was More and more biomarkers and new molecular performed to determine miR-889 expression in CRC therapies have gradually been discovered and tissues and cells. The proliferative capacity of cells become new choices for many patients with che- transfected with miR-889 mimics, miR-889 inhibitor motherapy resistance5-7. Previous studies8,9 have or NC was measured by CCK-8 (cell counting kit- 8), colony formation and EdU (5-Ethynyl-2’-deoxyu- found that a large number of genes and complex ridine) assays. The online bioinformatics sites were signaling pathways were involved in the progres- chosen to predict possible downstream regulatory sion of CRC, including oncogene activation, tu- genes of miR-899. The dual-luciferase report as- mor suppressor gene inactivation and epigenetic say was conducted to verify the relation between modification. MicroRNAs (miRNAs) also plays DAB2IP (DAB2 interacting protein) and miR-899. an indispensable role in the CRC progression10. The expression changes of DAB2IP were assessed MiRNAs (microRNAs) are small RNAs con- by quantitative Real Time-Polymerase Chain Reac- tion (qRT-PCR) and Western blot. sisting of 21-25 nucleotides and provide negative 11 RESULTS: MiR-889 was upregulated in CRC post-transcriptional regulation . MiRNAs are tissues and CRC cells, and upregulated miR-889 involved in tumor proliferation, invasion, mi- was confirmed to promote cell growth in vitro. Du- gration angiogenesis, and EMT (epithelial-mes- al-luciferase reporter, qRT-PCR, and Western blot enchymal transition)12,13. MiRNAs also emerged assays suggested that DAB2IP might be regulated in the progression of CRC14. Previous findings15 by miR-889. The effects of miR-889 on proliferation could be abolished by DAB2IP through confirma- have affirmed that miR-1260b could attenuate the tory experiments. By directly targeting DAB2IP, chemosensitivity of CRC cells to 5-fluorouracil miR-889 served as a vital part in accelerating CRC (5-FU). MicroRNA-1258 could reduce the pro- cell proliferation. liferation of CRC cells and be used as an indis- CONCLUSIONS: Our current study substan- pensable target for CRC therapy16. Nevertheless, tiated that miR-889 might participate in con- the mechanism of miR-899 in CRC remains to trolling CRC proliferation by regulating DAB2IP, be explored. which provides potential and prospective ther- apeutic target for CRC. The DAB2 interacting protein (DAB2IP), also known as the ASK1 interacting protein (AIP1), is Key Words MiR-889, CRC, Proliferation, DAB2IP. located at chromosome 9 (q33.1-q33.3) and belongs to the Ras-GAP (Ras-GTPase activating protein) family17,18. DB2IP played a role as a tumor sup- pressor in ovarian cancer19,20, prostate cancer21,22, Introduction breast cancer22, and choriocarcinoma23. In CRC, the EZH2/HDAC1/Snail complex facilitated the CRC (colorectal cancer) remains one of the silence of DAB2IP in CRC cells, thereby pro- most common tumors and the major cause of moting the metastasis of CRC cells24. Also, the cancer-related deaths in the world1,2. Currently, downregulation of DAB2IP increased hnRNPK 3326 Corresponding Author: Yinghui Bi, MM; e-mail: [email protected] Role of miR-889 in CRC levels via the MAPK/ERK signaling pathway. microRNA detection were performed by using Subsequently, the translocation of hnRNPK to the the Hairpin-itTM miRNA qPCR quantification nucleus enhanced the transcriptional activity of kit (GenePharma, Shanghai, China). Specific MMP2, thereby promoting invasion and metasta- primers and internal controls for miRNA and sis of CRC25. However, it remains unknown wheth- mRNA were as follows: miR-889 F: ACACTC- er DAB2IP plays a role in CRC cell proliferation. CAGCTGGGAATGGCTGTCCGTAGT R: TG- In the CRC, the relationship between miR- GTGTCGTGGAGTCG; U6: F: CTCGCTTCGG- 889 and DAB2IP, as well as their expression and CAGCACA R: AACGCTTCACGAATTTGCGT; biological functions, have not been explored. In DAB2IP: F: AGGTGAGTTCATCAAAGCGC R: this study, it was substantiated that miR-889 is GTGGGAAGACACAGTAGGAG; GAPDH: F: an oncogene of CRC and can be used as a target AAGGTGAAGGTCGGAGTCA R: GGAAGAT- for cancer therapy. GGTGATGGGATTT. GAPDH and the small RNA RNU6B (U6) were chosen as an endoge- nous control. The results were shown in relative Patients and Methods expressions calculated by the 2-ΔΔCT method. Tissues Collection Plasmid Transfection We collected 40 pairs of tumors and adja- About 2 × 105 CRC cells were plated onto cent tissues that were resected from colorectal 6-well plates for 24 h. MiR-889 mimics, miR-889 patients in the Daqing Oilfield General Hospital inhibitor, plasmids DAB2IP and siDAB2IP were general surgery since 2018. Before collecting the synthesized by GenePharma (Shanghai, China). tissues, we got the consent of the patient or their Lipofectamine 3000 (Invitrogen, Carlsbad, CA, relatives. This investigation was ratified by the USA) was conducted to transfect in accordance Ethics Committee of Daqing Oilfield General with the manufacturer’ instructions. Hospital. The signed written informed consents were obtained from all patients before the study. Cell Counting Kit-8 (CCK-8) Assay Samples were stored at -80°C after excision and Cell counting kit-8 (CCK-8, Dojindo, Tokyo, prior to RNA extraction. Japan) was utilized to measure the efficiency of cell growth, in accordance with the manufactur- CRC Cell Lines er’s instructions. 1 × 103 cells/well were inoculat- Colorectal cancer cell lines including DLD- ed into 96 wells for culture. 10 µL of the CCK-8 1, HCT116, HT29, SW480, and NCM460 (nor- solution was added to the wells every 24 h. After mal colonic epithelial cells) were obtained from 2 h of incubation, we measured optical density Shanghai Academy of Sciences (Shanghai, Chi- (OD) 450 nm with a microplate reader. na). Colorectal cancer cells and NCM460 were cultured in Dulbecco’s Modified Eagle Medium Colony Formation Assay (DMEM; Gibco, Rockville, MD, USA) supple- Cells were cultured in a 6-well plate with 1 mented with 10% fetal bovine serum (Gibco, × 103 cells/well for 12 days. Next, the cells were Grand Island, NY, USA), 100 U/mL penicillin stained with 0.1% crystal violet staining solution (Gibco, Grand Island, NY, USA) and 100 µg/mL (Beyotime, Shanghai, China) for 15 min. Colo- streptomycin (Gibco, Grand Island, NY, USA) at nies containing at least 50 cells were counted. 37°C in a humidified cell incubator in a 5% CO2 Finally, plates were washed with water and then atmosphere. photographed. MiRNA RT-PCR and Quantitative 5-Ethynyl-2’-Deoxyuridine (EdU) Assay Real Time-Polymerase Chain Reaction To measure proliferation of CRC cells, EdU (qRT-PCR) kit (RiboBio, Guangzhou, China) was chosen. TRIzol reagent (Invitrogen, Carlsbad, CA, Cells were plated onto 24-well plates at 4 × 104 USA) was used to extract total RNA from tis- cells per well for 24 h. On the following day, sues and cells. For qRT-PCR, RNA was further cells were labeled with EdU, fixed with form- reverse transcribed into complementary Deoxyri- aldehyde, and stained with Apollo and 4’,6-di- bose Nucleic Acid (cDNA) by PrimeScript RT kit amidino-2-phenylindole (DAPI) according to the (TaKaRa, Kusatsu, Japan). For miRNA RT-PCR, instructions. Finally, the images were acquired by target-specific reverse transcription and TaqMan a fluorescence microscopy and merged. 3327 Y. Xiao, Z.-H. Li, Y.-H. Bi Bioinformatics Analysis The signals were detected by enhanced chemilu- To search for miR-889 target genes, three on- minescence system (ImageQuant LAS4000 mini, line analysis tools were used (TargetScan, miR- GE, Buckinghamshire, UK). Walk, and miRPathDB). Statistical Analyses Luciferase Report Assay All experimental data were statistically an- The 3’-UTR sequence of DAB2IP predicted alyzed using GraphPad software 7.0 (La Jolla, to bind with miR-889 or a mutated sequence CA, USA) and Statistical Product and Service within the predicted target sites was synthesized Solutions (SPSS) 17.0 (SPSS Inc., Chicago, IL, and inserted into the XbaI and FseI sites of the USA). The p-values were analyzed by perform- pGL3 control vector (Promega, Madison, WI, ing the Student’s t-test, ANOVA test followed by USA). DLD-1 and HCT116 cells were seeded onto Post Hoc Test (Least Significant Difference), and 24-well plates and were then co-transfected with Spearman’s test. p<0.05 for the difference was luciferase reporter vectors and miR-889 mimics considered of statistically significant. or NC by Lipofectamine 3000 (Invitrogen, Carls- bad, CA, USA). The relative luciferase activity was measured with a Dual-Glo Luciferase Assay Results Kit (Promega, Madison, WI, USA). MiR-889 Was Overexpressed Western Blot in Colorectal Cancer The harvested cells were lysed in radioimmu- With the aim of exploring the expression of noprecipitation assay (RIPA) lysis buffer (Beyo- miR-889 in colorectal cancer, miRNA RT-PCR time, Shanghai, China) containing PMSF. Protein was choosen to examine the miR-889 expression was separated by electrophoresis before trans- in 40 cases of CRC tissues and adjacent tissues.
Load more

Recommended publications
  • Wnt/Β-Catenin Signaling Pathway Induces Autophagy
    Yun et al. Cell Death and Disease (2020) 11:771 https://doi.org/10.1038/s41419-020-02988-8 Cell Death & Disease ARTICLE Open Access Wnt/β-catenin signaling pathway induces autophagy-mediated temozolomide-resistance in human glioblastoma Eun-Jin Yun 1,SangwooKim2,Jer-TsongHsieh3,4 and Seung Tae Baek 5,6 Abstract Temozolomide (TMZ) is widely used for treating glioblastoma multiforme (GBM), however, the treatment of such brain tumors remains a challenge due to the development of resistance. Increasing studies have found that TMZ treatment could induce autophagy that may link to therapeutic resistance in GBM, but, the precise mechanisms are not fully understood. Understanding the molecular mechanisms underlying the response of GBM to chemotherapy is paramount for developing improved cancer therapeutics. In this study, we demonstrated that the loss of DOC-2/DAB2 interacting protein (DAB2IP) is responsible for TMZ-resistance in GBM through ATG9B. DAB2IP sensitized GBM to TMZ and suppressed TMZ-induced autophagy by negatively regulating ATG9B expression. A higher level of ATG9B expression was associated with GBM compared to low-grade glioma. The knockdown of ATG9B expression in GBM cells suppressed TMZ-induced autophagy as well as TMZ-resistance. Furthermore, we showed that DAB2IP negatively regulated ATG9B expression by blocking the Wnt/β-catenin pathway. To enhance the benefit of TMZ and avoid therapeutic resistance, effective combination strategies were tested using a small molecule inhibitor blocking the Wnt/ β-catenin pathway in addition to TMZ. The combination treatment synergistically enhanced the efficacy of TMZ in GBM cells. In conclusion, the present study identified the mechanisms of TMZ-resistance of GBM mediated by DAB2IP 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; and ATG9B which provides insight into a potential strategy to overcome TMZ chemo-resistance.
    [Show full text]
  • Rabbit Anti-DAB2IP Rabbit Anti-DAB2IP
    Qty: 100 μg/400 μL Rabbit anti-DAB2IP Catalog No. 487300 Lot No. Rabbit anti-DAB2IP FORM This polyclonal antibody is supplied as a 400 µL aliquot at a concentration of 0.25 mg/mL in phosphate buffered saline (pH 7.4) containing 0.1% sodium azide. This antibody is epitope-affinity purified from rabbit antiserum. PAD: ZMD.689 IMMUNOGEN Synthetic peptide derived from the C-terminal region of the human DAB2IP protein (Accession# NP_619723), which is identical to mouse and rat sequence. SPECIFICITY This antibody is specific for the DAB2IP (DAB2 interacting protein, AIP1, DIP1/2) protein. On Western blots, it identifies the target band at ~110 kDa. REACTIVITY Reactivity has been confirmed with human DU145, SK-N-MC and rat B49 cell lysates. Based on amino acid sequence homology, reactivity with mouse is expected. Sample Western Immuno- Immuno- Blotting precipitation cytochemistry Human +++ 0 ND Mouse ND ND ND Rat +++ 0 ND (Excellent +++, Good++, Poor +, No reactivity 0, Not applicable N/A, Not Determined ND) USAGE Working concentrations for specific applications should be determined by the investigator. Appropriate concentrations will be affected by several factors, including secondary antibody affinity, antigen concentration, sensitivity of detection method, temperature and length of incubations, etc. The suitability of this antibody for applications other than those listed below has not been determined. The following concentration ranges are recommended starting points for this product. Western Blotting: 1-3 μg/mL STORAGE Store at 2-8°C for up to one month. Store at –20°C for long-term storage. Avoid repeated freezing and thawing. (cont’d) www.invitrogen.com Invitrogen Corporation • 542 Flynn Rd • Camarillo • CA 93012 • Tel: 800.955.6288 • E-mail: [email protected] PI487300 (Rev 10/08) DCC-08-1089 Important Licensing Information - These products may be covered by one or more Limited Use Label Licenses (see the Invitrogen Catalog or our website, www.invitrogen.com).
    [Show full text]
  • Disabled Homolog 2 Interactive Protein Functions As a Tumor Suppressor in Osteosarcoma Cells
    ONCOLOGY LETTERS 16: 703-712, 2018 Disabled homolog 2 interactive protein functions as a tumor suppressor in osteosarcoma cells JIANAN HE1,5, SHUAI HUANG2, ZHENHUA LIN3, JIQIN ZHANG4, JIALIN SU4, WEIDONG JI4 and XINGMO LIU1 1Department of Orthopaedic Surgery, The Sixth Affiliated Hospital of Sun Yat‑sun University, Guangzhou, Guangdong 510655; 2Department of Orthopaedic Surgery, The First Affiliated Hospital of Sun Yat‑sen University, Guangzhou, Guangdong 510080; 3Department of Orthopaedic Surgery, The People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, Guangxi 530021; 4Center for Translational Medicine, The First Affiliated Hospital of Sun Yat‑sen University, Guangzhou, Guangdong 510080; 5Department of Interventional Radiology, The Fifth Affiliated Hospital of Sun Yat-sun University, Zhuhai, Guangdong 519000, P.R. China Received April 2, 2016; Accepted June 16, 2017 DOI: 10.3892/ol.2018.8776 Abstract. The disabled homolog 2 interactive protein osteosarcoma will develop distant metastasis (2). Owing to the (DAB2IP) gene is a member of the family of Ras GTPases development of multidisciplinary therapy, the mortality rate and functions as a tumor suppressor in many types of carci- for patients with osteosarcoma has been decreasing in recent noma; however, its function in osteosarcoma remains unclear. years. Nevertheless, patients continue to exhibit a high risk The aim of the present study was to determine the function of of metastasis and/or recurrence (1,2). Previous studies have DAB2IP in osteosarcoma and normal bone cells in vitro. The indicated that several genetic aberrations are associated with expression of DAB2IP protein was assessed in osteoblast and tumor initiation and osteosarcoma progression (3,4). Thus, osteosarcoma cell lines by western blot analysis.
    [Show full text]
  • Methylome and Transcriptome Maps of Human Visceral and Subcutaneous
    www.nature.com/scientificreports OPEN Methylome and transcriptome maps of human visceral and subcutaneous adipocytes reveal Received: 9 April 2019 Accepted: 11 June 2019 key epigenetic diferences at Published: xx xx xxxx developmental genes Stephen T. Bradford1,2,3, Shalima S. Nair1,3, Aaron L. Statham1, Susan J. van Dijk2, Timothy J. Peters 1,3,4, Firoz Anwar 2, Hugh J. French 1, Julius Z. H. von Martels1, Brodie Sutclife2, Madhavi P. Maddugoda1, Michelle Peranec1, Hilal Varinli1,2,5, Rosanna Arnoldy1, Michael Buckley1,4, Jason P. Ross2, Elena Zotenko1,3, Jenny Z. Song1, Clare Stirzaker1,3, Denis C. Bauer2, Wenjia Qu1, Michael M. Swarbrick6, Helen L. Lutgers1,7, Reginald V. Lord8, Katherine Samaras9,10, Peter L. Molloy 2 & Susan J. Clark 1,3 Adipocytes support key metabolic and endocrine functions of adipose tissue. Lipid is stored in two major classes of depots, namely visceral adipose (VA) and subcutaneous adipose (SA) depots. Increased visceral adiposity is associated with adverse health outcomes, whereas the impact of SA tissue is relatively metabolically benign. The precise molecular features associated with the functional diferences between the adipose depots are still not well understood. Here, we characterised transcriptomes and methylomes of isolated adipocytes from matched SA and VA tissues of individuals with normal BMI to identify epigenetic diferences and their contribution to cell type and depot-specifc function. We found that DNA methylomes were notably distinct between diferent adipocyte depots and were associated with diferential gene expression within pathways fundamental to adipocyte function. Most striking diferential methylation was found at transcription factor and developmental genes. Our fndings highlight the importance of developmental origins in the function of diferent fat depots.
    [Show full text]
  • Negative Regulation of DAB2IP by Akt and Scffbw7 Pathways
    Negative regulation of DAB2IP by Akt and SCFFbw7 pathways The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Dai, Xiangping, Brian J. North, and Hiroyuki Inuzuka. 2014. “Negative regulation of DAB2IP by Akt and SCFFbw7 pathways.” Oncotarget 5 (10): 3307-3315. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:12717538 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA www.impactjournals.com/oncotarget/ Oncotarget, Vol. 5, No. 10 Negative regulation of DAB2IP by Akt and SCFFbw7 pathways Xiangping Dai1,*, Brian J. North1,* and Hiroyuki Inuzuka1 1 Department of Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA. * These authors contributed equally to this work. Correspondence to: Brian North, email: [email protected] Correspondence to: Hiroyuki Inuzuka, email: [email protected] Keywords: DAB2IP, Akt, Fbw7, degradation, cancer, phosphorylation, ubiquitination. Received: April 16, 2014 Accepted: April 30, 2014 Published: May 1, 2014 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT: Deletion of ovarian carcinoma 2/disabled homolog 2 (DOC-2/DAB2) interacting protein (DAB2IP), is a tumor suppressor that serves as a scaffold protein involved in coordinately regulating cell proliferation, survival and apoptotic pathways.
    [Show full text]
  • Dab2ip Regulates Neuronal Migration and Neurite Development
    DAB2IP REGULATES NEURONAL MIGRATION AND NEURITE DEVELOPMENT IN THE DEVELOPING NEOCORTEX by GUM HWA LEE A Dissertation submitted to the Graduate School-New Brunswick Rutgers, The State University of New Jersey And The Graduate School of Biomedical Sciences University of Medicine and Dentistry of New Jersey In partial fulfillment of the requirements For the degree of Doctor of Philosophy Graduate Program in Cell and Developmental Biology Written under the direction of Gabriella D’Arcangelo And approved by New Brunswick, New Jersey October, 2012 ABSTRACT OF THE DISSERTATION DAB2IP REGULATES NEURONAL MIGRATION AND NEURITE DEVELOPMENT IN THE DEVELOPING NEOCORTEX By GUM HWA LEE Dissertation Director: Gabriella D’Arcangelo Dab2ip (DOC-2/DAB2 interacting protein) is a member of the Ras GTPase- activating protein (GAP) family that has been previously shown to function as a tumor suppressor in several systems. Dab2ip is also highly expressed in the brain where it interacts with Dab1, a key mediator of the Reelin pathway that controls several aspects of brain development and function. I found that Dab2ip is highly expressed in the developing cerebral cortex, but that mutations in the Reelin signaling pathway do not affect its expression. To determine whether Dab2ip plays a role in brain development, I knocked down or over expressed it in neuronal progenitor cells of the embryonic mouse neocortex using the in utero electroporation technique. Dab2ip down-regulation severely disrupts neuronal migration, affecting preferentially late-born principal cortical neurons. Dab2ip overexpression also leads to migration defects. Structure-function experiments in ii vivo further show that both PH and GRD domains of Dab2ip are important for neuronal migration.
    [Show full text]
  • Expression of Mouse Dab2ip Transcript Variants and Gene Methylation During Brain Development
    Gene 568 (2015) 19–24 Contents lists available at ScienceDirect Gene journal homepage: www.elsevier.com/locate/gene Research paper Expression of mouse Dab2ip transcript variants and gene methylation during brain development Farimah Salami, Shuhong Qiao, Ramin Homayouni ⁎ Department of Biological Sciences, University of Memphis, Memphis, TN, United States article info abstract Article history: Dab2ip (DOC-2/DAB2 interacting protein) is a RasGAP protein which shows a growth-inhibitory effect in human Received 19 December 2014 prostate cancer cell lines. Recent studies have shown that Dab2ip also plays an important role in regulating den- Received in revised form 15 April 2015 drite development and neuronal migration during brain development. In this study, we provide a more complete Accepted 5 May 2015 description of the mouse Dab2ip (mDab2ip) gene locus and examined DNA methylation and expression of Dab2ip Available online 7 May 2015 during cerebellar development. Analysis of cDNA sequences in public databases revealed a total of 20 possible Keywords: exons for mDab2ip gene, spanning over 172 kb. Using Cap Analysis of Gene Expression (CAGE) data available fi Dab1 through FANTOM5 project, we deduced ve different transcription start sites for mDab2ip. Here, we character- AIP1 ized three different mDab2ip transcript variants beginning with exon 1. These transcripts varied by the presence Cerebellum or absence of exons 3 and 5, which encode a putative nuclear localization signal and the N-terminal region of a GTPase activating protein PH-domain, respectively. The 5′ region of the mDab2ip gene contains three putative CpG islands (CpG131, CpG54, and CpG85). Interestingly, CpG54 and CpG85 are localized on exons 3 and 5.
    [Show full text]
  • Downregulation of Human DAB2IP Gene Expression in Renal Cell
    Published OnlineFirst April 18, 2019; DOI: 10.1158/1078-0432.CCR-18-3004 Translational Cancer Mechanisms and Therapy Clinical Cancer Research Downregulation of Human DAB2IP Gene Expression in Renal Cell Carcinoma Results in Resistance to Ionizing Radiation Eun-Jin Yun1,2, Chun-Jung Lin1, Andrew Dang1, Elizabeth Hernandez1, Jiaming Guo3, Wei-Min Chen3, Joyce Allison4, Nathan Kim3, Payal Kapur5, James Brugarolas4, Kaijie Wu6, Dalin He6, Chih-Ho Lai7, Ho Lin8, Debabrata Saha3, Seung Tae Baek2, Benjamin P.C. Chen3, and Jer-Tsong Hsieh1,9 Abstract Purpose: Renal cell carcinoma (RCC) is known to be highly In vivo ubiquitination assay was used to test PARP-1 degrada- radioresistant but the mechanisms associated with radioresis- tion. Furthermore, in vivo mice xenograft model and patient- tance have remained elusive. We found DOC-2/DAB2 inter- derived xenograft (PDX) model were used to determine the active protein (DAB2IP) frequently downregulated in RCC, is effect of combination therapy to sensitizing tumors to IR. associated with radioresistance. In this study, we investigated Results: We notice that DAB2IP-deficient RCC cells acquire the underlying mechanism regulating radioresistance by IR-resistance. Mechanistically, DAB2IP can form a complex DAB2IP and developed appropriate treatment. with PARP-1 and E3 ligases that is responsible for degrading Experimental Design: Several RCC lines with or without PARP-1. Indeed, elevated PARP-1 levels are associated with the DAB2IP expression were irradiated with ionizing radiation IR resistance in RCC cells. Furthermore, PARP-1 inhibitor can (IR) for determining their radiosensitivities based on colony enhance the IR response of either RCC xenograft model or PDX formation assay.
    [Show full text]
  • Single-Cell Transcriptomes Reveal a Complex Cellular Landscape in the Middle Ear and Differential Capacities for Acute Response to Infection
    fgene-11-00358 April 9, 2020 Time: 15:55 # 1 ORIGINAL RESEARCH published: 15 April 2020 doi: 10.3389/fgene.2020.00358 Single-Cell Transcriptomes Reveal a Complex Cellular Landscape in the Middle Ear and Differential Capacities for Acute Response to Infection Allen F. Ryan1*, Chanond A. Nasamran2, Kwang Pak1, Clara Draf1, Kathleen M. Fisch2, Nicholas Webster3 and Arwa Kurabi1 1 Departments of Surgery/Otolaryngology, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States, 2 Medicine/Center for Computational Biology & Bioinformatics, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States, 3 Medicine/Endocrinology, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States Single-cell transcriptomics was used to profile cells of the normal murine middle ear. Clustering analysis of 6770 transcriptomes identified 17 cell clusters corresponding to distinct cell types: five epithelial, three stromal, three lymphocyte, two monocyte, Edited by: two endothelial, one pericyte and one melanocyte cluster. Within some clusters, Amélie Bonnefond, Institut National de la Santé et de la cell subtypes were identified. While many corresponded to those cell types known Recherche Médicale (INSERM), from prior studies, several novel types or subtypes were noted. The results indicate France unexpected cellular diversity within the resting middle ear mucosa. The resolution of Reviewed by: Fabien Delahaye, uncomplicated, acute, otitis media is too rapid for cognate immunity to play a major Institut Pasteur de Lille, France role. Thus innate immunity is likely responsible for normal recovery from middle ear Nelson L. S. Tang, infection. The need for rapid response to pathogens suggests that innate immune The Chinese University of Hong Kong, China genes may be constitutively expressed by middle ear cells.
    [Show full text]
  • The Impact of Structural Variation on Human Gene Expression
    bioRxiv preprint doi: https://doi.org/10.1101/055962; this version posted June 9, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The impact of structural variation on human gene expression Colby Chiang1, Alexandra J. Scott1, Joe R. Davis2,3, Emily K. Tsang2, Xin Li2, Yungil Kim4, Farhan N. Damani4, Liron Ganel1, GTEx Consortium, Stephen B. Montgomery2,3,5, Alexis Battle4, Donald F. Conrad6,7,8*, Ira M. Hall1,6,8* * Co-corresponding authors 1McDonnell Genome Institute, Washington University School of Medicine, St. Louis, MO, USA 2Department of Pathology, Stanford University School of Medicine, Stanford, CA, USA 3Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA 4Department of Computer Science, Johns Hopkins University, Baltimore, Maryland, USA 5Department of Computer Science, Stanford University, Stanford, CA, USA 6Department of Medicine, Washington University School of Medicine, St. Louis, MO, USA 7Department of Pathology & Immunology, Washington University School of Medicine, St. Louis, MO, USA 8Department of Genetics, Washington University School of Medicine, St. Louis, MO, USA 1 bioRxiv preprint doi: https://doi.org/10.1101/055962; this version posted June 9, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Structural variants (SVs) are an important source of human genetic diversity but their contribution to traits, disease, and gene regulation remains unclear.
    [Show full text]
  • Association of the Single Nucleotide Polymorphism in Chromosome 9P21
    Li et al. BMC Cardiovascular Disorders (2017) 17:255 DOI 10.1186/s12872-017-0685-0 RESEARCH ARTICLE Open Access Association of the single nucleotide polymorphism in chromosome 9p21 and chromosome 9q33 with coronary artery disease in Chinese population Qi Li1, Wenhui Peng2, Hailing Li2, Jianhui Zhuang2, Xuesheng Luo1 and Yawei Xu2* Abstract Background: Our study aims to explore the association of rs7025486 single-nucleotide polymorphisms (SNP) in DAB2IP and rs1333049 on chromosome 9p21.3 with the coronary artery disease in Chinese population. Methods: All patients came from the east China area and underwent coronary angiography. Rs7025486 and rs1333049 polymorphism were genotyped in 555 patients with CAD and in 480 healthy controls that underwent coronary angiography. Results: In Chinese population, the rs7025486 genotype in the case group was no significant different than the control group (P = 0.531).Meanwhile, the rs1333049 SNP has statistically significant (P = 0.006), which was the independent risk factors for CAD (OR1.252, P = 0.039), and consistent with the past studies conclusion. Conclusion: Genotype of rs1333049 on chromosome 9p21, but not rs7025486 on chromosome 9q33, is an independent determinant of the incidence of CAD in Chinese population. Keywords: Coronary artery disease, Single-nucleotide polymorphisms, rs1333049, rs702548 Background chromosome 9p21 [4–6]. However, several subsequent Coronary artery disease (CAD) is a chronic multifactor in- studies have shown inconsistent results when the associ- flammatory disease which can progress to acute coronary ation between these genetic variants and CAD or AMI syndrome and sudden cardiac death [1]. CAD is associ- was examined [7, 8]. In addition, these data are mostly ated with a family history as well as several established risk from American African, Caucasian, South Korean, and factors including diabetes mellitus, hypertension, hyperlip- Japanese cohorts.
    [Show full text]
  • EZH2-Regulated DAB2IP Is a Medulloblastoma Tumor Suppressor and a Positive Marker for Survival
    Published OnlineFirst June 13, 2012; DOI: 10.1158/1078-0432.CCR-12-0399 Clinical Cancer Human Cancer Biology Research EZH2-Regulated DAB2IP Is a Medulloblastoma Tumor Suppressor and a Positive Marker for Survival Michiel Smits1, Sjoerd van Rijn1, Esther Hulleman1, Dennis Biesmans1, Dannis G. van Vuurden1, Marcel Kool4, Christine Haberler5, Eleonora Aronica2, W. Peter Vandertop1,3, David P. Noske1, and Thomas Wurdinger€ 1,6 Abstract Purpose: Medulloblastoma is the most common malignant brain tumor in children. Despite recent improvements, the molecular mechanisms driving medulloblastoma are not fully understood and further elucidation could provide cues to improve outcome prediction and therapeutic approaches. Experimental Design: Here, we conducted a meta-analysis of mouse and human medulloblastoma gene expression data sets, to identify potential medulloblastoma tumor suppressor genes. Results: We identified DAB2IP, a member of the RAS-GTPase–activating protein family (RAS GAP), and showed that DAB2IP expression is repressed in medulloblastoma by EZH2-induced trimethylation. Moreover, we observed that reduced DAB2IP expression correlates significantly with a poor overall survival of patients with medulloblastoma, independent of metastatic stage. Finally, we showed that ectopic DAB2IP expression enhances stress-induced apoptosis in medulloblastoma cells and that reduced expression of DAB2IP in medulloblastoma cells conveys resistance to irradiation-induced cell death. Conclusion: These results suggest that repression of DAB2IP may at least
    [Show full text]