Microrna-889 Promotes Cell Proliferation in Colorectal Cancer by Targeting DAB2IP

European Review for Medical and Pharmacological Sciences 2019; 23: 3326-3334 MicroRNA-889 promotes cell proliferation in colorectal cancer by targeting DAB2IP

Y. XIAO1, Z.-H. LI1, Y.-H. BI2

1Laboratory Medicine, Daqing Oilfield General Hospital, Daqing, China. 2Department of Oncology, Qingdao Municipal Hospital, Qingdao, China. Yan Xiao and Zhihong Li contributed equally to this work

Abstract. – OBJECTIVE: Colorectal cancer the 5-year overall survival rate for stage I-II CRC (CRC) remains one of the most frequent lethal patients was approximately 90%. However, for malignant tumors worldwide. The correlation stage III patients, it was 60%, while which for between miR-889 expression and CRC progres- stage IV patients was only 8%3. Surgical resec- sion has not been well identified in the recent tion remains the main choice for CRC treatment, literature. Here, we aim to detect the role and mechanism of miR-889 in CRC. and chemotherapy is also suitable for patients 4 PATIENTS AND METHODS: First, miRNA RT- who cannot undergo surgery with stage III-IV . PCR (Real Time-Polymerase Chain Reaction) was More and more biomarkers and new molecular performed to determine miR-889 expression in CRC therapies have gradually been discovered and tissues and cells. The proliferative capacity of cells become new choices for many patients with che- transfected with miR-889 mimics, miR-889 inhibitor motherapy resistance5-7. Previous studies8,9 have or NC was measured by CCK-8 (cell counting kit- 8), colony formation and EdU (5-Ethynyl-2’-deoxyu- found that a large number of genes and complex ridine) assays. The online bioinformatics sites were signaling pathways were involved in the progres- chosen to predict possible downstream regulatory sion of CRC, including oncogene activation, tu- genes of miR-899. The dual-luciferase report as- mor suppressor gene inactivation and epigenetic say was conducted to verify the relation between modification. MicroRNAs (miRNAs) also plays DAB2IP (DAB2 interacting protein) and miR-899. an indispensable role in the CRC progression10. The expression changes of DAB2IP were assessed MiRNAs (microRNAs) are small RNAs con- by quantitative Real Time-Polymerase Chain Reac- tion (qRT-PCR) and Western blot. sisting of 21-25 nucleotides and provide negative 11 RESULTS: MiR-889 was upregulated in CRC post-transcriptional regulation . MiRNAs are tissues and CRC cells, and upregulated miR-889 involved in tumor proliferation, invasion, mi- was confirmed to promote cell growth in vitro. Du- gration angiogenesis, and EMT (epithelial-mes- al-luciferase reporter, qRT-PCR, and Western blot enchymal transition)12,13. MiRNAs also emerged assays suggested that DAB2IP might be regulated in the progression of CRC14. Previous findings15 by miR-889. The effects of miR-889 on proliferation could be abolished by DAB2IP through confirma- have affirmed that miR-1260b could attenuate the tory experiments. By directly targeting DAB2IP, chemosensitivity of CRC cells to 5-fluorouracil miR-889 served as a vital part in accelerating CRC (5-FU). MicroRNA-1258 could reduce the pro- cell proliferation. liferation of CRC cells and be used as an indis- CONCLUSIONS: Our current study substan- pensable target for CRC therapy16. Nevertheless, tiated that miR-889 might participate in con- the mechanism of miR-899 in CRC remains to trolling CRC proliferation by regulating DAB2IP, be explored. which provides potential and prospective ther- apeutic target for CRC. The DAB2 interacting protein (DAB2IP), also known as the ASK1 interacting protein (AIP1), is Key Words MiR-889, CRC, Proliferation, DAB2IP. located at chromosome 9 (q33.1-q33.3) and belongs to the Ras-GAP (Ras-GTPase activating protein) family17,18. DB2IP played a role as a tumor suppressor in ovarian cancer19,20, prostate cancer21,22, Introduction breast cancer22, and choriocarcinoma23. In CRC, the EZH2/HDAC1/Snail complex facilitated the CRC (colorectal cancer) remains one of the silence of DAB2IP in CRC cells, thereby pro- most common tumors and the major cause of moting the metastasis of CRC cells24. Also, the cancer-related deaths in the world1,2. Currently, downregulation of DAB2IP increased hnRNPK

3326 Corresponding Author: Yinghui Bi, MM; e-mail: [email protected] Role of miR-889 in CRC levels via the MAPK/ERK signaling pathway. microRNA detection were performed by using Subsequently, the translocation of hnRNPK to the the Hairpin-itTM miRNA qPCR quantification nucleus enhanced the transcriptional activity of kit (GenePharma, Shanghai, China). Specific MMP2, thereby promoting invasion and metasta- primers and internal controls for miRNA and sis of CRC25. However, it remains unknown wheth- mRNA were as follows: miR-889 F: ACACTC- er DAB2IP plays a role in CRC cell proliferation. CAGCTGGGAATGGCTGTCCGTAGT R: TG- In the CRC, the relationship between miR- GTGTCGTGGAGTCG; U6: F: CTCGCTTCGG- 889 and DAB2IP, as well as their expression and CAGCACA R: AACGCTTCACGAATTTGCGT; biological functions, have not been explored. In DAB2IP: F: AGGTGAGTTCATCAAAGCGC R: this study, it was substantiated that miR-889 is GTGGGAAGACACAGTAGGAG; GAPDH: F: an oncogene of CRC and can be used as a target AAGGTGAAGGTCGGAGTCA R: GGAAGAT- for cancer therapy. GGTGATGGGATTT. GAPDH and the small RNA RNU6B (U6) were chosen as an endoge- nous control. The results were shown in relative Patients and Methods expressions calculated by the 2-ΔΔCT method.

Tissues Collection Plasmid Transfection We collected 40 pairs of tumors and adja- About 2 × 105 CRC cells were plated onto cent tissues that were resected from colorectal 6-well plates for 24 h. MiR-889 mimics, miR-889 patients in the Daqing Oilfield General Hospital inhibitor, plasmids DAB2IP and siDAB2IP were general surgery since 2018. Before collecting the synthesized by GenePharma (Shanghai, China). tissues, we got the consent of the patient or their Lipofectamine 3000 (Invitrogen, Carlsbad, CA, relatives. This investigation was ratified by the USA) was conducted to transfect in accordance Ethics Committee of Daqing Oilfield General with the manufacturer’ instructions. Hospital. The signed written informed consents were obtained from all patients before the study. Cell Counting Kit-8 (CCK-8) Assay Samples were stored at -80°C after excision and Cell counting kit-8 (CCK-8, Dojindo, Tokyo, prior to RNA extraction. Japan) was utilized to measure the efficiency of cell growth, in accordance with the manufactur- CRC Cell Lines er’s instructions. 1 × 103 cells/well were inoculat- Colorectal cancer cell lines including DLD- ed into 96 wells for culture. 10 µL of the CCK-8 1, HCT116, HT29, SW480, and NCM460 (nor- solution was added to the wells every 24 h. After mal colonic epithelial cells) were obtained from 2 h of incubation, we measured optical density Shanghai Academy of Sciences (Shanghai, Chi- (OD) 450 nm with a microplate reader. na). Colorectal cancer cells and NCM460 were cultured in Dulbecco’s Modified Eagle Medium Colony Formation Assay (DMEM; Gibco, Rockville, MD, USA) supple- Cells were cultured in a 6-well plate with 1 mented with 10% fetal bovine serum (Gibco, × 103 cells/well for 12 days. Next, the cells were Grand Island, NY, USA), 100 U/mL penicillin stained with 0.1% crystal violet staining solution (Gibco, Grand Island, NY, USA) and 100 µg/mL (Beyotime, Shanghai, China) for 15 min. Colo- streptomycin (Gibco, Grand Island, NY, USA) at nies containing at least 50 cells were counted.

37°C in a humidified cell incubator in a 5% CO2 Finally, plates were washed with water and then atmosphere. photographed.

MiRNA RT-PCR and Quantitative 5-Ethynyl-2’-Deoxyuridine (EdU) Assay Real Time-Polymerase Chain Reaction To measure proliferation of CRC cells, EdU (qRT-PCR) kit (RiboBio, Guangzhou, China) was chosen. TRIzol reagent (Invitrogen, Carlsbad, CA, Cells were plated onto 24-well plates at 4 × 104 USA) was used to extract total RNA from tis- cells per well for 24 h. On the following day, sues and cells. For qRT-PCR, RNA was further cells were labeled with EdU, fixed with form- reverse transcribed into complementary Deoxyri- aldehyde, and stained with Apollo and 4’,6-di- bose Nucleic Acid (cDNA) by PrimeScript RT kit amidino-2-phenylindole (DAPI) according to the (TaKaRa, Kusatsu, Japan). For miRNA RT-PCR, instructions. Finally, the images were acquired by target-specific reverse transcription and TaqMan a fluorescence microscopy and merged.

3327 Y. Xiao, Z.-H. Li, Y.-H. Bi

Bioinformatics Analysis The signals were detected by enhanced chemilu- To search for miR-889 target genes, three on- minescence system (ImageQuant LAS4000 mini, line analysis tools were used (TargetScan, miR- GE, Buckinghamshire, UK). Walk, and miRPathDB). Statistical Analyses Luciferase Report Assay All experimental data were statistically an- The 3’-UTR sequence of DAB2IP predicted alyzed using GraphPad software 7.0 (La Jolla, to bind with miR-889 or a mutated sequence CA, USA) and Statistical Product and Service within the predicted target sites was synthesized Solutions (SPSS) 17.0 (SPSS Inc., Chicago, IL, and inserted into the XbaI and FseI sites of the USA). The p-values were analyzed by perform- pGL3 control vector (Promega, Madison, WI, ing the Student’s t-test, ANOVA test followed by USA). DLD-1 and HCT116 cells were seeded onto Post Hoc Test (Least Significant Difference), and 24-well plates and were then co-transfected with Spearman’s test. p<0.05 for the difference was luciferase reporter vectors and miR-889 mimics considered of statistically significant. or NC by Lipofectamine 3000 (Invitrogen, Carls- bad, CA, USA). The relative luciferase activity was measured with a Dual-Glo Luciferase Assay Results Kit (Promega, Madison, WI, USA). MiR-889 Was Overexpressed Western Blot in Colorectal Cancer The harvested cells were lysed in radioimmu- With the aim of exploring the expression of noprecipitation assay (RIPA) lysis buffer (Beyo- miR-889 in colorectal cancer, miRNA RT-PCR time, Shanghai, China) containing PMSF. Protein was choosen to examine the miR-889 expression was separated by electrophoresis before trans- in 40 cases of CRC tissues and adjacent tissues. ferred to membranes. Membranes were probed As shown in Figure 1A, the miR-889 expres- with anti-DAB2IP (ab87811, Abcam, Cambridge, sion in the tumor tissues was markedly higher MA, USA) and anti-GAPDH (2118, Cell Signal- than that in the adjacent tissues. Similarly, it ling Technology, Danvers, MA, USA) primary was shown that the miR-889 expression in CRC antibodies at 4°C overnight, followed by incuba- cell lines was significantly higher than that in tion with horseradish peroxidase (HRP)-linked NCM460 (Figure 1B). We also divided the 40 secondary antibodies for 2 h at room temperature. patients into high and low expression groups on

A B Figure 1. MiR-889 was upregulated in CRC tissues and cells. A, The miR- 889 expression in CRC patients was detected by miRNA qRT-PCR. B, The miR-889 expression in CRC cell lines and NCM460. C, The fold change (log2 change) in miR-889 levels between 40 pairs of CRC and adjacent normal tissues was measured and divided into low expression group (20 pairs) and high expression group (20 pairs) according to the median miR-889 level. Data are represented as mean ± C SD. (**p<0.01; ***p<0.001).

3328 Role of miR-889 in CRC

Table I. Expression of miR-889 and DAB2IP according to patients’ clinical features. Factors miR-889 expression p-value DAB2IP expression p-value

High Low High Low

Gender Male 6 12 0.112 7 11 0.340 Female 14 8 13 9 Age(years) ≥50 7 14 0.057 9 12 0.526 <50 13 6 11 8 Distant metastasis Yes 11 10 0.751 8 13 0.205 No 9 10 12 7 Tumour size (cm) >5 13 5 0.026* 4 14 0.004* ≤5 7 15 16 6 Lymph node metastasis Yes 12 6 0.112 5 13 0.026* No 8 14 15 7 TNM stage I-II 5 14 0.011* 13 6 0.057 I-IV 15 6 7 14

*Indicates p<0.05 (Chi square test) the basis of the median miR-889 level to explore ability. As seen in Figure 2E and 2F, EdU-stained correlations between clinicopathological features cells number was markedly increased in the miR- and miR-889 expression (Figure 1C). The expres- 889 mimics group compared with the NC group. sion of miR-889 was markedly associated with Similarly, the inhibition of miR-889 expression tumor size and TNM stage, while no differences significantly decreased EdU-stained cell number were found with gender, age, distant metastasis in the miR-889 inhibitor group. These findings or lymph node metastasis (Table I). Above results revealed that miR-889 may accelerate the CRC indicated that miR-889 might function as an on- cells proliferation. cogene in colorectal cancer. DAB2IP was the Direct Target MiR-889 Promoted CRC Cells of miR-889 Proliferation Previous studies26 have shown that miRNAs To explore the function of miR-889 in colorec- could degrade mRNA by binding to the 3’-UTR tal cancer cells, DLD-1 and HCT116 cells were of mRNA to achieve post-transcriptional regula- used to conduct further in vitro experiments. tion. We found possible target genes through Tar- Initially, we transfected the overexpression and getScan, miRWalk, and miRPathDB. As shown knockdown plasmids of miR-889, and the ef- in Figure 3A, DAB2IP might be regulated by fective expression of plasmids was verified with miR-889 by 3’-UTR binding. It was found that the miRNA RT-PCR (Figure 2A). Next, we performed DAB2IP expression in the tumor tissues was sig- cell function experiments using transfected cell nificantly lower when compared with the adjacent lines. CCK-8 assay indicated that upregulation tissues (Figure 3B). As illustrated in Table I, the of miR-889 promoted the proliferation of DLD-1 expression of DAB2IP was also markedly cor- cells, while downregulation of miR-889 inhibited related with tumor size, TNM stage, and lymph the growth of HCT116 cells (Figure 2B). Colony node metastasis, while no differences were found formation assays suggested that DLD-1 cells with with gender, age or distant metastasis. Also, the miR-889 overexpression formed more colonies contents of DAB2IP in the CRC cell lines were than the NC group. However, the ability of clon- lower than that of NCM460 (Figure 3C). To ing in HCT116 cells was reduced after miR-889 further validate our hypothesis, dual-luciferase inhibitor interference (Figure 2C and 2D). The report assay was executed. As seen in Figure 3D EdU assay was also used to test the proliferation and 3E, in the DLD-1 and HCT116 cell lines, lu-

3329 Y. Xiao, Z.-H. Li, Y.-H. Bi

A B

C E

D F

Figure 2. MiR-889 promoted CRC cell proliferation. A, DLD-1 cells were transfected with miR-889 mimics or NC, HCT116 cells were transfected with miR-889 inhibitor or NC, and the miR-889 expression was detected by miRNA RT-PCR. B, Using CCK-8 assay, we found distinct differences in proliferation after manipulation of miR-889 mimics or inhibitor at 96 h. C, Colony formation assays comparing the miR-889 mimics, NC, miR-889 inhibitor and inhibitor NC groups. D, Compared with the control, EdU cell growth profiles in DLD-1 cells and HCT116 cells after transfection with miR-889 mimics and miR-889 inhibitor, respectively (Magnification 100 X). The data are represented as mean ± SD. (*p<0.05; **p<0.01; ***p<0.001). ciferase activity of DAB2IP-WT was significant- and the expression of DAB2IP was restored (Fig- ly inhibited after co-transfection with miR-889 ure 3G and 3H). The above findings demonstrated mimics in comparison with the DAB2IP-MuT. that miR-889 might regulate DAB2IP expression Moreover, the miR-889 and DAB2IP expres- by directly targeting its 3’-UTR. sions of patients with CRC presented a negative correlation (Figure 3F). Similarly, in transfected MiR-889 Promoted Proliferation cells, when the expression of miR-889 increased, in CRC Cells by Regulating DAB2IP the DAB2IP expression was markedly decreased. To further verify whether miR-889-induced Conversely, the expression of miR-889 decreased, proliferation abnormalities are associated with

3330 Role of miR-889 in CRC

A B

C D

E F

H G

Figure 3. MiR-889 suppressed DAB2IP expression by directly binding its 3’-UTR. A, A luciferase reporter assay was conducted to verify that miR-889 directly bound to the 3’-UTR sequences of DAB2IP. B, The DAB2IP mRNA expression level in 40CRC tissues and adjacent tissues was detected by qRT-PCR. C, The RNA expression levels of DAB2IP in CRC cell lines and NCM460 were detected by qRT-PCR. D, and E, Luciferase activity was analyzed in cells co-transfected with miR-889 mimics or NC with DAB2IP-WT or DAB2IP-MuT. F, A negative correlation was found between RNA expression of miR-889 and DAB2IP in tumor samples. G, DAB2IP mRNA expression levels in transfected DLD-1 and HCT116 cells were analyzed by qRT-PCR. H, DAB2IP protein expression levels were analyzed by Western blot in transfected DLD-1 and HCT116 cells. GAPDH was used as a control. The data are expressed as the mean ± SD. (**p<0.01; ***p<0.001).

changes in DAB2IP expression, we performed 889 expression, we transfected siNC and siD- rescue experiments. In the miR-889 mim- AB2IP to decrease the expression. The DAB2IP ics group, we transfected the DAB2IP plasmid expression after transfection was detected by into DLD-1 cells to increase the expression of qRT-PCR and Western blot (Figure 4A and 4B). DAB2IP. In the HCT116 cell line with low miR- The CCK-8 assay showed that the upregulation of

3331 Y. Xiao, Z.-H. Li, Y.-H. Bi

A B

Figure 4. MiR-889 regulated CRC cell proliferation by targeting DAB2IP. A, The expression of DAB2IP was verified by qRT-PCR in co-transfected cell lines. B, Western blotting was used to verify the expression of DAB2IP. C, and D, The roles of miR-889 and DAB2IP in the regulation of CRC cell proliferation were examined by CCK-8 assay. The data are expressed as the mean ± SD. (**p<0.01; ***p<0.001).

DAB2IP effectively reversed the promoting effect and in return leading to translational repression or of miR-889 overexpression on the proliferation of degradation of mRNA are well studied in recent DLD-1 cells. Downregulation of DAB2IP effec- years, which may be a significant way to examine tively reversed the inhibitory effect of miR-889 their effects on tumors11. To explore the molec- downregulation on the proliferation of HCT116 ular mechanisms of miR-889 in the progress of cells (Figure 4C and 4D). These findings indi- CRC, we sought out the potential targets through cated that miR-889 promoted cell growth by the online websites (TargetScan, miRWalk, and regulating DAB2IP. miRPathDB). We found a negative correlation between DAB2IP and miR-889 expression, and miR- 889 might degrade protein expression by directly Discussion targeting the 3’-UTR of DAB2IP. Furthermore, DAB2IP mRNA and protein levels were down- CRC (colorectal cancer) is still one of the ma- regulated by miR-889 overexpression in DLD-1 jor sources of cancer-related deaths in developed cells and up-regulated by the miR-889 knockdown countries27. In this manuscript, it was first deter- in HCT116 cells. Notably, the positive effects of mined the overexpression of miR-889 in CRC cell proliferation induced by miR-889 could be tissues and cells. Upregulation of miR-889 signifi- reversed by the overexpression of DAB2IP. So far cantly enhanced CRC cells proliferation in vitro. as we know, it is the first to associate miR-889 with miRNAs binding to the 3’-UTR of target mRNAs tumor progression potential in CRC.

3332 Role of miR-889 in CRC

DAB2IP functioned as a tumor suppressor 7) Ma J, Dong C, Ji C. MicroRNA and drug resis- in various cancers. MiR-367 promoted prolif- tance. Cancer Gene Ther 2010; 17: 523-531. eration, migration, and invasion of osteosarco- 8) Ogino S, Chan AT, Fuchs CS, Giovannucci E. Mo- ma cells by regulating DAB2IP expression28. In lecular pathological epidemiology of colorectal neoplasia: an emerging transdisciplinary and in- bladder cancer, miRNA-556-3p could accelerate terdisciplinary field. Gut 2011; 60: 397-411. proliferation, migration, and invasion by target- 9) Luo Y, Tsuchiya KD, Il PD, Fausel R, Kanngurn S, ing DAB2IP29. In this study, we first discovered Welcsh P, Dzieciatkowski S, Wang J, Grady WM. RET that miR-889 can be involved in CRC progression is a potential tumor suppressor gene in colorectal by negatively regulating DAB2IP. Nevertheless, cancer. Oncogene 2013; 32: 2037-2047. 10) Wiemer EA. The role of microRNAs in cancer: no the possibility that other downstream targets small matter. Eur J Cancer 2007; 43: 1529-1544. may also be affected by miR-889 would not be 11) He L, Hannon GJ. MicroRNAs: small RNAs with a eliminated from consideration by the results of big role in gene regulation. Nat Rev Genet 2004; our work. Moreover, the role of DAB2IP in the 5: 522-531. Liu M, Zeng X, Lu YX, Mo YJ, Liao TH, Gan C, mechanism of inhibiting proliferation still needs 12) Lu XQ. Study on molecular mechanism of MiR- further exploration. NA-29a in promoting proliferation and invasion of non-small-cell lung cancer by inhibiting MTSS1. Eur Rev Med Pharmacol Sci 2018; 22: 5531- Conclusions 5538. 13) Vilar E, Tabernero J, Gruber SB. Micromanaging the classification of colon cancer: the role of the We verified that miR-889 is upregulated in microRNAome. Clin Cancer Res 2011; 17: 7207- CRC and plays a significant part in colorectal 7209. cancer progression. More notably, it was sug- 14) Liu DR, Guan QL, Gao MT, Jiang L, Kang HX. gested in our results that DAB2IP could play a miR-1260b is a potential prognostic biomarker in new part in inhibiting CRC cell proliferation. colorectal cancer. Med Sci Monit 2016; 22: 2417- 2423. Our manuscript revealed that miR-889 and its 15) Zhao J, Cao J, Zhou L, Du Y, Zhang X, Yang B, DAB2IP are potential to be the prognostic mark- Gao Y, Wang Y, Ma N, Yang W. MiR-1260b inhib- ers or targeted by the novel therapies for colorec- itor enhances the chemosensitivity of colorectal tal cancer management. cancer cells to fluorouracil by targeting PDCD4/ IGF1. Oncol Lett 2018; 16: 5131-5139. 16) Zhang Z, Li J, Huang Y, Peng W, Qian W, Gu J, Wang Q, Hu T, Ji D, Ji B, Zhang Y, Wang S, Sun Y. Conflict of Interest Upregulated miR-1258 regulates cell cycle and in- The authors declare that they have no conflict of interest. hibits cell proliferation by directly targeting E2F8 in CRC. Cell Prolif 2018: e12505. 17) Smits M, van Rijn S, Hulleman E, Biesmans D, van Vuurden DG, Kool M, Haberler C, Aronica E, Vandertop WP, Noske DP, Wurdinger T. EZH2-reg- References ulated DAB2IP is a medulloblastoma tumor suppressor and a positive marker for survival. Clin 1) Kraus S, Nabiochtchikov I, Shapira S, Arber N. Re- Cancer Res 2012; 18: 4048-4058. cent advances in personalized colorectal cancer 18) Wu K, Liu J, Tseng SF, Gore C, Ning Z, Sharifi N, research. Cancer Lett 2014; 347: 15-21. Fazli L, Gleave M, Kapur P, Xiao G, Sun X, Oz OK, 2) O'Connell JB, Maggard MA, Ko CY. Colon cancer Min W, Alexandrakis G, Yang CR, Hsieh CL, Wu HC, survival rates with the new American Joint Com- He D, Xie D, Hsieh JT. The role of DAB2IP in an- mittee on Cancer sixth edition staging. J Natl drogen receptor activation during prostate cancer Cancer Inst 2004; 96: 1420-1425. progression. Oncogene 2014; 33: 1954-1963. 3) Nagtegaal ID, Quirke P, Schmoll HJ. Has the new 19) Mok SC, Chan WY, Wong KK, Cheung KK, Lau CC, TNM classification for colorectal cancer improved Ng SW, Baldini A, Colitti CV, Rock CO, Berkowitz care? Nat Rev Clin Oncol 2011; 9: 119-123. RS. DOC-2, a candidate tumor suppressor gene in 4) Chua YJ, Zalcberg JR. Progress and challenges in human epithelial ovarian cancer. Oncogene 1998; the adjuvant treatment of stage II and III colon 16: 2381-2387. cancers. Expert Rev Anticancer Ther 2008; 8: 20) Fazili Z, Sun W, Mittelstaedt S, Cohen C, Xu XX. 595-604. Disabled-2 inactivation is an early step in ovarian 5) Grady WM, Pritchard CC. Molecular alterations tumorigenicity. Oncogene 1999; 18: 3104-3113. and biomarkers in colorectal cancer. Toxicol 21) Tseng CP, Ely BD, Li Y, Pong RC, Hsieh JT. Regula- Pathol 2014; 42: 124-139. tion of rat DOC-2 gene during castration-induced 6) Ye JJ, Cao J. MicroRNAs in colorectal cancer as rat ventral prostate degeneration and its growth markers and targets: recent advances. World J inhibitory function in human prostatic carcinoma Gastroenterol 2014; 20: 4288-4299. cells. Endocrinology 1998; 139: 3542-3553.

3333 Y. Xiao, Z.-H. Li, Y.-H. Bi

22) Zhou J, Scholes J, Hsieh JT. Signal transduction 26) Bartel DP. MicroRNAs: target recognition and targets in androgen-independent prostate cancer. regulatory functions. Cell 2009; 136: 215-233. Cancer Metastasis Rev 2001; 20: 351-362. 27) Sanoff HK, Sargent DJ, Campbell ME, Morton RF, 23) Fulop V, Colitti CV, Genest D, Berkowitz RS, Yiu Fuchs CS, Ramanathan RK, Williamson SK, Findlay GK, Ng SW, Szepesi J, Mok SC. DOC-2/hDab2, a BP, Pitot HC, Goldberg RM. Five-year data and candidate tumor suppressor gene involved in the prognostic factor analysis of oxaliplatin and development of gestational trophoblastic diseas- irinotecan combinations for advanced colorec- es. Oncogene 1998; 17: 419-424. tal cancer: N9741. J Clin Oncol 2008; 26: 5721- 24) Wang J, Zhu X, Hu J, He G, Li X, Wu P, Ren X, 5727. Wang F, Liao W, Liang L, Ding Y. The positive 28) Cai W, Jiang H, Yu Y, Xu Y, Zuo W, Wang S, Su Z. feedback between Snail and DAB2IP regulates miR-367 regulation of DOC-2/DAB2 interactive EMT, invasion and metastasis in colorectal can- protein promotes proliferation, migration and in- cer. Oncotarget 2015; 6: 27427-27439. vasion of osteosarcoma cells. Biomed Pharmaco- 25) Zhu XH, Wang JM, Yang SS, Wang FF, Hu JL, Xin ther 2017; 95: 120-128. SN, Men H, Lu GF, Lan XL, Zhang D, Wang XY, Liao 29) Feng C, Sun P, Hu J, Feng H, Li M, Liu G, Pan WT, Ding YQ, Liang L. Down-regulation of DAB2IP Y, Feng Y, Xu Y, Feng K, Feng Y. miRNA-556-3p promotes colorectal cancer invasion and metas- promotes human bladder cancer proliferation, tasis by translocating hnRNPK into nucleus to migration and invasion by negatively regulating enhance the transcription of MMP2. Int J Cancer DAB2IP expression. Int J Oncol 2017; 50: 2101- 2017; 141: 172-183. 2112.

3334