DOCSLIB.ORG

EZH2-Regulated DAB2IP Is a Medulloblastoma Tumor Suppressor and a Positive Marker for Survival

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
EZH2-Regulated DAB2IP Is a Medulloblastoma Tumor Suppressor and a Positive Marker for Survival Published OnlineFirst June 13, 2012; DOI: 10.1158/1078-0432.CCR-12-0399 Clinical Cancer Human Cancer Biology Research EZH2-Regulated DAB2IP Is a Medulloblastoma Tumor Suppressor and a Positive Marker for Survival Michiel Smits1, Sjoerd van Rijn1, Esther Hulleman1, Dennis Biesmans1, Dannis G. van Vuurden1, Marcel Kool4, Christine Haberler5, Eleonora Aronica2, W. Peter Vandertop1,3, David P. Noske1, and Thomas Wurdinger€ 1,6 Abstract Purpose: Medulloblastoma is the most common malignant brain tumor in children. Despite recent improvements, the molecular mechanisms driving medulloblastoma are not fully understood and further elucidation could provide cues to improve outcome prediction and therapeutic approaches. Experimental Design: Here, we conducted a meta-analysis of mouse and human medulloblastoma gene expression data sets, to identify potential medulloblastoma tumor suppressor genes. Results: We identified DAB2IP, a member of the RAS-GTPase–activating protein family (RAS GAP), and showed that DAB2IP expression is repressed in medulloblastoma by EZH2-induced trimethylation. Moreover, we observed that reduced DAB2IP expression correlates significantly with a poor overall survival of patients with medulloblastoma, independent of metastatic stage. Finally, we showed that ectopic DAB2IP expression enhances stress-induced apoptosis in medulloblastoma cells and that reduced expression of DAB2IP in medulloblastoma cells conveys resistance to irradiation-induced cell death. Conclusion: These results suggest that repression of DAB2IP may at least partly protect medulloblastoma cells from apoptotic cell death. Moreover, DAB2IP may represent a molecular marker to distinguish patients with medulloblastoma at high risk from those with a longer survival prognosis. Clin Cancer Res; 1–11. Ó2012 AACR. Introduction 4 subtypes: WNT, SHH, group 3, and group 4, which differ Brain tumors are the most common form of solid tumors regarding histology and clinical outcome (4) and are in children of which medulloblastoma is the most frequent believed to derive from the deregulation of various signaling malignant variant, accounting for 20% of cases (1). Treat- pathways in brain development, such as the WNT-pathway ment modalities consist of surgery, radiotherapy, and che- and sonic hedgehog (SHH) signaling pathways. Overacti- motherapy and result in a 5-year survival rate of 40% in vation of these pathways leads to a loss of cell-cycle control high-risk patients and 80% to 90% in low-risk patients (2). and a dysfunctional apoptosis program, allowing for con- Approximately 30% of patients however remain incurable tinued growth and tumorigenesis, predominantly in the and current intensive treatment protocols cause significant cerebellum (5). adverse long-term effects (3). Medulloblastomas comprise DAB2IP—disabled homolog 2–interacting protein, located at chromosome 9q33.1-q33.3—is a member of the RAS-GTPase activating protein family (RAS GAP) that inactivates RAS by promoting conversion of GTP into Authors' Affiliations: 1Neuro-oncology Research Group, Departments of GDP (6). DAB2IP acts as a putative tumor suppressor Neurosurgery and Pediatric Oncology/Hematology, Cancer Center gene and is downregulated by epigenetic modification in Amsterdam, VU University Medical Center; 2Department of (Neuro)Pathol- ogy, Academic Medical Center, University of Amsterdam; 3Neurosurgical multiple aggressive cancers. In prostate cancer, DAB2IP Center Amsterdam, Academic Medical Center, Amsterdam, The Nether- expression was shown to be repressed by promoter meth- 4 lands; Department of Molecular Genetics, German Cancer Research ylation and histone modification (7), whereas in breast Center (DKFZ), Heidelberg, Germany; 5Institut Curie, Laboratoire de Genet- ique et Biologie des Cancers, Paris, France; and 6Molecular Neurogenetics cancer (8), lung cancer (9), and gastrointestinal tumors Unit, Departments of Neurology and Radiology, Massachusetts General (10), aberrant promoter hypermethylation was shown to Hospital and Neuroscience Program, Harvard Medical School, Boston, Massachusetts downregulate DAB2IP. Moreover, it was shown in pros- tate cancer that downregulation of DAB2IP expression Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/). results in resistance to ionizing radiation (11), it initiates epithelial-to-mesenchymal transition (12) and promotes Corresponding Author: Thomas Wurdinger,€ VU University Medical Cen- ter, CCA Room 3.60, De Boelelaan 1117, Amsterdam 1081 HV, The tumor growth and metastasis (13). In addition, DAB2IP is Netherlands. Phone: 31-204447909; Fax: 31-20-4442126; E-mail: involved in TNFa-induced apoptosis in prostate cancer [email protected] cells by suppressing the ASK1-JNK and PI3-AKT pathway doi: 10.1158/1078-0432.CCR-12-0399 (14), and in endothelial cells via the ASK1-JNK pathway Ó2012 American Association for Cancer Research. (15). www.aacrjournals.org OF1 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2012 American Association for Cancer Research. Published OnlineFirst June 13, 2012; DOI: 10.1158/1078-0432.CCR-12-0399 Smits et al. was based on 108 cases for which expression and survival Translational Relevance data were available. Patient and tumor characteristics are Medulloblastoma is the most common malignant presented in Table 1. In brief, all samples were snap frozen pediatric brain tumor. Current treatment modalities in the institutional pathology departments immediately result in a 5-year survival rate of 40% in high-risk upon arrival. All samples were reviewed by experienced patients and 80% to 90% in standard risk patients. neuropathologists and examined for tumor content. Total Approximately 30% of patients however remain incur- RNA was extracted using TRIzol (Invitrogen). Gene expres- able and current intensive treatment protocols cause sion profiles were obtained by Affymetrix HG-U133 Plus 2.0 significant adverse long-term effects such as impaired arrays. Gene expression data were normalized using the neurologic function and endocrine dysfunction. GCRMA procedure. Informed consent and detailed meth- Currently, the staging for medulloblastoma between ods are described elsewhere (23, 24). high-risk and standard-risk disease is based on clinical Immunohistochemistry was conducted on a largely inde- parameters and histologic subtypes. However, it is sug- pendent medulloblastoma tissue microarray (TMA) cohort gested that including molecular markers in the risk with tumors from 87 patients obtained from the files of the stratification could improve survival and decrease treat- Department of Neuropathology of the Academic Medical ment-related toxicity. Here we show that high expression Center (University of Amsterdam). Subgroup information of DAB2IP in medulloblastoma is associated with a was obtained by immunohistochemistry using antibodies favorable prognosis, independent of metastatic stage. for the subgroup-specific protein markers b-catenin (WNT), This suggests DAB2IP expression inhibits tumor growth DKK1 (WNT), SFRP1 (SHH), NPR3 (Group 3), and KCNA1 and further research in its use as a potentially important (Group 4). Information on gender, age at diagnosis, his- prognostic factor and/or therapeutic target may contrib- tology, metastatic stage at diagnosis, and survival are pre- ute to improvements in the future treatment of patients sented in Table 2. The mean follow-up time of survivors in with medulloblastoma. the TMA cohort was 6.2 years (range 0.1–19.4 years). Informed consent was obtained for the use of brain tissue and for access to medical records for research purposes. MB1 and MB2 primary human medulloblastoma tissues were Apoptosis is a programmed variant of cell death common obtained from surgical specimens after informed consent to all human cells. Defects in the apoptosis program result and approval by the Medical Ethical Committee of the VU in an imbalance in the rate of cell proliferation and the rate University Medical Center. of cell death thereby contributing to tumor growth and treatment resistance. Essential steps in the apoptotic mech- Survival analysis anism are inactivated in medulloblastoma cells, resulting in Overall survival was calculated from the time of diagnosis resistance to apoptosis. A recent in vivo study showed that to the patient’s last follow-up or death. Survival of patients cerebellar stem cells can give rise to medulloblastomas was analyzed using Kaplan–Meier survival curves, and the when having acquired an impaired apoptosis mechanism log-rank test was used to examine the statistical significance. (16). Consequently, many of the apoptosis mediators are P-values < 0.05 were considered significant. Prognostic generally considered tumor suppressors (17). impact of covariates on survival was evaluated on the basis Here, we describe a comprehensive meta-analysis of gene of hazard ratios from Cox’s proportional hazards regression expression studies of mouse and human medulloblastoma model. Multivariate Cox’s proportional hazards regression (18–23) identifying multiple medulloblastoma tumor sup- models were used to estimate effects of additional the pressor candidates, including DAB2IP. We found DAB2IP covariates age, metastatic stage, and histology. expression to be strongly downregulated in human medul- loblastoma cells and in primary human medulloblastoma Cells tissues. We show that DAB2IP downregulation is—at least Human D283-med, D556-med (Dr Darrell Bigner, Duke partially—caused by EZH2-mediated
Load more

Recommended publications
  • Wnt/Β-Catenin Signaling Pathway Induces Autophagy
    Yun et al. Cell Death and Disease (2020) 11:771 https://doi.org/10.1038/s41419-020-02988-8 Cell Death & Disease ARTICLE Open Access Wnt/β-catenin signaling pathway induces autophagy-mediated temozolomide-resistance in human glioblastoma Eun-Jin Yun 1,SangwooKim2,Jer-TsongHsieh3,4 and Seung Tae Baek 5,6 Abstract Temozolomide (TMZ) is widely used for treating glioblastoma multiforme (GBM), however, the treatment of such brain tumors remains a challenge due to the development of resistance. Increasing studies have found that TMZ treatment could induce autophagy that may link to therapeutic resistance in GBM, but, the precise mechanisms are not fully understood. Understanding the molecular mechanisms underlying the response of GBM to chemotherapy is paramount for developing improved cancer therapeutics. In this study, we demonstrated that the loss of DOC-2/DAB2 interacting protein (DAB2IP) is responsible for TMZ-resistance in GBM through ATG9B. DAB2IP sensitized GBM to TMZ and suppressed TMZ-induced autophagy by negatively regulating ATG9B expression. A higher level of ATG9B expression was associated with GBM compared to low-grade glioma. The knockdown of ATG9B expression in GBM cells suppressed TMZ-induced autophagy as well as TMZ-resistance. Furthermore, we showed that DAB2IP negatively regulated ATG9B expression by blocking the Wnt/β-catenin pathway. To enhance the benefit of TMZ and avoid therapeutic resistance, effective combination strategies were tested using a small molecule inhibitor blocking the Wnt/ β-catenin pathway in addition to TMZ. The combination treatment synergistically enhanced the efficacy of TMZ in GBM cells. In conclusion, the present study identified the mechanisms of TMZ-resistance of GBM mediated by DAB2IP 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; and ATG9B which provides insight into a potential strategy to overcome TMZ chemo-resistance.
    [Show full text]
  • Rabbit Anti-DAB2IP Rabbit Anti-DAB2IP
    Qty: 100 μg/400 μL Rabbit anti-DAB2IP Catalog No. 487300 Lot No. Rabbit anti-DAB2IP FORM This polyclonal antibody is supplied as a 400 µL aliquot at a concentration of 0.25 mg/mL in phosphate buffered saline (pH 7.4) containing 0.1% sodium azide. This antibody is epitope-affinity purified from rabbit antiserum. PAD: ZMD.689 IMMUNOGEN Synthetic peptide derived from the C-terminal region of the human DAB2IP protein (Accession# NP_619723), which is identical to mouse and rat sequence. SPECIFICITY This antibody is specific for the DAB2IP (DAB2 interacting protein, AIP1, DIP1/2) protein. On Western blots, it identifies the target band at ~110 kDa. REACTIVITY Reactivity has been confirmed with human DU145, SK-N-MC and rat B49 cell lysates. Based on amino acid sequence homology, reactivity with mouse is expected. Sample Western Immuno- Immuno- Blotting precipitation cytochemistry Human +++ 0 ND Mouse ND ND ND Rat +++ 0 ND (Excellent +++, Good++, Poor +, No reactivity 0, Not applicable N/A, Not Determined ND) USAGE Working concentrations for specific applications should be determined by the investigator. Appropriate concentrations will be affected by several factors, including secondary antibody affinity, antigen concentration, sensitivity of detection method, temperature and length of incubations, etc. The suitability of this antibody for applications other than those listed below has not been determined. The following concentration ranges are recommended starting points for this product. Western Blotting: 1-3 μg/mL STORAGE Store at 2-8°C for up to one month. Store at –20°C for long-term storage. Avoid repeated freezing and thawing. (cont’d) www.invitrogen.com Invitrogen Corporation • 542 Flynn Rd • Camarillo • CA 93012 • Tel: 800.955.6288 • E-mail: [email protected] PI487300 (Rev 10/08) DCC-08-1089 Important Licensing Information - These products may be covered by one or more Limited Use Label Licenses (see the Invitrogen Catalog or our website, www.invitrogen.com).
    [Show full text]
  • Disabled Homolog 2 Interactive Protein Functions As a Tumor Suppressor in Osteosarcoma Cells
    ONCOLOGY LETTERS 16: 703-712, 2018 Disabled homolog 2 interactive protein functions as a tumor suppressor in osteosarcoma cells JIANAN HE1,5, SHUAI HUANG2, ZHENHUA LIN3, JIQIN ZHANG4, JIALIN SU4, WEIDONG JI4 and XINGMO LIU1 1Department of Orthopaedic Surgery, The Sixth Affiliated Hospital of Sun Yat‑sun University, Guangzhou, Guangdong 510655; 2Department of Orthopaedic Surgery, The First Affiliated Hospital of Sun Yat‑sen University, Guangzhou, Guangdong 510080; 3Department of Orthopaedic Surgery, The People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, Guangxi 530021; 4Center for Translational Medicine, The First Affiliated Hospital of Sun Yat‑sen University, Guangzhou, Guangdong 510080; 5Department of Interventional Radiology, The Fifth Affiliated Hospital of Sun Yat-sun University, Zhuhai, Guangdong 519000, P.R. China Received April 2, 2016; Accepted June 16, 2017 DOI: 10.3892/ol.2018.8776 Abstract. The disabled homolog 2 interactive protein osteosarcoma will develop distant metastasis (2). Owing to the (DAB2IP) gene is a member of the family of Ras GTPases development of multidisciplinary therapy, the mortality rate and functions as a tumor suppressor in many types of carci- for patients with osteosarcoma has been decreasing in recent noma; however, its function in osteosarcoma remains unclear. years. Nevertheless, patients continue to exhibit a high risk The aim of the present study was to determine the function of of metastasis and/or recurrence (1,2). Previous studies have DAB2IP in osteosarcoma and normal bone cells in vitro. The indicated that several genetic aberrations are associated with expression of DAB2IP protein was assessed in osteoblast and tumor initiation and osteosarcoma progression (3,4). Thus, osteosarcoma cell lines by western blot analysis.
    [Show full text]
  • Methylome and Transcriptome Maps of Human Visceral and Subcutaneous
    www.nature.com/scientificreports OPEN Methylome and transcriptome maps of human visceral and subcutaneous adipocytes reveal Received: 9 April 2019 Accepted: 11 June 2019 key epigenetic diferences at Published: xx xx xxxx developmental genes Stephen T. Bradford1,2,3, Shalima S. Nair1,3, Aaron L. Statham1, Susan J. van Dijk2, Timothy J. Peters 1,3,4, Firoz Anwar 2, Hugh J. French 1, Julius Z. H. von Martels1, Brodie Sutclife2, Madhavi P. Maddugoda1, Michelle Peranec1, Hilal Varinli1,2,5, Rosanna Arnoldy1, Michael Buckley1,4, Jason P. Ross2, Elena Zotenko1,3, Jenny Z. Song1, Clare Stirzaker1,3, Denis C. Bauer2, Wenjia Qu1, Michael M. Swarbrick6, Helen L. Lutgers1,7, Reginald V. Lord8, Katherine Samaras9,10, Peter L. Molloy 2 & Susan J. Clark 1,3 Adipocytes support key metabolic and endocrine functions of adipose tissue. Lipid is stored in two major classes of depots, namely visceral adipose (VA) and subcutaneous adipose (SA) depots. Increased visceral adiposity is associated with adverse health outcomes, whereas the impact of SA tissue is relatively metabolically benign. The precise molecular features associated with the functional diferences between the adipose depots are still not well understood. Here, we characterised transcriptomes and methylomes of isolated adipocytes from matched SA and VA tissues of individuals with normal BMI to identify epigenetic diferences and their contribution to cell type and depot-specifc function. We found that DNA methylomes were notably distinct between diferent adipocyte depots and were associated with diferential gene expression within pathways fundamental to adipocyte function. Most striking diferential methylation was found at transcription factor and developmental genes. Our fndings highlight the importance of developmental origins in the function of diferent fat depots.
    [Show full text]
  • Negative Regulation of DAB2IP by Akt and Scffbw7 Pathways
    Negative regulation of DAB2IP by Akt and SCFFbw7 pathways The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Dai, Xiangping, Brian J. North, and Hiroyuki Inuzuka. 2014. “Negative regulation of DAB2IP by Akt and SCFFbw7 pathways.” Oncotarget 5 (10): 3307-3315. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:12717538 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA www.impactjournals.com/oncotarget/ Oncotarget, Vol. 5, No. 10 Negative regulation of DAB2IP by Akt and SCFFbw7 pathways Xiangping Dai1,*, Brian J. North1,* and Hiroyuki Inuzuka1 1 Department of Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA. * These authors contributed equally to this work. Correspondence to: Brian North, email: [email protected] Correspondence to: Hiroyuki Inuzuka, email: [email protected] Keywords: DAB2IP, Akt, Fbw7, degradation, cancer, phosphorylation, ubiquitination. Received: April 16, 2014 Accepted: April 30, 2014 Published: May 1, 2014 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT: Deletion of ovarian carcinoma 2/disabled homolog 2 (DOC-2/DAB2) interacting protein (DAB2IP), is a tumor suppressor that serves as a scaffold protein involved in coordinately regulating cell proliferation, survival and apoptotic pathways.
    [Show full text]
  • Dab2ip Regulates Neuronal Migration and Neurite Development
    DAB2IP REGULATES NEURONAL MIGRATION AND NEURITE DEVELOPMENT IN THE DEVELOPING NEOCORTEX by GUM HWA LEE A Dissertation submitted to the Graduate School-New Brunswick Rutgers, The State University of New Jersey And The Graduate School of Biomedical Sciences University of Medicine and Dentistry of New Jersey In partial fulfillment of the requirements For the degree of Doctor of Philosophy Graduate Program in Cell and Developmental Biology Written under the direction of Gabriella D’Arcangelo And approved by New Brunswick, New Jersey October, 2012 ABSTRACT OF THE DISSERTATION DAB2IP REGULATES NEURONAL MIGRATION AND NEURITE DEVELOPMENT IN THE DEVELOPING NEOCORTEX By GUM HWA LEE Dissertation Director: Gabriella D’Arcangelo Dab2ip (DOC-2/DAB2 interacting protein) is a member of the Ras GTPase- activating protein (GAP) family that has been previously shown to function as a tumor suppressor in several systems. Dab2ip is also highly expressed in the brain where it interacts with Dab1, a key mediator of the Reelin pathway that controls several aspects of brain development and function. I found that Dab2ip is highly expressed in the developing cerebral cortex, but that mutations in the Reelin signaling pathway do not affect its expression. To determine whether Dab2ip plays a role in brain development, I knocked down or over expressed it in neuronal progenitor cells of the embryonic mouse neocortex using the in utero electroporation technique. Dab2ip down-regulation severely disrupts neuronal migration, affecting preferentially late-born principal cortical neurons. Dab2ip overexpression also leads to migration defects. Structure-function experiments in ii vivo further show that both PH and GRD domains of Dab2ip are important for neuronal migration.
    [Show full text]
  • Expression of Mouse Dab2ip Transcript Variants and Gene Methylation During Brain Development
    Gene 568 (2015) 19–24 Contents lists available at ScienceDirect Gene journal homepage: www.elsevier.com/locate/gene Research paper Expression of mouse Dab2ip transcript variants and gene methylation during brain development Farimah Salami, Shuhong Qiao, Ramin Homayouni ⁎ Department of Biological Sciences, University of Memphis, Memphis, TN, United States article info abstract Article history: Dab2ip (DOC-2/DAB2 interacting protein) is a RasGAP protein which shows a growth-inhibitory effect in human Received 19 December 2014 prostate cancer cell lines. Recent studies have shown that Dab2ip also plays an important role in regulating den- Received in revised form 15 April 2015 drite development and neuronal migration during brain development. In this study, we provide a more complete Accepted 5 May 2015 description of the mouse Dab2ip (mDab2ip) gene locus and examined DNA methylation and expression of Dab2ip Available online 7 May 2015 during cerebellar development. Analysis of cDNA sequences in public databases revealed a total of 20 possible Keywords: exons for mDab2ip gene, spanning over 172 kb. Using Cap Analysis of Gene Expression (CAGE) data available fi Dab1 through FANTOM5 project, we deduced ve different transcription start sites for mDab2ip. Here, we character- AIP1 ized three different mDab2ip transcript variants beginning with exon 1. These transcripts varied by the presence Cerebellum or absence of exons 3 and 5, which encode a putative nuclear localization signal and the N-terminal region of a GTPase activating protein PH-domain, respectively. The 5′ region of the mDab2ip gene contains three putative CpG islands (CpG131, CpG54, and CpG85). Interestingly, CpG54 and CpG85 are localized on exons 3 and 5.
    [Show full text]
  • Downregulation of Human DAB2IP Gene Expression in Renal Cell
    Published OnlineFirst April 18, 2019; DOI: 10.1158/1078-0432.CCR-18-3004 Translational Cancer Mechanisms and Therapy Clinical Cancer Research Downregulation of Human DAB2IP Gene Expression in Renal Cell Carcinoma Results in Resistance to Ionizing Radiation Eun-Jin Yun1,2, Chun-Jung Lin1, Andrew Dang1, Elizabeth Hernandez1, Jiaming Guo3, Wei-Min Chen3, Joyce Allison4, Nathan Kim3, Payal Kapur5, James Brugarolas4, Kaijie Wu6, Dalin He6, Chih-Ho Lai7, Ho Lin8, Debabrata Saha3, Seung Tae Baek2, Benjamin P.C. Chen3, and Jer-Tsong Hsieh1,9 Abstract Purpose: Renal cell carcinoma (RCC) is known to be highly In vivo ubiquitination assay was used to test PARP-1 degrada- radioresistant but the mechanisms associated with radioresis- tion. Furthermore, in vivo mice xenograft model and patient- tance have remained elusive. We found DOC-2/DAB2 inter- derived xenograft (PDX) model were used to determine the active protein (DAB2IP) frequently downregulated in RCC, is effect of combination therapy to sensitizing tumors to IR. associated with radioresistance. In this study, we investigated Results: We notice that DAB2IP-deficient RCC cells acquire the underlying mechanism regulating radioresistance by IR-resistance. Mechanistically, DAB2IP can form a complex DAB2IP and developed appropriate treatment. with PARP-1 and E3 ligases that is responsible for degrading Experimental Design: Several RCC lines with or without PARP-1. Indeed, elevated PARP-1 levels are associated with the DAB2IP expression were irradiated with ionizing radiation IR resistance in RCC cells. Furthermore, PARP-1 inhibitor can (IR) for determining their radiosensitivities based on colony enhance the IR response of either RCC xenograft model or PDX formation assay.
    [Show full text]
  • Single-Cell Transcriptomes Reveal a Complex Cellular Landscape in the Middle Ear and Differential Capacities for Acute Response to Infection
    fgene-11-00358 April 9, 2020 Time: 15:55 # 1 ORIGINAL RESEARCH published: 15 April 2020 doi: 10.3389/fgene.2020.00358 Single-Cell Transcriptomes Reveal a Complex Cellular Landscape in the Middle Ear and Differential Capacities for Acute Response to Infection Allen F. Ryan1*, Chanond A. Nasamran2, Kwang Pak1, Clara Draf1, Kathleen M. Fisch2, Nicholas Webster3 and Arwa Kurabi1 1 Departments of Surgery/Otolaryngology, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States, 2 Medicine/Center for Computational Biology & Bioinformatics, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States, 3 Medicine/Endocrinology, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States Single-cell transcriptomics was used to profile cells of the normal murine middle ear. Clustering analysis of 6770 transcriptomes identified 17 cell clusters corresponding to distinct cell types: five epithelial, three stromal, three lymphocyte, two monocyte, Edited by: two endothelial, one pericyte and one melanocyte cluster. Within some clusters, Amélie Bonnefond, Institut National de la Santé et de la cell subtypes were identified. While many corresponded to those cell types known Recherche Médicale (INSERM), from prior studies, several novel types or subtypes were noted. The results indicate France unexpected cellular diversity within the resting middle ear mucosa. The resolution of Reviewed by: Fabien Delahaye, uncomplicated, acute, otitis media is too rapid for cognate immunity to play a major Institut Pasteur de Lille, France role. Thus innate immunity is likely responsible for normal recovery from middle ear Nelson L. S. Tang, infection. The need for rapid response to pathogens suggests that innate immune The Chinese University of Hong Kong, China genes may be constitutively expressed by middle ear cells.
    [Show full text]
  • The Impact of Structural Variation on Human Gene Expression
    bioRxiv preprint doi: https://doi.org/10.1101/055962; this version posted June 9, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The impact of structural variation on human gene expression Colby Chiang1, Alexandra J. Scott1, Joe R. Davis2,3, Emily K. Tsang2, Xin Li2, Yungil Kim4, Farhan N. Damani4, Liron Ganel1, GTEx Consortium, Stephen B. Montgomery2,3,5, Alexis Battle4, Donald F. Conrad6,7,8*, Ira M. Hall1,6,8* * Co-corresponding authors 1McDonnell Genome Institute, Washington University School of Medicine, St. Louis, MO, USA 2Department of Pathology, Stanford University School of Medicine, Stanford, CA, USA 3Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA 4Department of Computer Science, Johns Hopkins University, Baltimore, Maryland, USA 5Department of Computer Science, Stanford University, Stanford, CA, USA 6Department of Medicine, Washington University School of Medicine, St. Louis, MO, USA 7Department of Pathology & Immunology, Washington University School of Medicine, St. Louis, MO, USA 8Department of Genetics, Washington University School of Medicine, St. Louis, MO, USA 1 bioRxiv preprint doi: https://doi.org/10.1101/055962; this version posted June 9, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Structural variants (SVs) are an important source of human genetic diversity but their contribution to traits, disease, and gene regulation remains unclear.
    [Show full text]
  • Association of the Single Nucleotide Polymorphism in Chromosome 9P21
    Li et al. BMC Cardiovascular Disorders (2017) 17:255 DOI 10.1186/s12872-017-0685-0 RESEARCH ARTICLE Open Access Association of the single nucleotide polymorphism in chromosome 9p21 and chromosome 9q33 with coronary artery disease in Chinese population Qi Li1, Wenhui Peng2, Hailing Li2, Jianhui Zhuang2, Xuesheng Luo1 and Yawei Xu2* Abstract Background: Our study aims to explore the association of rs7025486 single-nucleotide polymorphisms (SNP) in DAB2IP and rs1333049 on chromosome 9p21.3 with the coronary artery disease in Chinese population. Methods: All patients came from the east China area and underwent coronary angiography. Rs7025486 and rs1333049 polymorphism were genotyped in 555 patients with CAD and in 480 healthy controls that underwent coronary angiography. Results: In Chinese population, the rs7025486 genotype in the case group was no significant different than the control group (P = 0.531).Meanwhile, the rs1333049 SNP has statistically significant (P = 0.006), which was the independent risk factors for CAD (OR1.252, P = 0.039), and consistent with the past studies conclusion. Conclusion: Genotype of rs1333049 on chromosome 9p21, but not rs7025486 on chromosome 9q33, is an independent determinant of the incidence of CAD in Chinese population. Keywords: Coronary artery disease, Single-nucleotide polymorphisms, rs1333049, rs702548 Background chromosome 9p21 [4–6]. However, several subsequent Coronary artery disease (CAD) is a chronic multifactor in- studies have shown inconsistent results when the associ- flammatory disease which can progress to acute coronary ation between these genetic variants and CAD or AMI syndrome and sudden cardiac death [1]. CAD is associ- was examined [7, 8]. In addition, these data are mostly ated with a family history as well as several established risk from American African, Caucasian, South Korean, and factors including diabetes mellitus, hypertension, hyperlip- Japanese cohorts.
    [Show full text]
  • Dab2ip (NM 001114125) Mouse Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC223689 Dab2ip (NM_001114125) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Dab2ip (NM_001114125) Mouse Untagged Clone Tag: Tag Free Symbol: Dab2ip Synonyms: 2310011D08Rik; AI480459; Aip1; mKIAA1743 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >MC223689 representing NM_001114125 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCCCGACTCCCTCCTGGACCCAGGCGACTCCTACGAGTCGCCCCAAGAAAGGCCGGGCTCCCGGC GGAGCCTTCCCGGCAGCATGTCAGAGAAAAACCCCAGCATGGAGCCCTCGGCTTCAACCCCGTTCCGGGT CACGGGCTTCCTCAGCCGCCGCCTCAAGGGCTCCATCAAGCGCACCAAGAGCCAGCCCAAACTGGACCGC AACCACAGCTTCCGCCACATCCTGCCGGGGTTCCGGAGCGCAGCCGCCGCCGCCGCGGACAATGAGAGGT CCCATCTGATGCCAAGGCTGAAGGAGTCTCGGTCACACGAGTCCCTGCTCAGCCCCAGCAGCGCAGTGGA GGCCCTGGACCTCAGCATGGAGGAGGAGGTGATTATCAAGCCCGTTCACAGCAGCATCCTGGGTCAGGAC TACTGCTTCGAGGTGACAACATCATCAGGAAGCAAGTGTTTTTCCTGCCGGTCAGCCGCTGAGCGCGATA AGTGGATGGAGAACCTGAGGCGAGCAGTGCACCCCAACAAGGACAACAGCCGGCGTGTGGAGCATATCCT GAAGCTGTGGGTGATTGAGGCCAAGGATCTGCCGGCCAAGAAGAAGTATCTATGTGAACTGTGCCTGGAC GATGTGCTGTATGCCCGTACCACAAGCAAGCTCAAGACGGACAATGTCTTCTGGGGAGAGCACTTTGAGT TCCATAACCTGCCGCCTCTACGCACAGTCACTGTGCACCTGTATCGGGAGACTGACAAGAAAAAGAAAAA GGAACGCAACAGCTACCTGGGCCTGGTGAGCCTGCCTGCCGCCTCTGTGGCTGGGCGGCAGTTTGTGGAG
    [Show full text]