DOCSLIB.ORG

Cutting the Brakes on Ras—Cytoplasmic Gaps As Targets of Inactivation in Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cutting the Brakes on Ras—Cytoplasmic Gaps As Targets of Inactivation in Cancer cancers Review Cutting the Brakes on Ras—Cytoplasmic GAPs as Targets of Inactivation in Cancer Arianna Bellazzo and Licio Collavin * Department of Life Sciences, University of Trieste, Via L. Giorgieri 1, 34127 Trieste, Italy; [email protected] * Correspondence: [email protected] Received: 28 September 2020; Accepted: 15 October 2020; Published: 21 October 2020 Simple Summary: GTPase-Activating Proteins (RasGAPs) are a group of structurally related proteins with a fundamental role in controlling the activity of Ras in normal and cancer cells. In particular, loss of function of RasGAPs may contribute to aberrant Ras activation in cancer. Here we review the multiple molecular mechanisms and factors that are involved in downregulating RasGAPs expression and functions in cancer. Additionally, we discuss how extracellular stimuli from the tumor microenvironment can control RasGAPs expression and activity in cancer cells and stromal cells, indirectly affecting Ras activation, with implications for cancer development and progression. Abstract: The Ras pathway is frequently deregulated in cancer, actively contributing to tumor development and progression. Oncogenic activation of the Ras pathway is commonly due to point mutation of one of the three Ras genes, which occurs in almost one third of human cancers. In the absence of Ras mutation, the pathway is frequently activated by alternative means, including the loss of function of Ras inhibitors. Among Ras inhibitors, the GTPase-Activating Proteins (RasGAPs) are major players, given their ability to modulate multiple cancer-related pathways. In fact, most RasGAPs also have a multi-domain structure that allows them to act as scaffold or adaptor proteins, affecting additional oncogenic cascades. In cancer cells, various mechanisms can cause the loss of function of Ras inhibitors; here, we review the available evidence of RasGAP inactivation in cancer, with a specific focus on the mechanisms. We also consider extracellular inputs that can affect RasGAP levels and functions, implicating that specific conditions in the tumor microenvironment can foster or counteract Ras signaling through negative or positive modulation of RasGAPs. A better understanding of these conditions might have relevant clinical repercussions, since treatments to restore or enhance the function of RasGAPs in cancer would help circumvent the intrinsic difficulty of directly targeting the Ras protein. Keywords: cell signaling; GTPase-Activating Proteins; tumor suppressor genes; signal transduction; mechanisms of transformation; RAS oncogene 1. Introduction Ras proteins (K-Ras, N-Ras, and H-Ras) are small monomeric GTPases that modulate cell fate by linking receptor activation to intracellular signaling, thereby controlling cell growth, survival, migration, and metabolism [1]. Ras signaling can be initiated by receptor tyrosine kinases (RTKs), G-protein coupled receptors (GPCRs), and integrin family members (reviewed in [2]). Once activated, Ras proteins trigger a number of pro-oncogenic signaling cascades, including mitogen-activated protein (MAP) kinases, the phosphoinositide 3-kinase/Akt (PI3K/Akt) axis, the NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells) transcription factor, and the mTOR (mammalian target of rapamycin) cytoplasmic regulator, supporting evasion of apoptosis, epithelial–mesenchymal Cancers 2020, 12, 3066; doi:10.3390/cancers12103066 www.mdpi.com/journal/cancers Cancers 2020, 12, x 2 of 22 Cancerscytoplasmic2020, 12, regulator, 3066 supporting evasion of apoptosis, epithelial–mesenchymal transition (EMT),2 of 22as well as metabolic and inflammatory cell reprogramming [2]. Ras proteins can also drive cytoskeletal reorganization and cell motility by stimulating the Rac-Rho and Rac-PAX networks [1,2]. transitionIn cancer (EMT), cells, as wellaberrant as metabolic Ras activation and inflammatory establishes a cellcomplex reprogramming oncogenic [circuit2]. Ras that proteins promotes can alsotumor drive initiation, cytoskeletal growth, reorganization and dissemination, and cell to motilitysuch an extent by stimulating that some the authors Rac-Rho have and proposed Rac-PAX the networksconcept of [1 ,Ras-driven2]. cancer [2]. In a large-scale analysis of the patterns of somatic alterations in cancer,In cancerthe RTK-Ras cells, aberrant axis turned Ras out activation to be the establishes canonical pathway a complex with oncogenic the highest circuit median that promotesfrequency tumorof mutation initiation, [3]. growth,Indeed, andRas dissemination,proteins are frequent to suchly an altered extent thatin tumors, some authors with activating have proposed mutations the conceptidentified of in Ras-driven around one cancer third [ 2of]. all In human a large-scale cancer analysiss [4,5]. Notably, of the patterns in tumors of without somatic RAS alterations mutation, in cancer,multiple the events RTK-Ras can axisphenocopy turned Ras out tohyperactivation be the canonical [6]. pathway For instance, with increased the highest Ras median pathway frequency activity ofis mutationdetected in [3 more]. Indeed, that 50% Ras of proteins breast carcinomas are frequently, although altered the in frequency tumors, with of RAS activating mutation mutations is much identifiedlower in this in around tumor onetype third [4,7,8]. of allSimilarly, human evidence cancers [4 of,5 ].activated Notably, Ras in tumors signaling without is consistently RAS mutation, found multiplein liver cancer events and can phenocopymyeloma, tumors Ras hyperactivation that have a lower [6]. ForRAS instance, mutation increased rate compared Ras pathway to other activity cancers is detected[4,5,9,10]. in more that 50% of breast carcinomas, although the frequency of RAS mutation is much lower in thisLike tumor most type GTPases, [4,7,8]. Similarly,Ras activity evidence is controlled of activated by activators Ras signaling and is inhibitors; consistently therefore, found in in liver the cancerabsence and of myeloma,RAS gene tumors alterations, that have one aimportant lower RAS mechanism mutation rate of Ras compared hyperactivation to other cancers in cancer [4,5 ,9is,10 the]. loss Likeof function most GTPases, of Ras inhibitors. Ras activity Here, is controlled we anal byyze activators one major and class inhibitors; of Ras therefore,inhibitors: in the the GTPase- absence ofActivating RAS gene Proteins alterations, (RasGAPs). one important mechanism of Ras hyperactivation in cancer is the loss of function of Ras inhibitors. Here, we analyze one major class of Ras inhibitors: the GTPase-Activating Proteins2. The Brakes: (RasGAPs). GAPs as Negative Regulators of Ras Activity 2. TheThe Brakes: duration GAPs of asRas Negative activity Regulatorsis tightly contro of Raslled; Activity the conversion from the active GTP-bound form to the inactive GDP-bound state, intrinsic in Ras proteins, is accelerated by members of the GAP The duration of Ras activity is tightly controlled; the conversion from the active GTP-bound form family. Consequently, loss of function of RasGAPs leads to aberrant Ras activation and increases to the inactive GDP-bound state, intrinsic in Ras proteins, is accelerated by members of the GAP family. downstream oncogenic signaling. Currently, there are 14 recognized RasGAP genes in the human Consequently, loss of function of RasGAPs leads to aberrant Ras activation and increases downstream genome; they all contain a GAP domain, but share limited similarity outside this region [11,12]. A set oncogenic signaling. Currently, there are 14 recognized RasGAP genes in the human genome; they all of additional modules is common in RasGAPs, such as Ca2+-binding domains (C2) and contain a GAP domain, but share limited similarity outside this region [11,12]. A set of additional phosphatidylinositol lipid-binding motifs (pleckstrin homology (PH)). The protein architecture and modules is common in RasGAPs, such as Ca2+-binding domains (C2) and phosphatidylinositol specific domains define six RasGAP subfamilies of shared structure and function (Figure 1; for a lipid-binding motifs (pleckstrin homology (PH)). The protein architecture and specific domains define detailed description see [11] and [12]). six RasGAP subfamilies of shared structure and function (Figure1; for a detailed description see [ 11,12]). RASA1 (1047 aa) NF1 (2839 aa) RASA2 (850 aa) RASA3 (834 aa) GAP1 RASA4 (803 aa) RASAL1 (804 aa) SynGAP (1343 aa) DAB2IP (1189 aa) SynGAP RASAL2 (1139 aa) RASAL3 (1011 aa) Figure 1. Domain organization of RasGAPs (Ras GTPase-Activating Proteins). In addition to the GAPFigure domain, 1. Domain different organization RasGAP of proteins RasGAPs are (Ras characterized GTPase-Activating by a specific Proteins). array ofIn functionaladdition to domains, the GAP orchestratingdomain, different their subcellularRasGAP proteins localization are characterize and regulationd by (SH2 a specific= Src homology array of 2functional domain; SH3 domains,= Src homologyorchestrating 3 domain; their subcellular PH = plekstrin localization homology and domain; regulation C2 = (SH2calcium-dependent = Src homology phospholipid-binding 2 domain; SH3 = Src motif;homology CSR = 3Cys domain;/Ser-rich PH region; = plekstrin SEC14 = homologyCRAL-TRIO do lipid-bindingmain; C2 = domain;calcium-dependent CTD = C-terminal phospholipid- domain; Zbinding= Btk-type motif; zinc CSR finger = Cys/Ser-rich motif; PER =region;period-like SEC14 domain; = CRAL-TRIO PR = proline-rich lipid-binding region). domain; Representative CTD = C- proteinsterminal are domain; drawn Z based
Load more

Recommended publications
  • Wt1) – an Effector in Leukemogenesis?
    WILMS’ TUMOUR GENE 1 PROTEIN (WT1) – AN EFFECTOR IN LEUKEMOGENESIS? Vidovic, Karina 2010 Link to publication Citation for published version (APA): Vidovic, K. (2010). WILMS’ TUMOUR GENE 1 PROTEIN (WT1) – AN EFFECTOR IN LEUKEMOGENESIS?. Lund University: Faculty of Medicine. Total number of authors: 1 General rights Unless other specific re-use rights are stated the following general rights apply: Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal Read more about Creative commons licenses: https://creativecommons.org/licenses/ Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. LUND UNIVERSITY PO Box 117 221 00 Lund +46 46-222 00 00 Download date: 07. Oct. 2021 Division of Hematology and Transfusion Medicine Lund University, Lund, Sweden WILMS’ TUMOUR GENE 1 PROTEIN (WT1) – AN EFFECTOR IN LEUKEMOGENESIS? Karina Vidovic Thesis 2010 Contact adress Karina Vidovic Division of Hematology and Transfusion Medicine BMC, C14 Klinikgatan 28 SE- 221 84 Lund Sweden Phone +46 46 222 07 30 e-mail: [email protected] ISBN 978-91-86443-99-3 ! Karina Vidovic Printed by Media-Tryck, Lund, Sweden 2 ”The journey of a thousand miles begins with one step” Lao Tzu (Chinese taoist), 600-531 BC 3 4 LIST OF PAPERS This thesis is based on the following papers, referred to in the text by their Roman numerals I.
    [Show full text]
  • Crystal Structure of a Small G Protein in Complex with the Gtpase
    letters to nature of apolipoproteins2,12–14. However, our results show that the residues lipoprotein metabolism involving cell surface heparan sulfate proteoglycans. J. Biol. Chem. 269, 2764– 2+ 2772 (1994). in the conserved acidic motif of LR5 are buried to participate in Ca 16. Innerarity, T. L., Pitas, R. E. & Mahley, R. W. Binding of arginine-rich (E) apoprotein after coordination, instead of being exposed on the surface of the domain recombination with phospholipid vesicles to the low density lipoprotein receptors of fibroblasts. J. Biol. Chem. 254, 4186–4190 (1979). (Fig. 4a). Although lipoprotein uptake by members of the LDLR 17. Otwinowski, Z. & Minor, W. Data Collection and Processing (eds Sawyer, L., Isaacs, N. & Bailey, S.) family may involve an electrostatic component, perhaps through 556–562 (SERC Daresbury Laboratory, Warrington, UK, 1993). association of the lipoproteins with cell-surface proteoglycans15, the 18. CCP4. The SERC (UK) Collaborative Computing Project No. 4 A Suite of Programs for Protein Crystallography (SERC Daresbury Laboratory, Warrington, UK, 1979). LR5 structure demonstrates that the primary role for the conserved 19. Cowtan, K. D. Joint CCP4 and ESF-EACBM Newsletter on Protein Crystallography 31, 34–38 (1994). acidic residues in LDL-A modules is structural. It has been noted 20. Jones, T. A., Zou, J. Y., Cowan, S. W. & Kjeldgaard, M. Improved methods for binding protein models in electron density maps and the location of errors in these models. Acta Crystallogr. A 47, 110–119 previously that only lipid-associated apolipoproteins bind with (1991). 16 high affinity to the LDLR ; the LR5 structure suggests an alternative 21.
    [Show full text]
  • Ras Gtpase Chemi ELISA Kit Catalog No
    Ras GTPase Chemi ELISA Kit Catalog No. 52097 (Version B3) Active Motif North America 1914 Palomar Oaks Way, Suite 150 Carlsbad, California 92008, USA Toll free: 877 222 9543 Telephone: 760 431 1263 Fax: 760 431 1351 Active Motif Europe Waterloo Atrium Drève Richelle 167 – boîte 4 BE-1410 Waterloo, Belgium UK Free Phone: 0800 169 31 47 France Free Phone: 0800 90 99 79 Germany Free Phone: 0800 181 99 10 Telephone: +32 (0)2 653 0001 Fax: +32 (0)2 653 0050 Active Motif Japan Azuma Bldg, 7th Floor 2-21 Ageba-Cho, Shinjuku-Ku Tokyo, 162-0824, Japan Telephone: +81 3 5225 3638 Fax: +81 3 5261 8733 Active Motif China 787 Kangqiao Road Building 10, Suite 202, Pudong District Shanghai, 201315, China Telephone: (86)-21-20926090 Hotline: 400-018-8123 Copyright 2021 Active Motif, Inc. www.activemotif.com Information in this manual is subject to change without notice and does not constitute a commit- ment on the part of Active Motif, Inc. It is supplied on an “as is” basis without any warranty of any kind, either explicit or implied. Information may be changed or updated in this manual at any time. This documentation may not be copied, transferred, reproduced, disclosed, or duplicated, in whole or in part, without the prior written consent of Active Motif, Inc. This documentation is proprietary information and protected by the copyright laws of the United States and interna- tional treaties. The manufacturer of this documentation is Active Motif, Inc. © 2021 Active Motif, Inc., 1914 Palomar Oaks Way, Suite 150; Carlsbad, CA 92008.
    [Show full text]
  • Wnt/Β-Catenin Signaling Pathway Induces Autophagy
    Yun et al. Cell Death and Disease (2020) 11:771 https://doi.org/10.1038/s41419-020-02988-8 Cell Death & Disease ARTICLE Open Access Wnt/β-catenin signaling pathway induces autophagy-mediated temozolomide-resistance in human glioblastoma Eun-Jin Yun 1,SangwooKim2,Jer-TsongHsieh3,4 and Seung Tae Baek 5,6 Abstract Temozolomide (TMZ) is widely used for treating glioblastoma multiforme (GBM), however, the treatment of such brain tumors remains a challenge due to the development of resistance. Increasing studies have found that TMZ treatment could induce autophagy that may link to therapeutic resistance in GBM, but, the precise mechanisms are not fully understood. Understanding the molecular mechanisms underlying the response of GBM to chemotherapy is paramount for developing improved cancer therapeutics. In this study, we demonstrated that the loss of DOC-2/DAB2 interacting protein (DAB2IP) is responsible for TMZ-resistance in GBM through ATG9B. DAB2IP sensitized GBM to TMZ and suppressed TMZ-induced autophagy by negatively regulating ATG9B expression. A higher level of ATG9B expression was associated with GBM compared to low-grade glioma. The knockdown of ATG9B expression in GBM cells suppressed TMZ-induced autophagy as well as TMZ-resistance. Furthermore, we showed that DAB2IP negatively regulated ATG9B expression by blocking the Wnt/β-catenin pathway. To enhance the benefit of TMZ and avoid therapeutic resistance, effective combination strategies were tested using a small molecule inhibitor blocking the Wnt/ β-catenin pathway in addition to TMZ. The combination treatment synergistically enhanced the efficacy of TMZ in GBM cells. In conclusion, the present study identified the mechanisms of TMZ-resistance of GBM mediated by DAB2IP 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; and ATG9B which provides insight into a potential strategy to overcome TMZ chemo-resistance.
    [Show full text]
  • Rabbit Anti-DAB2IP Rabbit Anti-DAB2IP
    Qty: 100 μg/400 μL Rabbit anti-DAB2IP Catalog No. 487300 Lot No. Rabbit anti-DAB2IP FORM This polyclonal antibody is supplied as a 400 µL aliquot at a concentration of 0.25 mg/mL in phosphate buffered saline (pH 7.4) containing 0.1% sodium azide. This antibody is epitope-affinity purified from rabbit antiserum. PAD: ZMD.689 IMMUNOGEN Synthetic peptide derived from the C-terminal region of the human DAB2IP protein (Accession# NP_619723), which is identical to mouse and rat sequence. SPECIFICITY This antibody is specific for the DAB2IP (DAB2 interacting protein, AIP1, DIP1/2) protein. On Western blots, it identifies the target band at ~110 kDa. REACTIVITY Reactivity has been confirmed with human DU145, SK-N-MC and rat B49 cell lysates. Based on amino acid sequence homology, reactivity with mouse is expected. Sample Western Immuno- Immuno- Blotting precipitation cytochemistry Human +++ 0 ND Mouse ND ND ND Rat +++ 0 ND (Excellent +++, Good++, Poor +, No reactivity 0, Not applicable N/A, Not Determined ND) USAGE Working concentrations for specific applications should be determined by the investigator. Appropriate concentrations will be affected by several factors, including secondary antibody affinity, antigen concentration, sensitivity of detection method, temperature and length of incubations, etc. The suitability of this antibody for applications other than those listed below has not been determined. The following concentration ranges are recommended starting points for this product. Western Blotting: 1-3 μg/mL STORAGE Store at 2-8°C for up to one month. Store at –20°C for long-term storage. Avoid repeated freezing and thawing. (cont’d) www.invitrogen.com Invitrogen Corporation • 542 Flynn Rd • Camarillo • CA 93012 • Tel: 800.955.6288 • E-mail: [email protected] PI487300 (Rev 10/08) DCC-08-1089 Important Licensing Information - These products may be covered by one or more Limited Use Label Licenses (see the Invitrogen Catalog or our website, www.invitrogen.com).
    [Show full text]
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
    [Show full text]
  • Supporting Information
    Supporting Information Edgar et al. 10.1073/pnas.1601895113 SI Methods (Actimetrics), and recordings were analyzed using LumiCycle Mice. Sample size was determined using the resource equation: Data Analysis software (Actimetrics). E (degrees of freedom in ANOVA) = (total number of exper- – Cell Cycle Analysis of Confluent Cell Monolayers. NIH 3T3, primary imental animals) (number of experimental groups), with −/− sample size adhering to the condition 10 < E < 20. For com- WT, and Bmal1 fibroblasts were sequentially transduced − − parison of MuHV-4 and HSV-1 infection in WT vs. Bmal1 / with lentiviral fluorescent ubiquitin-based cell cycle indicators mice at ZT7 (Fig. 2), the investigator did not know the genotype (FUCCI) mCherry::Cdt1 and amCyan::Geminin reporters (32). of the animals when conducting infections, bioluminescence Dual reporter-positive cells were selected by FACS (Influx Cell imaging, and quantification. For bioluminescence imaging, Sorter; BD Biosciences) and seeded onto 35-mm dishes for mice were injected intraperitoneally with endotoxin-free lucif- subsequent analysis. To confirm that expression of mCherry:: Cdt1 and amCyan::Geminin correspond to G1 (2n DNA con- erin (Promega E6552) using 2 mg total per mouse. Following < ≤ anesthesia with isofluorane, they were scanned with an IVIS tent) and S/G2 (2 n 4 DNA content) cell cycle phases, Lumina (Caliper Life Sciences), 15 min after luciferin admin- respectively, cells were stained with DNA dye DRAQ5 (abcam) and analyzed by flow cytometry (LSR-Fortessa; BD Biosci- istration. Signal intensity was quantified using Living Image ences). To examine dynamics of replicative activity under ex- software (Caliper Life Sciences), obtaining maximum radiance perimental confluent conditions, synchronized FUCCI reporter for designated regions of interest (photons per second per − − − monolayers were observed by time-lapse live cell imaging over square centimeter per Steradian: photons·s 1·cm 2·sr 1), relative 3 d (Nikon Eclipse Ti-E inverted epifluorescent microscope).
    [Show full text]
  • Snotarget Shows That Human Orphan Snorna Targets Locate Close to Alternative Splice Junctions
    Available online at www.sciencedirect.com Gene 408 (2008) 172–179 www.elsevier.com/locate/gene snoTARGET shows that human orphan snoRNA targets locate close to alternative splice junctions Peter S. Bazeley a, Valery Shepelev b, Zohreh Talebizadeh c, Merlin G. Butler c, Larisa Fedorova d, ⁎ Vadim Filatov e, Alexei Fedorov a,d, a Program in Bioinformatics and Proteomics/Genomics, University of Toledo Health Science Campus, Toledo, OH 43614, USA b Department of Bioinformatics, Institute of Molecular Genetics, RAS, Moscow 123182, Russia c Section of Medical Genetics and Molecular Medicine, Children's Mercy Hospitals and Clinics and University of Missouri, Kansas City School of Medicine, Kansas City, MO, USA d Department of Medicine, University of Toledo Health Science Campus, Toledo, OH 43614, USA e Dinom LLC, 8/44 Pedagogicheskaya st., Moscow 115404, Russia Received 31 July 2007; received in revised form 19 October 2007; accepted 24 October 2007 Available online 21 November 2007 Received by Takashi Gojobori Abstract Among thousands of non-protein-coding RNAs which have been found in humans, a significant group represents snoRNA molecules that guide other types of RNAs to specific chemical modifications, cleavages, or proper folding. Yet, hundreds of mammalian snoRNAs have unknown function and are referred to as “orphan” molecules. In 2006, for the first time, it was shown that a particular orphan snoRNA (HBII-52) plays an important role in the regulation of alternative splicing of the serotonin receptor gene in humans and other mammals. In order to facilitate the investigation of possible involvement of snoRNAs in the regulation of pre-mRNA processing, we developed a new computational web resource, snoTARGET, which searches for possible guiding sites for snoRNAs among the entire set of human and rodent exonic and intronic sequences.
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • Disabled Homolog 2 Interactive Protein Functions As a Tumor Suppressor in Osteosarcoma Cells
    ONCOLOGY LETTERS 16: 703-712, 2018 Disabled homolog 2 interactive protein functions as a tumor suppressor in osteosarcoma cells JIANAN HE1,5, SHUAI HUANG2, ZHENHUA LIN3, JIQIN ZHANG4, JIALIN SU4, WEIDONG JI4 and XINGMO LIU1 1Department of Orthopaedic Surgery, The Sixth Affiliated Hospital of Sun Yat‑sun University, Guangzhou, Guangdong 510655; 2Department of Orthopaedic Surgery, The First Affiliated Hospital of Sun Yat‑sen University, Guangzhou, Guangdong 510080; 3Department of Orthopaedic Surgery, The People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, Guangxi 530021; 4Center for Translational Medicine, The First Affiliated Hospital of Sun Yat‑sen University, Guangzhou, Guangdong 510080; 5Department of Interventional Radiology, The Fifth Affiliated Hospital of Sun Yat-sun University, Zhuhai, Guangdong 519000, P.R. China Received April 2, 2016; Accepted June 16, 2017 DOI: 10.3892/ol.2018.8776 Abstract. The disabled homolog 2 interactive protein osteosarcoma will develop distant metastasis (2). Owing to the (DAB2IP) gene is a member of the family of Ras GTPases development of multidisciplinary therapy, the mortality rate and functions as a tumor suppressor in many types of carci- for patients with osteosarcoma has been decreasing in recent noma; however, its function in osteosarcoma remains unclear. years. Nevertheless, patients continue to exhibit a high risk The aim of the present study was to determine the function of of metastasis and/or recurrence (1,2). Previous studies have DAB2IP in osteosarcoma and normal bone cells in vitro. The indicated that several genetic aberrations are associated with expression of DAB2IP protein was assessed in osteoblast and tumor initiation and osteosarcoma progression (3,4). Thus, osteosarcoma cell lines by western blot analysis.
    [Show full text]
  • (NF1) Defects Are Common in Human Ovarian Serous Carcinomas and Co-Occur with TP53 Mutations
    Volume 10 Number 12 December 2008 pp. 1362–1372 1362 www.neoplasia.com Neurofibromin 1 (NF1) Defects Navneet Sangha*, Rong Wu*, Rork Kuick†, Scott Powers‡, David Mu§, Diane Fiander*, Are Common in Human Ovarian Kit Yuen*, Hidetaka Katabuchi¶, Hironori Tashiro¶, Serous Carcinomas and Co-occur Eric R. Fearon*,†,# and Kathleen R. Cho*,†,# 1,2 with TP53 Mutations *Department of Pathology, The University of Michigan Medical School, Ann Arbor, MI 48109, USA; †The Comprehensive Cancer Center, The University of Michigan Medical School, Ann Arbor, MI 48109, USA; ‡Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA; §Department of Pathology, Penn State University College of Medicine, Hershey, PA 17033, USA; ¶Department of Gynecology, Kumamoto University, Kumamoto, 860-8556, Japan; #Department of Internal Medicine, The University of Michigan Medical School, Ann Arbor, MI 48109, USA Abstract Ovarian serous carcinoma (OSC) is the most common and lethal histologic type of ovarian epithelial malignancy. Mutations of TP53 and dysfunction of the Brca1 and/or Brca2 tumor-suppressor proteins have been implicated in the molecular pathogenesis of a large fraction of OSCs, but frequent somatic mutations in other well-established tumor-suppressor genes have not been identified. Using a genome-wide screen of DNA copy number alterations in 36 primary OSCs, we identified two tumors with apparent homozygous deletions of the NF1 gene. Subsequently, 18 ovarian carcinoma–derived cell lines and 41 primary OSCs were evaluated for NF1 alterations. Markedly re- duced or absent expression of Nf1 protein was observed in 6 of the 18 cell lines, and using the protein truncation test and sequencing of cDNA and genomic DNA, NF1 mutations resulting in deletion of exons and/or aberrant splicing of NF1 transcripts were detected in 5 of the 6 cell lines with loss of NF1 expression.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]