DOCSLIB.ORG

In Stock Protein

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
In Stock Protein In Stock Protein Uniprot Target Product Name Code Species Source Purity Tag Info ID Recombinant Enterobacteria phage T7 Single- >90% (SDS- 2.5 CSB-YP366021EEB P03696 Enterobacteria phage T7 Yeast Tag-Free stranded DNA-binding protein gp2.5 (2.5) PAGE) Recombinant Hypocrea rufa Endo-beta-1,6- >90% (SDS- 6GAL CSB-YP762323THZ Q76FP5 Hypocrea rufa Yeast N-terminal 6xHis-tagged galactanase(6GAL) PAGE) Recombinant Hypocrea rufa Endo-beta-1,6- >85% (SDS- 6GAL CSB-EP762323THZ Q76FP5 Hypocrea rufa E.coli N-terminal 10xHis-tagged galactanase(6GAL) PAGE) Recombinant Variola virus 14 kDa fusion >85% (SDS- A27L CSB-BP335866VAR P33816 Variola virus Baculovirus N-terminal 10xHis-tagged protein(A27L) PAGE) Recombinant Vaccinia virus 14 kDa fusion >85% (SDS- N-terminal 10xHis-tagged and A27L CSB-BP324948VAA P20535 Vaccinia virus Baculovirus protein(A27L) PAGE) C-terminal Myc-tagged Recombinant Vaccinia virus Protein >85% (SDS- N-terminal 10xHis-tagged and A33R CSB-EP300755VAA1 P68616 Vaccinia virus E.coli A33(A33R),partial PAGE) C-terminal Myc-tagged Salmonella enterica subsp. Recombinant Salmonella enterica OmpA family >90% (SDS- N-terminal 10xHis-tagged and A673_03341 CSB-MP028238SBG S4JJH7 enterica serovar Enteritidis Mammalian cell protein(A673_03341),partial PAGE) C-terminal Myc-tagged str. 2009K0958 Recombinant Actinoplanes utahensis Aculeacin-A >90% (SDS- N-terminal 6xHis-SUMO- aac CSB-EP333489ACY P29958 Actinoplanes utahensis E.coli acylase(aac) ,partial PAGE) tagged N-terminal 10xHis-SUMO- Recombinant Human Arylacetamide >90% (SDS- AADAC CSB-EP001014HU P22760 Human E.coli tagged and C-terminal Myc- deacetylase(AADAC),partial PAGE) tagged Uniprot Target Product Name Code Species Source Purity Tag Info ID Recombinant Human Serotonin N- >85% (SDS- AANAT CSB-EP623090HU Q16613 Human E.coli N-terminal 10xHis-GST-tagged acetyltransferase(AANAT) PAGE) N-terminal 10xHis-SUMO- Recombinant Human 4-aminobutyrate >90% (SDS- ABAT CSB-EP001032HU P80404 Human E.coli tagged and C-terminal Myc- aminotransferase, mitochondrial(ABAT) PAGE) tagged Recombinant Human Multidrug resistance- >90% (SDS- ABCC1 CSB-EP001056HU P33527 Human E.coli N-terminal 6xHis-tagged associated protein 1 (ABCC1),partial PAGE) in vitro E.coli Recombinant Human ATP-binding cassette sub- >90% (SDS- ABCD1 CSB-CF001068HU P33897 Human expression C-terminal 10xHis-tagged family D member 1(ABCD1) PAGE) system Recombinant Human Tyrosine-protein kinase >90% (SDS- ABL1 CSB-RP043554h P00519 Human E.coli N-terminal GST-tagged ABL1(ABL1) ,partial PAGE) Recombinant Human Acetyl-CoA acetyltransferase, >85% (SDS- ACAT1 CSB-EP001134HU P24752 Human E.coli N-terminal 10xHis-tagged mitochondrial(ACAT1) PAGE) Recombinant Saccharomyces cerevisiae Acyl-CoA- >90% (SDS- ACB1 CSB-YP006519SVG P31787 S. cerevisiae Yeast N-terminal 6xHis-tagged binding protein(ACB1) PAGE) Recombinant Saccharomyces cerevisiae Acetyl- >85% (SDS- ACC1 CSB-EP2725SVG1 Q00955 S. cerevisiae E.coli N-terminal 10xHis-tagged CoA carboxylase(ACC1),partial PAGE) Recombinant Saccharomyces cerevisiae Acetyl- >85% (SDS- ACC1 CSB-EP2725SVG2 Q00955 S. cerevisiae E.coli N-terminal 10xHis-tagged CoA carboxylase(ACC1),partial PAGE) Recombinant Candida albicans Acetyl-CoA A0A1D8 >90% (SDS- ACC1 CSB-EP2727CZD Yeast E.coli N-terminal 10xHis-tagged carboxylase(ACC1),partial PRR7 PAGE) Recombinant Human ATP-citRate >90% (SDS- N-terminal 6xHis-SUMO- ACLY CSB-EP001158HU P53396 Human E.coli synthase(ACLY),partial PAGE) tagged Recombinant Escherichia coli Acyl carrier >90% (SDS- N-terminal 6xHis-SUMO- acpP CSB-EP015636ENV P0A6A8 E.coli E.coli protein(acpP) PAGE) tagged Uniprot Target Product Name Code Species Source Purity Tag Info ID Recombinant Staphylococcus aureus Acyl carrier >90% (SDS- N-terminal 6xHis-SUMO- acpP CSB-EP015636SKX P0A001 Staphylococcus aureus E.coli protein(acpP) PAGE) tagged Recombinant Staphylococcus aureus Acyl carrier pr >90% (SDS- acpP CSB-EP015636SKXe0 P0A001 Staphylococcus aureus E.coli N-terminal GST-tagged otein(acpP) PAGE) Recombinant Staphylococcus aureus Acyl carrier >90% (SDS- acpP CSB-YP015636SKX P0A001 Staphylococcus aureus Yeast N-terminal 6xHis-tagged protein(acpP) PAGE) Recombinant Streptococcus pyogenes serotype M28 Streptococcus pyogenes >85% (SDS- N-terminal 10xHis-tagged and acpS CSB-EP669769SBAF Q48RM7 E.coli Holo-[acyl-carrier-protein] synthase(acpS) serotype M28 PAGE) C-terminal Myc-tagged Recombinant Streptococcus pyogenes serotype M28 Streptococcus pyogenes >90% (SDS- N-terminal 10xHis-tagged and acpS CSB-BP669769SBAF Q48RM7 Baculovirus Holo-[acyl-carrier-protein] synthase(acpS) serotype M28 PAGE) C-terminal Myc-tagged >85% (SDS- N-terminal 10xHis-tagged and ACR Recombinant Meleagris gallopavo Acrosin(ACR) CSB-EP001183MQV Q2UVH8 Meleagris gallopavo E.coli PAGE) C-terminal Myc-tagged Recombinant Human Acetyl-coenzyme A >90% (SDS- ACSS1 CSB-EP882105HU Q9NUB1 Human E.coli N-terminal 6xHis-tagged synthetase 2-like, mitochondrial(ACSS1) PAGE) Recombinant Human Acetyl-coenzyme A >90% (SDS- ACSS1 CSB-YP882105HU Q9NUB1 Human Yeast N-terminal 10xHis-tagged synthetase 2-like, mitochondrial(ACSS1) PAGE) Recombinant Mouse Acetyl-coenzyme A >90% (SDS- Acss2 CSB-EP882544MO Q9QXG4 Mouse E.coli N-terminal 6xHis-tagged synthetase, Cytoplasmic domain (Acss2) PAGE) >85% (SDS- N-terminal 6xHis-tagged and C- ACT1 Recombinant Absidia glauca Actin-1(ACT1),partial CSB-EP320814AAD P10982 Absidia glauca E.coli PAGE) terminal Myc-tagged Recombinant Human Actin, cytoplasmic >90% (SDS- ACTB CSB-EP001207HU1 P60709 Human E.coli N-terminal 6xHis-tagged 1(ACTB),partial PAGE) Recombinant Cricetulus griseus Actin, cytoplasmic >85% (SDS- ACTB CSB-EP344170DXU P48975 Cricetulus griseus E.coli N-terminal 6xHis-tagged 1(ACTB) PAGE) >85% (SDS- N-terminal 10xHis-tagged and ACTB Recombinant Human Actin, cytoplasmic 1(ACTB) CSB-EP001207HU P60709 Human E.coli PAGE) C-terminal Myc-tagged Uniprot Target Product Name Code Species Source Purity Tag Info ID >85% (SDS- N-terminal 6xHis-tagged and C- ACTL8 Recombinant Human Actin-like protein 8(ACTL8) CSB-EP887982HUa1 Q9H568 Human E.coli PAGE) terminal Myc-tagged >85% (SDS- N terminal 10xHis-tagged and ACTL8 Recombinant Human Actin-like protein 8(ACTL8) CSB-EP887982HU Q9H568 Human E.coli PAGE) C-terminal Myc-tagged Recombinant Mouse Disintegrin and >90% (SDS- N-terminal 10xHis-tagged and Adam12 metalloproteinase domain-containing protein CSB-BP720263MO Q61824 Mouse Baculovirus PAGE) C-terminal Myc-tagged 12(Adam12), partial Recombinant Human Alcohol dehydrogenase >90% (SDS- N-terminal 6xHis-SUMO- ADH1B CSB-EP001354HU P00325 Human E.coli 1B(ADH1B) PAGE) tagged Recombinant Arabidopsis thaliana Alcohol >90% (SDS- ADH2 CSB-EP842610DOA Q96533 A. thaliana E.coli N-terminal 6xHis-tagged dehydrogenase class-3(ADH2) PAGE) >90% (SDS- ADIPOQ Recombinant Bovine Adiponectin(ADIPOQ) CSB-YP661101BO Q3Y5Z3 Bovine Yeast N-terminal 6xHis-tagged PAGE) >85% (SDS- Adipoq Recombinant Mouse Adiponectin(Adipoq) CSB-EP723362MO Q60994 Mouse E.coli N-terminal 6xHis-tagged PAGE) N-terminal 10xHis-SUMO- Recombinant Shigella flexneri Adenylate >90% (SDS- adk CSB-EP769467SZB Q83M40 Shigella flexneri E.coli tagged and C-terminal Myc- kinase(adk) PAGE) tagged in vitro E.coli Recombinant Human Androgen-dependent TFPI- >90% (SDS- N-terminal 10xHis-tagged and ADTRP CSB-CF846640HUb1 Q96IZ2 Human expression regulating protein(ADTRP) PAGE) C-terminal Myc-tagged system Recombinant Mouse Adipocyte enhancer-binding >90% (SDS- N-terminal 6xHis-SUMO- Aebp1 CSB-EP723715MO Q640N1 Mouse E.coli protein 1(Aebp1) ,partial PAGE) tagged >90% (SDS- Afp Recombinant Mouse Alpha-fetoprotein(Afp) CSB-EP001421MOe1 P02772 Mouse E.coli Tag-Free PAGE) Uniprot Target Product Name Code Species Source Purity Tag Info ID >90% (SDS- afp Recombinant Antifungal protein(afp) CSB-EP325933APN P17737 Aspergillus giganteus E.coli N-terminal 6xHis-B2M-tagged PAGE) >90% (SDS- Afp Recombinant Mouse Alpha-fetoprotein(Afp) CSB-EP001421MO P02772 Mouse E.coli N-terminal 6xHis-tagged PAGE) Recombinant Raphanus sativus Defensin-like >90% (SDS- N-terminal 6xHis-SUMO- AFP2 CSB-EP339081RJP P30230 Raphanus sativus E.coli protein 2(AFP2) PAGE) tagged Recombinant Aspergillus niger Probable alpha- >90% (SDS- aglB CSB-YP381525AVE A2QEJ9 Aspergillus niger Yeast N-terminal 6xHis-tagged galactosidase B(aglB) PAGE) Recombinant Schizosaccharomyces pombe Glucan >85% (SDS- N-terminal 10xHis-tagged and agn1 CSB-EP522580SXVb1 O13716 Schizosaccharomyces pombe E.coli endo-1,3-alpha-glucosidase agn1(agn1) PAGE) C-terminal Myc-tagged in vitro E.coli N-terminal 10xHis-SUMO- Recombinant Human Type-1 angiotensin II >85% (SDS- AGTRAP CSB-CF744194HU Q6RW13 Human expression tagged and C-terminal Myc- receptor-associated protein(AGTRAP) PAGE) system tagged Recombinant Mouse Allograft inflammatory factor >90% (SDS- Aif1 CSB-EP001490MO O70200 Mouse E.coli N-terminal 6xHis-tagged 1(Aif1) PAGE) Recombinant Yersinia enterocolitica Attachment >90% (SDS- N-terminal 6xHis-SUMO- ail CSB-EP322286YAQ P16454 Yersinia enterocolitica E.coli invasion locus protein(ail) PAGE) tagged Recombinant Penaeus monodon Arginine >90% (SDS- N-terminal 6xHis-SUMO- AK CSB-EP511311ETF C7E3T4 Penaeus monodon E.coli kinase(AK) PAGE) tagged Recombinant Human GTP:AMP >90% (SDS- N-terminal 10xHis-tagged and AK3 CSB-EP883438HU Q9UIJ7 Human E.coli phosphotransferase, mitochondrial(AK3) PAGE) C-terminal Myc-tagged Recombinant Human Aldo-keto reductase family 1 >90% (SDS- N-terminal 6xHis-SUMO- AKR1C2 CSB-EP001543HU P52895 Human E.coli member C2(AKR1C2) PAGE) tagged Recombinant Mouse 5-aminolevulinate synthase, >85% (SDS- N-terminal 10xHis-tagged
Load more

Recommended publications
  • Genetic Analysis of Retinopathy in Type 1 Diabetes
    Genetic Analysis of Retinopathy in Type 1 Diabetes by Sayed Mohsen Hosseini A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Medical Science University of Toronto © Copyright by S. Mohsen Hosseini 2014 Genetic Analysis of Retinopathy in Type 1 Diabetes Sayed Mohsen Hosseini Doctor of Philosophy Institute of Medical Science University of Toronto 2014 Abstract Diabetic retinopathy (DR) is a leading cause of blindness worldwide. Several lines of evidence suggest a genetic contribution to the risk of DR; however, no genetic variant has shown convincing association with DR in genome-wide association studies (GWAS). To identify common polymorphisms associated with DR, meta-GWAS were performed in three type 1 diabetes cohorts of White subjects: Diabetes Complications and Control Trial (DCCT, n=1304), Wisconsin Epidemiologic Study of Diabetic Retinopathy (WESDR, n=603) and Renin-Angiotensin System Study (RASS, n=239). Severe (SDR) and mild (MDR) retinopathy outcomes were defined based on repeated fundus photographs in each study graded for retinopathy severity on the Early Treatment Diabetic Retinopathy Study (ETDRS) scale. Multivariable models accounted for glycemia (measured by A1C), diabetes duration and other relevant covariates in the association analyses of additive genotypes with SDR and MDR. Fixed-effects meta- analysis was used to combine the results of GWAS performed separately in WESDR, ii RASS and subgroups of DCCT, defined by cohort and treatment group. Top association signals were prioritized for replication, based on previous supporting knowledge from the literature, followed by replication in three independent white T1D studies: Genesis-GeneDiab (n=502), Steno (n=936) and FinnDiane (n=2194).
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Mouse CELA3B ORF Mammalian Expression Plasmid, C-His Tag
    Mouse CELA3B ORF mammalian expression plasmid, C-His tag Catalog Number: MG53134-CH General Information Plasmid Resuspension protocol Gene : chymotrypsin-like elastase family, 1. Centrifuge at 5,000×g for 5 min. member 3B 2. Carefully open the tube and add 100 l of sterile water to Official Symbol : CELA3B dissolve the DNA. Synonym : Ela3; Ela3b; AI504000; 0910001F22Rik; 2310074F01Rik 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 810bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_026419.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-C-His Shipping carrier : The plasmid is ready for: Each tube contains approximately 10 μg of lyophilized plasmid. • Restriction enzyme digestion Storage : • PCR amplification The lyophilized plasmid can be stored at ambient temperature for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F： 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R ： 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 ： 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH ： 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS.
    [Show full text]
  • Longitudinal Peripheral Blood Transcriptional Analysis of COVID-19 Patients
    medRxiv preprint doi: https://doi.org/10.1101/2020.05.05.20091355; this version posted May 8, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. 1 Longitudinal peripheral blood transcriptional analysis of COVID-19 patients 2 captures disease progression and reveals potential biomarkers 3 Qihong Yan1,5,†, Pingchao Li1,†, Xianmiao Ye1,†, Xiaohan Huang1,5,†, Xiaoneng Mo2, 4 Qian Wang1, Yudi Zhang1, Kun Luo1, Zhaoming Chen1, Jia Luo1, Xuefeng Niu3, Ying 5 Feng3, Tianxing Ji3, Bo Feng3, Jinlin Wang2, Feng Li2, Fuchun Zhang2, Fang Li2, 6 Jianhua Wang1, Liqiang Feng1, Zhilong Chen4,*, Chunliang Lei2,*, Linbing Qu1,*, Ling 7 Chen1,2,3,4,* 8 1Guangzhou Regenerative Medicine and Health-Guangdong Laboratory 9 (GRMH-GDL), Guangdong Laboratory of Computational Biomedicine, Guangzhou 10 Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, 11 China 12 2Guangzhou Institute of Infectious Disease, Guangzhou Eighth People’s Hospital, 13 Guangzhou Medical University, Guangzhou, China 14 3State Key Laboratory of Respiratory Disease, National Clinical Research Center for 15 Respiratory Disease, Guangzhou Institute of Respiratory Health, the First Affiliated 16 Hospital of Guangzhou Medical University, Guangzhou, China 17 4School of Medicine, Huaqiao University, Xiamen, China 18 5University of Chinese Academy of Science, Beijing, China 19 †These authors contributed equally to this work. 20 *To whom correspondence should be addressed: Ling Chen ([email protected]), 21 Linbing Qu ([email protected]), Chunliang Lei ([email protected]), Zhilong 22 Chen ([email protected]) NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.
    [Show full text]
  • Phytic Acid (Phytate)/ Total Phosphorus
    www.megazyme.com PHYTIC ACID (PHYTATE)/ TOTAL PHOSPHORUS Measured as phosphorus released by phytase and alkaline phosphatase ASSAY PROCEDURE K-PHYT 05/19 (50 Assays per Kit) © Megazyme 2019 INTRODUCTION: Phytic acid (phytate; myo-inositol 1,2,3,4,5,6-hexakisphosphate) is the primary source of inositol and storage phosphorus in plant seeds contributing ~ 70% of total phosphorus. The abundance of phytic acid in cereal grains is a concern in the foods and animal feeds industries because the phosphorus in this form is unavailable to monogastric animals due to a lack of endogenous phytases; enzymes specific for the dephosphorylation of phytic acid. In addition, the strong chelating characteristic of phytic acid reduces the bioavailability of other essential dietary nutrients such as minerals (e.g. Ca2+, Zn2+, Mg2+, Mn2+, Fe2+/3+), proteins and amino acids.2 High phytic acid content feeds are generally supplemented with inorganic phosphate, however this causes increased faecal phosphate levels and subsequent eutrophication of waterways. Alternatively, supplementation with commercial phytases is becoming increasingly popular and reduces the requirement for inorganic phosphate supplementation as well as the associated environmental issues. Currently, there is no commercially available, simple, quantitative method for phytic acid and, while such measurement is relatively complex, the generally accepted AOAC Method 986.11 has limitations.3 For each individual analysis the method requires cumbersome anion-exchange purification and a major inherent assumption here is that only phytic acid is purified. While this assumption is viable for non-processed grains for which phytic acid comprises at least 97% of total inositol phosphates, it is not viable for processed foods and feeds which can contain higher levels of some lower myo-inositol phosphate forms (i.e.
    [Show full text]
  • Gene Standard Deviation MTOR 0.12553731 PRPF38A
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Gut Gene Standard Deviation MTOR 0.12553731 PRPF38A 0.141472605 EIF2B4 0.154700091 DDX50 0.156333027 SMC3 0.161420017 NFAT5 0.166316903 MAP2K1 0.166585267 KDM1A 0.16904912 RPS6KB1 0.170330192 FCF1 0.170391706 MAP3K7 0.170660513 EIF4E2 0.171572093 TCEB1 0.175363093 CNOT10 0.178975095 SMAD1 0.179164705 NAA15 0.179904998 SETD2 0.180182498 HDAC3 0.183971158 AMMECR1L 0.184195031 CHD4 0.186678211 SF3A3 0.186697697 CNOT4 0.189434633 MTMR14 0.189734199 SMAD4 0.192451524 TLK2 0.192702667 DLG1 0.19336621 COG7 0.193422331 SP1 0.194364189 PPP3R1 0.196430217 ERBB2IP 0.201473001 RAF1 0.206887192 CUL1 0.207514271 VEZF1 0.207579584 SMAD3 0.208159809 TFDP1 0.208834504 VAV2 0.210269344 ADAM17 0.210687138 SMURF2 0.211437666 MRPS5 0.212428684 TMUB2 0.212560675 SRPK2 0.216217428 MAP2K4 0.216345366 VHL 0.219735582 SMURF1 0.221242495 PLCG1 0.221688351 EP300 0.221792349 Sundar R, et al. Gut 2020;0:1–10. doi: 10.1136/gutjnl-2020-320805 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Gut MGAT5 0.222050228 CDC42 0.2230598 DICER1 0.225358787 RBX1 0.228272533 ZFYVE16 0.22831803 PTEN 0.228595789 PDCD10 0.228799406 NF2 0.23091035 TP53 0.232683696 RB1 0.232729172 TCF20 0.2346075 PPP2CB 0.235117302 AGK 0.235416298
    [Show full text]
  • Effect of Ph and Temperature on the Activity of Phytase Products Used In
    Brazilian Journal of Poultry Science Revista Brasileira de Ciência Avícola Effect of ph and Temperature on the Activity of ISSN 1516-635X Jul - Sept 2012/ v.14 / n.3 / 159-232 Phytase Products Used in Broiler Nutrition Author(s) ABSTRACT Naves L de P1 Corrêa AD2 The activity of three commercial microbial phytase (Aspergillus Bertechini AG3 oryzae, A. niger, and Saccharomyces cerevisae) products used in broiler Gomide EM4 Santos CD dos2 nutrition was determined at different pH (2.0 to 9.0) and temperature (20 to 90°C) values. Enzymatic activity was determined according to the reaction of the phytase with its substrate (sodium phytate), in four replicates, and was expressed in units of phytase activity (FTU). A. oryzae phytase exhibited optimal activity at pH 4.0 and 40°C, but 1Graduate student in Monogastric Nutrition of its absolute activity was the lowest of the three phytases evaluated. the Animal Science Department − Federal A. niger phytase exhibited maximal activity close to pH 5.0 and 45oC, University of Lavras (UFLA). whereas S. cerevisae phytase presented its highest activity at pH close to 2Professor of the Chemistry Department/ UFLA. 4.5 and temperatures ranging between 50 and 60°C. It was concluded 3Professor of the Animal Science Department/ that A. niger and S. cerevisae phytase products exhibited the highest UFLA. absolute activities in vitro at pH and temperature values (pH lower than 4Ph. D. student in Monogastric Nutrition of o the Animal Science Department/UFLA. 5.0 and 41 C) corresponding to the ideal physiological conditions of broilers, which would theoretically allow high hydrolysis rate of the phytate contained in the feed.
    [Show full text]
  • Peraturan Badan Pengawas Obat Dan Makanan Nomor 28 Tahun 2019 Tentang Bahan Penolong Dalam Pengolahan Pangan
    BADAN PENGAWAS OBAT DAN MAKANAN REPUBLIK INDONESIA PERATURAN BADAN PENGAWAS OBAT DAN MAKANAN NOMOR 28 TAHUN 2019 TENTANG BAHAN PENOLONG DALAM PENGOLAHAN PANGAN DENGAN RAHMAT TUHAN YANG MAHA ESA KEPALA BADAN PENGAWAS OBAT DAN MAKANAN, Menimbang : a. bahwa masyarakat perlu dilindungi dari penggunaan bahan penolong yang tidak memenuhi persyaratan kesehatan; b. bahwa pengaturan terhadap Bahan Penolong dalam Peraturan Kepala Badan Pengawas Obat dan Makanan Nomor 10 Tahun 2016 tentang Penggunaan Bahan Penolong Golongan Enzim dan Golongan Penjerap Enzim dalam Pengolahan Pangan dan Peraturan Kepala Badan Pengawas Obat dan Makanan Nomor 7 Tahun 2015 tentang Penggunaan Amonium Sulfat sebagai Bahan Penolong dalam Proses Pengolahan Nata de Coco sudah tidak sesuai dengan kebutuhan hukum serta perkembangan ilmu pengetahuan dan teknologi sehingga perlu diganti; c. bahwa berdasarkan pertimbangan sebagaimana dimaksud dalam huruf a dan huruf b, perlu menetapkan Peraturan Badan Pengawas Obat dan Makanan tentang Bahan Penolong dalam Pengolahan Pangan; -2- Mengingat : 1. Undang-Undang Nomor 18 Tahun 2012 tentang Pangan (Lembaran Negara Republik Indonesia Tahun 2012 Nomor 227, Tambahan Lembaran Negara Republik Indonesia Nomor 5360); 2. Peraturan Pemerintah Nomor 28 Tahun 2004 tentang Keamanan, Mutu dan Gizi Pangan (Lembaran Negara Republik Indonesia Tahun 2004 Nomor 107, Tambahan Lembaran Negara Republik Indonesia Nomor 4424); 3. Peraturan Presiden Nomor 80 Tahun 2017 tentang Badan Pengawas Obat dan Makanan (Lembaran Negara Republik Indonesia Tahun 2017 Nomor 180); 4. Peraturan Badan Pengawas Obat dan Makanan Nomor 12 Tahun 2018 tentang Organisasi dan Tata Kerja Unit Pelaksana Teknis di Lingkungan Badan Pengawas Obat dan Makanan (Berita Negara Republik Indonesia Tahun 2018 Nomor 784); MEMUTUSKAN: Menetapkan : PERATURAN BADAN PENGAWAS OBAT DAN MAKANAN TENTANG BAHAN PENOLONG DALAM PENGOLAHAN PANGAN.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis Et Al
    US 201500 72349A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis et al. (43) Pub. Date: Mar. 12, 2015 (54) CANCER BOMARKERS AND METHODS OF (52) U.S. Cl. USE CPC. G0IN33/57484 (2013.01); G0IN 2333/705 (2013.01) (71) Applicant: University Health Network, Toronto USPC ......................................... 435/6.12: 435/7.94 (CA) (57) ABSTRACT A method of evaluating a probability a Subject has a cancer, (72) Inventors: Eleftherios P. Diamandis, Toronto diagnosing a cancer and/or monitoring cancer progression (CA); Ioannis Prassas, Toronto (CA); comprising: a. measuring an amount of a biomarker selected Shalini Makawita, Toronto (CA); from the group consisting of CUZD1 and/or LAMC2 and/or Caitlin Chrystoja, Toronto (CA); Hari the group CUZD1, LAMC2, AQP8, CELA2B, CELA3B, M. Kosanam, Maple (CA) CTRB1, CTRB2, GCG, IAPP, INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, KLK3, NPY, (21) Appl. No.: 14/385,449 PSCA, RLN1, SLC45A3, DSP GP73, DSG2, CEACAM7, CLCA1, GPA33, LEFTY1, ZG16, IRX5, LAMP3, MFAP4, (22) PCT Fled: Mar. 15, 2013 SCGB1A1, SFTPC, TMEM100, NPY, PSCA RLN1 and/or SLC45A3 in a test sample from a subject with cancer; (86) PCT NO.: PCT/CA2O13/OOO248 wherein the cancer is pancreas cancer if CUZD1, LAMC2, S371 (c)(1), AQP8, CELA2B, CELA3B, CTRB1, CTRB2, GCG, LAPP (2) Date: Sep. 23, 2014 INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, DSP GP73 and/or DSG2 is selected; the cancer is colon cancer if CEACAM7, CLCA1, GPA33, LEFTY 1 and/ Related U.S. Application Data or ZG16 is selected, the cancer is lung cancer if IRX5, (60) Provisional application No.
    [Show full text]
  • Functional Analogy in Human Metabolism: Enzymes with Different Biological Roles Or Functional Redundancy?
    GBE Functional Analogy in Human Metabolism: Enzymes with Different Biological Roles or Functional Redundancy? Rafael Mina Piergiorge1, Antonio Basılio de Miranda2, Ana Carolina Guimaraes~ 1,*, and Marcos Catanho1 1Laboratorio de Genoˆ mica Funcional e Bioinformatica, Fiocruz, Instituto Oswaldo Cruz, Manguinhos, Rio de Janeiro, Brazil 2Laboratorio de Biologia Computacional e Sistemas, Fiocruz, Instituto Oswaldo Cruz, Manguinhos, Rio de Janeiro, Brazil *Corresponding author: E-mail: carolg@fiocruz.br. Accepted: July 4, 2017 Abstract Since enzymes catalyze almost all chemical reactions that occur in living organisms, it is crucial that genes encoding such activities are correctly identified and functionally characterized. Several studies suggest that the fraction of enzymatic activities in which multiple events of independent origin have taken place during evolution is substantial. However, this topic is still poorly explored, and a comprehensive investigation of the occurrence, distribution, and implications of these events has not been done so far. Fundamental questions, such as how analogous enzymes originate, why so many events of independent origin have apparently occurred during evolution, and what are the reasons for the coexistence in the same organism of distinct enzymatic forms catalyzing the same reaction, remain unanswered. Also, several isofunctional enzymes are still not recognized as nonhomologous, even with substantial evidence indicating different evolutionary histories. In this work, we begin to investigate the biological significance of the cooccur- rence of nonhomologous isofunctional enzymes in human metabolism, characterizing functional analogous enzymes identified in metabolic pathways annotated in the human genome. Our hypothesis is that the coexistence of multiple enzymatic forms might not be interpreted as functional redundancy. Instead, these enzymatic forms may be implicated in distinct (and probably relevant) biological roles.
    [Show full text]
  • The Transition from Primary Colorectal Cancer to Isolated Peritoneal Malignancy
    medRxiv preprint doi: https://doi.org/10.1101/2020.02.24.20027318; this version posted February 25, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . The transition from primary colorectal cancer to isolated peritoneal malignancy is associated with a hypermutant, hypermethylated state Sally Hallam1, Joanne Stockton1, Claire Bryer1, Celina Whalley1, Valerie Pestinger1, Haney Youssef1, Andrew D Beggs1 1 = Surgical Research Laboratory, Institute of Cancer & Genomic Science, University of Birmingham, B15 2TT. Correspondence to: Andrew Beggs, [email protected] KEYWORDS: Colorectal cancer, peritoneal metastasis ABBREVIATIONS: Colorectal cancer (CRC), Colorectal peritoneal metastasis (CPM), Cytoreductive surgery and heated intraperitoneal chemotherapy (CRS & HIPEC), Disease free survival (DFS), Differentially methylated regions (DMR), Overall survival (OS), TableFormalin fixed paraffin embedded (FFPE), Hepatocellular carcinoma (HCC) ARTICLE CATEGORY: Research article NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.02.24.20027318; this version posted February 25, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . NOVELTY AND IMPACT: Colorectal peritoneal metastasis (CPM) are associated with limited and variable survival despite patient selection using known prognostic factors and optimal currently available treatments.
    [Show full text]