Determined by Radiation Hybrid Mapping Synteny Between

Conservation of Mhc Class III Region Synteny Between Zebrafish and Human as Determined by Radiation Hybrid Mapping

This information is current as Holger Sültmann, Akie Sato, Brent W. Murray, Naoko of October 2, 2021. Takezaki, Robert Geisler, Gerd-Jörg Rauch and Jan Klein J Immunol 2000; 165:6984-6993; ; doi: 10.4049/jimmunol.165.12.6984 http://www.jimmunol.org/content/165/12/6984 Downloaded from

References This article cites 59 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/165/12/6984.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on October 2, 2021

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2000 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Conservation of Mhc Class III Region Synteny Between Zebraﬁsh and Human as Determined by Radiation Hybrid Mapping1

Holger Su¨ltmann,2* Akie Sato,* Brent W. Murray,* Naoko Takezaki,† Robert Geisler,‡ Gerd-Jo¨rg Rauch,‡ and Jan Klein3*

In the HLA, H2, and other mammalian Mhc, the class I and II loci are separated by the so-called class III region comprised of ϳ60 genes that are functionally and evolutionarily unrelated to the class I/II genes. To explore the origin of this island of unrelated loci in the middle of the Mhc 19 homologues of HLA class III genes, we identified 19 homologues of HLA class III genes as well as 21 additional non-class I/II HLA homologues in the zebrafish and mapped them by testing a panel of 94 zebrafish-hamster radiation hybrid cell lines. Six of the HLA class III and eight of the flanking homologues were found to be linked to the zebrafish class I (but not class II) loci in linkage group 19. The remaining homologous loci were found to be scattered over 14 zebrafish linkage groups. Downloaded from The linkage group 19 contains at least 25 genes (not counting the class I loci) that are also syntenic on human chromosome 6. This gene assembly presumably represents the pre-Mhc that existed before the class I/II genes arose. The pre-Mhc may not have contained the complement and other class III genes involved in immune response. The Journal of Immunology, 2000, 165: 6984–6993.

lthough all jawed vertebrates possess an Mhc, our views tion of peptides acquired in the endoplasmic reticulum (ER),4 and of it have been forged by two mammalian systems, the the class II molecules to the presentation of peptides procured in http://www.jimmunol.org/ A human HLA and the mouse H2 complexes (1, 2). The the endosomal compartment (5). remarkable similarity of the HLA and H2 complexes (3) has kin- However, the presence of the class III genes in the region sep- dled the expectation that the Mhc of all vertebrates would be or- arating the class I and class II parts of the complex has always been ganized in a similar way to those of the human and the mouse. For somewhat puzzling (3, 8). Most of the class III genes are neither some time, this expectation seemed to be borne out by studies of functionally nor evolutionarily related to one another. They are a other species, albeit mostly other mammals (4). Like the HLA and variegated assortment of elements that do not seem to have any the H2 complexes, the Mhcs of these other species could be shown particular reason to be together with one another or with the class to constitute a single chromosomal segment divisible, rather arbi- I and class II loci. A justiﬁcation for their presence in the vicinity by guest on October 2, 2021 trarily, into three regions, ensconced by three different classes of of class I and II loci has been sought in the involvement of some loci, the class I and class II regions taking up the ﬂanks and the of them in immunity. However, this argument always seemed class III region the center. The class I and II loci comprise the core rather weak for three reasons. First, the class III region contains of the Mhc and, with their involvement in peptide presentation (5), several loci for which there is no evidence for involvement in provide functional and evolutionary identity to the chromosomal immunity. Second, for the loci that are involved in immunity, no segment they occupy. Their organization and sequence, as well as compelling reason has been provided for their linkage to the class the structure of the molecules they encode, leave no doubt that the I and II loci. And third, with the large number of loci involved in genes in each of the two classes are related to one another by their immune responses, it is to be expected that almost any region of origin (6). Nor has there ever been any doubt expressed that the the genome will, by chance, contain some of them. class I and class II genes are derived from a common ancestor (7, The existence and composition of the class III region are not the 8). The existing differences between the genes and their products only seemingly illogical features of the HLA/H2 organization. An- are generally interpreted as being the result of an adaptation to other such feature concerns the genes participating in the produc- slightly different functions, the class I molecules to the presentation of peptides for loading onto the class I molecules. The bulk of these peptides is derived from cytosolic proteins processed by pro-

*Max-Planck-Institut fu¨r Biologie, Abteilung Immungenetik, Tu¨bingen, Germany; teasomes (5). The peptides thus produced are then transported †The Graduate University for Advanced Studies, Department of Biosystems Science, across the ER membrane and on the lumenal side loaded into the Hayama, Kanagawa, Japan; and ‡Max-Planck-Institut fu¨r Entwicklungsbiologie, Tu¨- peptide-binding groove of the newly synthesized class I molecules. bingen, Germany Some of the proteasome components, the ER transporters, and the Received for publication July 6, 2000. Accepted for publication September 12, 2000. molecules involved in the loading are encoded in genes (PSMB, The costs of publication of this article were defrayed in part by the payment of page ABCB or TAP, and TAPBP, respectively) that reside in the charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. HLA/H2 complexes. This arrangement makes sense, for one can 1 This work was supported in part by a grant from the Deutsches Humangenomprojekt argue that the genes must either coevolve with the class I genes or (to R.G. and G.-J.R.). their expression must be coordinated with that of these genes (4). 2 Address correspondence requests to Dr. Holger Su¨ltmann, Deutsches Krebsfors- The illogical aspect of this arrangement is that the PSMB, ABCB, chungszentrum, Im Neuenheimer Feld 506, D-69120 Heidelberg, Germany. E-mail address: [email protected] 3 Address reprint requests to Dr. Jan Klein, Max-Planck-Institut fu¨r Biologie, Abtei- 4 Abbreviations used in this paper: ER, endoplasmic reticulum; EST, expressed se- lung Immungenetik, Corrensstrasse 42, D-72076 Tu¨bingen, Germany. E-mail ad- quence tag; PAC, P1-derived artiﬁcial chromosome; YAC, yeast artiﬁcial dress: [email protected] chromosome.

Copyright © 2000 by The American Association of Immunologists 0022-1767/00/$02.00 The Journal of Immunology 6985 and TAPBP genes are found in the class II rather than the class I finding seems to explain one illogical aspect of the HLA/H2 orga- region. nization. The present study has been aimed at shedding light on the More recently, evidence has accumulated that the HLA/H2 par- puzzle of the class III region and so on the other seemingly illog- adigm of Mhc organization has many exceptions, even in mam- ical feature of the Mhc organization. mals. For example, in cattle, a chromosomal segment bearing a part of the class II region has been inverted so that some of the Materials and Methods class II genes are now at a distance of Ͼ17 cM from the main body PCR, subcloning, and sequencing of the Mhc (9–11). In the rabbit, to give another example, the class III region has apparently been transposed to an unidentified loca- PCR amplifications (22) were conducted in 25 or 50 ␮l of reaction mixture using the MJ Research PTC-100 Programmable Thermal Controller (MJ tion, and the class I and class II regions have become directly ϫ Research, Watertown, MA), 1 reaction buffer containing 1.5 mM MgCl2, adjacent (12). Even greater departures from the HLA/H2 norm 100 ␮M of each of the four deoxynucleosidtriphosphates, 0.5–1 ␮Mof have been found when studies of Mhc organization have been ex- each of the sense and antisense primers (Table I),1UofTaq DNA poly- tended to nonmammalian gnathostomes. Thus, in the domestic merase (Amersham Pharmacia Biotech, Freiburg, Germany) or HotStar fowl, the entire Mhc segment has been reduced in length to ϳ100 Taq DNA polymerase (Qiagen, Hilden, Germany), and 20–100 ng of tem- plate DNA. The PCR products were separated on agarose gels and purified kb and part of it translocated transcentrically (13). In Xenopus with the help of the QIAEX II kit (Qiagen). For cloning, the DNA frag- laevis, a separate Mhc region has been generated by tetraploidiza- ments were ligated to the pGEM-T vector (Promega, Mannheim, Germany) tion (14). In the zebrafish (15) and the majority of, if not all, teleost under conditions recommended by the supplier, and transformed into elec- fishes (16), the class I and class II regions are on different chro- trocompetent Escherichia coli DH10B cells (Life Technologies, Karlsruhe, mosomes, the latter apparently on more than one chromosome. Germany). The plasmid DNA was isolated from 10-ml overnight cultures

with the Qiagen Plasmid Mini kit (Qiagen) and sequenced using the Au- Downloaded from These puzzling aspects call for an explanation that can come toRead or the cycle sequencing kits (Amersham Pharmacia Biotech) with only from an understanding of Mhc evolution. The latter can be fluorescent primers annealing to the multiple cloning sites of the pGEM-T obtained from a detailed knowledge of the Mhc in lower verte- vector. The sequencing products were separated on an A.L.F. (Amersham brates. To provide such knowledge, we have embarked on a sys- Pharmacia Biotech) or the LI-COR DNA sequencer (MWG Biotech, Eber- sberg, Germany). tematic study of the zebrafish Mhc. Being a widely used model in developmental and genomic research, the zebrafish seems an ap- Phylogenetic analysis propriate choice for the stated purpose. In earlier publications, we http://www.jimmunol.org/ described the zebrafish class I (17) and class II (18) loci, and the Homologous sequences for constructing phylogenetic trees were procured by Blastx searches (23, 24) in the nonredundant parts of the GenBank/ organization of the class I region (19). We have shown that in the EMBL/DDBJ databases. For genes identified from expressed sequence tag zebrafish, the Mhc-associated PSMB, ABCB, and TAPBP genes are (EST) sequences, Blastp and Blastn searches were also conducted with the located in the class I rather than the class II region (20, 21). This nonzebrafish sequences identified as the highest match in the initial Blastx

Table I. Primers used for radiation hybrid panel typing by guest on October 2, 2021 Gene Primer Sequence (5Ј33Ј)Taa PCR Product Size (bp)

MUT TGAGAACATGGGAGGTATGGCTCG/GCGTGCTTGTCTTCGGGCAGCG 60°C 88 NFYA ATGGTTCAAGTCAGCGGCGGTC/CAGCCCCTGTGTACCAGATACC 60°C 123 RDS CAACMTTCTMATYYKKGTGGGAC/TTGTTGCCACAGCAKCGGAACTC 63°C 327 HMGIY CCACAGCAGGAGGCCAGTGGATC/CGAGACACAGTAGAGCTCGGC 60°C 90 PIM1 GGCATCGGATTTCAGACGGACA/GACCACTGTTGGATTCTGTCAC 60°C 180 BING3⌿ GAGTTCAARGAGGCSTTYAACATGAT/CCAAACATGGTNAGGAACATGGTG 63°C 458 RAB2L AGGAGCATGTTGGTCAGTCAGAG/GCTCTGCAGCGCTGAGAGGATG 60°C 330 SACM2L TTGGTGATCTGGACATCACTACAG/TCCACCTGCCTAGAGTACTGCC 60°C 300 RING1B CACACCACCCAGCAGGCGCTCAG/CTGTGCACTGATGACTTGCTGCA 58°C 400 KE4 GGTTATCTGAACCTGGCTGCTGA/TTGGTGCAGCCTGATTGGACAAG 60°C 200 DBB CATGGACATTATGGATTT/CCTTAATGACCGCACA 45°C 379 DCB GGCTATCTTCAACGTCAA/TTCAGTAACTGACCGAAT 45°C 400 PBX2 TCATTGGAGCACTCCGATTATAAAAG/GTGCGAGACTGCTCCCTCAGC 60°C 370 PPT2 GTGTTTCTGATGGACTTGTTTGG/GCCATTTTCAATGCAGGTTTTAAAC 60°C 140 STK19 GTGTTTGCTGAAGATTACAGAGCC/ATCTCAGAGTCGGAGAAGAGGAAC 60°C 160 SK12W CCCACATGGACTGCCTCCTAC/GCCGGTGGTTGGATCTCTGACC 60°C 320 BF AAGTCCGGGTTTGCCAACCTAATG/ACAGTGGTACGTGACTTCATCATC 63°C 350 (550) G9A ATCTTCGAGTGTAACATGGCCTG/AGGAATATCTTGAAGAGCTCGAAC 60°C 450 HSPA1A GACCGCAGGTGGAGTCATGACG/TGATCTTGCCTTTCAGGTTGTCG 60°C 476 SMX5 GATATCAGTGTTACTGATCCAGAG/ACTTCATCTGCAGGAAGCTGAAC 63°C 800 VARS1 ACCTAGCTGTCACTCAAGTGGC/TCGGCTCACTCAGTTTCTTCCTC 63°C 400 CLIC1 GCTCCAGAGGTATTCAAGGACCTG/TTATGAAAGATGTCATCGCCTGCC 60°C 345 BAT5 GGCCATGAGACCAATGTTACAGC/GAATGACACCTATCACACTCCAG 60°C 184 CSNK2B GACATGATCCTCGATCTGGAACC/GACAGTAGCCAAAGTCTCCCTG 60°C 550 APOM CTGTTTAACTCTAAATGGGAGATG/ACATACAGCATGATGATGCATGT 60°C 300 BAT3 AGGAGCACATTTCACCATCTGTTG/GCATCACATAGCTATTGGCGTTG 60°C 400 BAT2 TCAGACCAAGCCAATGAGGAATG/TGGCCGCTGACTTGAGAAGCTC 63°C 250 AIF1 GATGGGCTTGAAGCGAATGATGG/TTGAGAACAGCTGATCGCTTGCC 60°C 155 BAT1 ATCGCCATCCACAGAGGAATGG/CGGCATGTCGTAGTTGAAGACG 50°C 400 TUBB AGGAGGTGGACGAGCAGATGCT/ATGCAGGAAAGCCTTGCGCCTG 63°C 200 EDN1 CCAGCACGTCACTCCAGGAATAAG/AGCGTTTCAAGTCCATATGACACC 60°C 282 TCP1 TGGAAAGCCAAGGGATAACAAGC/AAACATGACAGACAGCCATGCTAA 58°C 320 ACAT2 AGTCTGTGTGCCTTGGTGCTC/CAGTCAGTGGCATCTCACCTAT 58°C 600

a Ta, Annealing temperature. 6986 EVOLUTION OF Mhc CLASS III REGION search. Alignments of amino acid sequences were generated by CLUST- and sequenced to establish their identity. Second, amino acid se- ALW (25), and phylogenetic trees were constructed by the neighbor-join- quences of proteins encoded in HLA and linked genes were used to ing method (26) with Poisson-corrected distances; significance of branch- conduct tBlastn searches (36) of the EST database (http://www. ing patterns was assessed by 1000 bootstrap replications (27). ncbi.nlm.nih.gov/blast/). If fish homologues identified by a high Linkage analysis by PCR on zebrafish radiation hybrid panels score were found, the identified ESTs were compared with the Two zebrafish radiation hybrid panels constructed by Kwok et al. (28) nonredundant compartment of the GenBank, EMBL, and DDBJ (T51) and Hukriede et al. (29) (LN54) were used at the Max-Planck-Institut databases. The EST sequences were then used to design specific fu¨r Entwicklungsbiologie (Tu¨bingen, Germany). The PCR, agarose gel PCR primers. Third, sequences of previously identified zebrafish electrophoresis, and data analysis were conducted as recommended on the genes deposited in GenBank were used for designing PCR primers. web site (http://wwwmap.tuebingen.mpg.de). The current T51-based map, including the markers reported in this work, is available at the same Fourth, two DNA probes from other species, winter flounder address. RAB2L (37) and X. laevis HSPA1A (38), were used to screen zebrafish cDNA libraries (30) and a genomic (phage) DNA library Genomic clones (18), respectively. One of the four positive clones identified after P1-derived artificial chromosome (PAC) clones from the zebrafish rescreening was digested with restriction enzymes and the digest genomic library 706 were obtained from the Resource Center of the Ger- was hybridized with the same probe. The two hybridizing frag- man Human Genome Project (30). PAC DNA was isolated from 20-ml overnight cultures in the Luria-Bertani medium using the plasmid mini or ments were cloned, sequenced, and assembled into one intronless the large construct kit (Qiagen). The phage genomic library was screened HSPA1A gene (GenBank accession number AF210640). In all four and DNA was isolated and hybridized, as described by Su¨ltmann et al. (18). approaches, the identity of the PCR fragments obtained with spe- Primary and secondary yeast artificial chromosome (YAC) pool DNA of cific primers was confirmed by cloning and sequencing. the zebrafish genomic library HACHy914 (30) was screened by PCR with The homology of the identified candidate genes with corre- Downloaded from the primers listed in Table I. sponding HLA genes was assessed by conducting a Blastx search Southern blot hybridization of the nonredundant GenBank/EMBL/DDBJ databases with the A total of 7 ␮g of zebrafish genomic DNA or 5 ␮g of the radiation hybrid candidate gene. The HLA class III region contains a total of ϳ60 cell line DNA (Research Genetics, Huntsville, AL) was digested with 100 loci, of which more than half were targeted by the present study. U of the restriction enzymes HindIII, BamHI, and MspI (Roche Diagnos- Of the 31 loci analyzed, we failed to identify the homologues of 12 tics, Mannheim, Germany) overnight. The recovered DNA was loaded onto loci (NOTCH4, AGER, AGPAT1, CREBL1, CYP21A2, C4, TNXA, http://www.jimmunol.org/ 0.8% agarose gel and run overnight. Alkali blots were prepared using the Hybond Nϩ nylon membrane (Amersham Pharmacia Biotech). Prehybrid- C2, NEU1, LTA, LTB, and NFKBIL1). The failure does not mean ization, hybridization, and probe labeling were conducted using the Alk- that these loci are absent in the zebrafish; they have just not yielded Phos DIRECT kit (Amersham Pharmacia Biotech). One hundred nano- to our identification efforts to date. The 19 successfully identified grams of DNA was used for the labeling of the probe. After the overnight zebrafish homologues of the HLA class III loci are listed in Table hybridizations, the DNA was washed according to the AlkPhos DIRECT II. In addition to these, we have been able to identify six zebrafish protocol. Following the application of the chemiluminescent detection re- agent CDP-Star (from the kit), Hyperfilm ECL (Amersham Pharmacia Bio- homologues of loci that reside in the HLA class II region, but are tech) was exposed to the blot for 6 h and developed. neither class II or class I loci (BING3, RAB2L, RPS18, SACML2, RING1B, and KE4), and one nonclass I gene (TUBB) homologous Map construction by guest on October 2, 2021 to a gene in the HLA class I region. Of the loci on the centromeric The position of genes on the zebrafish map was determined by using the flank of the HLA complex, we identified the homologues of the SAMapper program (31) (K. McKusick and D. R. Cox, unpublished data) MUT, NFYA, RDS, HMGIY, and PIM1 (39) loci. Similarly, of the on a DECstation 3000-600, following the standard procedure described in the SAMapper manual. Logarithm of the odds score limits and other pa- loci on the telomeric flank of the HLA complex, we identified in rameters were set as described in Geisler et al. (32). this study the zebrafish homologue of the EDN1 locus, and in an earlier study (40) the zebrafish homologues of the TCP1 and Nomenclature ACAT2 loci, which are located on human chromosome 6q26-q27. The zebrafish genes are designated by the same symbols as their human The Dare-DBB and -DCB class II genes were described by Su¨lt- homologues. Where required by the context, the zebrafish symbols are mann et al. (18). Altogether, we assembled a collection of 36 ze- prefixed by Dare, for Danio rerio. The human gene symbols are according to the Online Mendelian Inheritance in Man (OMIM) homepage (33). brafish homologues of HLA or linked loci suitable for a mapping Symbols of genes not yet entered in OMIM are according to The MHC study. Of the additional four genes listed in Table II, three (EF1A, Sequencing Consortium (34). GTF2H4, and DSP) were identified on a public website (http:// wwwmap.tuebingen.mpg.de) as already mapped, and one (FLOT1) Results was described by Michalovaét al. (19). Identification of HLA class III region homologues The specific aims of the study were to identify zebrafish genes Tests of orthology homologous to the HLA/H2 class III region genes and to determine Blastx searches established that the identified zebrafish sequences their positions in the zebrafish genome, in particular their linkage were homologous to genes on human chromosome 6p, in the HLA relationship to the previously identified Danio rerio (Dare) Mhc complex or in its vicinity. However, homology can be of two genes in linkage groups 19 (class I), 4 (class II), and 8 (class II). kinds: two genes can be either orthologous (divergent by a spe- Selected loci more distantly linked to the HLA/H2 complexes were ciation event) or paralogous (derived by a gene duplication) (41). also targeted by the study to assess the limits of the expected To be able to compare the zebrafish and human Mhc-associated synteny. In the search for the homologous loci, four approaches genes, it is necessary to determine of what kind the homology of were applied (Table II). First, for each HLA class III locus, nucle- the genes from the two species is. We approached this issue from otide sequences of known orthologs in other species were obtained two different angles. The first approach consisted of phylogenetic from the database (GenBank), the sequences were aligned, con- reconstructions based on the gene or protein sequences. If the reserved segments identified, and degenerate oligonucleotide prim- construction revealed the existence of a clade containing both the ers based on them were synthesized. The primers were used to HLA-linked gene (protein) and its zebrafish homologue, the two amplify zebrafish genomic DNA, a cDNA library (35), or a PAC genes were considered to be orthologous. In cases in which the library (30) by PCR. Candidate amplification products were cloned analysis yielded only one major clade, but the branching pattern The Journal of Immunology 6987

Table II. Zebraﬁsh genes and their positions on linkage groups as determined by typing radiation hybrid panels

GenBank Accession Location of Genea LGb PAC Clone (Resource Center) Number Idc Phylogenyd Human Homolog References

MUT [20ϩ] ND AA605843 2 O 6p21.2–6p21.1 33 NFYA 11ϩ ND AI496965 2 O 6p21.1 33 RDS 12ϩ ND AF210643/4 1 O 6p21.2 33 HMGIY 23ϩ ND AI658166 2 O 6p21 33 PIM1 8ϩ ND AF062643 3 O 6p21 33 BING3⌿ 7ϩ B12152, C0485, J15123, J15193, J24117, O2379 AF210638 1 ND Class II region 34, 42, 55 RAB2L 16ϩ ND AF202722 2 O Class II region 34, 42, 55, 56 RPS18 19ϩ D12166, I17148, K01108 AF210641 1 O Class II region 34, 42, 55, 56 SACM2L 19ϩ D12166, I17148, K01108 AA494847 1 O Class II region 34 RING1B 2ϩ ND AF196346 1 P Class II region 34, 56 KE4 19ϩ ND AF196345 2 O Class II region 34, 42, 55, 57 DBB 18ϩ ND U08869 3 O Class II gene 18 DCB 8ϩ ND U08873 3 O Class II gene 18 PBX2 19ϩ B02262, C1662, G12114, J08121, N24131, P0619 AF210642 1 O Class III region 34, 56, 58 PPT2 19ϩ N1074 AI545830 2 O Class III region 34, 56, 59 STK19 3ϩ H06241 AF210646 1 O Class III region 34, 60 SK12W 19ϩ ND AI545057 2 O Class III region 34, 61 BF 21ϩ L04161, O16162 AF047412 3 O Class III region 34, 62, 63 G9A 19ϩ ND AI497334 2 O Class III region 34, 56, 62 Downloaded from HSPA1A 3ϩ D2039, D1966, P1471, D05179, N21190 AF210640 4 O Class III region 34, 56, 58, 62 O23193, C19222, D12222, J15263, G17264 SMX5 [6ϩ] C04161, C13269, G0467, L14231, O0745, P0682 AF210645 1 O Class III region 34, 64 VARS1 16ϩ E0983, M12264, P05106 AF210648 1 O Class III region 34, 58, 65 CLIC1 21ϩ B14149, H13195, K18259, E09106 AA497337 2 O Class III region 34, 56, 60 DDAH ND ND AI477385 1 P Class III region 34, 56 ϩ

BAT5 16 P13230, E15135 AI477821 2 O Class III region 34, 66 http://www.jimmunol.org/ CSNK2B 19ϩ B1220, D1057, D1775, E0846, F0778, S76877 1 O Class III region 34, 67 F17180, I0942, L1023, M1288 APOM 2ϩ ND AI497429 2 O Class III region 34, 66 BAT3 15ϩ ND AW127905 2 O Class III region 34, 66 BAT2 19ϩ B1220, D1775, F0778, F17180, I0942, M1288 AI588507 2 O Class III region 34, 56, 58, 66 AIF1 5ϩ A22199, M05190 AA495202 2 O Class III region 34, 56 ATP6G ND ND AF210636 1 P Class III region 34, 56 G12245, N1942 AI477441 2 O?3P Class III region 34, 56, 66 ءBAT1 1 FLOT1e 19ϩ ND AF182161 O Class I region 34 TUBB – C09194, D04241, H16228, I24239, L22201, AF210647 1 ND Class I region 34, 56 P17250 by guest on October 2, 2021 EDN1 19ϩ ND AI396807 2 O 6p24 33 TCP1 23ϩ O23263 AF143493 3 O 6q26–6q27 33, 40 ACAT2 20ϩ G1276, G23214, N20142 AF143488 3 O 6q26–6q27 33, 40 EF1A f 19ϩ ND X77689 O 6q14 33 GTF2H4 f 19ϩ ND AA497366 O 6p21.3 33 DSP f 19ϩ ND AI396965 O 6p24 33

a Genes for which paralogs on other human chromosomes have been reported are indicated in bold. b LG, Linkage group (brackets indicate that the support for the assignment is not, as yet, significant). ϩ, T51 radiation hybrid panel used; *, LN54 radiation hybrid panel used. c Method of identification (see text). d O, Ortholog; P, paralog. e Michalovaét al. (19). f The location of these genes is taken from the http://www.map.tuebingen.mpg.de.

was consistent with the known vertebrate phylogeny, the zebrafish analysis (Table II). Examples of the analysis are shown in Fig. 1. gene was also considered orthologous to its human counterpart. If Phylogenetic analysis of the zebrafish BF gene is described in the zebrafish gene grouped in a clade with a human gene known to Gongora et al. (43), and that of TCP1 and ACAT2 genes in Takami be located on a different chromosome than 6p, the HLA-linked and et al. (44) and Shintani et al. (40). The BF and RDS genes are each zebrafish genes were assumed to be paralogous. The analysis re- found in two copies in the zebrafish genome, both copies behaving vealed the identified zebrafish RING1B, DDAH, ATP6G, and pos- as orthologs of the single HLA-linked gene by the above criterion sibly BAT1 genes to be paralogs of the corresponding HLA-linked (43). We assume that they are the result of a recent gene duplica- genes. Attempts to identify the zebrafish orthologs of the four hu- tion in the lineage leading to the zebrafish. Therefore, strictly man genes failed. The HLA-associated BING3 is a pseudogene speaking, in each of these two cases, it was the ancestor of each whose relationship to the identified zebrafish gene was difficult to gene pair that was orthologous to the HLA-linked gene, whereas establish because of its accelerated evolution. It appears to be a late the two copies are paralogous. The recent origin of the two BF acquisition to the HLA region (42). The TUBB gene did not cluster copies is supported by their high sequence similarity and by the with the mammalian Mhc-linked genes, but because only 60 aa fact that the copies are closely linked to each other (43). residues were available for the analysis and most of the bootstrap In the second approach, we used short stretches of coding se- values of the tree were low, the results of the analysis must be quence from the candidate genes (obtained by PCR amplification) regarded as inconclusive. All other identified zebrafish genes be- as probes for hybridization of Southern blots. The target of the haved as orthologs of their human counterparts in the phylogenetic hybridization was genomic DNA isolated from either the whole 6988 EVOLUTION OF Mhc CLASS III REGION Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021

FIGURE 1. Examples of phylogenetic analyses conducted to determine homology between zebrafish and other metazoan proteins. The PBX2 and FLOT1 are examples of proteins encoded in orthologous genes on human chromosome 6 and zebrafish linkage group 19. RAB2L is an example of a protein encoded by orthologous genes in the HLA region, but in zebrafish linkage group 16. RING1B is an example of a protein encoded by a zebrafish gene (linkage group 2) paralogous to the HLA-RING1 gene. Trees were produced by the neighbor-joining method of Saitou and Nei (26). Bootstrap values indicating the percentage of times a node could be recovered in 1000 replications are indicated. Sequences are identified by their accession codes in the GenBank/ EMBL/DDBJ and Swissprot databases. body of the fish or from selected radiation hybrid cell lines, and I/II loci, but would not be detected by the linkage test. To examine digested with the restriction enzymes BamHI, MspI, and in some this possibility, we hybridized the probes with DNA isolated from cases also HindIII. Because of their short length (100–600 bp), the the zebrafish-hamster radiation hybrid cell lines 47, 53, and 56, probes used could be expected to hybridize to a single fragment in which were part of the panel used in the linkage tests described in most cases, unless the genome contained more than one hybridiz- the next section and which together covered the entire class I re- ing gene. The presence of additional fragments could indicate that gion. These tests have revealed the presence of the class I and the candidate gene might not be orthologous to the HLA-linked linked genes in the three cell lines, but the absence of genes from gene. Examples of Southern blot hybridizations are shown in Fig. many other linkage groups. Therefore, absence of hybridization 2. We concentrated on genes that in the phylogenetic analysis were with the DNA samples from the three cell lines would support the identified as orthologs of HLA class III genes, but that in linkage conclusion that none of the multiple fragments carries a gene from analyses (see next section) did not show evidence of close prox- the vicinity of the zebrafish class I loci. An example of this test is imity to either Mhc class I or class II loci. Of these, the probes shown in Fig. 2B. Here, the HSPA1A probe hybridized with mul- derived from the BAT3, CLIC1, and APOM genes hybridized with tiple fragments in the positive control (zebrafish genomic DNA), a single fragment in both the BamHI and MspI digests (Fig. 2A). cross-hybridized with an unidentified fragment in the negative Therefore, these three zebrafish loci, unlike their human orthologs, control (hamster genomic DNA), but did not hybridize with any of are not linked to either the class I or the class II loci. However, the zebrafish DNA fragments present in the cell lines 47, 53, and hybridization with probes derived from the remaining genes in this 56. In the positive control, the cell line DNAs hybridized with set revealed two (STK19, VARS1), three (AIF1, BAT5), four probes specific for zebrafish genes shown by linkage tests to reside (BAT1), or multiple (HSPA1A) positive fragments (Fig. 2A). in linkage group 19 (Fig. 2C). Similar results were obtained also Therefore, the possibility existed that a gene borne by one of these with the other genes. Therefore, in all these cases, it can be con- additional fragments was not amplified by the PCR primers, but cluded that none of the homologues of the HLA class III genes is did hybridize with the probe. This gene might be linked to the class near the class I genes of the zebrafish. The Journal of Immunology 6989

cell lines of the T51 zebrafish-hamster radiation hybrid panel (45). In the few cases in which the localization of genes to a linkage group was not statistically significant, another radiation hybrid panel, LN54 (29), was also tested. Only those PCR amplification results were considered in which amplification of genomic zebrafish DNA (positive control), but not of genomic hamster DNA (negative control), yielded the expected fragment. The results of the PCR amplifications were evaluated by logarithm of the odds score analysis, as described in Geisler et al. (32). Altogether the map positions of 37 genes were determined (Ta- ble II, Fig. 3). The TUBB-specific primers cross-amplified hamster DNA and, for this reason, the position of this gene in the zebrafish linkage group maps could not be determined. The ATP6G and DDAH homologues were not mapped because they turned out to be paralogous to the HLA-linked genes. Of the 37 genes, 10 mapped to the zebrafish linkage group 19 (Fig. 4) at differing distances from the class I region contig defined by Michalovaét al. (19). The remaining 27 genes were scattered among 15 of the 25 zebrafish linkage groups (1, 2, 3, 5, 6, 7, 8, 11, 12, 15, 16, 18, 20, 21, 23). Because only a few of the tested genes that were not in Downloaded from linkage group 19 were found to be together in the same linkage group, we assume that whatever was responsible for the difference in their location between zebrafish and human was a random pro- cess. Of the 17 zebrafish genes that could be mapped and that were homologous to HLA class III region genes, six (PBX2, PPT2, SKI2W, G9A, CSNK2B, and BAT2) could be assigned to linkage http://www.jimmunol.org/ group 19 (Fig. 4). The remaining 11 genes were scattered among eight different linkage groups (1, 2, 3, 5, 6, 15, 16, and 21). Only the genes STK19 and HSPA1A, VARS1, and BAT5, as well as BF and CLIC1 mapped to the same linkage groups (3, 16, and 21, respectively). Of the six tested zebrafish homologues of HLA class II region genes, three (RPS18, SACM2L, and KE4) mapped to the linkage group 19, in the vicinity of the class I region contig. The two new zebrafish class II genes tested (Dare-DBB and -DCB) by guest on October 2, 2021 mapped to linkage groups 18 and 8, respectively. The former is a third linkage group harboring class II genes; the other two are linkage groups 4 and 8 (15). The human BING3, as mentioned earlier, is a pseudogene, apparently a late acquisition to the HLA region (42), and so it is not surprising that its zebrafish homologue does not map to the linkage group 19. Similarly, the zebrafish RING1B is apparently a paralog of the corresponding HLA complex gene, so here too, its position outside linkage group 19 might have been expected. Of the eight zebrafish genes homologous to genes on human chromosome 6p outside of the HLA complex, only one (EDN1) mapped to linkage group 19. These results lead to the conclusion that there is a partial conservation of synteny between FIGURE 2. Examples of Southern blot hybridization with probes spe- the HLA class III region and part of the zebrafish linkage group 19. cific for zebrafish homologues of HLA class III genes. A, Zebrafish In the HLA class III region, the conserved synteny genes are in- genomic DNA was digested by BamHI (B), MspI (M), or HindIII (H) restriction enzymes, and the blot was hybridized with a probe derived terspersed with genes whose homologues in the zebrafish are lo- specific for the gene indicated at the top. B, DNA extracted from hamster- cated in various other linkage groups. However, in the zebrafish, zebrafish radiation hybrid cell lines 47, 53, and 56 and digested with four of the six conserved class III synteny genes (SKI2W, BamHI was hybridized with the HSPA1A probe. C, DNA extracted from CSNK2B, BAT2, and PPT2) are part of a single cluster that con- cell lines 47 and 56 and digested with MspI was hybridized with the PBX2 tains the DSP gene, whose human homologue is on chromosome probe. The positive and negative controls were hamster (HA) and zebrafish 6p, but not in the HLA region. (ZF) genomic DNAs, respectively. The six genes that comprise the conserved synteny group are scattered over the entire length of the HLA class III region and are interspersed among loci that are found in different linkage groups Mapping of genes in the zebrafish. The conserved synteny loci thus form a core of the In an earlier study (15), the zebrafish class I genes were mapped to HLA class III region to which genes have either been added during linkage group 19 and the class II genes to linkage groups 8 the evolution of the mammalian Mhc, or from which loci have (Mhc-DAA, -DAB, -DDB)and4(Mhc-DFB). To map the zebrafish been deleted during the evolution of bony fishes, or both. The homologues of the HLA class III and selected flanking genes on finding that the orthologs of the remaining 11 HLA class III region human chromosome 6p, primers specific for the individual genes loci are scattered over eight zebrafish linkage groups suggests that (Table I) were used to amplify DNA samples isolated from the 94 the movement into and out of the core class III region occurred on 6990 EVOLUTION OF Mhc CLASS III REGION Downloaded from

FIGURE 3. Zebrafish linkage groups to which genes discussed in the present study have been mapped. Markers most closely related to the mapped genes http://www.jimmunol.org/ are shown in small print. multiple occasions and each time affected either a single locus or COL11A2, RXRE) (19, 46). The present study adds to this region a small group of loci on a short chromosomal segment. the loci EDN1, G9A, and PBX2, which flank the contig on one It should be possible to determine the length of the transferred side, as well as the loci RPS18, SACM2L, KE4, PPT2, DSP, BAT2, chromosomal segments by physical mapping. We have taken the CSNK2B, SKI2W, and GTF2H4, which flank the other side of the first step toward this goal by screening zebrafish PAC and YAC contig. Of these, six loci (G9A, PBX2, NG3, BAT2, CSNK2B, libraries available at the Resource Center of the Max-Planck-In- SKI2W) are orthologs of HLA class III region loci; three (RPS18, by guest on October 2, 2021 stitute for Molecular Genetics (Berlin, Germany). Filters contain- SACM2L, KE4) are orthologs of HLA class II region genes; and the ing the PAC library 706 were screened with probes for the class III human orthologs of the remaining three loci (EDN1, DSP, and genes PBX2, PPT2, STK19, HSPA1A, SMX5, VARS1, CLIC1, GTF2H4) are on the human 6p chromosome, but at some distance BAT1, BAT2, BAT5, and AIF1 (Table II). The digested DNA of the from the HLA complex. positive PAC clones was then hybridized again with probes that Taken together, the conserved synteny between the human chro- gave positive signals with these clones during the screening. Only mosome 6p and the zebrafish linkage group 19 encompasses at one pair of probes (CSNK2B and BAT2) was found to hybridize to least 27 loci (not counting the class I loci and obvious duplicates the same six PAC clones. When this approach was extended to such as the PSMB9A and PSMB9C loci in the zebrafish). This is other homologues of the HLA genes, another pair of genes (RPS18 the largest conserved synteny between fishes and mammals re- and SACM2L in the HLA class II region) was found to hybridize to corded to date. The synteny is in the composition (gene content) of a set of three PAC clones (Table II). Therefore, genes in these two the conserved chromosomal segments and much less in their or- pairs are closely linked in both the zebrafish and humans, and have ganization (gene order). To facilitate the comparison of the con- apparently been moved together during the remodeling of the Mhc served segments, it is convenient to divide them somewhat arbi- region. PCR screening of the HACHy914 YAC library with prim- trarily into the four blocks depicted in Fig. 5 and designated A ers listed in Table I confirmed the close linkage of CSNK2B to through D. The blocks have been rearranged relative to one an- BAT2 and of RPS18 to SACM2L, but did not reveal any additional other (Fig. 5E) and, to a lesser extent, internally, during the evo- linkages. lution of bony fishes and mammals from their common ancestor. Block A contains four genes, two of which appear to be in Discussion inverted order in the zebrafish relative to the human. The orienta- The present data must be interpreted in the context of earlier stud- tion of the block, too, is reversed in the two species, as is that of ies on the zebrafish class I region in linkage group 19. The core of block B. The latter consists of six loci arranged in the same order this region is a chromosomal segment covered by a PAC clone in the zebrafish and the human, but the fish ABCB and PSMB9 loci contig of about 450 kb (19). It contains a variable, haplotype- have duplicated, and one locus (KE6) has been transposed from dependent number of class I loci (Dare-UAA through -UFA), as block C in the zebrafish or to block C in the human. It is this block well as loci concerned with the production (PSMB8, PSMB9A, that may have been the original integration site of the class I and PSMB9B, PSMB9C, PSMB11, PSMB12) and transport (ABCB2, class II loci when the Mhc arose in the ancestor of the jawed ABCB3) of peptides and their loading onto nascent class I mole- vertebrates or earlier. The zebrafish RXRE is one of two closely cules (TAPBP) (17, 19–21, 46). It also contains additional loci not related loci (47), which presumably arose by duplication of the known to be involved with either class I molecules or with immu- RXRB ortholog (43); the other gene, RXRD, is in linkage group 16, nity in general (FLOT1, KNSL2, BING1, DAXX, KE6, FSRG1, which, perhaps significantly, contains three other orthologs of The Journal of Immunology 6991 Downloaded from

FIGURE 4. Comparison of syntenic human and zebraﬁsh groups. The data on the class I genomic region were reported previously (19). http://www.jimmunol.org/

HLA-associated genes (VARS1, BAT5, and RAB2L). Block C is comprised of four loci in the human and three loci in the zebrafish, the KE6 locus presumably having moved out of the latter or moved into the former. In both species, the loci are arranged in the same order, but the block’s orientation has been reversed in one species relative to the other. In the human, blocks A, B, and C encompass the HLA class II region. FIGURE 5. Blocks of conserved synteny between human (Hosa) chro- by guest on October 2, 2021 Block D is the largest and the most rearranged of the four. In the mosome 6p and zebrafish (Dare) linkage group 19 genes. The zebrafish human, it covers the HLA class III region in the band 6p21.3, but class I genomic region is represented by the blocks A and B (19); the it also includes a subblock of genes in bands 6p24.1 (EDN1) and blocks C and D refer to the other genes of the conserved synteny between the human chromosome 6p and the zebrafish linkage group 19. Relative 6p25 (DSP). In the human chromosome 6, these two subblocks are orientation of the blocks in the two species is indicated by long arrows. thus separated by a long genetic and physical distance; in the ze- Arrowheads indicate gene insertions (I and II, Mhc class I and class II brafish, in contrast, they are not only closer together, but also in- genes, respectively). Relative arrangement of the blocks in the two species termixed. When suitable markers become available, it will be in- is shown in the lower part of the figure. teresting to find out whether the region of synteny conservation also includes the segment between the two subblocks in human chromosome 6. The order of five block D loci is conserved be- of the bony fish and tetrapod lineages more than 400 million years tween the human and the fish chromosomes, while five other loci ago. That the group might, in fact, be much older than 400 million are rearranged in one species relative to the other. The human years is suggested by the existence of a region on human chromo- block D contains at least 12 additional loci (not counting the class some 6 displaying conserved synteny with the genomes in Cae- I genes) that are apparently absent in the zebrafish block D. norhabditis elegans and Drosophila melanogaster (49). As in that Whether the zebrafish block D similarly contains loci absent in the synteny, in the conserved synteny described in this study, there are human counterpart remains to be determined. ancient genes whose homologues have been found in vertebrates, There may exist another block of synteny conservation at the as well as nonvertebrates. In contrast, the class I and class II Mhc telomeric end of the long arm of chromosome 6 (band 6q27). The loci are apparently absent in nonvertebrates and may have origi- putative block is to date marked only by the Brachyury (T) homo- nated after the divergence of jawless and jawed vertebrates (50). logue, which in the zebrafish is at a distance of ϳ4–7 cM from the Thus, before the emergence of the Mhc, there apparently existed a class I region (15, 48). However, the TCP1 and ACAT2 loci, which pre-Mhc region with many of the non-class I and non-class II loci in the human reside in band 6q26-q27 and are partially overlap- already in place, including some of the class III loci, but lacking ping, are in different linkage groups in the zebrafish (40; and the the class I and class II genes. Whether the class I and class II loci present study). Interestingly, TCP1 in the zebrafish linkage group arose in situ from genes already present in the pre-Mhc region, or 23 is closely linked to HMGIY, and ACAT2 in zebrafish linkage from genes elsewhere in the genome and were then transposed into group 20 is loosely linked to MUT; the human HMGIY and MUT the pre-Mhc region, is unclear. Abi Rached and his colleagues (51) genes are closely linked to the HLA complex. have pointed out the presence of Ig superfamily genes (exons) in Based on these findings, we suggest that many of the genes that the vicinity of the vertebrate Mhc. Some of these genes may have are now part of the vertebrate Mhc or of the flanking segments are donated the Ig-like exons of the class I (␣3 domain-encoding) and part of an ancient synteny group that existed before the divergence class II (␣2 and ␤2 domain-encoding) genes. However, there are 6992 EVOLUTION OF Mhc CLASS III REGION no known genes in the Mhc region or elsewhere in the genome that 11. Lewin, H. A., G. C. Russel, and E. J. Glass. 1999. Comparative organization and could be considered good candidates for donors of the peptide- function of the major histocompatibility complex of domesticated cattle. Immu- nol. Rev. 167:145. binding region-encoding exons of the class I and class II genes (7). 12. Chouchane, L., and T. J. Kindt. 1992. Mapping of the rabbit MHC reveals that The reasons for the conservation of synteny between the pre- class I genes are adjacent to the DR subregion and defines an insertion/deletion- related polymorphism in the class II region. J. Immunol. 149:1216. Mhc segments remain obscure. The gene composition of the pre- 13. Kaufman, J., J. Jacob, I. Shaw, B. Walker, S. Milne, S. Beck, and J. Salomonsen. Mhc segment does not give any indication for specialization in 1999. Gene organization determines evolution of function in the chicken MHC. nonadaptive immune response. None of the genes suggested as Immunol. Rev. 167:101. 14. Flajnik, M. F., Y. Ohta, C. Namikawa-Yamada, and M. Nonaka. 1999. Insight forming a functional immunological supercluster in the mamma- into the primordial MHC from studies in ectothermic vertebrates. Immunol. Rev. lian Mhc (3) are part of the conserved synteny group in the ze- 167:59. brafish. There is to date no evidence for the existence of comple- 15. Bingulac-Popovic, J., F. Figueroa, A. Sato, W. S. Talbot, S. L. Johnson, M. Gates, J. H. Postlethwait, and J. Klein. 1997. Mapping of Mhc class I and class ment factor 2 (C2) gene in bony fishes (52); this gene may have II regions to different linkage groups in the zebrafish. Danio rerio. Immunoge- arisen in tetrapods. The complement factor B (BF) gene is in the netics 46:129. zebrafish linkage group 21, and in the medaka fish, too, it is in a 16. Sato, A., F. Figueroa, B. W. Murray, E. Ma´laga-Trillo, Z. Zaleska-Rutczynska, H. Su¨ltmann, S. Toyosawa, C. Wedekind, N. Steck, and J. Klein. 2000. Non- different linkage group than any of the class I and class II loci (53). linkage of the major histocompatibility complex of class I and class II loci in The zebrafish complement factor 4 (C4) locus could not be iden- bony fishes. Immunogenetics 51:108. 17. Takeuchi, H., F. Figueroa, C. O’hUigin, and J. Klein. 1995. Cloning and char- tified in the present study, but in medaka, it is again in a different acterization of class I Mhc genes of the zebrafish Brachydanio rerio. Immuno- linkage group than the class I and class II loci (53). The zebrafish genetics 42:77. HSPA1A gene is in linkage group 3, which apparently lacks class 18. Su¨ltmann, H., W. E. Mayer, F. Figueroa, C. O’hUigin, and J. Klein. 1994. Or- ganization of Mhc class II B genes in the zebrafish (Brachydanio rerio). Genom- I and class II loci. Finally, all efforts to identify the zebrafish or- ics 23:1. Downloaded from thologs of the human TNF (TNF) and the lymphotoxin (LT) genes, 19. Michalova´, V., B. W. Murray, H. Su¨ltmann, and J. Klein. 2000. A contig map of either in genomic DNA or in PAC and YAC clones bearing class the Mhc class I genomic region in the zebrafish reveals ancient synteny. J. Im- munol. 164:5296. III region homologues, have failed to date (unpublished data). 20. Takami, K., Z. Zaleska-Rutczynska, F. Figueroa, and J. Klein. 1997. Linkage of Therefore, we conclude that if there is any significance in the clus- LMP, TAP, and RING3 with Mhc class I rather than class II genes in the zebrafish. tering of all these genes in the class III region of the mammalian J. Immunol. 159:6052. 21. Murray, B. W., H. Su¨ltmann, and J. Klein. 1999. Analysis of a 26-kilobase region Mhc, it apparently does not extend beyond tetrapods or possibly linked to the Mhc in zebrafish: genomic organization of the proteasome compo- only some mammals. Teleost fishes, which comprise more than nent ␤/transporter associated with antigen processing-2 gene cluster and identi- http://www.jimmunol.org/ fication of five new proteasome ␤ subunit genes. J. Immunol. 163:2657. one-half of jawed vertebrates in terms of the number of identified 22. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, species, apparently do not suffer any disadvantage from not having K. B. Mullis, and H. A. Erlich. 1988. Primer-directed enzymatic amplification of some of the genes of nonadaptive immune response linked to the DNA with a thermostable DNA polymerase. Science 239:487. 23. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic class I or class II loci. However, there may be a selective advan- local alignment search tool. J. Mol. Biol. 215:403. tage in having genes for protein processing and for transport, as 24. Zhang, J., and T. L. Madden. 1997. PowerBLAST: a new network BLAST ap- well as for the loading of peptides, linked to the class I loci. The plication for interactive or automated sequence analysis and annotation. Genome Res. 7:649. rest of the conserved synteny genes may have remained together 25. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Improved sensitivity of perhaps for reasons having to do with the organization of chroma- profile searches through the use of sequence weights and gap excision. Comput. by guest on October 2, 2021 tin loops (54). However, even this explanation must make gener- Appl. Biosci. 10:19. 26. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for ous allowance for the busy traffic of genes in and out of the con- reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406. served regions. 27. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783. 28. Kwok, C., R. Critcher, and K. Schmitt. 1999. Construction and characterization of zebrafish whole genome radiation hybrids. Methods Cell Biol. 60:287. Acknowledgments 29. Hukriede, N. A., L. Joly, M. Tsang, J. Miles, P. Tellis, J. A. Epstein, We thank Dr. Susan Douglas for the RAB2L and Dr. Vladimir Vincek for W. B. Barbazuk, F. N. Li, B. Paw, J. H. Postlethwait, et al. 1999. Radiation the HSPA1A gene probes, Dr. Colm O’hUigin for critical reading of the hybrid mapping of the zebrafish genome. Proc. Natl. Acad. Sci. USA 96:9745. manuscript, Sabine Jantschek and Silke Geiger-Rudolph for technical as- 30. In Resource-Center/Primary-Database. (RZPD of the German Human Genome Project at the Max-Planck-Institute for Molecular Genetics (former Reference sistance, and Jane Kraushaar for editorial assistance. We are grateful to the Library Database.) Heubnerweg, Berlin-Charlottenburg, Germany. URL: http:// staff of the Resource Center for their support. www.rzpd.de. 31. Stewart, E. A., K. B. McKusick, A. Aggarwal, E. Bajorek, S. Brady, A. Chu, N. Fang, D. Hadley, M. Harris, S. Hussain, et al. 1997. An STS-based radiation References hybrid map of the human genome. Genome Res. 7:422. 1. Klein, J. 1986. Natural History of the Major Histocompatibility Complex. John 32. Geisler, R., G. J. Rauch, H. Baier, F. van Bebber, L. Brobeta, M. P. Dekens, Wiley, New York. K. Finger, C. Fricke, M. A. Gates, H. Geiger, et al. 1999. A radiation hybrid map of the zebrafish genome. Nat. Genet. 23:86. 2. Kasahara, M. 2000. Major Histocompatibility Complex: Evolution, Structure, 33. In National Center for Biotechnology Information: Omim: Online Mendelian and Function. Springer-Verlag, Tokyo. Inheritance in Man. http://www.ncbi.nlm.nih.gov/Omim/. National Library of 3. Trowsdale, J. 1995. “Both man & bird & beast”: comparative organization of Medicine, Bethesda, MD MHC genes. Immunogenetics 41:1. 34. The MHC Sequencing Consortium. 1999. Complete sequence and gene map of a 4. Parham, P., ed. 1999. Genomic organization of the MHC: structure, origin and human major histocompatibility complex. Nature 401:921. function. Immunological Reviews, Vol. 167. Munksgaard International Publish- 35. Ono, H., D. Klein, V. Vincek, F. Figueroa, C. O’hUigin, H. Tichy, and J. Klein. ers, Copenhagen. 1992. Major histocompatibility complex class II genes of zebrafish. Proc. Natl. 5. Parham, P., ed. 1999. Pathways of antigen processing and presentation. Immu- Acad. Sci. USA 89:11886. nological Reviews, Vol. 172. Munksgaard International Publishers, Copenhagen. 36. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, W. Miller, and 6. Kasahara, M., M. F. Flajnik, T. Ishibashi, and T. Natori. 1995. Evolution of the D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of pro- major histocompatibility complex: a current overview. Transplant. Immunol. 3:1. tein database search programs. Nucleic Acids Res. 25:3389. 7. Klein, J., and C. O’hUigin. 1993. Composite origin of major histocompatibility 37. Douglas, S. E., J. W. Gallant, C. E. Bullerwell, C. Wolff, J. Munholland, and complex genes. Curr. Opin. Genet. Dev. 3:923. M. E. Reith. 1999. Winter flounder expressed sequence tags: establishment of an 8. Klein, J., and A. Sato. 1998. Birth of the major histocompatibility complex. EST database and identification of novel fish genes. Mar. Biotechnol. 1:458. Scand. J. Immunol. 47:199. 38. Bienz, M. 1984. Xenopus hsp70 genes are constitutively expressed in injected 9. Skow, L. C., S. N. Snaples, S. K. Davis, J. F. Taylor, B. Huang, and oocytes. EMBO J. 3:2477. D. H. Gallagher. 1996. Localization of bovine lymphocyte antigen (BoLA) DYA 39. Icard-Liepkalns, C., R. N. Haire, S. J. Strong, and G. W. Litman. 1999. Cloning and class I loci to different regions of chromosome 23. Mamm. Genome 7:388. of a cDNA encoding a Pim1 homologue in zebrafish. Danio rerio. Immunoge- 10. Band, M., J. H. Larson, J. E. Womack, and H. A. Lewin. 1998. A radiation hybrid netics 49:351. map of BTA23: identification of a chromosomal rearrangement leading to sep- 40. Shintani, S., C. O’hUigin, S. Toyosawa, V. Michalova´, and J. Klein. 1999. Origin aration of the cattle MHC class II subregions. Genomics 53:269. of gene overlap: the case of TCP1 and ACAT2. Genetics 152:743. The Journal of Immunology 6993

41. Li, W.-H. 1997. Molecular Evolution. Sinauer Associates, Sunderland. 56. Kasahara, M. 1999. Genome dynamics of the major histocompatibility complex: 42. Herberg, J. A., S. Beck, and J. Trowsdale. 1998. TAPASIN, DAXX, RGL2, HKE2 insights from genome paralogy. Immunogenetics 50:134. and four new genes (BING1.3 to 5) form a dense cluster at the centromeric end 57. Hanson, I., and J. Trowsdale. 1991. Colinearity of novel genes in the class II of the MHC. J. Mol. Biol. 277:839. regions of the MHC in mouse and man. Immunogenetics 34:5. 43. Gongora, R., F. Figueroa, and J. Klein. 1998. Independent duplications of Bf and 58. Katsanis, N., J. Fitzgibbon, and E. M. C. Fisher. 1996. Paralogy mapping: iden- C3 complement genes in zebrafish. Scand. J. Immunol. 48:651. tification of a region in the human MHC triplicated onto human chromosomes 1 44. Takami, K., F. Figueroa, W. E. Mayer, and J. Klein. 2000. Ancient allelism at the and 9 allows the prediction and isolation of novel PBX and NOTCH loci. Genom- cytosolic chaperonin-encoding gene of the zebrafish. Genetics 154:311. ics 35:101. 45. Kwok, C., R. M. Korn, M. E. Davis, D. W. Burt, R. Critcher, L. McCarthy, 59. Soyombo, A. A., W. Yi, and S. L. Hofmann. 1999. Structure of the human B. H. Paw, L. I. Zon, P. N. Goodfellow, and K. Schmitt. 1998. Characterization palmitoyl-protein thioesterase-2 gene (PPT2) in the major histocompatibility of whole genome radiation hybrid mapping resources for non-mammalian ver- complex on chromosome 6p21.3. Genomics 56:208. tebrates. Nucleic Acids Res. 26:3562. 46. Su¨ltmann, H., B. W. Murray, and J. Klein. 2000. Identification of seven genes in 60. Sargent, C. A., I. Dunham, and R. D. Campbell. 1989. Identification of multiple the Mhc class I region of the zebrafish. Scand. J. Immunol. 10:577. HTF-island associated genes in the human major histocompatibility complex 47. Jones, B. B., C. K. Ohno, G. Allenby, M. B. Boffa, A. A. Levin, J. F. Grippo, and class III region. EMBO J. 8:2305. M. Petkovich. 1995. New retinoid X receptor subtypes in zebrafish (Danio rerio) 61. Dangel, A. W., L. Shen, A. R. Mendoza, L. Wu, and C. Y. Yu. 1995. Human differentially modulate transcription and do not bind 9-cis retinoic acid. Mol. Cell. helicase gene SKI2W in the HLA class III region exhibits striking structural Biol. 10:5226. similarities to the yeast antiviral gene SKI2 and to the human gene KIAA0052: 48. Johnson, S. L., M. A. Gates, M. Johnson, W. S. Talbot, S. Horne, K. Baik, emergence of a new family. Nucleic Acids Res. 23:2120. S. Rude, J. R. Wong, and J. H. Postlethwait. 1996. Centromere-linkage analysis 62. Spies, T., M. Bresnahan, and J. Strominger. 1989. Human major histocompati- and consolidation of the zebrafish genetic map. Genetics 142:1277. bility complex contains a minimum of 19 genes between the complement cluster 49. Trachtulec, Z., R. M. Hamvas, J. Forejt, H. R. Lehrach, V. Vincek, and J. Klein. and HLA-B. Proc. Natl. Acad. Sci. USA 86:8955. 1997. Linkage of TATA-binding protein and proteasome subunit C5 genes in 63. Postlethwait, J. H., Y.-L. Yan, M. A. Gates, S. Horne, A. Amores, A. Brownlie, mice and humans reveals synteny conserved between mammals and inverte- A. Donovan, E. S. Egan, A. Force, Z. Gong, et al. 1998. Vertebrate genome brates. Genomics 44:1. evolution and the zebrafish gene map. Nat. Genet. 18:345. 50. Klein, J., A. Sato, and W. E. Mayer. 2000. Jaws and AIS. In Major Histocom-

64. Olavesen, M. G., M. Snoek, and R. D. Campbell. 1993. Localization of a new Downloaded from patibility Complex: Evolution, Structure, and Function. M. Kasahara, ed. Spring- gene adjacent to the HSP70 genes in human and mouse MHCs. Immunogenetics er-Verlag, Tokyo. 37:394. 51. Abi Rached, L., M. F. McDermott, and P. Pontarotti. 1999. The MHC big bang. Immunol. Rev. 167:33. 65. Hsieh, S.-H., and R. D. Campbell. 1991. Evidence that gene G7a in the human 52. Seeger, A., W. E. Mayer, and J. Klein. 1996. A complement factor B-like cDNA major histocompatibility complex encodes valyl-tRNA synthetase. Biochem. J. clone from the zebraﬁsh (Brachydanio rerio). Mol. Immunol. 33:511. 278:809. 53. Nonaka, M., N. Kuroda, K. Naruse, and A. Shima. 1998. Molecular genetics of 66. Spies, T., G. Blanck, M. Bresnahan, J. Sand, and J. Strominger. 1989. A new the complement C3 convertases in lower vertebrates. Immunol. Rev. 166:59. cluster of genes within the human major histocompatibility complex. Science

54. Lundin, L. G. 1993. Evolution of the vertebrate genome as reﬂected in paralogous 243:214. http://www.jimmunol.org/ chromosome regions in man and in the house mouse. Genomics 16:1. 67. Albertella, M., H. Jones, W. Thomson, M. G. Olavesen, and R. D. Campbell. 55. Stephens, R., R. Horton, S. Humphray, L. Rowan, J. Trowsdale, and S. Beck. 1996. Localization of eight additional genes in the human major histocompati- 1999. Organization, sequence variation and isochore structure at the centromeric bility complex, including the gene encoding the casein kinase II ␤ subunit boundary of the human MHC. J. Mol. Biol. 291:789. (CSNK2B). Genomics 36:240. by guest on October 2, 2021