Universitätsklinikum Ulm Zentrum für Innere Medizin Klinik für Innere Medizin I Ärztliche Director: Prof. Dr. G. Adler
IDENTIFICATION AND CHARACTERIZATION OF PKD2 SUBSTRATES -CIB1A AS A SUBSTRATE FOR PKD2-
Dissertation zur Erlangung des Doktorgrades der Humanbiologie (Dr. biol. hum.) der Medizinischen Fakultät der Universität Ulm
vorgelegt von Milena Armacki aus Zrenjanin, Serbien 2010
Amtierender Dekan: Prof. Dr. med. Klaus-Michael Debatin
1. Berichterstatter: Prof. Dr. med Thomas Seufferlein
2. Berichterstatter: Prof. Dr. Johan van Lint
Tag der Promotion: 19.02.2010.
Table of content i Index of Figures iii Abbreviations iv Table of Content 1.Introduction 1 1.1. Cell migration 3 1.1.1. The migration cycle 3 1.1.2. Focal adhesion 5 1.2. Protein Kinase D family (PKD) 7 1.2.1. Modular structure of PKD enzymes 7 1.2.2. Regulation of PKD activity 7 1.2.2.1. Intramolecular regulation of PKD 7 1.2.2.2. Activation mechanisms of PKDs in various signalling pathways 8 1.2.3. Biological functions of PKDs 9 1.2.3.1. PKD substrates 9 1.2.3.2. Regulation of cell shape, adhesion, motility and invasion 11 1.2.3.3. Regulation of cell proliferation and differentiation 12 1.2.3.4. Role of PKDs in Secretion 13 1.2.3.5. Role for PKD in Angiogenesis 13 1.3. Ca and Integrin Binding protein (CIB) 14 1.3.1. CIB structure 14 1.3.2. Molecular interactions of CIB1 16 1.3.2.1. CIB 1 and Integrins 17 1.3.2.2. Role for CIB1 in ischemia-induced pathological and adaptive angiogenesis 18 1.3.2.3. Role of CIB1 in regulating PAK1 activation and cell migration 18 1.4.Aim of the study 20 2.Materials and methods 21 2.1. Chemicals and other products 21 2.2. Cell biology 21 2.2.1. Cell lines 21 2.2.2. Transient transfection 22 2.2.2.1. Transfection with Poly Ethylen Imine (PEI) 22 2.2.2.2. Transfection of cells with Nucleofector 22 2.2.3. Activation of PKD2 in HEK 293T 22 2.2.4. Inhibition of nuclear export by Leptomycin B( LMB) 23 2.3. Molecular Biology 23 2.3.1. Enzymes and ready-to-use kits 23 2.3.2. Primers for cDNA constructs 24 2.3.3. Plasmids 24 2.3.4. Plasmid purification 25 2.3.5. Computer programs for DNA analysis 25 2.3.6. Cloning Methods 26 2.3.6.1. PCR 26 2.3.6.1.1. Nested PCR 26 2.3.6.1.2. Overlapping PCR 27 2.3.6.2. TOPO Cloning 27 2.3.6.3. Site directed mutagenesis (SDM) 28 2.3.7. Generation of cDNA-constructs 28 2.3.7.1. Cloning of the pGEX 4T1-CIB 1a 28 2.3.7.2. Generation of point CIB 1a mutants 29 2.3.7.3. Cloning of the Myc-CIB 1a 29 2.3.7.4. Generation of the CIB1 29 2.3.7.5. Cloning of the N- and C- terminal eGFP tagged CIB1a mutants 30 2.3.7.6. Cloning of the IRES-CIB 1a-GFP 30 2.3.7.7. Cloning of pcDNA 3-CIB 1a 31 2.3.7.8. Cloning of the Cherry-CIB1a 31 2.3.7.9. Cloning of the PKD2 31 2.3.8. RNA isolation and Semi-quantitative RT-PCR 32 2.3.9. Quantitative one step real time PCR 33 2.3.9.1. Relative quantification 33 2.3.9.2. Determining amplification efficiencies 33 2.4. Biochemical technique 34 2.4.1. SDS-PAGE and Western Blot 34 2.4.1.1. Antisera and Antibodies 35 2.4.2. Coomassie staining 35 2.4.3. Preparation of whole cell lysate 35 2.4.4. (Co-)immunoprecipitation 35 2.4.5. Catch and Release® v2.0 Reversible Immunoprecipitation 36 2.4.6. Production and purification of phospho-specific CIB1a antibody 36 2.4.6.1. Antibody evaluation by ELISA 37 2.4.7. Expression and purification of GST-tagged proteins in bacteria 37 2.4.8. GST-pull down experiments 38 2.4.9. In vitro kinase assays 38 2.4.10. The In Vitro Expression Cloning (IVEC) Method 39 2.4.10.1. Preparation of protein pools 39 2.4.10.2. Identification of phosphorylated proteins by gel mobility assay 40 2.4.10.3. Subdivision of positive pools and Molecular Identification of Specific Clones 40 2.4.11. Computer programs for protein analysis 40 2.5. Imaging techniques 41 2.5.1. Time-lapse microscopy 41 2.5.1.1. Migration Assay 41 2.5.2. Epi-fluorescent and Laser scanning confocal microscopy (LSCM) 41 2.5.2.1. Colocalisation of proteins 42 2.5.2.2. Staining of endogenous proteins 42 2.5.2.3. Quantication of Focal adhesions 43 3.Results 44 3.1. Library screening 44 3.1.1. Molecular identification of specific clones 46 3.2. Expression pattern of CIB1/ CIB1a 48 3.3. In vitro phosphorylation of CIB1a by PKD2 50 3.3.1. Identification of the phosphorylated Serine in silico method and by computer modelling 52 3.3.2. PKD2 phosphorylates CIB1a on Ser 118 in vitro 53 3.3.3. In vivo phosphorylation of CIB1a by PKD2 54 3.4. PKD2 directly interacts with CIB1a 55 3.4.1. Identification of the CIB1a-binding site within PKD2 56 3.5. CIB1a directly stimulates PKD2 activity 58 3.6. Localisation of CIB1a 59 3.7. CIB1a interacts with PAX 3 61 3.8.Phosphorylation of CIB1a on Ser 118 induces its subcelular re-localisation 61 3.9. Nuclear export of CIB1a 63 3.10. Phosphorylated CIB 1a colocalises with Vimentin 66 3.10.1. CIB1a physically interacts with Vimentin 68 3.11. Phosphorylated CIB1a promotes cell migration 69 3.11.1. Effect of CIB1a phosphorylation by PKD2 on FA formation 70 4.Discussion 73 5.Summary 79 6.References 81 ACKNOWLEDGEMENTS 97
ii Index of Figures Figure 1: A schematic of the metastatic process 2 Figure 2: Stages of cell movement: 4 Figure 3: Molecular architecture of focal contacts 6 Figure 4: Molecular structure of members of the protein kinase D family 7 Figure 5: Calmyrin/Ca and integrin binding protein(CIB1) amino acid sequence and transcript expression pattern. 15 Figure 6. Relationship of Ca and integrin binding protein 1(CIB1) with some of its nearest homologs 16 Figure 7. Strategy for performing deletion mutagenesis by PCR Fusion. 27 Figure 8. Phosphorylation of single clones by catalytically active Protein kinase D2 (PKD2se) 45 Figure 9. Sequence analysis of the positive IVEC clone. 47 Figure 10. Expression of CIB1 and CIB1a in human cancer cell lines 48 Figure 11. Expression of CIB and CIB1a proteins. 49 Figure 12. Quantification of the mRNA expression level of the CIB1a gene in various cell lines. 50 Figure 13. In vitro phosphorylation of CIB1a and CIB1 by PKD2. 51 Figure 14. Identification of the protein kinase D2 (PKD2) phosphorylation site in CIB 1a. 53 Figure 15. Protein Kinase D2 (PKD2) phosphorylates CIB1a at Serine 118 and not at Threonine 207 54 Figure 16. Development of site-specific phospho-CIB1a antibody. 55 Figure 17. CIB1a interacts with Protein Kinase D2 (PKD2). 56 Figure 18. Localisation of interaction sites in Protein Kinase D2 (PKD2) 57 Figure 19. Localisation of CIB1a interaction site in PKD1 and PKD3 58 Figure 20. Phosphorylation of CIB1a stimulates Protein Kinase D2 (PKD2) activity 59 Figure 21. Localisation of tagged and untagged CIB1a in HeLa cells 60 Figure 22. CIB1a interacts with Pax 3 independently of CIB1a phosphorylation 61 Figure 23. Catalytically active PKD2 induces phosphorylation and subsequent translocation of CIB1a to the cytoplasm in HeLa cells 62 Figure 24. Catalytically active PKD2 induces phosphorylation and subsequent translocation of CIB1a to the cytoplasm in U 87 cells 63 Figure 25. NetNES 1.1 prediction of the nuclear export signal (NES) in CIB1a protein. 64 Figure 26. Nuclear export of PKD2 is regulated by a CRM-1 dependent mechanism 65 Figure 27. CIB1a interactes with Crm1 independent of the phosphorylation by PKD2 66 Figure 28. Subcelular distribution of wild type or phosphorylated CIB1a and Vimentin in HeLa cells. 67 Figure 29. Subcelular distribution of wild type or phosphorylated CIB1a and Vimentin in U87 cells. 68 Figure 30. CIB1a interacts with Vimentin 69 Figure 31. CIB positively regulates migration as a result of phosphorylation on Serine 118. 70 Figure 32. Effect of the CIB1a phosphorylation on the focal adhesion formation 71 Figure 33. Effect of CIB1a phosphorylation by PKD2 on Focal Adhesions (FA) formation. 72
iii Abbreviations A Adenin aa amino acid AB Antibody Abl Abelson leukaemia AEBSF 4-(2-Aminoethyl)benzylsulfonylfluorid Arg Arginine (three letter code) Ala Alanine (three letter code) Amp Ampicillin ATCC American Type Culture Collection ATP Adenosine Triphosphate APC Antigen Presenting Cell bp base pairs BSA Bovine Serum Albumin BCR B Cell Receptor C Cytosine °C degree Celsius Ca2+ Calcium ion CAMK Ca2+/Calmodulin-depenent protein kinase cAMP cyclic Adenosine Monophosphate CCK-2 Cholecystokinine2 CCK-2R Cholecystokinine2 Receptor CDK Cyclin-dependent protein kinase cDNA mRNA complementary DNA CIB Calcium and integrin binding protein CRD Cysteine Rich Domain Crm1 Chromosomal region maintenance 1 CTP Cytidin Triphosphate Cys Cysteine (three letter code) DAG Diacylglycerol DMEM Dulbecco's modified Eagles medium DNA Desoxyribonucleinacid dNTP desoxy ATP/CTP/GTP/TTP DTT Dithiothreitol ECL Enhanced chemiluminescence ECM Extra Cellular Matrix EDTA Ethylendiamine-N, N, N´, N´- tetra-acetate EF hand Helix-loop-helix structural domain found in family of calcium-binding proteins FA Focal adhesions FAK Focal Adhesion Kinase e. g. for example (expempli gracia) FCS Fetal Calve Serum G Guanine G Glycine (one letter code) g gram iv Gαq G-protein-subunit αq Gly Glycine (three letter code) GDP Guanosindiphosphate GPCR G-protein coupled receptor GTP Guanosin Triphosphate GST Glutathione S Transferase HDAC Histone Deacetylase HMBS Hydroxymethylbilansynthase IgG Immunglobulin G IP Immunoprecipitation
IP3 Inositoltriphosphate IVEC The In Vitro Expression Cloning Method IVK Invitro Kinase assay KIP calcium-binding myristoylated protein with homology to calcineurin Jak Janus kinase K Lysine (single letter code) kb kilo base pairs Kidins 220 Kinase D-interacting substrate-220 kD kD kilo Dalton l liter L Leucine (one letter code) Leu Leucine (three letter code) LMB Leptomycin B Lys Lysine (three letter code) M Molar MAPK Mitogen Activated Protein Kinase MDa Mega Dalton MEF Myocyte Enhancing Factor MHC Major Histocompatibility Complex MnSOD manganese-dependent superoxide dismutase mg milligram min minute ml milliliter mM millimolar mRNA messenger RNA NCBI National Center for Biotechnology and Information NES Nuclear Export Sequence NFAT Nuclear Factor of Activated T cells NFκB Nuclear Factor κ B NLS Nuclear Localization Signal μg microgram μl microliter nM nanomolar PAK P21- activated kinase
v PAX 3 Paired box(PAX) family transcription factor PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction PDZ Postsynaptic Density-95/Discs large/Zonula Occludens-1 PDGF Platelet Derived Growth Factor PEI Poly Ethylen Imine PE Phorbol Ester pH negative logarithm of hydrogen concentration PH Pleckstrin Homology domain
PIP2 Phosphatidylinositol 4,5-bisphosphate PKC Protein Kinase C PKD Protein Kinase D PLC Phospholipase C PMA Phorbol 12-myristate 13-acetate Pro Proline PS Phosphatidyl-L-Serine PTM Post Translational Modification PVDF Polyvinylidenedifluoride R Arginine (one letter code) Ran Ras related nuclear protein RNA Ribonucleic acid ROI Region of Interest ROS Reactive Oxygen Species rpm rounds per minute RT Room Temperature S Serine (one letter code) SDM Site Directed Mutagenesis SDS-PAGE Sodium Dodecyl Sulfate – polyacrylamide gel electrophoresis Ser Serine (three letter code) SH2 Src homology domain 2 siRNA small interfering RNA SOD Super Oxide Dismutase STAT Signal Transducers and Activators of Transcription T Thymine TAE Tris-Acetate EDTA TCR T Cell Receptor TGN Trans Golgi Network TGFβ Transforming Growth factor β Thr Threonine (three letter code) Tris Tris(hydroxymethyl)aminomethane Tyr Tyrosine (three letter code) U enzyme Unit V Valine (one letter code) Val Valine (three letter code) v/v volume per volume vi VSVG Vesicular Stomatitis Virus G protein w/v weight per volume WCL Whole Cell Lysate WB Western Blot Y Tyrosine (one letter code)
vii Introduction
1.Introduction
Cancer generally is a genetic disease, which progresses through the accumulation of often multiple alterations in the DNA of cells (multi-step process). These alterations lead to gain-of function of oncogenes or a loss-of-function of tumor suppressor genes and drive the progressive transformation of normal human cells into malignant derivates (Hanahan and Weinberg, 2000). An important characteristic of malignant tumor cells is the formation of metastasis. Metastasis is the process by which a tumor cell leaves the primary tumor, travels to a distant site via the circulatory system, and establishes a secondary tumor. Although the genetic basis of tumorigenesis can vary greatly, the steps required for metastasis are similar for all tumor cells. Several steps can be recognized in the process of metastasis. The generation of blood vessels (angiogenesis) is an essential step for the primary tumor to grow. The rich vascularization also increases the chance for tumor cells to reach the bloodstream and colonize secondary sites. During the metastatic process, tumor cells need to attach to other cells and/or matrix proteins. Adhesion molecules play a central role in cellular attachment. Translocation of neoplastic cells across extracellular matrix barriers (invasion) is also part of the metastatic process. Lysis of matrix proteins by specific proteinases is required for invasion. Finally, colonization of the secondary site by tumor cells requires tumor cell proliferation (Figure 1).
1 Introduction
Figure 1. A schematic of the metastatic process: (A) An in situ cancer surrounded by an intact basement membrane. (B) Invasion requires reversible changes in cell–cell and cell–extracellular-matrix adherence, destruction of proteins in the matrix and stroma, and motility. Metastasizing cells can enter via the lymphatics (C), or directly enter the circulation (D). (E) Survival and arrest of tumor cells, and extravasation of the circulatory system. (F) Metastatic colonization of the distant site.
Tumor cells migrate in response to environmental signals and for cell migration rearrangements of the cytoskeleton are necessary. In addition, migration is not possible without alterations in normal adhesion. So in order to metastasize, cancer cells need to alter different cell functions such as cell adhesion, cell migration and cell invasion. Of the different processes involved in cancer progression, cell adhesion and cell migration are discussed below, as they are relevant to the results presented in this study. Research in the last decade has identified protein kinase D (PKD) family members as mobile intracellular traffic regulators with important roles in growth factor signalling as well as in stress induced signalling. PKDs have emerged as regulators of intracellular signaling traffic through modification of other kinase signaling pathways and plasma membrane proteins (van Lint et al, 2002). Several studies indicated a role for PKDs in cytoskeletal reorganization, cell shape modulation, cell motility, adhesion and invasion (Prigozhina et al., 2004; Eiseler et al., 2007; Yeaman et al., 2004).
2 Introduction
Several reports identify PKD as a regulator of cell proliferation and apoptosis, proposing a role for the enzyme in carcinogenesis (Pfizenmaier et al, 1998; Datta et al., 2000, Zhukova et al., 2001). Expression of PKD isoforms is deregulated in various tumors including gastric and prostate carcinomas (Syed et al., 2008; Kim et al., 2008). PKDs mediate NF-κB activation in leukemia cells (Mihailovic et al., 2004) and regulate proliferation in prostate cancer cells (Sharlow et al., 2008). Seufferlein and co-workers (unpublished data) have identified the PKD family, in particular PKD2, as a major mediator of glioblastoma cell growth in vitro and in vivo. The role of specific PKD isoforms in solid tumours is so far poorly characterized. In order to establish the possible role of PKD2 in tumors in this study we investigate its involvement in the signalling network.
1.1. Cell migration
Cell movement or motility is a highly dynamic phenomenon that plays a central role in a wide variety of biological phenomena. From the early stages of development on, cell movement is essential for the generation of the entire organism. Also in adult organisms cell motility remains important for wound healing and immune response. Many pathologies arise from aberrant motility processes such as inappropriate immune responses or tumor spreading.
1.1.1. The migration cycle
Cell movement is a complex process primarily driven by the actin network beneath the cell membrane, and can be divided into three general components: protrusion of the leading edge of the cell, adhesion of the leading edge, de-adhesion at the cell body and rear, and cytoskeletal contraction to pull the cell forward (Figure 2). Each of these steps is driven by physical forces generated by unique segments of the cytoskeleton. (Ananthakrishnan et al., 2007).
3 Introduction
Figure 2. Stages of cell movement: 1) after determining its direction of motion, the cell extends a protrusion in this direction by actin polymerization at the leading edge. 2) It then adheres its leading edge to the surface on which it is moving and de-adheres at the cell body and rear. 3) Finally, it pulls the whole cell body forward by contractile forces generated at the cell body and rear of the cell.
To migrate, cells use dynamic rearrangements of the actin cytoskeleton for the formation of protrusive structures and for generation of intracellular forces that lead to cell translocation. This is initiated by a transition from a non-polarized to a polarized state, most often induced by response of a cell to a migration promoting agent. Polarized motile cells extend distinct protrusive regions in the direction of translocation. Two types of protrusion are typically associated with cell migration: lamellipodia are large veil-like sheets, which contain highly branched and cross-linked actin filaments (Small, 1994); filopodia are long thin structures that often project beyond the edge of the lamellipodium and have parallel bundles of actin filaments (Small, Rottner, & Kaverina, 1999; Svitkina et al., 2003). For a cell to translocate (i.e. to move from one place to another), the cell needs to attach at a new site and retract its rear (Lauffenburger & Horwitz, 1996; Mitchison & Cramer, 1996). The new attachment sites or focal contacts, that constitute a physical link between the substrate and the actin cytoskeleton, are formed behind the leading edge (Geiger & Bershadsky, 2001). While they mature into focal adhesions, they pull the cell forward (Wehrle-Haller & Imhof, 2002; Kaverina,
4 Introduction
Krylyshkina, & Small, 2002). Subsequently, attachment sites at the rear of the cell are released, allowing the cell to pull its rear towards the direction of movement.
1.1.2. Focal adhesions
Focal adhesions are dynamic groups of structural and regulatory proteins that transduce external signals to the cell interior and can also relay intracellular signals to generate an activated integrin state at the cell surface. They are formed at ECM–integrin junctions that bring together cytoskeletal and signalling proteins during the processes of cell adhesion, spreading and migration (Mitra et al., 2005). At the molecular level, focal adhesions are formed around the transmembrane core of a α-β integrin heterodimer, which binds to a component of the ECM on its extracellular region; it constitutes the site of anchorage of the actin cytoskeleton to the cytoplasmic side of the membrane, and mediates various intracellular signalling pathways (Burridge et al., 1988; Hynes, 2002; Jockusch et al., 1995; Schwartz et al., 1995). Because integrins do not contain actin-binding or enzymatic activity, all of the structural and signalling events are presumably mediated by proteins associated with the integrin cytoplasmic tails and molecules they recruit (Figure 3). Integrin-mediated adhesions can undergo dynamic changes in structure and molecular properties from dotlike focal complexes to stress-fiber-associated focal adhesions, which can further ‘mature’ to form fibronectin bound fibrillar adhesions. Focal complexes appear as small dotlike structures at the cell periphery of spreading cells or at the leading edge of migrating cells. These structures are associated with a loose actin meshwork. Early focal complexes contain α3-integrin, talin, and paxillin. Vinculin, α -actinin, VASP, and focal adhesion kinase (FAK) appear in late focal complexes (Laukaitis et al., 2001, Rottner et al 1999 Zaidel-Bar et al., 2003) . In slow moving cells, focal complexes that do not disassemble mature into focal adhesions (or focal contacts). Focal adhesions are more stable and display a slower turnover than focal complexes. They are located at the cell periphery and more centrally in less motile regions, associated with the end of stress fibres. These structures contain high levels of vinculin, talin, paxillin, zyxin, α -actinin, VASP, FAK, other phosphotyrosine proteins, and integrin αVβ3 (Zaidel-Bar et al., 2004). Fibrillar adhesions that arise from focal adhesions are elongated structures associated with ECM (fibronectin) and located more centrally in cells. In contrast to focal adhesions, fibrillar adhesions are not associated with stress fibers but only thin actin cables and contain high levels of tensin and α5β1-integrin, only traces of paxillin, and no vinculin (Zamir et al. 2000).
5 Introduction
Figure 3. Molecular architecture of focal contacts: The integrin-binding proteins paxillin and talin recruit focal adhesion kinase (FAK) and vinculin to focal contacts).α-Actinin, a cytoskeletal protein that is phosphorylated by FAK, binds to vinculin and crosslinks actomyosin stress fibres and tethers them to focal contacts. Zyxin is a α- actinin- and stress-fibre binding protein that is present in mature contacts. The composition of a focal contact is constantly varying depending on external cues and cellular responses.
Focal adhesion kinase (FAK) was found to be one of the first proteins to be recruited to sites of adhesion. It might be that the ability of FAK to promote both the maturation and turnover of focal contacts is related to its role as both a signalling kinase and as an adaptor/scaffold protein, which places FAK in a position to modulate various intracellular signalling pathways. The association of FAK with both activators and/or inhibitors of various small GTPase proteins (Rho, Rac, Cdc42 and Ras) connect the FAK activity to alterations in the polymerization or stabilization of actin and microtubule filaments. Additionally, because migrating cells experience changes in forces through integrin contacts that link the ECM with the cytoskeleton, FAK is important in the ‘sensing’ of mechanical forces that are either generated internally or exerted on the cells. FAK activation is therefore involved in modulating ‘corrective’ cell responses to environmental stimuli. FAK does this through signal-mediated effects on actin polymerization, the assembly of focal contacts, and the regulation of protease activation or secretion (Mitra et al., 2005).
6 Introduction
1.2. Protein Kinase D family (PKD) The protein kinase D (PKD) family of serine/threonine kinases belongs to a subfamily of the calcium-calmodulin kinase-like superfamily (Manning et al., 2002) that comprises PKD1 (protein kinase D1) or its human homolog protein kinase Cμ (PKCμ) (Johannes et al., 1994; Valverde et al., 1994 ), PKD2 (Sturany et al., 2001), and PKD3 (also named PKCν ) (Hayashi et al., 1999).
1.2.1. Modular structure of PKD enzymes
The members of this PKD family share a similar modular structure (illustrated in Figure. 4.), consisting of an N-terminal regulatory domain and a C-terminal kinase domain. The N-terminal regulatory portion of PKD1 and PKD 2 contain an N-terminal region with a high frequency of apolar amino acids, mainly alanine and/or proline. In PKD3 this hydrophobic domain is absent. All three isoforms contain a tandem repeat of zinc finger-like cysteine-rich motifs (termed CRD or C1a and C1b) separated by an exceptionally long Zinc-finger linker region (usually only 14–20 amino acids long in PKCs). Moreover, in PKD2 this linker region contains a serine-rich stretch. The Zinc-fingers precede a region rich in negatively charged amino acids and a PH domain in all the isoforms (Van Lint et al., 2002; Ryx et al; 2003).
Figure 3. Molecular architecture of focal contacts y. PKD1, PKD2 and PKD3. Abbreviations: PKD=Protein kinase D, AP = Ala- and Pro-rich domain, P = Pro-rich domain; C1a/C1b = Cys-rich zinc finger domain; S = Ser- rich domain; AC = acidic domain; PH = pleckstrin homology domain; kinase = kinase catalytic domain .Taken from Ryx et al., (2002).
1.2.2. Regulation of PKD activity 1.2.2.1. Intramolecular regulation of PKD
Regulation of protein kinases is achieved through a variety of mechanisms that include auto- and transphosphorylation events and control by N terminal regulatory domains or subunits. Mutagenesis studies have highlighted the N-terminal domains of PKD1 (Vertommen et al., 7 Introduction
2000.) and PKD2 (Auer et al., 2005) as the negative regulators of kinase activity, since the deletion of this domains leads to full activation of the kinases. Moreover, individual regions within the regulatory domain of PKD1 and PKD2 seem to have an inhibitory effect. Deletion of the C1a, the C1b, or the PH sub-domain, respectively, leads to the constitutive activation of PKD1 (Iglesias T. et al.; 1998). It was also shown that the PH domain in PKD2 functions as a negative regulator of enzyme activity, which is similar to PKD1. However, in marked contrast to PKD1, the C1a/C1b domain of PKD2 plays a positive/stimulatory role in the regulation of the catalytic activity (Auer et al., 2005). PKD3, because of its similar structure, may share common interacting factors and regulation characteristics.
1.2.2.2.Activation mechanisms of PKDs in various signalling pathways
PKDs can be activated in response to a wide variety of PKC activating stimuli such as receptor tyrosine kinase activating ligands (such as PDGF, VEGF), neuropeptides (such as bombesin, gastrin, angiotensin, vasopressin), T-cell receptor activation and B-cell receptor activation (Van Lint J. et al., 1998; Qin L. et al., 2006; Zugaza J. et al., 1997; Sturany S. et al., 2002; Matthews S. et al., 2000 and 2006). These agents activate PKDs through the activation of phospholipase C (PLC), leading to production of DAG and thereby activating of classical (cPKC, PKCα) and novel isoforms (nPKC, PKC δ, ε, η, θ) of the protein kinase family. PKCs activate PKDs by trans-phosphorylation of a region termed “activation-loop”. This activation occurs through the release of autoinhibition of the PH domain, and the activation loop phosphorylation is the trigger for this process (Waldron R. et al., 2001). PKD1 was shown to be trans-phosphorylated by PKCε and or PKCη at serine residues in position 744 and 748 (Iglesias et al., 1998c). PKD1 also gets activated in response to oxidative stress. This activation requires two sequential signalling events; i.e. phosphorylation of Tyr463 by Abl, which in turns promotes a second step, phosphorylation of the PKD activation loop by PKCδ(Storz et al, 2003; Toker et al, 2004). For PKD2 was demonstrated to be trans-phosphorylated by PKCα, ε or η at Ser706 and Ser710 in the activation loop upon gastrin binding to cholecystokinin/CCKB receptor in human gastric cancer cells stably transfected with the CCKB/gastrin receptor (Sturany et al., 2001). PKD3 was proposed to be trans-phosphorylated at Ser 731 and Ser 735 after GPCR stimulation with bombesin (Rey at al., 2003). Mass-spectroscopy analysis revealed that PKD1 is phosphorylated on distinct other sites during in vivo activation (Vertommen et al., 2001). Apart from the activation loop phosphorylation (Ser744 and Ser748) there is an autophosphorylation sites Ser916 (C-terminus) required for regulating the conformation of PKD1. Ser203 (regulatory domain) is other autophosphorylation site and is located in the region that interacts with 14-3-3 proteins. Ser255 is an additional trans-phosphorylation site in the regulatory domain targeted by PKC or a PKC- 8 Introduction activated kinase (Vetrommen et al., 2005). PKD1 activation also occurs after the interaction of PH domain with Gβγ subunits of heterotrimeric G proteins (Jamora et al., 1999). A third mechanism for PKD1 activation is through caspase-mediated cleavage during the induction of apoptosis by genotoxic drugs (Vantus et al., 2004). PKD2 and PKD 3 isoforms are also getting autophosphorylated in the C-terminus after activation (PKD2 at Ser876, and PKD3 at Ser888) (Sturany et al., 2001, Rey et al., 2003). Recent findings from our laboratory (von Blume et al, 2007) have shown an additional phosphorylation site (Ser244) within the zinc-finger domain of PKD 2, which is crucial for blocking nuclear export of active PKD2 by preventing its interaction with the Crm-1 export machinery.
1.2.3. Biological functions of PKDs
PKDs are implicated in the regulation of a remarkable array of fundamental biological processes. Functions of PKDs depend on the stimulus and the targeted subcellular compartment where e. g. specific substrates or binding molecules are localized.
1.2.3.1. PKD substrates
Post-translational modification of proteins by phosphorylation is the most abundant type of cellular regulation. Approximately one-third of all proteins in eukaryotic cells are phosphorylated on serine, threonine, or tyrosine, a reaction that is catalyzed by members of protein kinase super family (Cohen at al., 2002). Protein kinases catalyze the transfer of the terminal phosphate group of ATP to acceptor protein target(s) at serine, threonine and tyrosine residues. Protein phosphatases play opposite roles to protein kinases by dephosphorylating the protein target. To ensure signalling fidelity, kinases must be sufficiently specific and act only on a defined subset of cellular targets. Understanding the basis for this substrate specificity is essential for understanding the role of an individual protein kinase in a particular cellular process. Only a few physiological substrates of PKDs are identified and it is clear that numerous other PKD substrates must exist given the large number of cellular responses attributed to these protein kinases. In the table 1, we summarize the known PKD1 and PKD2 substrates, their cellular role, and the functional consequences of their phosphorylation by PKD1 (if known). By using an oriented peptide library approach, Nishikawa et al. determined the preferred substrate phosphorylation motif of PKDμ/PKD1. This and similar studies revealed that PK1D seems to preferentially phosphorylate substrates with a LXRXX (T*/S*) consensus motif, where T* and S* denote the phosphor acceptor sites threonine or serine. Some PKD1/PKD2 substrates will be discussed in more details further.
9 Introduction
Table 1.PKD substrates: cellular role and function of the PKD-mediated phosphorylation PKD1 Functional effect of PKD Cellular role Reference(s) Substrate mediated phosphorylation Ras interactor that prevents Ras-Raf RIN1 Facilitation of ERK activation Wang Y. et al.,2001 interaction C-jun Transcription factor Unknown Hurd C. et al., 2002 Regulator of subcellular trafficking of Zemlickova.et al. Centaurin α1 Unknown macro-molecular signalling complexes 2003
Integration of cellular stress detection p53 Unknown Uhle S. et al., 2003 and response signals
Inhibitor of actin myosin interaction at Troponin I Increased inhibition Haworth et al.,2004 low, diastolic Ca2+
Vanilloid Increased response to low pH Non-selective cation channel Wang et al., 2004 receptor 1 and capsaicin
Increased cellular adhesion. Mediator of cell-cell adhesion and E-cadherin Decreased cellular motility Jaggi M. et al., 2005 signalling induced by cell-cell contact (prostate cancer) Mediator of TCR induced NF-κB Activation of HPK1, leading to HPK1 Arnold R. et al.,2005 activation NF-κB activation
Doppler H. et hsp27 Chaperone Unknown al.,2005
Splice variant of EVL (Ena/VASP like Phosphorylated EVL-I can EVL-I Janssens et al., 2008 protein), support filopodia formation
Cortactin Actin binding protein Unkown de Kimpe et al., 2008
Regulation of Kidins220 membrane Iglesias et al.,2000; Kidins220 Integral membrane protein localisation in PC12 cells and NT Evers et al., 2007 hormone secretion in BON Cells
Role in Golgi vesicle fission Lipid kinase activation. PI4K IIIb Hausser et al.,2005
Repression of Nur77 expression in Nuclear export of HDAC7, followed Matthews et al., HDA7 2006; thymocytes by derepression of Nur 77expression Dequiedt et al., 2005;
Transcription factor cAMP response CREB Stimulation of CREB mediated transcription Johannessen et al., element-binding protein 2007 Repression of fetal gene expression in HDAC 5 Nuclear export of HDAC5 Vega et al.,2004 heart Altered cofilin activity, actin reorganisation SSH1L Dephosphorylation of Cofilin Storz et al., 2009 and decreased cell motility
10 Introduction
1.2.3.2. Regulation of cell shape, adhesion, motility and invasion
Several studies indicated a role of PKD in cytoskeleton organisation, cell shape modulation and adhesion. At the leading edge of migrating cells active PKD co-localise with F-Actin, Arp3 and Cortactin. PKD1 also directly interacts with F-Actin. It was hypothesized that PKD1 regulates the dynamics of actin turnover through phosphorylation of proteins of the actin polymerization machinery, such as Cortactin. This may lead to a stabilization of the cortical actin network, thereby reducing migration potential (Eiseler et al., 2007). Cortactin was found to be a high affinity substrate for PKD1 (de Kimpe et al., 2008). Another link of PKD1 to cell migration is given with its substrate Kidins220 which is localised at neurite tips and growth cones of PC12 cells (Iglesias et al., 2000). In motile immature dendritic cells, Kidins220 was localised to a raft compartment of membrane protrusions at the leading edge of migrating cells (Rio-Blanco et al., 2004). Recently, cofilin phosphatase slingshot 1 like (SSH1L) was identified as a substrate whose phosphorylation by PKD1 mediates relocalisation and inhibition, which translates to altered cofilin activity, actin reorganization and decreased directed cell motility. Besides PKD1 also PKD2 phosphorylates SSH1L, thereby controlling its localisation and thus cofiline dephosphorylation and activation at the membrane protrusions (Hausser et al, 2009). Accordingly, the loss of PKD1 or PKD2 decreases cofilin phosphorylation induces a more spread cell morphology and stimulates chemotactic migration of breast cancer cells in an SSH1L- dependent fashion (Hausser et al, 2009). Locomoting cells exhibit a constant retrograde flow of membrane proteins from the leading edge of the lamellipodia backwards, which when coupled to substrate adhesion might drive movement of the cell forward. In NIH3T3 fibroblasts, a kinase dead, dominant negative mutant of PKD1 specifically inhibited retrograde flow of surface markers as well as filamentous actin (Prigozhina et al., 2004). Retrograde flow is strictly coupled to the anterograde transport from the TGN to PM in which PKD has a crucial role (Liljedahl et al. 2001). It was also shown that PKD1 influences cell migration by directing vesicular transport of the αvβ3 integrin heterodimer (Woods et al., 2004). RNAi-mediated knockdown of PKD1 or expression of a dominant negative PKD1 mutant abolishes PDGF-induced recycling of αvβ3 integrin from early endosomes to the plasma membrane and blocks recruitment of this integrin to nascent focal adhesions. This recycling process requires the direct association of PKD1 with the C-terminal region of the β3 integrin cyto-domain. These observations indicate that PKD1 influences cell migration by controlling vesicular transport of the αvβ3 integrin heterodimer. Several findings also link PKD1 to invasion of cancer cells, but the effects seem to vary amongst different cancers. PKD1 forms a complex with the actin-binding protein, cortactin, and the focal adhesion protein, paxillin at invadopodia (sites of extracellular matrix degradation) in invasive breast cancer cells (Bowden E. et al., 1999), suggesting a possible role for this kinase in 11 Introduction controlling the ability of cancer cells to invade the extracellular matrix. In myeloma cells, the pro- invasive factors IGF-I and Wnt both activate PKD1 (Qiang Y. et al., 2004 and 2005). Wnt stimulation causes association of PKD1 with Rho and several PKCs, and blocking Rho kinase led to PKD1 inhibition, suggesting that Wnt activates PKD1 via a Rho-ROCK-PKC pathway. In BON neuroendocrine cells, overexpression of PKD2 leads to increased proliferation and invasion (Jackson et al., 2006). Recent work has shown that PKD3 has a role in prostate cancer cell growth and survival. PKD3 expression is elevated in human prostate tumors, and disease progression correlates with an increase in PKD3 nuclear accumulation. PKCε acting upstream controls PKD3 activity and nuclear localization, and the effects of PKD3 on prostate cancer cells is coupled to the modulation of downstream ERK1/2 and Akt activities (Chen J., et al, 2008). On the other hand it has been reported that PKD1 has also anti-invasive properties. PKD1 is down-regulated in prostate cancer and is associated with altered cellular aggregation and motility in prostate cancer cells (Kennett S. et al., 2004; Palmantier R. et al., 2001). Prostate cancer cells require PKD1 activity to phosphorylate and activate E-cadherin. Inhibition of PKD1 in these cell leads to a decrease in cell aggregation and an increase in invasion (Jaggi et al., 2005). In contrast, Wang and co-workers (2008) demonstrated that expression of PKD1 was significantly higher in human prostate tumors compared with normal tissues. PKD1 is also a novel epigenetic target frequently silenced by promoter hypermethylation in gastric cancer, perhaps as an early event during gastric carcinogenesis. Kim et al., (2008) suggest that epigenetic silencing of PKD1 increases tumor cell invasiveness in gastric cancer. From these contradictory reports, it is obvious that much remains to be discovered about the precise role of PKD in cell motility and cancer.
1.2.3.3. Regulation of cell proliferation and differentiation
The role of PKD1 in the coordinated regulation of cell proliferation and differentiation has been well documented in keratinocytes. PKD1 expression levels correlate closely with enhanced keratinocyte proliferation (Bollag W. et al., 2004; Ernest D. et al., 2005; Rennecke J. et al., 1999; Ristich V. et al., 2006). Treatment of mouse skin with tumor inducing agents results in tumors that display high PKD1 levels (Rennecke J. et al., 1999; Ristich V. et al., 2006). Also, the potent PKD1 inhibitor Gö6976 stimulates transglutaminase activity (a marker of differentiation) in keratinocytes, suggesting that PKD1 normally represses keratinocyte differentiation (Shapiro B. et al., 2002). Elevated extracellular calcium and acute 12-O-tetradecanoylphorbol-13-acetate (TPA) treatments of keratinocytes (both differentiation inducing factors) induced differentiation and triggered a down modulation of PKD levels, autophosphorylation at serine 916, and activity. Chronic TPA treatment stimulated proliferation and resulted in a recovery of PKD levels, 12 Introduction autophosphorylation, and activity. TPA, a complete tumor promoter and phorbol ester, causes biphasic responses in keratinocytes, stimulating differentiation acutely and proliferation chronically, in situ (Yuspa et al., 1982a) and in vivo (Argyris et al., 1980; Toftgardet et al., 1985). Transfection of keratinocytes with PKD1 is sufficient to activate the keratin 5 promoter (a proliferation marker) and to inhibit the involucrin promoter (a differentiation marker) (Ernest D. et al., 2005). There is also a strong correlation between the degree of PKD1 expression and proliferation in NIH3T3 fibroblasts (Rennecke et al., 1999). Several studies document a potentiation of DNA synthesis and proliferation by overexpression of PKD1, an effect that could be in part explained by an increase in the duration of ERK activation (Sinnett-Smith J. et al., 2004; Zhukova E. et al., 2001).
1.2.3.4. Role of PKDs in Secretion
Transport of proteins through and emanating from the Golgi apparatus is characterized by the formation of vesicles from Golgi membranes (Glick et al., 1998; Warren et al., 1998). Golgi- targeted PKD1 is required for the fission of transport carriers destined to the cell surface (Liljedahl et al., 2001). Similar effects have been reported for PKD2 and PKD3 (Yeaman et al., 2004). It was proposed that PKDs regulate the secretory process by phosphorylating a set of proteins involved in generation and/or fusion of transport vesicles. PI4KIIIβ is one of the PKD1 and PKD2 substrates at the Golgi apparatus (Hauser et al., 2005.) PKD1 mediated phosphorylation stimulated lipid kinase activity of PI4KIIIβ and enhanced VSV-G transport to the plasma membrane. How these two kinases promote membrane fission during vesicle formation is the obvious next challenge.
1.2.3.5. Role for PKD in Angiogenesis
It was demonstrated that VEGF rapidly induces activation of PKD1 via the VEGFR2-PLCγ- PKC pathway, and that PKD1 is involved in VEGF-induced mitogen-activated protein kinase (ERK1/2) signalling and endothelial cell proliferation (Wong, C., and Jin, Z. G. 2005). Furthermore, it has recently been proposed that PKD1 regulates gene transcription by controlling the subcellular localization of class II histone deacetylases (HDACs) (Wang et al., 2008; Ha et al., 2008).VEGF stimulates PKD1-dependent phosphorylation of HDAC5 at Ser 259/498 residues in endothelial cells (EC), which leads to HDAC5 nuclear exclusion and myocyte enhancer factor-2 (MEF2) transcriptional activation (Ha et al., 2005). It was demonstrated that VEGF induces the phosphorylation of three conserved serine residues (178, 344, and 479) in
13 Introduction
HDAC7 via PKD1, which promotes nuclear export of HDAC7 and activation of VEGF- responsive genes in ECs (Zheng-Gen Jin et al., 2008). Further substrate identification will be needed to gain a better understanding of the precise contribution of PKDs to cellular signalling and regulation of cellular function. In the next section of this introduction we will focus on a signaling molecule that has also been implicated in cell migration and angiogenesis, and whose splice variant was identified as PKD2 substrate in this study.
1.3. Ca and Integrin Binding protein (CIB)
One important mechanism by which cells respond to changes in Ca2 levels involves the activation of EF-hand proteins. Upon Ca2+ binding, these proteins undergo structural changes that allow them to bind and activate target proteins. At least two specific structural changes can occur in EF-hand-containing proteins due to Ca2+ binding that facilitate signal transduction. The first type of change occurs when a hydrophobic binding pocket becomes accessible, thus facilitating ligand binding. The second type of change, termed a myristoyl switch, involves the extrusion of an N- terminal myristoyl group from a hydrophobic cavity in the protein, thereby leading to membrane localization. CIB1 is a 22-kDa EF-hand-containing, widely expressed regulatory protein. Two groups have recovered this calcium-binding protein in yeast two-hybrid screens and have named it CIB, for its calcium- and integrin αIIb–binding ability (Naik et al., 1997), and KIP, due to its interaction with eukaryotic DNA-dependent protein kinase, DNA-PKs (Wu and Lieber, 1997). Protein is also named calmyrin (for calcium-binding myristoylated protein with homology to calcineurin) because it describes its inherent properties without bias towards its multiple binding partners.
1.3.1. CIB structure
CIB1 possesses many features of some other Ca2-binding proteins containing EF hands, such as calmodulin, calcineurin and the neuronal calcium sensor (NCS) family of EF-hand-containing proteins. The 191–amino acid sequence of CIB1 has a number of notable features (Figure 5). The crystal structure for CIB1 has been determined and revealed a compact α helical protein containing four EF-hands (denoted EF1–4), of which the last two (EF3 and EF4) bind calcium ions as seen in many other EF-hand proteins (Yamniuk, et al., 2004). The major differences between CIB1 relative to the NCS and calcineurin B families are in the overall structure of EF1 and the N-terminal portions. It is not surprising that Ca2+ is absent from EF1, because it has an additional eight amino acids within the loop that normally binds Ca2+. EF2 is less radically
14 Introduction modified from a canonical EF hand domain, it has only one additional residue, but as EF1 does not have ability to bind Ca2+.
Figure 5: Calmyrin/Ca and integrin binding protein (CIB1) amino acid sequence and transcript expression pattern. The complete amino acid sequence of Calmyrin (CIB1) is shown in comparison to human calcineurin B. The two conserved calcium-binding EF hands are circled and the two EF hands that are disrupted in calmyrin are noted by a dashed line. Picture taken from Stabler et al., (1999).
In addition, CIB1 is N-terminally myristoylated (Stabler et al., 1999). The myristoyl group of CIB1 may target it to membranes since CIB1 fractionates with membrane fractions in both nucleated (Stabler et al., 1999)) and non-nucleated (Shock at al., 1999) cells. Stabler et al. also noted that the location of CIB could also potentially be regulated by a calcium-myristoyl switch, in which the myristoyl group would be either exposed or sequestered, depending upon the state of calcium binding. CIB mutants lacking the C-terminal EF-hand domain are mainly found in the cytoplasm which supports the concept that the EF-hand motif additionally determines its location and suggests that a C-terminal tag may also influence the distribution of CIB among the different subcellular locations (Haataja et al., 2001). Several groups have shown that all forms of
CIB (N-terminal, C-terminal, and untagged) showed a nuclear and cytoplasmic distribution. CIB1 contains a large hydrophobic channel just following the C terminus of the molecule. This hydrophobic channel could be important in peptide binding. Indeed, it has been demonstrated that residues within this C-terminal helix are critical for CIB1 binding to the αIIb cytoplasmic tail (Tsuboi et al., 2002). Several proteins in the sequence data base from arthropods to humans share significant sequence homology to CIB1 (Picture 6). Three proteins in humans with high homology to CIB1 are CIB2 (also known as KIP2), CIB3 (also known as KIP3), and CIB4, which share 59%, 62%, and 64% similarity, respectively. Based on the sequence alignment, all CIB homologs have a large insertion within EF1, strongly suggesting that this EF-hand cannot bind Ca2 in any of the CIB homologs. However, one notable difference among CIB homologs is that the EF2 loop of CIB2 and CIB3 contains more acidic residues than CIB1, indicating that CIB2 and CIB3 may each bind an
15 Introduction
2 additional Ca ion within this region (Gentry et al., 2004). There is currently no published data on any of the homologs.
Figure 6. Relationship of Ca and integrin binding protein 1(CIB1) with some of its nearest homologs. A: Evolutionary relationship of CIB1 with other Ca2+binding proteins. The dendrogram is colored to highlight the distinct families of CIB-like proteins (purple), calcineurin B-like proteins (blue), and neuronal calcium sensor (NCS) proteins (green). The proteins are human unless otherwise stated, and their NCBI accession numbers are included. Taken from Gentry et al.,( 2004)
CIB mRNA and protein are widely distributed in a variety of tissues. Probing of a multiple-tissue Northern blot with CIB cDNA indicated a single species of mRNA in all tissues examined, especially in pancreas and heart. The anti-CIB antibodies detected the endogenous immunoreactive band at the 22 kDa in most tissues tested with slightly lower levels in kidney (Hollenbach et al., 2002). CIB1 was successfully detected in several mouse tissue lysates (Stabler et al 1999). Saito et al. (1999) identified a high conservation between the human and mouse CIB proteins (only five dissimilar residues). CIB protein is also expressed in cell lines of megakaryocytic or erythrocytic lineages, i.e. DAMI, Meg 01, K562 and HEL, and in the non- haematopoietic T47D breast epithelial carcinoma cell line (Shock et al., 1999).
1.3.2. Molecular interactions of CIB1
CIB1 was originally identified as a specific binding partner for the αIIb cytoplasmic domain of platelet integrin (Naik et al. 1997). Although CIB1 is expressed in a variety of tissues including
16 Introduction platelets, its potential interaction with other integrin α or β subunits has not yet been reported to date (Naik et al., 1997; Shock et al., 1999; Barry et al., 2002). CIB1 also interacts with several protein kinases, such as p21-activated kinase 1 (Leisneret al., 2005), FAK (Naik and Naik, 2003a), DNA-dependent protein kinase (Wu, Xet al.,1997), the polo-like kinases Fnk and Snk (Kauselmann, G., et al., 1999) and with some additional CIB1-binding proteins like Rac3 (Haataja, L., et al., 2002), Pax3 (Hollenbach, A. D., et al., 2002) and presenilin (Stabler, S. M., et al., 1999).
1.3.2.1. CIB 1 and Integrins
Integrins are transmembrane receptors that mediate cell adhesion and cell migration. They are heterodimeric integral membrane proteins composed of noncovalently associated α and β subunits (1–3). ). Integrins can exist in a resting conformation in unactivated cells and convert to an active conformation upon cell stimulation, resulting in a conformational change that allows the integrin to bind its adhesive protein ligands with higher affinity. αIIbβ3, a platelet- and megakaryocytes specific integrin is essential for hemostasis by virtue of its role in mediating platelet aggregation and spreading on vascular matrices at sites of injury in the vascular wall (Tsuboi 2002). Both in vivo and in vitro binding studies using intact αIIbβ3 as well as αIIb cytoplasmic domain peptides have shown that CIB specifically binds to the cytoplasmic domain of αIIb and that its affinity is enhanced in the presence of Ca2+ (Shock et al. 1999; Barry et al. 2002; Tsuboi 2002). The CIB1 binding region of αIIb has been delineated, and corresponds to a membrane-proximal portion of the cytoplasmic tail, including several amino acids within the putative transmembrane domain (Barry, W. T., 2002). A homology model of CIB indicated a conserved hydrophobic pocket within the C-terminal EF-hand motifs of CIB as a potential integrin-binding site (Barry, W. T., 2002). CIB1 binding to αIIb appears to modulate the activation state of the integrin (Yuan, W., et al 2003; Tsuboi, S. 2002), platelet spreading (Naik, 2003) and FAK activation (Naik, 2003). Vallar et al. (1999) showed that CIB is not involved in activation of αIIb and, in fact, interacts prefereably with the high affinity state of αIIbβ3. This places the function of CIB in the category of post-receptor occupancy events. CIB1 appears to inhibit agonist induced integrin activation in megakaryocytes by competing with talin for binding to αIIbβ3, thus providing a model for tightly controlled regulation of αIIbβ3 activation (Yuan et al., 2006).
17 Introduction
1.3.2.2. Role for CIB1 in ischemia-induced pathological and adaptive angiogenesis
CIB1 is expressed in highly vascularised adult mouse organs, embryonic vascular structures, and endothelial cells (ECs). Because CIB1 associates with angiogenic kinases such as PAK1 and FAK, Zayed et al., (2007) hypothesized that CIB1 may contribute to EC function. They demonstrated that endothelial cells depleted of CIB1 have reduced migration, proliferation, and tubule formation. Moreover, loss of CIB1 in these cells decreases p21-activated kinase 1 activation, downstream extracellular signal-regulated kinase 1/2 activation, and matrix metalloproteinase 2 expression, all of which are known to contribute to angiogenesis. Consistent with these findings, tissues derived from CIB1-deficient (CIB1-/-) mice have reduced growth factor–induced microvessel sprouting in ex vivo organ cultures and in vivo Matrigel plugs. Furthermore, in response to ischemia, CIB1-/- mice demonstrate decreased pathological and adaptive angiogenesis, increased tissue damage and significantly reduced p21-activated kinase 1 activation.
1.3.2.3. Role of CIB1 in regulating PAK1 activation and cell migration
Upon adhesion to ECM, cytoskeletal rearrangements occur that lead to cell spreading, actin turnover, and cell migration. The p21-activated kinase (PAK) family of serine/threonine kinases plays a significant role in regulating these processes (Kiosses et al., 1999; Sells et al., 1999). CIB1 binds to and specifically activates PAK1 both in vitro and in vivo via a specific CIB1-binding region within PAK1. CIB1 binding to PAK1 is calcium dependent and is inhibited by active GTP-Cdc42. The CIB1-binding sites within PAK1, map to the NH2-terminal residues within the inhibitory switch (IS) domain, thereby providing a mechanism by which CIB1 directly activates PAK1. The CIB1–PAK1 interaction is required for normal adhesion-induced PAK1 activation, which negatively regulates cell migration across fibronectin and appears to involve a PAK1– LIMK–phosphocofilin pathway (Leisner et al., 2005). Overexpression of either PAK1 or CIB1 inhibited both REF52 and NIH3T3 cell migration towards low FN concentrations. Importantly, overexpression of CIB1 in PAK1-null MEFs, unlike wild-type MEFs, did not suppress cell migration on low concentrations of FN, further demonstrating the requirement of PAK1 in CIB1-induced inhibition of cell migration. (Leisner et al., 2005). Many data indicate involvement of CIB1 in the regulation of cell migration. However, the precise function of CIB1 in migration has not been clearly delineated. A fundamental question is how CIB1, regulates cytoskeletal dynamics that ultimately impact cell migration. Because CIB1 is widely expressed and interacts with a variety of proteins, it is possible that CIB1 may have different functions in different cell types. It was reported that stable overexpressed human CIB1
18 Introduction induced cell migration on FN through the regulation of FAK activation in CHO cells (Naik et al.,2003). A separate report indicated overexpression of human CIB1 in CHO cells also overexpressing two additional CIB1 binding partners, Rac3 and integrin αIIb3, resulted in αIIb3- dependent cell spreading on fibrinogen (Haataja et al., 2002). The presence of additional CIB1- binding partners in other cell lines induces the opposite function of CIB1 in the migration. Overexpression of CIB1 inhibited REF52, NIH3T3 and MEF cell migration, in a PAK1- dependent manner (Leisner et al., 2005). In agreement with overexpression studies, depletion of CIB1 from HeLaS3 cells resulted in a dramatic increase in cell migration, further supporting an inhibitory effect of CIB1 on the cell migration (Leisner et al., 2005). It was also shown that CIB1 interacts with Pax3 in vitro and inhibits the transcriptional activity of Pax3 by inhibiting Pax3 from binding to DNA in vivo (Grosveld et al., 2002). Expression of PAX3 required during embryogenesis for the proper migration and specification of progenitor cells, including neural-crest-derived cells and myogenic precursor cells, to reach their final tissue destination (Buckingham et al., 2004). Endogenous Pax3 and CIB1 are co-expressed and co- localize in undifferentiated primary myoblasts and that CIB1 expression levels increase in the nucleus upon myogenic differentiation, consistent with the repression of Pax3 transcriptional activity during the early stages of myogenesis. Further study of CIB1 and its relationship to other binding partners, will provide a greater understanding of cytoskeletal regulation and migration in both normal and pathological conditions such as metastases and invasion.
19 Introduction
1.4. Aim of the study
The aim of this study is to further position PKD2 in the ever expanding map of intracellular signal transduction pathways. More specifically we were interested in the role of PKD2 in cell migration and invasion, which are important hallmarks of cancer.
1.4.1. Identification and characterisation of PKD2 substrates
Identification of PKD2 substrate using the IVEC method Analysis of the identified substrates for the occurrence of PKD consensus phosphorylation site motifs, and experimental examination whether these predictions are correct. If consensus phosphorylation motifs are found in one or more of the family members, generation of phosphorylation-site mutants of the substrate(s) that (1): cannot be phosphorylated by PKD2 (Ser to Ala mutants), or that (2): mimic the PKD2 phosphorylated proteins (Ser to Glu mutants). Generation of a phospho-specific antibody directed against the PKD2 phosphorylation site in the substrate Localisation study of substrate and PKD2 Examination of functional consequences of substrate phosphorylation in various cell models
20 Materials and Methods
2. Materials and Methods 2.1. Chemicals and other products
Chemicals were purchased from following companies: Roche (Basel,Switzerland), BioRad (Mannheim), Merck (Darmstadt), Roth (Karlsruhe), Sigma (Diesenhofen), Fluka (Buchs,Switzerland), Qiagen (Hilden), Gibco/Invitrogen (Paisley, UK), Biochrom (Berlin), Amaxa/Lonza (Köln), Calbiochem (Nottingham, UK), Stratagene (Cedar Creek, USA), New England Biolabs (Ipswich, USA), Pierce/Thermo (Rockford, USA), Santa Cruz (Santa Cruz, USA), Orbigen (San Diego, USA), Promega (Mannheim), DAKO (Hamburg), BD Bioscience (San Jose, USA). 32P γATP (5000Ci/mmol; 37 GBq=1mCi) was purchased Amersham Pharmacia Biotech (Milan, Italy). Further informations are supplied with the corresponding method.
2.2. Cell biology 2.2.1. Cell lines
Table 2. List of cell lines used in this study. Cell Type Tissue Species
HEK 293 Embryonic kidney Homo sapiens/ATCC AGSe Gastric carcinoma Homo sapiens/ATCC Cos 1 Kidney African green monkey/ATCC U 87 Gliooblastoma Homo sapiens/ATCC HeLa Cervical carcinoma Homo sapiens/ATCC NIH 3T3 Emryonic fibroblasts Mus musculus /ATCC Panc1 Pancreatic carcinoma Homo sapiens/ATCC MiaPaca 2 Pancreatic Cancer Cells Homo sapiens/ATCC
AGS-E cells are AGS human gastric cancer cells (American Type Culture Collection) stably transfected with the expression construct pEF1a-CCK-2R comprising the full length coding region of the human cholecystokinin-2 receptor (CCK-2R) All cell lines, were maintained in Dulbecco’s modified Eagle’s medium(GIBCO) supplemented with 10%(v/v) fetal bovine serum (Biochrom), penicillin (100U/ml), and 100 µg/ml streptomycin in a humidified atmosphere at 37°C under 5% CO2.
21 Materials and Methods
2.2.2. Transient transfection
According to cell type and application, different cell lines were transfected via different methods.
Table 3. Transient transfection methods applied in different assays. Cell Type Application Method Company
HEK 293 T Biochem. detection of proteins PEI Polyscience Inc HEK 293 T Biochem. detection of phosphorylation events PEI Polyscience Inc HeLa Migration Assay Fugene HD Roche* HeLa Immunofluorescence(microscopy) Nucleofection Roche* NIH 3T3 Immunofluorescence(microscopy) Nucleofection Amaxa* U87 Immunofluorescence(microscopy) Lipofectamine LTX Invitrogen* *Applied according to manufacturer.
2.2.2.1. Transfection with Poly Ethylen Imine (PEI)
Transfection of HEK293T was performed with Polyethyleneimine (PEI, linear, MW ~ 25000, Polysciences Inc., Warrington, Pennsylvania, stock concentration of 1 mg/ml) with a ratio of 1:7,5 (µg DNA : µlPEI). (Zhang C. et al., 2004).
TM 2.2.2.2. Transfection of cells with Nucleofector
The Nucleofector technology is a transfection technology especially designed for the difficult-to- transfect cell lines. It is a non-viral method which is based on a unique combination of electrical parameters and cell-type specific solutions. Nucleofection allows transfected DNA to directly enter the nucleus. In contrast, other commonly used non-viral transfection methods rely on cell division for the transfer of DNA into the nucleus. This method was used to transfect cells with a high efficiency for microscopy purposes. 6 1x10 cells were harvested by centrifugation for 3 min at 1000 rpm (Megafuge 10, Heraeus) at TM 20°C. Cells were then resuspended in 100 μl Nucleofector solution (Amaxa), subsequently mixed with 5 μg DNA and transferred into an Amaxa certified cuvette which was inserted into TM TM the Nucleofector . Cells were further processed with cell specific Nucleofector program and seeded according to manufacturers recommendations.
2.2.3. Activation of PKD2 in HEK 293T Phorbol ester activation of endogenous or overexpressed PKD2 in HEK293T cells was done by treating the cells with 400 nM phorbol 12-myristate 13-acetate (Calbiochem) for 10 minutes. The cell
22 Materials and Methods were plated in serum-free DMEM-medium and after 24 hours were stimulated with PMA as described above. Control cells received an equivalent amount of solvent (PBS).
2.2.4. Inhibition of nuclear export by leptomycin B (LMB)
Leptomycin B (LMB) is a streptomyces metabolite that blocks nuclear export by inhibiting the function of CRM1, a receptor for the nuclear export signal (NES). To block Crm-1 dependent nuclear export of proteins, cells (either non-transfected or transfected) were incubated with 10 ng/ml leptomycin B (LMB, Calbiochem) for 1 hour at 37°C. Control cells were incubated with the same amount of solvent.
2.3. Molecular biology 2.3.1. Enzymes and ready-to-use kits
Table 4. Enzymes used in site-directed mutagenesis and cloning procedures. Enzyme Name Supplier Restriction enzymes New England Biolabs DNA polymerases Taq polymerase Invitrogen Herculase Stratagene Pfu Turbo Polimerase Stratagene Ligase T4 DNA ligase Invitrogen Alkaline-Phosphatase Calf Intestinal Phosphatase(CIP) New England Biolabs
Table 5. Ready-to-use kits for molecular biology. Application Kit Supplier DNA preparation PureLinkTM HiPure Plasmid DNA purification Kit Invitrogen High Pure Plasmid Isolation Kit Roche DNA gel extraction QIAquick Gel extraction kit Qiagen RNA purification RNeasy mini Kit Qiagen Reverse transcription One Step RT PCR Kit Qiagen Cloning Kit Topo TA Cloning Kit Invitrogen SDM QuikCangeXL Kit Qiagen
23 Materials and Methods
2.3.2. Primers for cDNA constructs
Table 6. Primers used for CIB1a cloning DNA Construct Name Sequence
TOPO-CIB1a(clone2c) FCIB 5'-GAGGCGAGTTGGCGGAG-3' RCIB 5'-TGTGTCGACAGTGCGGGC-3' CIB S118A F-CIB S/A (SDM) 5'-GCAGGGTCTTCGCCACATCCCCAGCC-3' R-CIB S/A (SDM) 5'-GGCTGGGGATGTGGCGAAGACCCTGC-3' CIB S118E F-CIB S/E (SDM) 5'-GCAGGGTCTTCGAGACATCCCCAGCC-3' R-CIB S/A (SDM) 5'-GGCTGGGGATGTCTCGAAGACCCTGC-3' CIB T207A F-CIB T/A (SDM) 5´-GGATGGAGCCATCAACCTCTTTGAGTTCCAG-3´ CIB T207/A R-CIB T/A (SDM) 5´-CTGGAACTCAAAGAGGTTGATGGCTCCATCC-3` CIB 1 Inner R-CIB 5'-CCTGACGAAGCAGGAGATCCTCGCCCACAGGCGGTTTTGTG Inner F-CIB 5-CACAAAACCGCCTGTGGGCGAGGATCTCCTGCTTCGTCAGG Outer F- CIB 5-AGTGTGCTGGAATTCGCCC-3´ Outer R-CIB 5'-CACTGTCGACACAGGCTTGA-3' pGEX4T1-CIB1a C-Term F-CtermCIB 5'-ATCTGCAGGGAATTCTCCACATCC-3' R-CtermCIB 5'-TTCACCGTCATCACCGAAACG-3' pGEX4T1-CIB1a N-Term F-Nterm CIB 5'-TTGGTGGTGGCGACCATCC-3' R-NtermCIB 5'-ATGTGGAGTCGACCCTGCAGATTC-3' pEGFP-N1-CIB1a F-CTERM-CIB 5'-GTGCGCTAGCCGGGGCGAT-3' R-CTERM-CIB 5'-CCTCGGAGGAGGCCTCGAGGA-3' pcDNA-CIB1a-RFP F-RFP-CIB 5'-GGACTCAGATCTCGAGCTCAAGCTT-3' R-RFP-CIB 5'-GGCTGCTGCTCGAGGACAATCTT-3' pcDNA3Cherry-CIB 1a F-Cherry-CIB 5'-TTGGTGGTGGCGACCATCC-3' R-RFP-CIB 5'-GGCTGCTGCTCGAGGACAATCTT-3' pcDNA3-CIB1a F-pcDNA3-CIB 5'-GAGTTGGCGGATCCGTGCG-3' RCIB 5'-TGTGTCGACAGTGCGGGC-3' pIRES-AcGFP-CIB1a F-Cherry-CIB 5'-TTGGTGGTGGCGACCATCC-3' R-IRES-CIB 5'-CTGGGGATCCTGTCACAGGACAA-3'
2.3.3 Plasmids
Table 7. Vectors used for cloning Plasmid Size[kb] Resistance Supplier pcDNA3 5.4 Ampicillin Invitrogen Flag-pcDNA3 4.7 Ampicillin Osswald F., Ulm pEGFP-C2 4.7 Kanamicin Clontech pEGFP-N1 4.7 Kanamicin Clontech pGEX-4T-1 4.9 Ampicilin Amersham pcDNA3-Cherry 7.5 Ampicilin Osswald F., Ulm pcDNA3-RFP 7.5 Ampicilin Osswald F., Ulm pIRES-AcGFP 5.3 Kanamicin Clontech pCMV-Tag 3b 4.3 Kanamicin Stratagene
24 Materials and Methods
Table 7. Overview of all recombinant plasmids generated in this study Insert Vector Restriction sites Construct Name *PKD2 and PKD2-mutants pcDNA3 EcoRI/XhoI pcDNA3-Flag-PKD2 *PKD2 and PKD2-mutants pEGFP-C2 EcoRI/XbaI pEGFP-C2-PKD2 *PKD1 pEGFP-C2 n/a pEGFP-PKD1 *PKD3 pEGFP-C2 n/a pEGFP-PKD3 #pCMV-FAK wt pCMV-Myc n/a pCMV-Myc-FAK wt ♦PAX 3 n/a n/a Flag-PAX 3 PKD2 and PKD2-mutants pGEX-4T-1 EcoRI/XhoI pGEX-4T-1-PKD2 Δ P-PKD2mutant pEGFP-C2 EcoRI/XbaI pEGFP-C2-PKD2 ΔP CIB 1a and CIB 1a mutants pGEX-4T-2 EcoRI/SalI pGEX-4T1-CIB1a CIB 1a and CIB 1a mutants pcDNA3 BamHI/EcoRI pcDNA3-CIB1a CIB 1a and CIB 1a mutants pEGFP-C2 EcoRI/SalI pEGFP-C2-CIB1a CIB 1a and CIB 1a mutants pEGFP-N1 NheI/XhoI pEGFP-N1-CIB1a CIB 1a and CIB 1a mutants pcDNA-Cherry BamHI/XhoI Cherry-CIB1a CIB 1a and CIB 1a mutants pAcGFP-IRES HindIII/EcoRI IRES-CIB1a CIB 1a and CIB 1a mutants pCMV-Tag 3b EcoRI/SalI Myc-CIB1a CIB1 and mutants pGEX-4T-1 EcoRI/SalI pGEX-4T-1-CIB1 *Cloned by Dr. A.Auer;#Gift from v.Wichert (Ulm);♦Gift from G.Grosveld (St. Jude Children's Research Hospital,Memphis)
2.3.4. Plasmid purification
The host E. coli XL-1 blue (genotype: recA1, endA1, gyrA96,thi-1,hsdR17,supE44, relA1, q r lac,[F'proAB, lac ZΔM15Tn10 (tet )], (Bullock et al, 1987) was used for the plasmid propagation. The PureLink™ HiPure Plasmid Purification Kits (Invitrogen) based on anion-exchange chromatography was used for the isolation of plasmid DNA. E. coli cells were harvested, resuspended and lysed and the lysate was subsequently neutralized. The cleared lysate was passed through a pre-packed anion exchange column. The negatively charged phosphates on the backbone of the DNA interacted with the positive charges on the surface of the resin. Under moderate salt conditions, plasmid DNA remains bound to the resin while RNA, proteins, carbohydrates and other impurities were washed away. The plasmid DNA is eluted under high salt conditions.
2.3.5. Computer programs for DNA analysis
For primer design and sequence analysis of nucleotides and amino acids CLC Free Work bench Version 3.0.3 (from CLC Bio A/C), Primer Premier 5 (from Premier Biosoft Intrnational) and MacMolly®Tetra, Version 3.9, 1999 (from SoftGene) were used. Internet analysis of nucleotides and amino acids was made with the Ensembl Genome Browser. Nucleotide sequences of all generated plasmids were verified by sequencing (GATC, Konstanz).
25 Materials and Methods
2.3.6. Cloning methods 2.3.6.1. PCR
The polymerase chain reaction (PCR) was used for the amplification of DNA segments with two defined (sense and antisense) primers for analytical (using Taq DNA polymerase, Invitrogen) or preparative (using Pfu Turbo DNA polymerase or Herculase, Stratagene) applications. A typical PCR reaction mixture for Taq- and Pfu- polymerase or Herculase (Table 10) as well as a PCR program profiles (Table 9) are listed below.
Table 9. PCR program PCR Condition Temperature Time 1 cycle 94°C 2 min
94°C 30 sec 30 cycles 40-68°C 50 sec 72°C 1min per 1kb
72°C 10 min
Table 10. PCR mixture Substance Concentration 10XBuffer 1x Taq- or Pfu-Polimerase 1U dNTPs each 0.2mM MgCl2 1.5mM Primers each 100ng DNA Template 100ng
2.3.6.1.1. Nested PCR
Nested PCR was done to increase the specificity of PCR reaction and reduce the contamination in products due to the amplification of unexpected primer binding sites. Nested PCR involved two sets of primers, used in two successive runs of polymerase chain reaction, the second set intended to amplify a secondary target within the first run product.
Table 11.Primers for nested PCR Primer Name Sequence
PCR I: F-RT-PCR-CIB No 3 5'- GACGTTCCTGACGAAGCAGGAGA -3' R-RT-PCR-CIB No4 5'- CTCAGACGC ACT AAG CCG TGT GT -3‘ PCR II: F-REAL-CIB 1a 5'- GAGACCGATCGCTGAGAACA -3' R-RT-PCR-CIB No4 5'- CTCAGACGCACTAAGCCGTGTGT -3‘
26 Materials and Methods
2.3.6.1.2. Overlapping PCR
Overlapping PCR (Figure 7) was used to make deletions within a gene. The method consists of three PCR steps. The first step is a conventional PCR reaction, in which oligonucleotide primers are partially complementary at their 5' ends to the adjacent fragments that are going to be fused. The second PCR step consists in the fusion of the PCR fragments generated in the first step using the complementary extremities of the primers. The third step corresponds to the PCR amplification of the fusion product. The final PCR product is a gene built up with the different amplified PCR fragments.
Figure 7. Strategy for performing deletion mutagenesis by PCR Fusion. To delete a designated fragment of a target DNA, a pair of primers partially complementary at their 5' ends to the adjacent fragments that are going to be fused were used in two independent PCR reaction. PCR fragments generated in the first step using the complementary extremities of the primers, were then fused in the additional PCR reaction
2.3.6.2. TOPO Cloning
The key to TOPO® cloning (Invitogen) is the enzyme DNA topoisomerase I, which biological role is to cleave and rejoin DNA during replication. Vaccinia virus topoisomerase I specifically recognizes the pentameric sequence 5´-(C/T)CCTT-3´ and forms a covalent bond with the phosphate group attached to the 3´ thymidine. It cleaves one DNA strand, enabling the DNA to unwind. The enzyme then relegates the ends of the cleaved strand and releases itself from the DNA. TOPO® vectors are provided linearized with topoisomerase I covalently bound to each 3´ phosphate. This enables the vectors to readily ligate DNA sequences with compatible ends
27 Materials and Methods
2.3.6.3. Site directed mutagenesis (SDM)
PCR-based site-directed mutagenesis was performed using Stratagene’s Quickchange XL site- directed mutagenesis kit according to the manufacturer (Stratagene, La Jolla, CA, USA). The basic procedure utilises a supercoiled double stranded DNA (dsDNA) vector with an insert of interest and two synthetic oligonucleotide primers containing the desired mutation. The oligonucleotide primers, each complementary to opposite strands of the vector, are extended during temperature cycling by using PfuTurbo DNA polymerase. PfuTurbo DNA polymerase replicates both plasmid strands with high fidelity and without displacing the mutant oligonucleotide primers. Incorporation of the oligonucleotide primers generates a mutated plasmid containing staggered nicks. Following temperature cycling, the product is treated with Dpn I. The Dpn I endonuclease (target sequence: 5´-Gm6ATC-3´) is specific for methylated and hemimethylated DNA and is used to digest the parental DNA template and to select for mutation containing synthesized DNA. DNA isolated from almost all E. coli strains is dam methylated and therefore susceptible to Dpn I digestion. The nicked vector DNA incorporating the desired mutations is then transformed into XL10-Gold®* Ultra competent cells.
Table 12.Cycling parameters for the QuikChange® XL method Segment Cycles Temperature Time 1 1 95°C 1 min 2 18 95°C 50 sec 60°C 50 sec 68°C 1min/1kb of plasmid lenght 3 1 68°C 7 min
Table 13. SDM-PCR mixture Substance Concentration 10× reaction buffer 1x dsDNA template 10 ng oligonucleotide primer #1 125 ng oligonucleotide primer #2 125 ng dNTP mix 0.6mM QuikSolution 1μl Pfu Polimerase 2.5 U
2.3.7. Generation of cDNA-constructs 2.3.7.1. Cloning of the pGEX 4T1-CIB 1a
To clone the CIB1 a, PCR on full-length CIB1a cDNA was performed using the primers:
5´-GAG GCG AGT TGG CGG AG-3'
28 Materials and Methods
5'- TGT GTC GAC AGT GCG GGC -3'
PCR product was by using TOPO Cloning Method subcloned into pCR II-TOPO vector, which in this case served as a shuttle vector. Then CIB1a was subcloned as an EcoR I/ SalI fragment into pGEX 4T 1 vector.
2.3.7.2. Generation of point CIB 1a mutants
Point mutations in the CIB1a sequence were generated using the site directed mutagenesis method. CIB 1a S118/ A; CIB S118/ E and CIB1a T207/A were prepared by using pGEX-4T 1- CIB1 as a template and the following primers:
5´-GCA GGG TCT TCG CCA CAT CCC CAG CC -3' 5´-GCA GGG TCT TCG AGA CAT CCC CAG CC 5´-GGATGGAGCCATCAACCTCTTTGAGTTCCAG-3´ (Only one strand is shown) for CIB 1a S118/ A; CIB S118/ E and CIB1a T207/A respectively.
2.3.7.3. Cloning of the Myc-CIB 1a
Myc-tagged CIB1a constructs (WT, SA and SE Mutants) were prepared as follows: -pGEX 4T-CIB1a (WT; SA; SE) was digested with EcoRI/SalI to cut out CIB1a and subsequently the EcoRI/SalI fragment was subcloned into pCMV-Tag3B vector.
2.3.7.4. Generation of the CIB1
The overlapping PCR was used to make deletion within CIB1a cDNA gene and generate CIB1. Two sets of primers in different combination were used in three PCR reactions to generate deletion.
PCR I: 5'- AGT GTG CTG GAA TTC GCC C -3 5'- CCT GAC GAA GCA GGA GAT CCT CGC CCA CAG GCG GTT TTG TG –3´ PCR I: 5'- CAC AAA ACC GCC TGT GGG CGA GGA TCT CCT GCT TCG TCA GG –3´ 5'- AGT GTG CTG GAA TTC GCC C -3
29 Materials and Methods
PCR products from previous two PCR´s were used together as a DNA template in third reaction with following combination of primers: PCR III: 5'- AGT GTG CTG GAA TTC GCC C -3 5'- AGT GTG CTG GAA TTC GCC C -3
Final PCR product was subcloned at first in pCR II TOPO Vector using TOPO Cloning method and then removed from TOPO vector as EcoRI / SalI fragment and subcloned into the pGEX 4T1 vector.
2.3.7.5. Cloning of the N- and C- terminal eGFP tagged CIB1a mutants
N- and C- terminal eGFP-tagged CIB1a constructs (WT, S118A and S118E mutants) were prepared as follows: - CIB1a (WT, S118A, S118E mutants) cDNA was removed as EcoRI/SalI fragment from pGEX 4T –CIB 1a plasmid and subcloned into pEGFP-C2 vector. -For C-terminal tagging of CIB1 it was necessary to remove the stop codon in a CIB1a gene and generate new restriction site instead. This was achieved using following primers which contained the required restriction sites (underlined).
5'- GTG CGC TAG CCG GGG CGA T -3' 5'- CCT CGG AGG AGG CCT CGA GGA -3'
The PCR product was digested with NheI and XhoI respectively and cloned in the corresponding sites of the pEGFP-N1 vector.
2.3.7.6. Cloning of the IRES-CIB 1a-GFP
IRES-CIB-GFP was prepared by performing PCR with pGEX-CIB1a (WT; S118A; S118E mutants) as a template, using the primers:
5'- TTG GTG GTG GCG ACC ATC C -3' 5'- CTG GGG ATC CTG TCA CAG GAC AA -3'
Reverse Primer include a restriction site for BamHI (underlined). The resulting PCR product was digested with EcoRI and BamHI restricition enzymes, and subcloned into the pIRES-AcEGFP vector.
30 Materials and Methods
2.3.7.7. Cloning of the pcDNA 3-CIB 1a
To clone CIB1a into pcDNA3 vector, PCR of full-length CIB1a cDNA using pGEX4T-CIB1a as template was performed using the primers:
5'- GAG TTG GCG GAT CCG TGC G -3' 5'- TGT GTC GAC AGT GCG GGC -3'
Forward Primer includes a restriction site for BamHI. Using TOPO cloning, PCR product was subcloned into the pCR II TOPO vector. Then CIB1a was removed from construct with BamHI and EcoRI digestion and subcloned into the pcDNA3 vector.
2.3.7.8. Cloning of the Cherry-CIB1a
To generate Cherry-CIB1a (WT, S118A, S118E) the stop codon was removed from the gene using primers containing the required mutation.
5'- TTG GTG GTG GCG ACC ATC C -3' 5´- GGC TGC TGC TCG AGG ACA ATC TT-3'
PGEX-4T1-CIB1a (WT, S118A, S118E) was used as template for the PCR. Product was cut with BamHI and XhoI and subcloned in the pcDNA3-Cherry vector cut with the same enzymes.
2.3.7.9. Cloning of the PKD2 plasmids
-In order to generate GST-PKD2, wild type (Wt), kinase dead (DA) and kinase active (SE) mutants were subcloned as EcoRI/XhoI fragments into pGEX4T Vector. -To create a GFP-PKD2-ΔP deletion mutant, PKD2 without the N-terminal polar region was amplified in two PCR reactions using following primers:
No 1 : 5'- CCCTAATGAATTCCTGGGGGA -3' No 2 : 5'- GCAGGAAGCCACTTTCCCTAGAA -3' No 2a: 5'- GGA AGC CAC TTT CTC TAG AAC AGT TCA T -3'
In the first PCR reaction (primers No 1 and No 2) the EcoRI site was introduced with a forward primer. PCR product was then reamplified using primers No 1 and No 2a. During the second reaction XbaI site was introduced at the C-terminal end of the PKD2. Finally, PCR product was subcloned in TOPO vector from which it is removed as EcoRI/XbaI fragment and subcloned in the pEGFP-C2 vector.
31 Materials and Methods
-Generation of PKD2 point mutants (kinase dead D695A ; kinase active S706/710E and S244E- S706/710E SE) and deletion mutants of the entire C1a/C1b (H139-C314, 176 amino acids), the C1a domain (H139-P185; 47 amino acids), PH domain, and kinase domain were described in the work of Dr. Alexandra Auer (Auer A., Dissertation 2006). PKD2 deletion mutants (PKD2- ΔC1a/C1b, PKD2-ΔC1a, PKD2 ΔC1b, PKD2 ΔKD and PKD2 ΔPH) and point mutants were inserted into pcDNA3-Flag1 via EcoRI and XbaI restriction sites.
2.3.8. RNA isolation and semi-quantitative RT-PCR
Total RNA was isolated using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instruction. Application of the QIAGEN One-Step RT-PCR Kit provided highly sensitive and specific RT-PCR using RNA instead of DNA. The kit contains optimized components (Table 3.11.) that allow both reverse transcription and PCR amplification to take place in a “one-step” reaction. The QIAGEN One-Step RT-PCR Enzyme Mix contains a specially formulated enzyme blend for both reverse transcription and PCR. -Omniscript and Sensiscript Reverse Transcriptases are included in the QIAGEN OneStep RT-PCR Enzyme Mix and provide highly efficient and specific reverse transcription. -HotStarTaq DNA Polymerase included in the QIAGEN OneStep RT-PCR EnzymeMix provides hot-start PCR for highly specific amplification. During reverse transcription, chemically modified HotStarTaq DNA Polymerase is completely inactive and does not interfere with the reverse-transcriptase reaction. After reverse transcription, reaction is heated to 95°C for 15 min to activate HotStarTaq DNA Polymerase and to simultaneously inactivate the reverse transcriptases. cDNA was amplified using the specific primer sequences summarized in table 14.
Table 14. Primers for one-step RT-PCR Gene RT Primer Product Length Ta opt (°C) CIB1 5'-GACGTTCCTGACGAAGCAGGAGA-3' 383bp 61 5'-CTCAGACGCACTAAGCCGTGTGT-3'
CIB 1a 5'-GAGACCGATCGCTGAGAACA-3' 405bp 57 5'-CTCAGACGCACTAAGCCGTGTGT-3 61
32 Materials and Methods
Table 15. Reaction components for one-step RT-PCR Component Volume/reaction Final Concentration RNase-free water Variable 5x QIAGEN OneStep RT-PCR Buffer* 10.0 µl 1x dNTP Mix (containing 10 mM 2.0 µl 400 µM of each dNTP Primer A Variable 0.6 µM Primer A Variable 0.6 µM QIAGEN OneStep RT-PCR Enzyme Mix 2.0 µl Template RNA Variable 1 pg – 2 µg/reaction
Total volume 50.0 µl
Table 16. Thermal cycler conditions Segment Time Temperature Reverse transcription 30 min 50°C Initial PCR activation step 15 min 95°C 3-step cycling Denaturation 0.5–1 min 94°C Annealing 0.5–1 min 50–68°C Extension 1 min 72°C Number of cycles 25–40 Final extension 10 min 72°C
2.3.9. Quantitative one step real time PCR
One step real time-PCR was carried out using the LightCycler® System (Roche, Mannheim, Germany). RNA was reversely transcribed and subsequently amplified using One Step QuantiTect® SYBR® Green RT-PCR-Kit (Qiagen).
2.3.9.1. Relative quantification
Gene expression level was calculated by determining the ratio between the amount of a target gene and an endogenous reference gene that is in all samples (housekeeping gene). The normalized value is determined for each sample and used to compare differential expression of a gene in different cell lines. The quantification procedure differs depending on whether the target and the endogenous reference gene are amplified with comparable or different efficiencies.
2.3.9.2. Determining amplification efficiencies
The amplification efficiency of endogenous reference gene and target gene were compared by preparing a dilution series for both genes from a reference RNA sample. Each dilution series is then amplified in real-time PCR and the CT values obtained are used to construct standard
33 Materials and Methods curves for targets, by plotting CT values (Y-axis) against the log of template dilution (X-axis). To compare the amplification efficiencies of the two target sequences, the CT values of target gene are subtracted from the CT values of reference gene. The difference in CT values is then plotted against the logarithm of the template dilution. If the slope of the resulting straight line is <0.1, amplification efficiencies are comparable.
2.4. Biochemical methods 2.4.1. SDS-PAGE and Western Blot
WCL-, IP- or GST-pull down samples were subjected to SDS-PAGE to analyse proteins. SDS- gel electrophoresis under denaturating conditions separates negatively charged proteins based on the molecular size as they move through a polyacrylamide gel toward the anode. The polyacrylamide gel was cast as a separating gel (1.5 M Tris, pH 8.8, 12%, 10% or 8% acrylamide) and topped by a 4% stacking gel (0.5 M Tris pH 6.8, 4% acrylamide). Proteins were transferred from gel to a PVDF membrane (Millipore) by electroblotting for 8 hour at 400 mA in a cold environment (transfer buffer: 25 mM Tris, 200 mM glycine, 20% (v/v) methanol). Membranes were blocked for 1 hour at room temperature in blocking buffer (5% dry milk powder in TBS + 0.2% Tween-20). Subsequently membranes were incubated with the appropriate primary antibody (dilutions are listed in table 3.14.) for 1 hour at RT or at 4°C over night with gentle agitation. Membranes were washed 3 times for 15 minutes with TBS-Tween and subsequently incubated with HRP-conjugated antibodies (anti-mouse 1:5000, anti-rabbit 1:5000, or anti-goat 1:25000) for 45 minutes at RT with gentle agitation. Membranes were further washed (3 times 15 minutes) with TBS-Tween. Finally HRP-linked secondary antibodies were detected by chemiluminescence (Pierce or Amersham). For SDS-PAGE and Western blot we used the electrophoresis and blotting system from Biorad Laboratories.
34 Materials and Methods
2.4.1.1. Antisera and Antibodies
Table 17. Antisera and monoclonal antibodies for the western blotting.
Specificity Suplier Species Dilution GFP Roche Mouse 1/1000 Myc-Tag 9B11 Cell Signalling Mouse 1/1000 GST Santa Cruz Mouse 1/1000 CIB(h-20) Santa Cruz Goat 1/800 CIB(h-115) Santa Cruz Rabbit 1/1000 P-CIB1a Van Lint J. , Leuven, Belgium Rabbit 1/1000 PKD2 Upstate Rabbit 1/1000 PKD2 Orbigen Rabbit 1/1000 PKD3 Orbigen Rabbit 1/1000 PKD(P-Ser916) Affinity purified from rabbit serum Rabbit 1/1000 PKD(P-Ser744/748) Cell Signalling Rabbit 1/1000 Anti-mouseIgG(peroxidase conjugated) Amersham Mouse 1/1000 Anti-RabbitIgG(peroxidase conjugated) BioRad Rabbit 1/5000
Anti-goat IgG(peroxidase conjugated) Jackson Immunoresearch Lab Goat 1/25000
2.4.2. Coomassie staining
Coomassie staining of polyacrylamide gels was performed for 30 minutes in a solution of Coomassie Brilliant Blue (Sigma, 0.4% Coomassie Brilliant Blue in 40% methanol and 10% acetic acid) followed by de-staining (40% methanol, 10% acetic acid) and drying under vacuum condition.
2.4.3. Preparation of whole cell lysates (WCL)
Cells were washed twice with phosphate-buffered saline (PBS), scraped in regular lysis buffer (50 mM Tris pH 7.6, 1% Triton-X-100, 1 mM DTT, 2 mM EDTA, 2 mM EGTA, Complete EDTA- free protease inhibitor mix (Roche), Phosphatase inhibitor mix (Phospho-Stop Roche)) and centrifuged at 15 000 x g for 15 min. Protein concentration was measured in triplicates using Bradford Protein assay from Biorad.
2.4.4. (Co-) Immunoprecipitation
Endogenous and overexpressed tagged proteins were immunoprecipitated from WCL with the TM respective antibodies. Cell extracts were pre-cleared with ProteinA-Sepharose 6MB (Pharmacia Biotech) for 30 min at 4°C and subsequently incubated with antibody for 1 - 2 h at 4°C. After
35 Materials and Methods addition of 30 μl ProteinA-SepharoseTM 6MB (Pharmacia Biotech) or anti mouse agarose (Sigma), mix was further incubated for 60 min. Beads were then pelleted by centrifugation at 14000 rpm (Centrifuge 5417C, Eppendorf) and washed twice with lysis buffer A. Finally samples were mixed with sample buffer and proteins were denaturated for 5 min at 95°C. Proteins were separated using SDS PAGE. For preparation of samples for kinase assays, agarose beads were washed once with lysis buffer A and twice with lysis buffer B (lysis buffer A without Triton- X100).
2.4.5. Catch and Release® v2.0 reversible immunoprecipitation
As additional approach for testing protein: protein interaction we also used Catch and Release Reversible Immunoprecipitation. Catch and Release System (Upstate) enables the elution of the antigen: antibody complex without denaturation, while ensuring minimal contamination by non- specific proteins in the eluate. System was used according to manufacturer’s instruction.
2.4.6. Production and purification of the phospho-specific CIB1a antibody
Dephospho- and phosphopeptides corresponding to the PKD2 phosphorylation sites in CIB1a were synthesised (CRVFSTSPAKDS, CRVFpSTSPAKDS; GenscriptCorporation) and coupled to Maleimide Activated mc Keyhole Limpet Hemocyanin (Pierce). The peptide-KLH conjugates were used to immunize rabbits. Antibodies were precipitated with 50 % ammonium sulphate from rabbit serum and redissolved in PBS (Harlow E. and Lane D., 1988, p. 298-299). Phosphospecific antibodies were purified sequentially on a phosphopeptide column and a dephosphopeptide column. These columns were prepared by coupling the peptides to SulfoLink resin (Pierce). Elution of antibodies from the phosphopeptide column was done with 100 mM glycine pH 3.0. The eluates were immediately neutralized with 1 M Tris-HCl pH 8 (antibodies were generated by de Kimpe, L. and van Lint, J. at the Department of Molecular Cell Biology, Faculty of Medicine, Katholieke Universiteit Leuven, Belgium)
Table 18.Phospho- and de-phosphopeptide used to immunize Name Peptide Background CIB1a Ser 118 CRVFSTSPAKDS Ser 118 is a phosphorylation site for PKD2 CIB1a Ser 118-P CRVFpSTSPAKDS
36 Materials and Methods
2.4.6.1. Antibody evaluation by ELISA
BSA-coupled phospho- and dephospho-peptides (table 3.15.) or MAPCs were coated on a microtiter plate (100 µl of 10 µg/ml solution in PBS per well) overnight at 4°C. Wells were washed three times with buffer A (PBS, 0.5 M NaCl, 0.1 % Tween-20, pH 7.2) and incubated with 100 µl of primary antibody (dilutions ranging from 1:1000 to 1:512000 in buffer A containing 3 % PEG6000) for 2 h at room temperature. Buffer A was used for another three washing steps. Secondary anti-rabbit HRP-conjugated antibody (diluted in buffer A containing 3 % PEG 6000) was incubated for 1-2 h at room temperature. Again three washes were performed with buffer A. Colorimetric detection of antibody was done with 3, 3’, 5, 5’-tetramethylbenzidine (TMB) as substrate for horseradish peroxidase (HRP). One tablet of TMB was dissolved in 1 ml
DMSO, 9 ml of 0.1 M citric acid – phosphate buffer, pH 5.0 was added and 2 µl of 30 % H2O2. 100 µl of the substrate solution was incubated for 15 min on the plate (in dark). The reaction was then stopped by the addition of 100 µl of 2 M H2SO4 and antibody-antigen recognition was quantified by reading the absorption at 450 nm in a spectrophotometer.
2.4.7. Expression and purification of GST-tagged proteins in bacteria
For expression and purification of fusion proteins produced in Escherichia coli we used the Glutathione S-transferase (GST) Gene Fusion System. The system is based on inducible expression of genes or gene fragments as fusions with Schistosoma japonicum GST. The protein accumulates within the cell’s cytoplasm. GST fusion proteins are purified from bacterial lysates by affinity chromatography using immobilized glutathione. CIB1a, CIB1, PKD2 were at first cloned into pGEX-4T vector in which expression is under the control of the tac promoter, which is induced by the lactose analog isopropyl b-D thiogalactoside (IPTG). E.Coli strain TOP 10 (Invitrogen) and NEB Iq Express Competent E.coli were used as a host for GST-proteins expression. The host bacteria were grown in Luria Bertani (LB) medium at 37°C to achieve exponential growth and OD of ~0.5. Incubation temperature was then decreased (20-30°C) 600 and bacteria were additionally grown for 30 minutes at a lower temperature to decrease metabolism and avoid formation of the inclusion bodies. Expression of GST-tagged proteins was stimulated by adding IPTG (Isopropyl-thiogalactopyaranid, peQLab) to a final concentration of 100-500μM, and the culture was grown at lower temperature for the next 4 hours. The cells were harvested by centrifugation at 5000 rpm (Suprafuge 22, Heraeus) for 20 minutes and the pellet was resuspended in the lysis buffer (500 mM NaCl, 50 mM Tris pH 7.5, 10 mM MgCl and 5% 2 glycerol (w/v), Complete protease inhibitor mix (Roche)). After addition of lysozyme (10 μg/ml,
37 Materials and Methods
Fluka) the cells were sonicated (3 X 10 seconds, constant pulse; B-15 Sonicator, Branson). The cell lysate was precleared by centrifugation (4000xg, 15 minutes, 4°C.; Suprafuge 22, Heraeus) The supernatant was incubated with GST-beads for 4 hours on a rotating wheel. Fusion proteins are eluted under mild, non-denaturing conditions using reduced 25mM glutathione (Sigma). The experiments were performed, either with proteins associated with the glutathione sepharose beads or with soluble proteins.
2.4.8. GST-pull down experiments
GST and GST-CIB1a proteins were produced as described under 4.7. Cells previously transfected with GFP-tagged PKD2 mutants were lysed in GST-pull down lysis buffer (TBS, 1%
Triton X-100, 2 mM EDTA, 5 mM MgCl2, Complete EDTA-free protease inhibitor mix (Roche)) and cleared by centrifugation at 15.000 x g for 20 min. Cell extracts were pre-incubated for 1 h at 4°C (rotating wheel) with GST protein bound to GST-beads as a pre-clearing step. GST and complexed proteins were removed from the lysate settling down the beads by centrifugation at 500 x g for 5 min. Precleared extracts were than incubated with The GST-CIB1a protein bound to GST-beads (in parallel with GST protein as a control condition) for 3 hours at 4°C while rotating. Beads with bound protein complexes were washed three times with TBS (150 mM Tris pH 7.5, 150 mM NaCl). Samples were denaturated by adding a Leammli buffer and incubating at 95◦C for 5 minutes. Proteins were separated by SDS-PAGE:
2.4.9. In vitro kinase assays
To examine PKD2 autokinase activity and in vitro histone or GST-CIB1a /CIB1 phosphorylation by PKD2 and its mutants, PKD2 was enriched by immunoprecipitation as described above. Immune complexes were washed with lysis buffer I (50 mM Tris pH 7.6, 1% Triton-X-100, 1 mM DTT, 2 mM EDTA, 2 mM EGTA, complete EDTA-free protease inhibitor mix (Roche), phosphatase inhibitor mix (Phospho-Stop Roche)), with lysis buffer II (buffer I without triton X- 100) and with kinase buffer (30 mM Tris-HCl, pH 7.4, 10 mM MgCl , 1 mM DTT) and then 2 resuspended in 20 μl of kinase buffer in the presence (for histone phosphorylation) or absence (for autokinase activity) of 0.5 mg/ml histone H1 or 2 μg GST-CIB1a/CIB1 and 100 μM 32 [γ P]ATP. Reactions were incubated at 30°C for 15 minutes during which kinase catalyzed transfer of the gamma-phosphate group of adenosine-5'-triphosphate (ATP) to a peptide. Reaction was terminated by adding an equal amount of the 5xSDS-PAGE sample buffer. Finally, the kinase activity is observed after performing SDS-PAGE and exposing the gel to x-ray or
38 Materials and Methods
Fujifilm's phosphor Imaging Plate. Phosphor Imaging Plate is a high-sensitive, two-dimensional sensor for the detection of radioisotopes. The AIDA Image Analyzer software was used for the evaluation and annotation of images that were obtained with the radioluminography scanner (Fuji Film BAS).
2.4.10. The In Vitro Expression Cloning (IVEC) Method
As an approach to define the spectrum of PKD2 substrates, we used an in vitro expression cloning method (IVEC). The system is a plasmid-based human adult brain cDNA library that is expressed using Promega´s GoldTNT®Express 96 Transcription/Translation System. Small plasmid pools are expressed in vitro and screened for a decreased mobility on denaturing polyacrylamide gels desired biochemical activity. Kinase substrates have a decreased mobility on denaturing polyacrylamide gels. Positive pools are progressively subdivided until a single cDNA encoding the active protein is isolated.
2.4.10.1. Preparation of protein pools
Protein pools were prepared by in vitro transcription/translation reaction using the TnT T7 Quick Coupled Transcription/Translation Kit (Promega) according to the manufacturer’s instructions.
Table 19. Components of IVEC Reaction Components Standard reaction 35S Methionine (1,000Ci/mol at 10mCi/ml) 1μl cDNA template (0.25μg/μl) 2μl Nuclease-Free water 2μl
For each reaction (i.e., one 20 µl pre-dispensed well of lysate), the components in the table 19. were added to the GoldTNT®SP6 Express 96 Plate to yield a final reaction volume of 25µ. Optimal results were obtained when 0.5µg pooled cDNA is used. The transcription/translation reaction was incubated at 30°C for 80 minutes. Radioactive aminoacids are incorporated during the translation reaction. The pool of proteins was then incubated with a modifying enzyme (catalytically active PKD2) and was assayed for modified mobility in SDS-PAGE analysis due to phosphorylation.
39 Materials and Methods
2.4.10.2. Identification of phosphorylated proteins by gel mobility assay
2.5 ml aliquots of the [35S] methionine labeled protein pools were mixed with phosphorylation buffer (final concentration 20mM Tris–HCl, pH7.5, 10% glycerol, 1.5mM DTT, 150nM microcystin-LR, 8mM NaF, 0.15 mM Na3VO4, 10mM MgOAc, 0.5 mM ATP) , with or without 0.2mM PKD2 ca (catalytically active protein kinase D2 ) in a final volume of 15ml. Samples were incubated at 30° C for 50 min, and then the reactions were terminated by adding 30ml of 3xSDS–PAGE sample buffer and boiled for 4 min. The denatured samples were separated on a 10% SDS polyacrylamide gel (BioRad). After electrophoresis, the gels were fixed in a methanol/aceticacid/H2Osolution (8/2/10,v/v/v) for 15 min, washed with distilled water for 10 min and vacuum dried . Labeled proteins were detected by 2–3 day exposure on Hyperfilm ECL film (Amersham). Films were examined for the presence of bands of altered mobility in the presence of added kinase. Once a pool possessing a candidate substrate was identified, the original cDNA pool was subdivided and retested until the single cDNA encoding the protein of interest was isolated.
2.4.10.3. Subdivision of positive pools and molecular identification of specific clones
Competent cells E.Coli XL-Blue (Promega) were transformed with 1µl of a 1:100 dilution of DNA from each well of the cDNA plate that corresponds to a positive well from the GoldTNT®SP6 Express 96 Lysate Plate. A dilution series of bacterial stocks were then spread on LB ampicillin-agar plates to achieve approximately 100–200 colonies per plate. 96 colonies were picked and grown individually in LB medium (plus ampicillin) over night on 37°C with appropriate agitation. All plasmid DNAs were isolated by using QIAprep Spin Miniprep Kit (QIAGEN) following the manufacturer’s protocol. Recovered DNA was then used in the secondary TNT® screen as in the initial screen. When a positive protein subpool was identified, the individual cDNA that corresponded to a positive subpool was further sequenced from both ends and compared with known sequences in GenBank using BLAST.
2.4.11. Computer programs for protein analysis
Expasy (www.expasy.org) was used for protein sequence analysis and alignments. Scansite was used to analyze PKD2, CIB 1a in silico. Scansite 2.0 is a peptide library-based algorithm that identifies short protein sequence motifs likely to bind to specific protein domains or likely to be
40 Materials and Methods phosphorylated by the specific protein kinase (www.scansite.mit.edu). Possible phosphorylation sites within protein were identified by the NetPhos. For general DNA sequence analysis we used the CLC Free Workbench (CLC bio A/S Science Park Aarhus, Denmark), MacMolly®Tetra, Version 3.9, 1999 (Soft Gene GmbH), and for the analysis of abi data Codon Code Aligner, V.1.4.4 Demo (Codon Code Corporation, Li-Con, Inc.) For the primer design we used Primer Premier Version 5.00 program (Premier Biosoft International; www.PremierBiosoft.com). The LightCycler Front Page 3.5 from Roche was used for the analysis the Real-Time PCR data. Statistical significances were calculated using the Graph Pad Prism software using Students t-test.
2.5. Imaging techniques 2.5.1. Time-lapse microscopy 2.5.1.1. Migration Assay
In order to verify effect of CIB1a on the velocity of cells, serum-starved tumor epithelial cells (HeLa) transfected with pIRES-AcGFP-CIB1a Wt -CIB1a S118A or CIB1a S118E mutant were subjected to a spontaneous migration on the Fibronectin and imaged for 14 hours by the time- lapsed microscopy. Glass bottom culture dishes (MakTek Corporation) were coated with 50 µg/ml of Fibronectin (Roche). Cells were transfected and after 24 hours were trypsinized and allowed to spread for 30 minutes on fibronectin coated dishes in 1%FCS DMEM,1% PenStrep. Migration of cells was monitored upon spreading. Imaging of living cells expressing GFP-IRES- CIB1a mutants was peformed with a BZ-8000 Keyence Fluorescence Microscope. An image is captured every 10 min for 14h. During the measurements cells were kept at 37°C in an atmosphere containing 5% CO2 using a Keyence Incubation Chamber. Motion picture (AVI format) was created from time-lapse images using BZ-Analyzer software (Keyence Corporation). The movement of cells was analyzed using tracking routines implemented in the ImageJ software. Three independent experiments were done for each CIB1a mutant.
2.5.2. Epi-fluorescence imaging and Laser scanning confocal microscopy (LSCM) To clearly identify subcellular structures and compartments and determine protein colocalisation, epi-fluorescence (BZ-8000 Keyence Fluorescence Microscope) and confocal microscopy (LSCM, LSM 510 META, Zeiss) were used.
41 Materials and Methods
2.5.2.1. Colocalisation of proteins
To reveal the localisation and co-localisation of PKD2, CIB1a and phospho-CIB1a , HeLa and U87 cells were transfected, after 24 h tripsynized and spread for 5 h on fibronectin coated cover slips in 10%FCS 1% PS DMEM. Cells were then washed three times with PBS and fixed with 3.7% (v/v) paraformaldehyd. After washing with PBS, the cells were incubated with 50 mM NH Cl for 10 minutes and subsequently washed with PBS three times. For cell permeabilisation 4 0.1% Triton X-100 was used for 10 minutes. As blocking solution was used, 1% fish skin gelatin to minimize unspecific binding. .After 30 min of blocking, primary antibodies (table 4.1) diluted in 1% fish skin gelatin were applied on cell samples and kept over night at 4°C. After washing in PBS, cells were subsequently incubated with secondary antibodies (Alexa Fluor, Molecular Probes) for 1 h at room temperature. Cover slips were finally embedded in Prolong Gold Anti- fade Reagent (Invitrogen). The images were taken using the BZ-8000 Keyence Fluorescence Microscope and LSM 510 META with a laser line of 488 nm (argon laser) and HeNe laser. Images were captured and merged in parallel.
2.5.2.2. Staining of endogenous proteins
To detect endogenous proteins cells were treated and fixed as described above. Cells were incubated with the primary antibody (dilutions are presented in table 20.) at 4°C over night. Secondary antibodies were AlexaFluor 568 and AlexaFluor 488 according with the application.
Table 20. Antibodies and Markers use d for co-localisation studies Specificity Dilution Application Supplier Vimentin 1:1000 mouse primary Ab for Vimentin detection Dako Paxillin 1:1000 mouse primary Ab for paxillin and FA detection BD Bioscience P-CIB1a 1:5000 rabbit primary Ab for detection of phospho CIB 1a J.v.Lint Golgin 97 1:1000 marker for golgi apparatus Phalloidin568 1:500 marker for actin cytoskeleton Invitrogen msAlexa488 1:5000 rabbit secondary Alexa coupled AB (green) Invitrogen rbAlexa568 1:5000 rabbit secondary Alexa coupled Ab (red) Invitrogen msAlexa568 1:5000 mouse secondary Alexa coupled Ab (red) Invitrogen msAlexa488 1:5000 mouse secondary Alexa coupled Ab (green) Invitrogen
42 Materials and Methods
2.5.2.3. Quantification of Focal adhesions
In order to determine the effect of CIB1a mutants on formation of focal adhesions (FA), 24h serum-starved HeLa cells transfected with pIRES-AcGFP-CIB1aWT, -CIB1a -SA or CIB1a-SE mutant were fixed and stained for paxillin as described above and imaged with epi-fluorescent BZ-8000 Keyence Fluorescence Microscope. Quantification was done by the Image J. To obtain the average surface of the focal adhesions, all paxillin positive FA in one cell were marked with “the polygon selection tool” and the number of pixels was measured in the selected area. The obtained average size and number of focal adhesion were normalized to the size of the cell. The average surface of the each cell was obtained the same way as described for focal adhesions.
43 Results
3. Results 3.1. Library screen
In an attempt to augment the spectrum of PKD2 substrates, we used the In Vitro Expression Cloning (IVEC) method (Figure 8A). Pools of approximately 100 clones from a cDNA library were transcribed and translated in vitro, and then the resulting S35 labelled protein pools were incubated with or without catalytically active PKD2 and assayed for the presence of phosphorylation. Phosphorylation of potential substrates was assessed by the kinase-dependent alteration in electrophoretic mobility in SDS-PAGE. Phosphorylation replaces neutral hydroxyl groups on serines, threonines, or tyrosines with negatively-charged phosphates. Addition of a negative charge changes the mass charge ratio of the protein leading to decreased mobility of the phosphorylated protein through the gel. Positive cDNA pools were progressively subdivided and single cDNA sub pools were re-assayed for the presence of the kinase-induced mobility shift. (Figure 8 B, C). This procedure yielded specific cDNAs encoding putative PKD2 substrates.
44 Results
Figure 8. Phosphorylation of single clones by catalytically active Protein kinase D2 (PKD2se). A.B: The strategy of the in vitro expression cloning (IVEC). 35S-Labelled protein pools were generated by in vitro transcription and translation of plasmid based, human adult brain cDNA library, using Promega´s Gold TnT SP6 Express 96 coupled Transcription and Translation System and incubated with(+) or without(-) catalytically active PKD2 (PKD2se). Substrates exhibit a lower relative mobility upon phosphorylation by PKD2se. Alteration in the electrophoretic mobility in figure B is indicated with red circle. A is taken from Promegas´s Neural Notes Issue 20, 2001. C: Single clones were identified by progressive subdivision of the positive pools. The 35S labelled proteins were synthesized from the single clone by in vitro transcription and translation and incubated with or without PKD2se, separated by SDS-PAGE and visualized by autoradiography. Arrows indicate single clone mobility shift caused by phosphorylation.
45 Results
3.1.1. Molecular identification of specific clones
Positive plasmid library inserts were sequenced from both ends and compared with known sequences in the GeneBank using the Ensemble BLAST. We found several cDNAs that encoded potential substrates of PKD2. Some of these cDNAs encoded N-terminally truncated polypeptides, produced by translation from Met codons positioned internally in the corresponding wild type open reading frames (ORFs). Although some of these truncated proteins may prove to be physiologically relevant substrates of the PKD2, we focused primarily on the ones encoded by a full-length cDNA. Sequence analysis of a positive clone indicated 1170-bp insert and an ATG sequence in a region making it the likely a translation start site. The open reading frame of 697 bp encodes a polypeptide with a predicted mass of 26 kDa. A consensus sequence for a polyadenylation recognition site (AATAAA) is located before the 3´ end. A search of GeneBank revealed that the cDNA encodes a human splice variant of the Calcium and Integrin binding protein (CIB), which we termed CIB 1a. The CIB1a is a splice variant generated by an intron retaining mode of splicing. It has an additional 120 bp located in the coding region of the N-terminal part of the cDNA. The retained part of the intron encoded amino-acids properly, containing no stop codon and causing no shift in the reading frame (Figure 9). Sequence analysis of CIB1a using “Prosite” (Sigrist et al., 2007; Bucher et al., 2002) revealed an N-terminal myristoylation site and the presence of two EF hand domains in C-Terminus.
46 Results
A.
B
Figure 9. Sequence analysis of the positive IVEC clone. A: cDNA sequence alignment of CIB1a (marked in black) with CIB1 (marked in green). Sequence analysis and alignment were done by MacMolly®Tetra, Version 3.9, 1999 (Soft Gene GmbH. B: Protein sequence of CIB1a. The two EF hand motifs are boxed and indicated in red. A putative myristoylation site is boxed and marked in blue. Protein sequence analysis was done using ExPASy Proteomics tools (NMT –The MYR Predictor, Scan site). The nuclear export sequence (NES) is marked and boxed in green (NetNES 1.1 server). IVEC =in vitro expression cloning, EF=helux-loop-helix structural domain found in family of calcium-binding proteins.
47 Results
3.2. Expression pattern of CIB1/ CIB1a
It has been previously determined that the CIB1 protein is expressed in platelets and in cells of megakaryocytic or erythrocytic lineage (Shock et al., 1999). To address the expression level of CIB1 and CIB1a in human cancer cell lines, we isolated total RNA from various cancer cell lines including a gastric adenocarcinoma cell line (AGSE), pancreatic cancer cell lines (Panc 1, MiaPaca2), glioblastoma-astrocytoma cell line (U87) and cervical cancer cell line (HeLa). Additionally we tested an embryonic kidney cell line (HEK 293T) since we used them as efficient system for overexpression of proteins in further experiments. RT-PCR was performed using CIB1- specific sense and antisense primers designed to amplify a 0.4-kb CIB1 and 0.5kb CIB1a segment. With these primers, we observed only the amplification of a 0.4-kb band in all the cell lines tested (Fig. 10, upper panel) indicating just the presence of CIB1-specific mRNA. We speculated that the CIB1a isoform is also amplified but was not visible in the same reaction. To confirm this we designed primers specific for CIB1a and we managed to amplify CIB1a in an independent reaction. Both PCR products have been sequenced and amplification of both CIB isoforms was confirmed (Fig. 10, lower panel).
Figure 10. Expression of CIB1 and CIB1a in human cancer cell lines. Both CIB1 and CIB1a were detected in cell lines tested.Upper panel: RT-PCR amplification using primers designed to amplify a 0.4-kb CIB1 and 0.5kb CIB1a segments. With these primers, only the amplification of a CIB1 RNA was observed. Lower panel: RT-PCR for amplification of CIB1a isoform. With CIB1a-specific primers, we observed the amplification of a 0.5-kb band indicating the presence of CIB1a mRNA in tested cell lines.Total RNA was isolated and RT-PCR performed as described under “Material and methods.” Lane 1, gastric adenocarcinoma (AGSE) cells; lane 2, cervical cancer cell line (HeLa cells); lane 3, pancreatic cancer cell lines (MiaPaca2); lane 4, Panc1 cells; lane 5, embryonic kidney cell line (HEK 293 cells); lane 6, glioblastoma-astrocytoma cell line (U 87 cells).
We also performed Western blot analysis using polyclonal and monoclonal anti-CIB antibodies in an attempt to detect CIB1 and CIB1a, in the above mentioned cell lines. Antibodies raised against amino acids corresponding to the C-terminus of CIB of human origin detected the
48 Results overexpressed CIB1 and CIB1a, while at the endogenous protein level, antibodies detected only a ~28kDa band in all the cell extracts. (Fig.11.). The theoretical predicted molecular weights of CIB1a is 26 kDa .The slightly higher than predicted molecular mass observed (on Western blots) may be due to post-translational modification of CIB1a. The theoretical molecular weight of CIB1 is 21,6 kDa and according to manufacturer, antibodies should detect CIB1 at molecular weight of 23 kDa. We did not detect endogenous CIB1 in any tested cell lysates despite the detection of CIB1 mRNA by RT–PCR. These results indicate that CIB1a could be the splice variant specifically expressed in the cancer or transformed cell lines (HEK 293T).
.
Figure 11. Expression of CIB and CIB1a proteins. Left Panel: Western blot analysis of overexpressed CIB1 and CIB1a in HEK293 cells transfected with Myc-CIB1 or Myc-CIB1a. Besides the band indicating presence of the overexpressed CIB1 protein, a band corresponding to CIB1a was detected using antibody raised against C-terminus of the CIB1. Right Panel: Endogenous expression of CIB1 and CIB1a protein in human cancer cell lines. Proteins from different cell lysates were first immunoprecipitated using an anti-CIB1 antibody, separated by SDS-PAGE, transferred to PVDF membranes, and blotted with the same CIB1 mAbs used for IP. At the endogenous protein level, only a band corresponding to the CIB1a isoform was detected in all cell extracts. The 26-kDa CIB1a appears to migrate at 28kDa, which could be due to the aberrant migration of the prestained molecular-mass markers or due to the post-translational modifications of CIB1a. The 24-kDa endogenous CIB1 was not detected. Lane 1, cervical cancer cell line (HeLa cells); lane 2, embryonic kidney cell line (HEK 293 cells); lane 3, glioblastoma-astrocytoma cell line (U 87 cells); lane 4, pancreatic cancer cell line (Panc1 cells); lane 5, gastric adenocarcinoma (AGSE) cells; lane 6, pancreatic cancer cell line (MiaPaca2).
We also performed real-time PCR with mRNA extracted from the previously mentioned cell lines to get an insight into CIB1a mRNA expression levels in different cell lines. We focused on the relative quantification of target gene transcript in comparison to a reference gene transcript. We found that all cell lines tested express CIB1a mRNA. The highest level was observed in the pancreatic cancer cell line Panc1 (Fig 12.).
49 Results
Figure 12. Quantification of the mRNA expression level of the CIB1a gene in various cell lines. CIB1a mRNA was detected in all tested cancer cell lines with highest levels in pancreatic cancer cell lines. The relative expression ratio was calculated on the basis of the PCR efficiency and crossing point deviation of the investigated transcript. The relative expression of the target gene is normalised with the expression of an endogenous reference gene to compensate inter-PCR variations between runs. As a reference or house keeping gene we used HMBS (Hydroxymethylbilansynthase) mRNA which is considered to be stable and secure. PCR and data analysis were performed by using Light Cycler and LyghtCycler Software respectively, (version 3.5, Roche). HeLa cells, cervical cancer cell line; HEK 293, cells embryonic kidney cell line; U 87 cells, glioblastoma-astrocytoma cell line; Panc1 cells, pancreatic cancer cell line; AGSE, gastric adenocarcinoma cell line; MiaPaca2, pancreatic cancer cell line.
3.3. In vitro phosphorylation of CIB1a by PKD2
To confirm that CIB1a is a direct substrate of PKD2, the CIB1a cDNA was subclonned into suitable expression vector followed by expression and purification of CIB1a protein from bacteria and analysed for the possible phosphorylation by recombinant PKD2 in an in vitro kinase assay (Fig.13). Wild type PKD2 and to a higher degree (** p<0.005) constitutively active PKD2 phosphorylated CIB1a in vitro. The CIB1a phosphorylation in the presence of inactive kinase (PKD2 DA) is insignificant compared to the level of phosphorylation observed with wild type and cataliticaly active kinase. When wild type PKD2 was immunoprecipitated from HEK 293 cells treated with PMA and used in in vitro kinase assays (IVKs), we observed an increase in CIB1a phosphorylation compared to phosphorylation observed in the presence of wild type PKD2.We have shown that also CIB1 splice variant is getting phosphorylated by active PKD2 (Fig., 13. C).
50 Results
Figure 13. In vitro phosphorylation of CIB1a and CIB1 by PKD2. A: In vitro kinase assay (IVK). HEK 293T cells were transfected with recombinant kinase eGFP-PKD2 WT (wild type), eGFP-PKD2 DA (kinase dead) or eGFP-PKD2-S706/710E (constitutively active kinase). 24h after transfection cells were incubated for 10 minutes with or with out PMA (400nM) and lysed. Lysates were tested for the equal expression of the recombinant kinase and, subsequently the kinase was immunoprecipitated. GST-CIB1a produced in E.Coli was then incubated with purified recombinant kinase, followed by SDS-PAGE and autoradiography. The AIDA Image Analyzer software was used for the evaluation and annotation of images that were obtained by radioluminography scanner (Fuji Film BAS). A: Western blot (WB) with anti-GFP antibody shows the equal levels of PKD2 mutant expression in HEK 293 cell lysates. B: Quantification of CIB1a phosphorylation by PKD2 mutants. Phosphorylation represented as % of the maximum, obtained with constitutively active kinase (PKD2 SE). Error bars indicate SEM of three independent experiments. Level of significance: ** p<0.005; *** p<0.00005. C: CIB1 phosphorylation by PKD2. In vitro kinase assay (IVK). HEK 293T cells were transfected with recombinant kinase eGFP-PKD2-S706/710E (constitutively active kinase). Recombinant kinase was immunoprecipitated from the cell lysate and incubated with or without GST-CIB1 followed by SDS-PAGE and autoradiography. GST-CIB1a was produced in E.Coli as described in Materials and Methods. PKD2=protein kinase D, PMA=Phorbol 12-myristate 13-acetate, activating phorbol ester of protein kinase D.
51 Results
3.3.1. Identification of the phosphorylated Serine in silico method and by computer modelling
The phosphorylation site in CIB1a was identified by in silico analysis using Scan site. Scansite is a computational tool built on experimental binding and/or substrate information from oriented peptide library screening and phage display experiments, together with detailed biochemical characterization to derive a weight matrix-based scoring algorithm that predicts protein– interactions and sites of phosphorylation. We searched for occurrences of serine threonine kinases group specific motifs in the CIB1a protein. Scansite search revealed the two sequences ERICRVFSTSPAKDS and SDIDRDGTINLFEFQ which have a certain resemblance to a PKD1 substrate phosphorylation motif (LXRXX (T*/S*). Identified sequences have a basic residue at position -3 (arginine) and a hydrophobic residue at position p-5 (isoleucine) with respect to the phosphorylatable serine/threonine (Fig.14. upper panel). A preference for an arginine at position p-3 is a requirement for all kinases from the AGC and CAMK group. The strong preference for a hydrophobic amino acid at p-5 was deduced from the oriented peptide library approach and its presence was observed in all the physiological PKD substrates identified so far. Another important feature we considered was the exposure of the serine towards the surface of the proteins of interest. Although in Scansite a surface accessibility plot is generated for each protein, we did not take this into account because this plot is calculated based on the primary sequence of proteins. Using DeepView/Swiss-PdbViewer we generated a hypothetical computer model of CIB1a with its phosphorylation sites based on the known crystal structure of the CIB1 isoform (Fig.14. lower panel). For proteins of known sequence but unknown structure, DeepView submits amino acid sequences to ExPASy to find homologous proteins, onto which subsequently the sequence of interest is align to build a preliminary three-dimensional model. Then DeepView submits the alignment to ExPASy, where the SWISS-MODEL server builds a final model, called a homology model and returns it directly to DeepView. Swiss-Model is a server for automated comparative protein modelling. Homology modeling, also called comparative protein modeling is the process by which a 3D model of a target sequence is built based on an homologue experimentally solved structure (experimental processes include X-ray crystallography and solution nuclear magnetic resonance),(DeepView – The Swiss-PdbViewer Manual, v 3.7;2001).
52 Results
Figure 14. Identification of the protein kinase D2 (PKD2) phosphorylation site in CIB 1a. Upper Panel: Motif Scan Graphic result. Possible phosphorylation sites within CIB1a were predicted using the Scansite 2.0, library-based algorithm, that identifies short protein sequence motifs likely to bind to specific protein domains or likely to be 118 207 phosphorylated by specific protein kinase. The CIB1a Scansite motif scan proposed Ser and Thr as a substrate phosphorylation sites for serine threonine kinases group. Lower Panel: Hypothetical model of CIB1a protein, with Ser118 and Thr207 highlighted yellow (indicated by arrow), which are surface accessible (DeepView/Swiss-PdnViewer 3.7, GlaxoSmithKlineR&D). Abbreviations: Ser=Serine, Thr=Threonine
3.3.2. PKD2 phosphorylates CIB1a on Ser 118 in vitro
To further examine the phosphorylation of CIB1a by PKD2, we mutated the identified phosphorylation sites. Ser 118 and Thr 207 and substituted these sites with alanine, thereby preventing phosphorylation. These mutants were first used in an in vitro kinase assay to assess
53 Results whether these sites contain the majority of the phosphate incorporated by PKD2 phosphorylation. As shown in Figure 15., mutation of Ser 118 to Ala118 abrogated phosphorylation of CIB1a by PKD2, while the mutant with substitution of Thr207 to Ala207 remained phosphorylated.
Figure 15. Protein Kinase D2 (PKD2) phosphorylates CIB1a at Serine 118 and not at Threonine 207. A: Schematic representation of CIB 1a S118A and T207A mutants. B: In Vitro Kinase assay (IVK) shows loss of CIB1a phosphorylation when Serine 118 is substituted with alanine while substitution of Threonine 207 with Alanine did not affect CIB1a phosphorylation. GST-CIB1a Wt (wild type), -S118A and -T118A fusion proteins were generated in NEB Iq Express Competent E.coli and their expression level was confirmed by Coomassie staining. HEK 293T cells were transfected with GFP-PKD2 SE (active kinase), lysed after 48 hrs and PKD2 was immunoprecipitated. Finally the GST-CIB1a fusion proteins were phosphorylated by immunoprecipitated PKD2SE in an in vitro kinase (IVK) assay (upper panel).
3.3.3. In vivo phosphorylation of CIB1a by PKD2
To investigate whether the phosphorylation site Ser118 was of physiological relevance, we raised phospho-specific antibodies against the peptide CRVFpSTSPAKDS (pS indicating phosphorylated serine) to investigate whether CIB1a is phosphorylated by PKD2 in intact cells. After sequential purification on a phospho-peptide column and a de-phosphopeptide column, the antibody displayed a very high specificity for phospho-Ser-118-CIB1a (Fig. 16, A, B). We co- transfected myc-CIB1a (wild type, and Ser118Ala or Ser118Glu mutants) with various PKD2 constructs (wild type, kinase-dead or constitutively active PKD2). As shown in Figure 16. we observed that wild type PKD2 phosphorylated myc-CIB1a and this phosphorylation was further enhanced upon PMA stimulation of PKD2. Furthermore, constitutively active PKD2 mutants (PKD2-S707/710E and PKD2- S244/707/710/E; von Blume et al., (2005,2007)) phosphorylated
54 Results myc-CIB1a, while the same was not observed with kinase-dead PKD2 mutant. The antibody did not detect CIB1a when Serine118 was substituted with Alanine or Glutamine.
Figure 16. Development of site-specific phospho-CIB1a antibody. A: Binding of the purified pSer 118 antibody to the corresponding phospho- and dephosphopeptides was analyzed via ELISA at the indicated dilutions. White bars represent absorbance values (450 nm) for dephospho-peptide recognition, gray bars are absorbance values (450 nm) for phospho-peptide recognition. The ELISA results indicate phosphospecificity of the antibody. B: P-CIB antibody only recognized the phosphorylated wild type CIB1a. 293T cells were transfected with wild type myc-CIB1a (Wt), phosphorylated (myc-CIB1a S118E) or non-phosphorylatable (myc-CIB1a S118A) mutants and wild type, kinase dead (eGFP-PKD2 DA), or kinase active (eGFP-PKD2 S706/710E and eGFP-PKD2 S706/710/244E) PKD2 mutants as indicated. Transfected cells were left untreated (-) or stimulated (+) with 400 nM PMA (10 min). Cell lysates were analyzed via Western blotting (WB) with anti phospho-Ser118 antibody (P-CIB, for CIB1a phosphorylation), anti- Myc antibodies (MYC, for CIB1a expression) or anti-GFP (GFP, for PKD2 expression). Abbreviations: PMA= PMA=Phorbol 12-myristate 13-acetate, activating phorbol ester of protein kinase D. .
3.4. PKD2 directly interacts with CIB1a
Having identified that PKD2 phosphorylates CIB1a we next examined whether PKD2 and CIB1a physically interact with each other. For this purpose Myc-CIB1a and GFP-PKD2 expression plasmids were co-expressed in 293T cells. Myc-CIB1a was immunoprecipitated, and the immunoprecipitate was probed for the presence of GFP-PKD2. Both proteins interacted, regardless of the order of immunoprecipitation (Fig. 17., A).
55 Results
To investigate this interaction in greater detail we also tested the presence of endogenous PKD2 in CIB1a immunoprecipitates. Immunoprecipitation of CIB1a from Panc 1 cell lysates specifically recovered endogenous PKD2 (Fig. 17., B). Vice versa, anti-PKD antibody co- immunoprecipitated endogenous CIB1a.
Figure 17. CIB1a interacts with PKD2. A: Lysates of HEK 293T cells transfected with GFP-PKD2 and Myc- CIB1a for 48h were subjected to immunoprecipitation (IP) with either anti-GFP or anti-MYC antibodies followed by western blot (WB) analysis. B: Endogenous PKD2 associates with endogenous CIB1a in Panc1 cells. Endogenous CIB1a and PKD2 were immunoprecipitated from Panc1 cells using the Catch and Release system (Upstate) followed by Western blot analysis.
3.4.1. Identification of the CIB 1a-binding site within PKD2
The PKD family consists of a group of three enzymes (PKD-1, -2 and -3) sharing a unique modular structure, consisting of two N-terminal cysteine-rich Zn-fingers, a central pleckstrin homology (PH) domain and a C-terminal Ser/Thr protein kinase domain. The N-terminus of both PKD1 and PKD2 starts with a hydrophobic region, rich in alanine and/or proline residues, while the same is absent in PKD3. In vitro binding experiments were performed to examine a direct interaction of PKD2 and CIB1a and to identify the specific interaction site in PKD2. A GST-full-length CIB1a fusion protein was overexpressed in E.coli, purified, immobilized on glutathione-Sepharose beads and then incubated with recombinant PKD2 –WT (wild type), - D695A (kinase dead) ,-S706/710E (catalytically active), or PKD2 deletion mutants as PKD2 -ΔCRD (deletion mutant without CRD domain), - ΔKD ( deletion mutant without kinase domain) ,- ΔPH (deletion mutant without PH domain) or -D5´ (deletion mutant without N-terminal polar region). The bound proteins were then analyzed by Western blotting. Full-length GST-CIB1a did not bind the PKD2 deletion mutant lacking the N- terminal polar region, but bound all the other PKD2 mutants (Fig.18.). This experiment suggests that CIB1a interacts directly with the N-terminal polar region of PKD2.
56 Results
Figure 18. Localisation of interaction sites in PKD2. A: N- terminal polar domain (AP) of PKD2 is necessary for the interaction with CIB1a. GST-CIB1a pull down was performed with lysates of HEK 293T cells transfected with eGFP-PKD2 -Wt, -DA,-SE, - ΔCRD,-ΔKD, - ΔPH or -D5´ mutants. GST-CIB1a fusion proteins was generated in NEB Iq Express Competent E.coli, purified and immobilised on gluthatione sepharose beads. The expression of PKD2 mutants in lysates and their interaction with GST-CIB1a were verified by western blotting (WB) with an anti- GFP antibody. B: Structure of the GFP-PKD2 mutants. PKD2=protein kinase D2, WB=western blot, Cys/CRD=cysteine rich domain, PH=pleckstrin homology domain, KD=kinase domain, AP-apolar domain.
To further test the N-terminal hydrophobic region as an interaction site for CIB1a we tested whether CIB1a also interacts with PKD1 or PKD3. All three PKD isoforms share a similar structure. A marked difference is present at the 5´-end. In PKD1, like in PKD2, the N-terminus is rich in polar amino acids. PKD1 interacts with CIB1a. In contrast, PKD3 which lacks this domain, did not interact with CIB1 (Fig.19.).
57 Results
Figure 19. Localisation of CIB1a interaction site in PKD1 and PKD3. A: Lysates of HEK 293T cells transfected with eGFP-PKD1 or eGFP-PKD3 and Myc-CIB1a for 48h were subjected to immunoprecipitation (IP) with either anti-GFP or anti-MYC antibodyes followed by western blot (WB) analysis. PKD1 interacts with CIB1a and N- terminal polar domain of PKD1 is necessary for the interaction (upper panels). An N-terminal polar region is absent in PKD3, and there is no interaction with CIB1a (lower panel). B: Structure of the eGFP-PKD1and eGFP-PKD3 mutants. PKD=Protein kinase D, PH=pleckstrin homology domain, KD=kinase domain, Cys=cysteine rich domain, AP= polar domain.
3.5. CIB1a directly stimulates PKD2 activity
CIB1 interacts with several protein kinases, including focal adhesion kinase (FAK) and 21- activated kinases (PAK) and functions as mediator of catalytic their activity (Leisner et al., 2006). Taking into account that the CIB1a isoform binds to PKD2 we investigated how this interaction affects PKD2 autokinase activity. In vitro kinase assays demonstrated that GFP-PKD2 alone exhibited some autophokinase activity. In the presence of the phoshomimic Myc-CIB1a S118E mutant PKD2 activity was significantly increased by 40% (*** p<0,005) (Fig. 20.A,C). Interestingly, Myc-CIB1a wild type had the same stimulatory effect. We speculate that this occurres due to the settings of the experiment; PKD2 is getting partially activated during transfection and co-transfected CIB1a wt is getting phosphorylated (Fig.20.,C.). On the other hand, activity of PKD2 was not increased in the presence of the not phosphorylatable CIB1a- S118A mutant. We conclude that a change in the physiological status of a substrate due to phosphorylation serves as a regulator of its upstream kinase, forming a positive feedback mechanism.
58 Results
Figure 20. Phosphorylation of CIB1a stimulates Protein Kinase D2 (PKD2) activity. A: HEK 293 cells were transfected with wild type PKD2 (eGFP-PKD2Wt) and Myc-Vector, Myc-CIB1a Wt (wild type CIB1a), Myc-CIB1a S118A (non-phosphorylatable CIB1a) or Myc-CIB1a S118E (phosphorylated CIB1a) mutants. Catalytically active GFP- PKD2 SE mutant was used as positive control.Cells were lysed and lysates were subjected to immunoprecipitation with an anti-GFP antibody (Ab). The expression level of the GFP-PKD2 or Myc-CIB1a mutants in lysates was determined by Western blotting using the GFP or Myc Abs. Immunoprecipitates were further subjected to in vitro kinase assays (IVC). Autophosphorylated PKD2 is indicated by an arrow. B: Level of PKD2 autokinase activity. The AIDA Image Analyzer software was used for the evaluation and annotation of images that were obtained by radioluminography scanner (Fuji Film BAS). Values shown are expressed as a percentage of the maximum kinase activity, represented by GFP-PKD2 SE mutant. Error bars represent SEM of three experiments (p<0.005***). C: Basal level of CIB1a phosphorylation by wild type kinase. HEK 293 cells were transfected with eGFP-PKD2 Wt and Myc-CIB1a Wt. Cell lysates were analyzed by WB using the P-CIB Ab to test CIB1a basal level of the phosphorylation by wild type PKD2 and compared to PMA induced phosphorylation. PMA=Phorbol 12-myristate 13-acetate, activating phorbol ester of protein kinase D.
3.6. Localisation of CIB1a
To investigate the consequences of PKD2- mediated phosphorylation of CIB1a at Ser118, we next performed colocalisation studies in a variety of cell lines such as HeLa, U87 and NIH3T3. CIB1a appears to have at least two regions that are important for subcellular localisation. The myristoyl group at the N terminus could target CIB1a to the membrane and the C terminally located EF hands could be involved in regulation of the calcium myristoyl switch, in which the myristoyl group would be either exposed or sequestered depending upon the state of calcium binding. This suggested that the presence of tags may influence the distribution of CIB1a among the different subcellular locations. Therefore, we used untagged as well as N- or, C-terminally-
59 Results tagged CIB1a in our study. The presence of tags, used in this study, did not have any effect on the CIB1a subcellular distribution, in fact, all forms of CIB1a wild type (N-terminal, C-terminal, and untagged) were localised mostly in the nucleus and at the plasma membrane (Fig.21.).
Figure 21. Localisation of tagged and untagged CIB1a in HeLa cells. We tested whether presence of N- terminal tag and C-terminal tag has any effect on CIB1a localisation. CIB1a localises in the nucleas and at the plasma membrane. Presence of tag did not affect CIB1 cellular distribution. Localization was examined in HeLa cells. A: Cells were transfected with N-terminal Myc-vector or Myc-CIB1a Wt (wild type), stained with H-115 CIB antibody (Ab) or Myc Ab and subsequently with AlexaFluor 488 (for Myc) and AlexaFluor 647 (for CIB). B: Cells were transfected with C-terminal GFP-vector or GFP-CIB1a Wt, stained with H-115 CIB Ab and subsequently with AlexaFluor 647 (for CIB) and Dapi (nuclei). Additionally C-terminal Cherry tag was tested. The cells were transfected with the Cherry-vector or Cherry-CIB1a wt and fixed. C: Cells were transfected with CIB1a-IRES-GFP and stained with the H-115 CIB Ab and subsequently labelled with AlexaFluor 647 (for CIB) and Dapi (nuclei). The CIB1a-IRES-GFP is giving expression of two not connected proteins (GFP and CIB1a). Imaging was performed using an epifluorescence microscope (Keyence).
60 Results
3.7. CIB1a interacts with PAX 3 It was demonstrated (Grovel et al., 2001) that CIB1 inhibits the transcriptional activity of Pax3 by blocking Pax3 binding to its recognition DNA sequences. CIB1 interacts with PAX 3 in vitro and the interaction is mediated by a region of the Pax3 paired domain that is involved in making DNA contacts. Considering the prominent localisation of the splice variant CIB1a in the nucleus, we wondered whether CIB 1a also interacts with Pax3 and whether its phosphorylation by PKD2 has an effect on the interaction. We overexpressed Flag-PAX3 and Myc-CIB1a wt, -SA or –SE mutants, subsequently lysed the cells, immunoprecipitated PAX3 and probed immunoprecipitates for the presence of CIB1a. All three CIB1a mutants interacted with PAX3, regardless of the order of immunoprecipitation (Fig.22). Phosphorylation did not have any effect on the binding capacity of CIB1a to PAX3.
Figure 22. CIB1a interacts with Pax 3 independently of CIB1a phosphorylation. Lysates of HEK 293T cells transfected with Flag-Pax3 and Myc-CIB1aWt (wild type), -S118A (non-phosphorylateble), or –S118E (phosphorylated) CIB1a mutants for 48h, were subjected to immunoprecipitation(IP) with either anti-Flag or anti- MYC Abs followed by western blot (WB) analysis. Pax 3 and CIB1a were immunoprecipitated from HEK 293T cells using the Catch and Release system (Upstate). PAX3=Paired box family transcription factor, Ab=antibody.
118 3.8. Phosphorylation of CIB1a on Ser induces its subcelular re-localisation
To monitor the localisation of CIB1a upon phosphorylation by PKD2, cells were co-transfected with Cherry-CIB1a wt and EGFP tagged wild type(wt) , kinase dead (-DA) or catalytically active PKD2 (2xSE and 3xSE) and subsequently stained using phospho-CIB Ab. It is apparent that in the cell lines tested (HeLa and U87), wild-type CIB1a (visualised by excitation of Cherry tag at 568nm) resides in the nucleus and upon phosphorylation moves to the cytoplasm localising to filamentous structures(visualised by excitation of the Cherry tag at 568nm and by P-CIB/ Alexa Fluor 647nm immunostaining) (Fig. 23., and 24.). The peripheral membrane localisation of
61 Results
CIB1a was not affected by phosphorylation. The cytoplasmic localisation of phosphorylated CIB1 was more pronounced in U87 cells compared to HeLa cells (Fig. 24.). Thus, phosphorylation of CIB1a governs the translocation of the protein from the nucleus to the cytoplasm. Non-phosphorylatable Cherry-CIB S118A mutant remains nuclear also in the presence of the active kinase.
Figure 23. Catalytically active PKD2 induces phosphorylation and subsequent translocation of CIB1a to the cytoplasm in HeLa cells. HeLa cells were plated on fibronectin coated cover slips and transfected with wild type CIB1a (Cherry-CIB Wt) and wild type (GFP-PKD2 Wt), kinase dead (GFP-PKD2 DA), or catalytically active PKD2 (GFP-PKD2 SE or GFP-PKD2 3xSE), as indicated. 24h after transfection cells were fixed and incubated with an antibody directed against phospho-CIB, followed by labelling with an Alexa 674 antibody. Images were captured by epifluorescent microscope (Keyence). The overlay of Cherry-CIB1a (red) and P-CIB (yellow –green) is indicated by the yellow color (merge). The size bars indicate 10 μm. PKD2= Protein kinase D2.
62 Results
Figure 24. Catalytically active PKD2 induces phosphorylation and subsequent translocation of CIB1a to the cytoplasm in Glioblastoma U 87 cells. U87 cells were plated on fibronectin coated cover slips and transfected with wild type CIB1a (Cherry-CIB Wt) and wild type (GFP-PKD2 Wt), kinase dead (GFP-PKD2 DA), or catalytically active PKD2 (GFP-PKD2 SE or GFP-PKD2 3xSE), as indicated. 24h after transfection cells were fixed and incubated with an antibody directed against phospho-CIB (P-CIB), followed by Alexa 674 staining. Images were captured by epifluorescence microscopy. The overlay of Cherry-CIB1a (red) and P-CIB (yellow–green) is indicated by the yellow color (merge) and higher power images of the boxed area. Size bars indicate 10 μm. PKD2= Protein kinase D2.
3.9. Nuclear export of CIB1a
Transport across the nuclear envelope occurs through the structurally conserved nuclear pore complex (NPC), a structure forming an aqueous channel (Stoffler et al., 1999; Ryan and Wente, 2000). Even though the internal diameter of the NPC allows passive diffusion of small proteins (<60 kDa), most proteins appear to be actively transported in and out of the nucleus. Several pathways of nuclear export have been identified (Ossareh-Nazari et al., 2001), but the export pathway, for which most knowledge has accumulated so far, requires a leucine-rich nuclear export signal (NES). Since that CIB1a relocates from to the nucleus to the cytoplasm upon phosphorylation we further examined how the transport occurs. We employed the NES
63 Results prediction server (NetNES; http://www.cbs.dtu.dk) to identify possible NES sites in CIB1a. NetNES sever predicted Leucine 135 as a possible NES in CIB1a protein (Fig.25.). NES contains a pattern of large hydrophobic residues, primarily leucines as the most conserved feature of NESs. In addition to the hydrophobic residues, glutamate, aspartate and serine also important for nuclear export signals, are present in the predicted NES (Figure 25). NES cannot be described by its hydrophobic pattern alone. The most important properties of NES are accessibility and flexibility to allow relevant proteins to interact with the signal.
. Figure 25. NetNES 1.1 prediction of the nuclear export signal (NES) in CIB1a protein. NetNES predicts residue Leucine 136 as possible NES site in CIB1a. The prediction server calculates the NES score from the HMM and Artificial Neural Network (ANN) scores (la Cour et al. 2004).
The karyopherin receptor CRM1/exportin 1/XPO1, hereafter called CRM1, has been identified as the export receptor for leucine-rich NESs in several organisms (Fornerod et al., 1997; Fukuda et al., 1997; Neville et al., 1997; Ossareh-Nazariet al., 1997; Stade et al., 1997; Haasen et al., 1999). CRM1-mediated export is effectively inhibited by the fungicide Leptomycin B (LMB) (Fornerodet al., 1997), providing excellent experimental verification of this pathway. To determine whether Leptomycin B would affect the nuclear export of cellular factors, the transport of phosphorylated CIB1a was analyzed in HeLa cells. Incubation of the cells in LMB blocked nuclear export of CIB1a; phosphorylated CIB1 was also trapped and exhibited maximum nuclear accumulation (Fig.26.). These data suggested that CIB1a relocalisation was dependent on active Crm1.
64 Results
Figure 26. Nuclear export of PKD2 is regulated by a CRM-1 dependent mechanism. LMB blocks nuclear export of CIB1a suggesting Crm1 dependent nuclear export. HeLa cells plated on fibronectin were transfected with wild type CIB1a (Chery-CIB1a Wt) and wild type (Wt), kinase dead (DA) or catalytically active (SE) GFP-PKD2 mutants, as indicated. 24h after transfection cells were incubated 1 h with 10 ng/ml LMB, fixed, subsequently labelled with a phospho-CIB1a Ab and Alexa Fluor 674 secondary Ab and imaged (epifluoresence microscope; Keyence). LMB=Leptomycin B, nuclear export inhibitor, CRM1=chromosomal region maintance 1 - nuclar export receptor, PKD2=protein kinase D2, Ab=antibody.
CIB1 phosphorylation by PKD2 promotes the nucleus–to–cytoplasmic redistribution of CIB1a, but how phosphorylation regulates redistribution has not yet been resolved. Redistribution of CIB1a could result from either phosphorylation dependent inhibition of nuclear import or activation of nuclear export. We next examined how CIB1a shuttles between nucleus and cytoplasm, and found that CIB1a coimmunoprecipitates with Crm1, suggesting additionaly a
65 Results
Crm1 dependent nuclear export of CIB1a (Fig. 27). We also observed that interaction was not dependent on CIB1a phosphorylation by PKD2; non-phosphorylatable (CIB1a S118A) and phosphorylated CIB1a (CIB1a S118E) mutant also interacted with Crm1 (Fig. 27). Therefore, phosphorylation of CIB1a by PKD2 is likely to play a role in the regulation of CIB1a nuclear entry, but this still remains to be elucidated.
Figure 27. CIB1a interactes with Crm1 independent of the phosphorylation by PKD2. A: HEK293 cells were transfected with Myc-CIB1a Wt (wild type CIB1a), Myc-CIB1a S118A (non-phosphorylatable CIB1a) or Myc-CIB1a S118E (phosphorylated CIB1a), lysed and lysates were used for immunoprecipitation (IP). CIB1a and Crm1 were immunoprecipitated using anti-Myc and anti-Crm1 antibodies, respectively. Immunoprecipitates were detected by anti-Crm1 or anti-Myc Western blotting as indicated. Abbreviations: PKD2=protein kinase D2, CRM1=chromosomal region maintance1/ karyopherin receptor, WB=western blot.
3.10. Phosphorylated CIB 1a colocalises with Vimentin
Localisation studies revealed that phosphorylated CIB1a was distributed throughout the cytoplasm along filamentous structures (high power images Fig.23 and Fig.24). This pattern of phosphorylated CIB1a resembled the expression pattern of the intermediate filament vimentin, the most abundant intermediate filament in cells of mesenchymal origin e.g. fibroblasts and endothelial cells. It is also transiently expressed in many cells during early stages of development and some cancer cells. HeLa cells express vimentin fibers mostly in perinuclear cytoplasm while the more flattened portions of the cell periphery do not show these fibres. The image analysis of vimentin /p-CIB1a co-staining in Hela cells demonstrated an extensive colocalisation between vimentin and p-CIB1a (Fig.28 higher power image). In order to confirm the staining and localisation pattern obtained in HeLa cells, the U87 glioblastoma cell line was also examined (Fig.29). This cell line appeared to have a more pronounced vimentin network compared to HeLa cells. Besides strongly expressing vimentin in
66 Results the perinuclear area, U87 cell also expressed vimentin in the peripheral cytoplasm. Phosphorylated CIB1a also colocalised with vimentin in U87 glioblastoma cells.
Figure 28. Subcelular distribution of wild type or phosphorylated CIB1a and Vimentin in HeLa cells. HeLa cells were plated on fibronectin coated cover slips and transfected with pcDNA3-CIB1aWt (wild type CIB1a) or pcDNA3-CIB1a S118A (non-phosphorylatable CIB1a) and, wild type PKD2, catalytically inactive (GFP-PKD2 DA) or active PKD2 mutant (GFP-PKD2 2xSE and 3xSE). Post-transfection cells were starved for 12 h, fixed and stained against vimentin(red) and P-CIB(yellow-green), followed by Alexa Fluor 674 and 568 secondary Abs staining. Imaging was performed with epifluorescent microscope. The overlay of vimentin (red) and P-CIB (yellow–green) is indicated by the yellow color (merge). Higher power image represents the merge of P-CIB and vimentin images. Size bars indicate 10 μm. PKD2=protein kinase D2, Ab=antibody, P-CIB=phospho-CIB.
67 Results
Figure 29. Subcelular distribution of wild type or phosphorylated CIB1a and Vimentin in U87 cells. U87 cells were plated on fibronectin coated cover slips and transfected with pcDNA3-CIB1a Wt (wild type CIB1a) or pcDNA3-CIB1a S118A(non-phosphorylateble CIB1a) and, wild type PKD2, catalytically inactive (GFP-PKD2 DA) or active PKD2 mutant (GFP-PKD2 2xSE and 3xSE). Post-transfection cells were starved for 12 h, fixed and stained against vimentin(red) and P-CIB(yellow-green), followed by Alexa Fluor 674 and 568 secondary Abs staining. Imaging was performed with epifluorescence microscope. The overlay of vimentin (red) and P-CIB (yellow–green) is indicated by the yellow color (merge). The higher power image of the boxed area represents also the merge of P-CIB and vimentin images. Size bars indicate 10 μm. PKD2=protein kinase D2, Ab=antibody, P-CIB=phospho-CIB.
3.10.1. CIB1a physically interacts with Vimentin
To evaluate whether CIB1a also physically interacts with vimentin and whether phosphorylation of CIB1a at Ser118 influences its binding in vitro, immunoprecipitations were performed. For this purpose pcDNA-CIB1a-Wt, -S118A or -S118E mutants were expressed in U87 cells. After 48h cells were lysed, subsequently CIB1a and vimentin were immunoprecipitated, and immunoprecipitates were probed for the presence of the immuno-complex. As shown in the Figure 30, phosphorylation of CIB1a did not have an effect on the CIB1a binding properties, all CIB 1a mutants are able to form complexes with Vimentin.
68 Results
Figure 30. CIB1a interacts with Vimentin. Phosphorylation of CIB1a at Ser 118 did not alter the interaction with vimentin. Lysates of U87 cells transfected with pcDNA-CIB1a-Wt (wild type CIB1a), -S118A (non-phosporylatable CIB1a) or S118E (phosphorylated CIB1a) mutants for 48h were subjected to immunoprecipitation (IP) with either anti-CIB or anti-Vimentin Ab followed by western blot analysis (WB). CIB1a and Vimentin were immunoprecipitated from U87 cells as described in Matherials and Methods. Lower panel shows level of endogenous Vimentin in U87 Cells. WCL=whole cell lysate.
3.11. Phosphorylated CIB1a promotes cell migration
Several studies indicated a role for PKD in the regulation of cell shape, motility, and adhesion. In order to further elucidate the role of PKD2 as a regulator of cell migration, we studied how phosphorylation of CIB1a by PKD2 affects cell migration. We chose HeLa cells as model, as these cells have been widely used as a model to study migration events. Due to their slow migration it is possible to observe even smaller changes in cell velocity. Upon adhesion to ECM, cytoskeletal rearrangements occur that lead to cell spreading, actin turnover, and cell migration. Cell migration on fibronectin was observed for 14h from the moment of cell spreading. Within a 14-hour period, CIB1a-S118E overexpressing cells migrated 20% and 40% faster compared to wild type and CIB1a–S118A transfected cells, respectively (Fig.31.)
69 Results
Figure 31. CIB positively regulates migration as a result of phosphorylation on Serine 118. Cells expresing phosphorylated CIB1a display 40 % higher velosity compared to cell expressing wild type and non-phosphorylatable CIB1a. A, B: In order to verify the effect of CIB1a on the velocity of cells, serum-starved HeLa cells transfected with pIRES-AcGFP-CIB Wt (wild type CIB1a), pIRES-AcGFP-CIB S118A (non-phosphorylatable CIB1a) or pIRES- AcGFP-CIB S118E (phosphorylated CIB1a) were subjected to spontaneous migration assays on fibronectin and imaged for 13 h by time-lapse video microscopy. Cells were tracked (red trail) and the velocity was calculated using the Image J program (National Institute of Health,USA;http://rsb.info.nih.goc/ij/Java 1.6.0_02). Values were significantly different (*p<0.01: ***p<0.001). Error bars indicate mean SEM of 20 cells per each condition.
3.11.1. Effect of CIB1a phosphorylation by PKD2 on FA formation
Disruption of the normal cell adhesion in malignant cells contributes to enhanced tumor cell migration and proliferation, leading to invasion and metastasis. In order for cells to migrate rapidly, adhesions are formed at the leading edge and are disassembled at the trailing edge (Le Clainche et al., 2008). Stress fibers and focal adhesions are functionally interactive structures. Focal adhesions initiate the elongation of stress fibers, and the tension generated by stress fibers enhances the growth of mechanosensitive focal adhesions. Because of the synergistic relationship between cell migration and cell adhesion, we also studied the effect of phosphorylation of CIB1a on the formation of focal adhesions. Focal adhesions were analysed in cancer cells (HeLa). For this experiment, cells were transfected with IRES-GFP-CIB –WT, - S118A or – S118E mutants, starved for 10h and subsequently stained for paxillin which is used as marker for focal complexes and phalloidine as marker for Actin.
70 Results
We found that in cells expressing CIB1a S118E (phosphorylated mutant) focal adhesions were most prominent, (Fig.32.). They were located at the cell periphery, especially at the leading edge of the cells associated with the end of the stress fibres (indicated in higher power images) (Fig.32.). We observed at the leading edge of cells expressing phosphorylated CIB1a more pronounced dendritically branched actin filaments compared to cells expressing wild type and non- phosphorylatable CIB1a. At the cell front actin assembly also exhibited extensions of finger-like protrusions called filopodia beyond the leading edge of protruding lamellipodia (indicated with the white arrows).
Figure 32. Effect of the CIB1a phosphorylation on the focal adhesion formation. To determine the effect of CIB1a phosphorylation by PKD2 on the formation of focal adhesions, we overexpressed CIB1a mutants (wild type, non phosphorylatable (S118A) and phosphorylatable (S118A)) in cells adhered on fibronectin. Cells were starved for 10h, fixed and stained for paxillin (focal adhesion-associated protein) and rhodamine phalloidine (high-affinity probe for F-actin). Cells expressing phosphorylated CIB1a expressed significantly more focal adhesions compared to cells expressing non-phosphorylated CIB1a. Focal adhesions were mostly localised at the leading edge of the cell associated with the end of the stress fibres. Cell observation and analysis was performed using epifluoresence microscopy. The higher power image of the boxed area represents the merge of paxillin and phalloidine images. Size bars indicate 10 μm.
To confirm our visual observations, size and number of paxilline positive focal adhesions were quantified using the Image J software (described in Materials and Methods). Calculations show that the number of focal adhesions formed in cells over-expressing phosphorylated-CIB1a
71 Results
(CIB1a S118E) significantly (P <0.05) increased compared to the focal adhesions formed in CIB1a wt and CIB1 S118A expressing cells (Figure 33.). The size of the focal adhesions remained the same in all three conditions.
Figure 33. Effect of CIB1a phosphorylation by PKD2 on Focal Adhesions (FA) formation. The number of focal adhesions formed in cells over-expressing phosphorylated-CIB1a was significantly increased compared to wild type and non-phosphorylatable CIB1a expressing cells, while the size of focal adhesion remained the same. Left panel: Average size of focal adhesions represented as % of the maximum. The size of paxilline positive FA in cells transfected with IRES-GFP-CIB1a Wt (wild type CIB1a), -S118A (non-phosphorylatable CIB1a), or –a S118E (phosphorylated CIB1a) mutant was measured using “polygon selection tool” of the Image J Program. Error bars indicate mean SEM of at least 5 cells analysed in each of the experiments, performed in triplicates. Right panel: Average number of the FA per µm2 of the cell. Number of the FA was normalized to the size of the cell. Statistical significance was checked by Student T-Test (p < 0, 05). PKD2=protein kinase D2.
72 Discussion
4. Discussion
Protein kinase D2 (PKD2) is a Ser/Thr kinase involved in many aspects of cellular regulation. The list of known physiological PKD2 substrates remained short in sharp contrast to its broad spectrum of established physiological functions. Therefore a lot of research still needs to be done to encrease our knowledge with regard to signalling cascades downstream of PKD2, enlightening the position of PKD2 in cellular signalling. Recently, attention has been given to the involvement of Protein kinase D1 in cell adhesion, cell invasion and cell migration. However, the precise function of PKD2 in these events, or the downstream targets involved in these processes, are still unknown. The main goal of this thesis is to identify physiological PKD2 substrates involved in one of these processes.
Identification of CIB1a as PKD2 substrate
In the present study, we made an attempt to identify PKD2 substrates that might be involved in cell adhesion, invasion and migration using an in vitro expression system (IVEC), a systematic and broadly applicable screen for kinase substrates. A total of 500 cDNA pools were translated in vitro using Promega’s Gold TNT® SP6 Express 96 Coupled Transcription/Translation System, and the translated proteins were assayed for phosphorylation by PKD2. Using this approach, we have identified several possible PKD2 substrates, and one of those – CIB1a (Figure 1A), is described here in detail. CIB1a is a splice variant of CIB1, generated by an intron retaining mode of splicing and it has additional 120 bp from the introns 2-3 in the N-terminal coding region. Sequence analysis of the CIB1a splice variant using “Prosite” revealed the presence of two EF hand in C-Terminus and N-terminal myristoylation site, which is typical for the molecules of the EF-hand super family. We have shown that both splice variants CIB1 and CIB1a are downstream targets for PKD2. Parise and co-workers (1997, 1999) have showed that CIB1 mRNA and protein are widely distributed in a variety of tissues, especially in the pancreas and the heart. It was also determined previously that CIB1 protein is expressed in platelets and in cells of megakaryocytic or erythrocytic lineage. In the this study, we observed expression of CIB1 and CIB1a in human cancer cell lines, and showed the presence of CIB1a mRNA in gastric adenocarcinoma cell line (AGSE), pancreatic cancer cell lines (Panc1, MiaPaca2) and a glioblastoma-astrocytoma cell line (U87). At the protein level we detected a 28kDa size protein, which corresponds to the size of CIB1a, while CIB1 was not detected.
73 Discussion
Characterisation of CIB1a as a PKD2 substrate and interaction partner
Using Scansite search, we could determine two potential PKD2 phosphorylation sites in CIB1a: Serine 118 (Ser 118) and Threonine 207 (Thr 207). Detailed analysis of the sequences surrounding these two residues have shown that the both sites have strong resemblance to the optimal PKD substrate phosphorylation motif (LXRXX (T*/S*). The hypothetical computer model of CIB1a 3D structure based on the known crystal structure of CIB1 isoform has depicted the exposure of the Ser118 and Thr207 towards the surface of the molecule. Further studies with Alanine (Ala) and Glutamic acid (Glu) substitution at these sites confirmed Ser118 as the PKD2 phosphorylation site. Using a phospho-specific Ser 118 antibody we were able to confirm that CIB1a is a direct in vitro and in vivo target for phosphorylation by PKD2. We further found that PKD2 and CIB1a physically interact in vitro and in vivo, and that the interaction site is located within N-terminal apolar region of PKD2. CIB1a also interacts with PKD1 but not with PKD3 which is missing N-terminal apolar domain. PKD1, 2 and 3 share a similar modular structure (illustrated in Chapter 1, Fig. 4), consisting of an N-terminal regulatory domain and a C-terminal kinase domain. The N-terminus of both PKD1 and PKD2 starts with an apolar region, rich in alanine and/or proline residues. In PKD3 this hydrophobic domain is absent. The three isoforms contain two cysteine rich Zn fingers, separated by Zn-finger linker region. In all three isoforms, the Zn fingers precede a region rich in negatively charged amino acids and a PH domain (Rykx et al. 2003). The homology between CIB1a, CIB1 and other EF-hand-containing proteins, suggested that the highly conserved hydrophobic pocket in CIB1a is a PKD2 binding site. Further experiments are needed to map the residues within PKD2 and CIB1a responsible for the interaction.
Caracterisation of biological function of CIB1a as PKD2 substrate
Our experiments showed that CIB1a is mainly localised at the nucleus and at the plasma membrane of cells. These results were consistent with the subcellular localisation predicted by bioinformatic tools (PSORTII; Horton P., and Nakai K.1999). It is known that the myristoylation of CIB1 as well as protein-protein interaction are important for the dynamic targeting of this protein to several sub-cellular compartments, including: the cytoplasm, long projections of the plasma membrane, and the nucleoplasm. Although a classical nuclear localization signal (NLS) was not identified CIB1a exists in the nucleoplasm and may be sequestered within the nucleoplasm by binding to nuclear resident proteins such as DNA-PKCs or PAX3, which have been shown to bind CIB1 in yeast two hybrid assays (Wu and Lieber, 1997; Grosveld et al., 2002). CIB1 is co-expressed and interacts with Pax3 inhibiting its transcriptional activity by
74 Discussion inhibiting Pax3 from binding to DNA in undifferentiated primary myoblasts (Grosveld et al., 2002). We demonstrated that also CIB1a inteacts with Pax3 and this interaction was not affected by the phosphorylation of CIB1a by PKD2. The regulation of the PAX3 transcriptional activity by CIB1a could be achived through CIB1a cellular redistribution upon phosphorylation by PKD2. One of the emerging themes associated with PAX genes, incuding PAX3, is their normal involvement in stem-cell self-renewal, both during fetal development and in adult life. This feature is important in morphogenesis, regeneration and repair of tissues, and is particularly relevant in the context of possible pathways by which cancer cells undergo self renewal and subsequent expansive division to generate a cancer mass. Whether phosphorylation and subsequent cytoplasmic relocalisation of CIB1a has effect on the transcriptional activity of PAX3 still remain to be investigated. Upon phosphorylation, nuclear CIB1a relocates from nucleus to the cytoplasm in HeLa and U87 cells, getting distributed along filamentous structures which showed great resemblances to the intermediate filament. The peripheral membrane localisation of CIB1a was not affected by phosphorylation by PKD2. The localization of CIB1a to the plasma membrane may similarly represent binding to αIIb-subunit of integrin, a known interaction partner of CIB1 (Parise et al., 1996, 2006). We also showed that nuclear export of CIB1a is blocked by Leptomicin B indicating potential regulation of the nuclear export of CIB1a by a Crm-1 dependent mechanism. The karyopherin receptor Crm-1, is an export receptor for leucine-rich nuclear export signals (NESs) (Fornerod et al., 1997; Fukuda et al., 1997; Neville et al., 1997; Ossareh-Nazari et al., 1997; Stade et al., 1997; Haasen et al., 1999). In silico analysis showed the presence of the NES within the CIB1a protein sequence. PKD2 phosphorylation of CIB1a promotes its nuclear-to-cytoplasmic redistribution, but how phosphorylation regulates CIB1a redistribution has not been resolved. Phosphorylation of nuclear CIB1a by PKD2 could increase its rate of nuclear export relative to nuclear import; alternatively phosphorylation could inhibit nuclear import of CIB1a. We found that CIB1a coimmunoprecipitates with Crm-1, confirming a Crm-1 dependent nuclear export mechanism for CIB1a. But the interaction of CIB1a with Crm-1 was independent of CIB1a phosphorylation by PKD2. The question whether phosphorylation of CIB1a by PKD2 has effect on nuclear import of CIB1a, still remains to be answered.
Functional effects of CIB1a phosphorylation by PKD2
Localisation studies revealed that phosphorylated CIB1a was distributed throughout the cytoplasm and co-localised with vimentin. We also verified a physical interaction between vimentin and CIB1a.Vimentin is the major structural component of intermediate filaments (IF) in
75 Discussion cells of mesenchymal origin, e.g. fibroblasts and endothelial cells (Franke et al., 1987) and in most types of tumor cells. It is well established that IFs are highly dynamic structures, which undergo active exchange between a major compartment of assembled IF polymers and a very small fraction of disassembled IF subunits. In order to achieve these dynamic properties IF proteins require an active support mechanism that maintains the exchange of subunits between the assembled and disassembled protein fractions. Goto and co-workers (2002) provided the evidence that vimentin can serve as an excellent substrate for PAK, and that phosphorylation is followed by the reorganisation of vimentin filament network. We speculate that vimentin phosphorylation and disassembly are related to CIB1a distribution. CIB1a might function as a docking station for PAK1 or some other kinase and could mediate activation of the kinase, which would further lead to vimentin phosphorylation. Previously it was reported that CIB1 directly and specifically interacts with PAK1 which results in kinase activation both in vitro and in vivo (Leisner et al. 2006). Therefore, further functional analysis of the effect of CIB1a on filament turnover could give the way for a better understanding of the functions of the vimentin and its connection to CIB1a and PKD2.
Functional effects of CIB1a phosphorylation by PKD2 on cell motility and adhesion
Several studies indicated a role for PKD in regulation of cell shape, motility, and adhesion. A link of PKD to cell migration is given with its substrate Kidins220 which is localized to a raft compartment of membrane protrusions at the leading edge of migrating dendritic cells (Riol- Blanco et al., 2004). Locomoting cells exhibit a constant retrograde flow of membrane proteins from the leading edge of the lamellipodia backwards, which when coupled to substrate adhesion might drive forward movement of the cell. Prigozhina and co-workers (2004) observed that the motility in fibroblasts was inhibited when a kinase dead PKD1 was expressed, which was due to the block in vesicle transport from the Trans Golgi network (TGN) to plasma membrane (PM). It has been demonstrated that active PKD1 associates with αvβ3 integrin. Suppression of endogenous PKD1 by RNAi, or overexpression of “kinase-dead”- PKD1 inhibited PDGF dependent recycling of αvβ3 from early endosomes to the plasma membrane and blocked recruitment of αvβ3 to newly formed focal adhesions during cell spreading. Therefore the group of Woods et al, (2004) concluded that PKD1 influences cell migration by directing vesicular transport of the αvβ3 integrin heterodimer in NIH 3T3 cells. There is evidence that CIB1 is also involved in regulation of cell motility and adhesion. It was reported that over-expression of human CIB1 in CHO cells also over-expressing two additional CIB1 binding partners, Rac3 and integrin αIIbβ3, resulted in αIIbβ3-dependent cell spreading on fibrinogen (Haataja et al., 2002). A separate report indicated that stably overexpressed human
76 Discussion
CIB1 in CHO cells induced cell migration on FN (Naik andNaik, 2003). Parise and co-workers (2006) demonstrated that CIB1 over expression significantly decreases cell migration on fibronectin in fibroblasts (NIHT3T) and epithelial (HeLaS3) cell lines as a result of a PAK1-and LIM kinase–dependent increase in cofilin phosphorylation. In contast, another study showed that over-expression of CIB in human platelates and mammalian epitheleal cells (CHO), enhanced the focal adhesion formation and consequently, cell spreading and migration. Furthermore, they found that CIB1 associates with FAK in these cells, and that FAK activity is up-regulated upon CIB1 over expression (Naik et al., 2003).Taken together, a role of PKD and also CIB1 in cell motility involves quite distinct, direct and indirect mechanisms of action. Finally, since the role for both PKD and CIB1 has been postulated in the regulation of the cell migration, we wondered whether PKD2 mediated phosphorylation of CIB1a would affect migration. We provided the evidence that cells expressing phosphorylated CIB1a were randomly migrating with 40% increased velocity compared to the cell expressing non-phosphorylated CIB1a. Our data sugests that PKD2 positively regulates cell migration by phosphorylating CIB1a. Because of a synergistic relationship between cell migration and cell adhesion we also studied effect of phosphorylation of CIB1a on the formation of focal adhesions. Cells expressing phosphorylated CIB1a expressed significantly more focal adhesions compared to cells expressing non-phosphorylated CIB1a. Focal adhesions were mostly localised at the leading edge of the cell associated with the end of the stress fibres. The exact role of PKDs in cell motility and cancer cell invasion is still unclear, and apparently varies amongst different cancers. In invasive breast cancer cells, PKD1 is found in invadopodia as a complex with cortactin and paxillin, whereas this complex is absent in non-invasive breast cancer cells (Bowden et al., 1999). In myeloma cells, the pro-invasive factors IGF-I and Wnt both activate PKD (Qiang Y. et al., 2004 and 2005). Wnt stimulation causes association of PKD with Rho and several PKCs, and blocking Rho kinase leads to PKD inhibition, suggesting that Wnt activates PKD via a Rho-ROCK-PKC pathway (Qiang Y.W et al., 2005). In BON neuroendocrine cells, overexpression of PKD2 leads to increased proliferation and invasion (Jackson et al., 2006). Recent work has shown that PKD3 contributes to growth and survival of prostate cancer cells (Wang et al, 2008). PKDs also have anti-invasive properties. Active PKD localizes to the leading edge and directly interacts with filamentous-actin (F-actin) in vitro (Hausser et al., 2007), making it very likely that PKD is involved in the regulation of actin remodeling, a fundamental aspect of cell migration and invasion. Indeed, wild-type (WT) PKD strongly inhibited migration of pancreas and prostate cancer cells, whereas dominant-negative PKD significantly increased cell migration (Hausser et al 2005; Jaggi et al., 2005). Most recent work shows that PKD1 directly phosphorylates and regulates SSH1L (slingshot 1 like), a phosphatase that activates the actin depolymerizing protein
77 Discussion cofilin by dephosphorylation (Storz et al., 2009). Consequently, expression of constitutively active PKD1 in HeLa cells enhanced the phosphorylation of cofilin and effectively blocked the formation of free actin-filament barbed ends and directed cell migration. Independently other group showed that PKD1 and PKD2 control migration of breast cancer cells via the SSH1L- cofilin signaling pathway (Hausser et al., 2009). How exactly CIB1a and its phosphorylation by PKD2 affect focal adhesion formation and cancer cell migration still remains to be elucidated. A possible explanation might be that CIB1a affects these processes indirectly through its interaction with vimentin and recruiting PKD2 to vimentin. It was previously showed the active remodelling of vimentin affects the organisation and expression of surface molecules that are critical for adhesion, thereby reflecting vimentin role in migration (Nieminen et al. 2006; Ivaska et al. 2005). Vimentin has been shown to associate with integrins and integrin containing adhesion sites (Gonzales et al, 1999; Homan et al, 2002; Kreis et al, 2005) and to mediate direct mechanical force transfer from the integrins at the cell surface all the way to the nucleus of endothelial cells (Maniotis et al, 1997). Ivaska et al., (2005) reported that the exit of endocytosed integrin from the intracellular vesicular compartment requires PKCε dependent phosphorylation of vimentin. Consistent with this requirement for vimentin phosphorylation in PKCε regulated migration and integrin recycling, a lack of vimentin in fibroblasts results in reduced mechanical stability and migration (Eckes et al, 1998). Whether phosphorylated CIB1a recruits PKD2 to vimentin and mediates activation of kinase, phosphorylation and reorganization of vimentin, still remains to be explored.
In conclusion, phosphorylation of CIB1a by PKD2 is probable mechanism which regulates subcelluar distribution of CIB1a, thereby providing the base of its interaction with specifically distributed intercellular partners.
78 Summary
5. Summary
Rapid tumour metastasis is a major problem in cancer, and little is known on the molecular events governing this process, however, features like changes in cell shape, modulation of cell-to- cell adhesion, enhanced cell motility and matrix degrading potential seem to be important. In the literature the protein kinase D (PKD) family of serine/threonine kinases, which consists of 3 structurally related isoforms, PKD1/PKCµ, PKD2 and PKD3/PKCν has been implicated in the regulation of some of these processes, yet the molecular mechanisms remain less explored. This prompted us to characterise the potential PKD2 substrates involved in this processes. During the course of this study, we have been able to identify a new substrate of PKD2 with a possible role in regulation of cytoskeletal organization and cell migration. As an approach to define the spectrum of PKD2 substrates, we used an in vitro expression cloning strategy (IVEC). We found that CIB1a act as a substrate for PKD2. CIB1a a splice variant of CIB1 (calcium and integrin binding protein), whose in vivo function and regulation is still poorly understood. CIB1 is also getting phosphorylated by the PKD2. We observed that CIB1a is the splice variant specifically expressed in the cancer cell lines what was not the case with CIB1. In silico analysis and hypothetical three dimensional model of CIB1a indicated Serine 118 as potential phosphorylation site within CIB1a, which phosphorylation by PKD2 we confirmed biochemicaly in vitro. We also developed phosphospecific antibody against phosphorylated sequence, and used it as tool to follow the in vivo phosphorylation of CIB1a by PKD2. Besides being a substrate for PKD2, CIB1a also functions as an interaction partner. We found that PKD2 interacts in vitro and in vivo with CIB1a and that binding site is localized within N-terminal polar region of PKD2. CIB1a interacts also with PKD1 which has similar structure of the N-terminus like PKD2. PKD3, in which N-terminal polar domain is absent, does not interact with CIB1a. We have shown that CIB1a localises in the nucleus and that after phosphorylation relocates to the cytoplasm. In silico analysis of CIB1a proved existence of NES (nuclear expert signal) within CIB1a and nuclear export was blocked in the presence of the Leptomicin B. We next examined how CIB1a shuttles between nucleus and cytoplasm, and found that CIB1a coimmunoprecipitates with Crm1 and that interaction was not dependent on CIB1a phosphorylation by PKD2. We provided evidence that upon translocation to the cytoplasm CIB1a co-localises and interacts with vimentin. We also demonstrated that CIB1a interacts with Pax3 and this interaction was not affected by the phosphorylation of CIB1a by PKD2. Alteration in the subcellular distribution of CIB1a by PKD2 phosphorylation may regulate CIB1a function towards Pax3.
79 Summary
The second part of the thesis was focused on the potential role of CIB1a phosphorylation by PKD2. Our major goal was to identify a molecular link between PKD2 and the regulation of cell motility. We could demonstrate that CIB1a indeed serves as a molecular link between PKD2 and cell migration since the PKD2 mediated CIB1 phosphorylation positively influence cell migration. We also shown that phosphorylation of CIB1a has effect on focal adhesion formation. Cells expressing phosphorylated CIB1a had increased number of focal adhesion and formed lammelipodial and filopodial protrusion. Taken together, during this work many interesting data concerning the functional aspect of CIB1a phosphorylation by PKD2 have been gathered, yet there is still much more work needed for a comprehensive understanding of PKD2 action in migration and invasion of cancer cells.
80 References
6. References
Ananthakrishnan, N., and Ehrlicher, A., (2007) The Forces Behind Cell Movement. Int. J. Biol. Sci.3:303-317.
Azoitei, N., Schoo, N., Kleger, A., Varma Pusapati, G., Moeller,P., Genze,., Kuefer, R., Baust, H., Van Lint, J.,Adler, G., Seufferlein, T., (2000) Protein kinase D2 is a major regulator of glioblastoma cell Growth. In Submission
Barry, W., Boudignon-Proudhon, C., Shock, D.D., McFadden, A., Weiss, J.M., Sondek, J., and Parise L.V., (2002) Molecular Basis of CIB binding to the Integrin αIIb Cytoplasmic Domain. J. Biol. Chem. 277:28877–28883
Baron, C.L. und Malhorta, V., (2002) Role of Diacylglycerol in PKD recruitment to the TGN and protein transport to the plasma membrane. Science. 295:325-328
Barry D.M. and Wente S.R. (2000) Nuclear transport: never-ending cycles of signals and receptors. Essays Biochem. 36:89-103.
Begitt, A., Meyer, T., Van Rossum, M., and Vinkemeier, U., (2000) Nucleocytoplasmic translocation of Stat1 is regulated by a leucine-rich export signal in the coiled-coil domain. Proc. Nat. Acad. Sci. 19: 10418-10423.
Brandlin I, Hubner S, Eiseler T, Martinez-Moya M, Horschinek A, Hausser A, Link G, Rupp S, Storz P, Pfizenmaier K, Johannes FJ. (2002) Protein kinase C (PKC)eta-mediated PKC mu activation modulates ERK and JNK signal pathways. J Biol Chem. 277:6490-6.
Brose N, Betz A und Wegmeyer H. (2004) Divergent and convergent signaling by the diacylglycerol second messenger pathway in mammals. Curr. Opin. Neurobiol. 14:328-340
Bowden, Barth, Thomas, Glazer, and Mueller (1999) An invasion-related complex of cortactin, paxillin and PKCmu associates with invadopodia at sites of extracellular matrix degradation. Oncogene. 18:4440-9.
Burridge, Fath, Kelly, Nuckolls, and Turner (1988) Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton. Annu. Rev. Cell Biol . 4: 487-525
Calnan BJ, Szychowski S, Chan FK, Cado D, Winoto A. (1995) A role for the orphan steroid receptor Nur77 in apoptosis accompanying antigen-induced negative selection.Immunity. 3:273– 282
Carnegie GK, Smith FD, McConnachie G, Langeberg LK, Scott JC. (2004) AKAP-Lbc nucleates a protein kinase D activation scaffold. Mol. Cell. 15:889-899.
Castagna M, Takai Y, Kaibuchi K, Sano K, Kikkawa U und Nishizuka Y. (1982) Direct activation of calcium-activated, phospholipid-dependent protein kinase by tumor-promoting phorbol esters. J Biol Chem. 257:7847-7851.
Chan, W., Kozma, R., Yasui, Y., Inagaki, M., Leung, T., Manser, E., Lim, L., (2002) Vimentin intermediate filament reorganization by Cdc42: Involvement of PAK and p70 S6 kinase European Journal of Cell Biology. 81:692-701
81 References
Chen, J., Deng, F., Singh, S., and Wang QJ. (2008) Protein Kinase D3 (PKD3) Contributes to Prostate Cancer Cell Growth and Survival Through a PKCE/PKD3 Pathway Downstream of Akt and ERK ½. Cancer Research. 68: 3844–53
Cryns, V. L., et al. (1997) J. Biol. Chem. 272: 29449–29453
Cohen P. (2002) The origins of protein phosphorylation. Nat Cell Biol. 4:127-130.
Cozier GE, Carlton J, Bouyoucef D, Cullen PJ. (2004) Membrane targeting by pleckstrin homology domains. Curr Top Microbiol Immunol. 282:49-88
Davies PS, Reddy H, Caivan and Cohen P. (2000) Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J. 351: 95-105
DeNofrio, J.C., Yuan,W., Temple, B.R., Gentry,H.R., and Parise L.V., (1999) Characterization of calcium- and integrin-binding protein 1 (CIB1) knockout platelets: Potential compensation by CIB family members. Platelets and Blood Cells.
Dignam JD, Martin, PL, Shastry, BS, and Roeder, RG. (1983) Eukaryotic gene transcription with purified components. Methods Enzymol 101: 582-598
Dingwall C and Laskey RA. (1991). Nuclear targeting sequences—a consensus? Trends Biochem.Sci. 101:582-598.
Eckes, B., Dogic, D., Colucci-Guyon, E., Wang, N., Maniotis, A., Ingber, D., Merckling, A., Delouvée, A., Koteliansky, V., Babinet, C., and Krieg, T., (1998) Impaired mechanical stability, migration and contractile capacity in vimentin deficient fibroblasts.Journal of Cell Science. 111: 1897-1907
Eiselet,T., Döppler, H., Yan, IK., Kitatani, K., Mizuno, K., and Storz, P. (2009) Protein kinase D1 regulates cofilin-mediated F-actin reorganization and cell motility through slingshot. Nature Cell Biology . 11:545-556
Eiselet,T., Döppler, H., Yan, IK., Goodison,S and Storz, P. (2009) Protein kinase D1 regulates matrix metalloproteinase expression and inhibits breast cancer cell invasion. Breast Cancer Research. 11.
Eiselet, T., Schmid, MA., Topbas, F., Pfizenmaier, K., and Hausser, A., (2007).PKD is recruited to sites of actin remodelling at the leading edge and negatively regulates cell migration.FEBS Letters. 581:4279-4287
Eriksson, J.E., He, T., Trejo-Skalli, A.V., Härmälä-Braskén, A.S., Hellman, J., Chou, Y.H., and Goldman, R., (2004) Specific in vivo phosphorylation sites determine the assembly dynamics of vimentin intermediate filaments. Journal of Cell Science. 117:919-932
Esue, O., Carson, A.A., Tseng, Y., and Wirtz, D., (2006) A Direct Interaction between Actin and Vimentin Filaments Mediated by the Tail Domain of Vimentin. J. Biol. Chem. 281: 30393–30399.
Gao., Z.H., Metherall, J., and Virshup, D.M., (2000) Identification of Casein Kinase I Substrate by in Vitro Expression Cloning Screeening. Biochemical and Biochemical Research Communication. 268:562-566.
82 References
Gentry, H.R., Singer, A.U., Betts,L., Yang,C., Ferrara, J., Sondek, J., and Parise, L.V., (2005) Structural and biochemical characterization of CIB1 delineates a new family of EF-hand- containing proteins. J. Biol. Chem. 280: 8407–8415
Goldman, R.D., Khuon, S., Chou, Y.H., Opal,P., and Steinert, P.M. (1996) The Function of Intermediate Filaments in Cell Shape and Cytoskeletal Integrity. The Journal of Cell Biology.
Green, K.J., Talian, J.C., and. Goldman, R.D., (1986). Relationship Between Intermediate Filaments and Microfilaments in Cultured Fibroblasts: Evidence for Common Foci During Cell Spreading. Cell motility and the cytoskeleton. 6:406-418
Goto, H., Tanabe, K., Manser, E., Lim,L., Yasui, Y., and Inagaki, M., (2002) Phosphorylation and reorganization of vimentin by p21-activated kinase (PAK). Genes to Cells. 7: 91–97
Görlich D und Kutay U. (1999) Transport between the cell nucleus and the cytoplasm. Annu Rev Cell Dev Biol. 15:607-660
Görlich D und Mattaj IW. (1996) Nucleocytoplasmic transport. Science. 271:1513-1518.
Ha,C.H., Wang,W., Jhun,B.S., Wong,C., Hausser,A., Pfizenmaier,K., McKinsey,T.A., Olson,E.N., and Jin,Z.G. (2008). Protein kinase D-dependent phosphorylation and nuclear export of histone deacetylase 5 mediates vascular endothelial growth factorinduced gene expression and angiogenesis. J. Biol. Chem. 283, 14590-14599.
Haataja, L., Kaartinen, V., Groffen, J., and Heisterkamp,N., (2002) The small GTPase Rac3 interacts with the integrin-binding protein CIB and promotes integrin alpha(IIb)beta(3)- mediated adhesion and spreading. J. Biol. Chem. 277: 8321–8328
Hanahan, D., and Weinberg, R.A., (2000) The Hallmarks of Cancer. Cell. 100: 57-70.
Hanks SK and Hunter T (1995) The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 9:576-596.
Hanks SK. (2003) Genomic analysis of the eukaryotic protein kinase superfamily: a perspective. Genome Biol. 4:111
Haushalter, Stukenberg, Kirschner, and Verdine (1999) Curr. Biol. 9, 174–185 Hausser A, Link G, Bamberg L, Burzlaff A, Lutz S, Pfizenmaier K, Johannes FJ. (2002) Structural requirements for localization and activation of protein kinase C mu (PKC mu) at the Golgi compartment. J Cell Biol. 156:65-74.
Hausser A, Storz P, Martens S, Link G, Toker A, Pfizenmaier K. (2005) Protein kinase D regulates vesicular transport by phosphorylating and activating phosphatidylinositol-4 kinase IIIbeta at the Golgi complex. Nat Cell Biol. 7:851-3.
Hausser A, Peterburs P, Heering J, Link G, Pfizenmaier K, Olayioye M. (2009). Protein Kinase D Regulates Cell Migration by Direct Phosphorylation of the Cofilin Phosphatase Slingshot 1 Like: Cancer Res 2009; 69:
83 References
Haworth RS, Cuello F, Herron TJ, Franzen G, Kentish JC, Gautel M, Avkiran M. (2004) Protein Kinase D Is a Novel Mediator of Cardiac Troponin I Phosphorylation and Regulates Myofilament Function. Circ Res. 95:1091-1099.
Hayashi A, Seki N, Hattori A, Kozuma S und Saito T. (1999) PKCnu, a novel member of the protein kinase C family, composes a fourth subfamily with PKCμ. Biochim Biophys Acta. 1450: 99-106
Hollenbach, D., McPherson, C.J., Lagutina, I., Grosveld, G., (2001) The EF-hand calcium- binding protein calmyrin inhibits the transcriptional and DNA-binding activity of Pax3. Biochimica et Biophysica Acta. 1574 : 321-328
Holtrich, U., Wolf, G., Yuan, J., Bereiter-Hahn, J., Karn, T., Weiler, W., Kauselmann, G., Rehli, M., Andreesen, R., Kaufmann, M., Kuhl D., and Strebhardt, K., (2000) Adhesion induced expression of the serine/threonine kinase Fnk in human macrophages. Oncogene.
Hynes,R.O., (2002) Integrins: bidirectional, allosteric signaling machines. Cell. 110, 673–687,
Schmidt, A., Wolde, M., Thiele, C., Fest, W., Kratzin, H., Podtelejnikov, A.V., Witke, W., Huttner, W.B. and So ling, H.D. (1999) Nature 401:133-141
Hurd C, Waldron RT, Rozengurt E. (2002) Protein kinase D complexes with C-Jun N- terminal kinase via activation loop phosphorylation and phosphorylates the C-Jun N-terminus. Oncogene 21:2154-2160.
Huynh QK and McKinsey TA. (2006) Protein kinase D directly phosphorylates histone deacetylase 5 via a random sequential kinetic mechanism. Arch Biochem Biophys. 450: 141-148.
Iglesias T and Rozengurt E. (1998) Protein kinase D activation by mutations within its pleckstrin homology domain. J Biol Chem. 273:410-416.
Iglesias T and Rozengurt E. (1999) Protein kinase D activation by deletion of its cysteinerich motifs. FEBS Letters. 454:53-56.
Iglesias T, Cabrera-Poch N, Mitchell MP, Naven TJ, Rozengurt E, Schiavo G. (2000) Identification and cloning of KiDins220, a novel neuronal substrate of protein kinase D. J Biol Chem. 275:40048-45006
Iglesias T, Matthews S and Rozengurt E. (1998) Dissimilar phorbol ester binding properties of the individual cysteine-rich motifs of protein kinase D. FEBS Letters. 437:19-23.
Iglesias T, Waldron RT, Rozengurt E. (1998) Identification of in vivo phosphorylation sites required for protein kinase D activation. J Biol Chem 273:27662-27667.
Hwang, P.M., and Vogel, H.J., (2000).Structures of the platelet calcium- and integrin binding protein and the aIIb-integrin cytoplasmic domain suggest a mechanism for calciumregulated recognition; homology modelling and NMR studies. Journal of Molecular Recognition. 13:83–92
Iglesias, T., Cabrera-Poch, N., Mitchell, M.P., Naven, T.J., Rozengurt, E. and Schiavo, G. (2000) Identification and cloning of Kidins220, a novel neuronal substrate of protein kinase D. J. Biol. Chem. 275: 40048–40056.
84 References
Ivaskaa, J., Pallarib,H.M., Nevoa, J., Eriksson, J.E., (2007) Novel functions of vimentin in cell adhesion, migration,and signaling. Experimental Cell Researh. 313:2050-2062.
Ivaska J, Vuoriluoto K, Huovinen T, Izawa I, Inagaki M, Parker PJ. (2005) PKCepsilon- mediated phosphorylation of vimentin controls integrin recycling and motility. EMBO J. 24:3834- 45
Iwata M, Maturana A, Hoshijima M, Tatematsu K, Okajima T, VandenheedeJR, Van LintJ, Tanizawa K and Kuroda S. (2005) PKCε–PKD1 signaling complex at Z-discs plays a pivotal role in the cardiac hypertrophy induced by G-protein coupling receptor agonists. BBRC 37: 1105-1113
Jackson LN, Jing Li, Chen AL, Townsend CM and B. Evers M. (2006) Overexpression of wild-type PKD2 leads to increased proliferation and invasion of BON endocrine cells. Biochem Biophys Res Commun. 348:945-9.
Jaggi M, Rao PS, Smith DJ, Hemstreet GP, Balaji KC. (2003) Protein kinase C μ is down- regulated in androgenindependent prostate cancer. Biochem Biophys Res Commun. 307:254–60.
Jaggi M, Rao PS, Smith DJ, Wheelock MJ, Johnson KR, Hemstreet GP, Balaji KC. (2005) E-Cadherin Phosphorylation by Protein Kinase D1/Protein Kinase CM is Associated with Altered Cellular Aggregation and Motility in Prostate Cancer. Cancer Res. 65:483–92.
Jamora C, Yamanouye N, Van Lint J, Laudenslager J, Vandenheede JR, Faulkner DJ und Malhotra V. (1999) Gbetagamma-mediated regulation of Golgi organization is through the direct activation of protein kinase D. Cell. 98:59-68
Jaggi,M. et al. (2003) Protein kinase C mu is down-regulated in androgenindependent prostate cancer. Biochem. Biophys. Res. Commun., 307, 254–260
Jaggi, M., Rao, P.S., Smith, D.J., Wheelock, M.J., Johnson, K.R., Hemstreet, G.P. and Balaji, K.C. (2005) E-cadherin phosphorylation by protein kinase D1/protein kinase C{mu} is associated with altered cellular aggregation and motility in prostate cancer. Cancer Res. 65: 483– 492.
Jockusch, B.M., Bubeck, P., Giehl, C., Kroemker, M., Moschner, J., Rothkegel, M., Riidiger, M., Schliiter, K., Stanke, G., and Winkler, J., (1995) The Molecular Architecture of Focal Adhesions. Anu. Rev. Cell Dev. . 11:379-416
Johannes FJ, Prestle J, Eis S, Oberhagemann P and Pfizenmaier K. (1994) PKCμ is a novel, atypical member of the protein kinase C family. J Biol Chem. 269: 6140-6148
Johnson JE, Giorgione J and Newton AC. (2000) The C1 and C2 domains of protein kinase C are independent membrane targeting modules, with specifity for phosphatidylserine conferred by the C1 domain. Biochemistry. 39:11360-11369
Johnson LN, Lowe ED, Noble MEM und Owen DJ. (1998) The structural basis for substrate recognition and control by protein kinases. FEBS Letters. 430:1-11.
Kreisa, S., Schfnfeldb, H.J., Melchiora, C., Steinerb, B. , Kieffer, N., (2005) The intermediate filament protein vimentin binds specifically to a recombinant integrin α2/β1
85 References cytoplasmic tail complex and co-localizes with native α2/β1 in endothelial cell focal adhesions.Experimental Cell Research . 305 : 110– 121
Lambrechts, A., Van Troys, M., Ampe, C., (2004) The actin cytoskeleton in normal and pathological cell motility. The International Journal of Biochemistry & Cell Biology. 36, 1890-1909.
Laukaitis CM, Webb DJ, Donais K, Horwitz AF. (2001) Differential dynamics of alpha 5 integrin, paxillin, alpha-actinin during formation and disassembly of adhesions in migrating cells. J Cell Biol .153: 1427–1440,
Le Clainche,C. and Carlier,M.F. (2008) Regulation of actin assembly associated with protrusion and adhesion in cell migration. Physiol Rev. 88, 489-513.
Leisner, T.M., Liu, M., Jaffer, Z.M., Chernoff, J., and Parise L.V., (2006) Essential role of CIB1 in regulating PAK1 activation and cell migration. J. Cell Biol. 170: 465–476
Linder S. (2007) The matrix corroded: podosomes and invadopodia in extracellular matrix degradation. Trends Cell Biol. 17: 107–117.
Lustig, K. D., et al. (1997) Methods Enzymol. 283:83–99.
Lambrechts,A., Van Troys,M., and Ampe,C. (2004) The actin cytoskeleton in normal and pathological cell motility. Int. J. Biochem. Cell Biol. 36:1890-1909.
Lauffenburger,D.A. and Horwitz,A.F. (1996) Cell migration: a physically integrated molecular process. Cell 84: 359-369
Jockusch,B.M., Bubeck,P., Giehl,K., Kroemker,M., Moschner,J., Rothkegel,M., Rudiger,M., Schluter,K., Stanke,G., and Winkler,J. (1995) The molecular architecture of focal adhesions. Annu. Rev. Cell Dev. Biol. 11, 379-416.
Jaggi, M., P. S. Rao, D. J. Smith, M. J. Wheelock, K. R. Johnson, G. P. Hemstreet, and K. C. Balaji. (2005) E-cadherin phosphorylation by protein kinase D1/protein kinase C{mu} is associated with altered cellular aggregation and motility in prostate cancer. Cancer Res. 65:483-492
Kauselmann, G., Weiler, M., Wulff, P., Scafidi, J., Staubli, U., Kuhl, D., (1999) The Polo- like kinase Fnk and Snk associate with a Ca 2+ and integrin binding protein and are regulated dynamically with synaptic plasticity. The EMBO. 18:5528-5539.
Kennett, S. B., Roberts, J.D., and Olden, K., (2004) Requirement of protein kinase C micro activation and calpain-mediated proteolysis for arachidonic acid-stimulated adhesion of MDA- MB-435 human mammary carcinoma cells to collagen type IV. J.Biol.Chem. 279:3300-3307.
Kim, M., Jang, H., Kim, J., Caswell, P.T., Kang, G., Kim, S., Yoo.H., and Kim, Y., (2008) Epigenetic inactivation of protein kinase D1 in gastric cancer and its role in gastric cancer cell migration and invasion. Carcinogenesis .29 :629–637
Kothakota, S., et al. (1997) Science 278, 294–298.
Kudo N, Wolff B, Sekimoto T, Schreiner EP, Yoneda Y, Yanagida M, Horinouchi S, Yoshida M. (1998) Leptomycin B inhibition of signalmediated nuclear export by direct binding to CRM1. Exp Cell Res. 242:540-547.
86 References
La Cour T, Kiemer L, Mølgaard A, Gupta R, Skriver K, Brunak S. 2004. Analysis and prediction of leucine-rich nuclear export signals. Protein Eng Des Sel. 17:527-36
Lauffenburger, D.A., and Horwitz, A. F., (1996).. Cell Migration: A Physically Integrated Molecular Process. Cell. 84:359-69.
Lee, G.E., Yu, E.Y., Cho, C.H., Lee, J., Muller, M.T., and Chung, I.K., (2004) DNA- Protein Kinase Catalytic Subunit-interacting Protein KIP Binds Telomerase by Interacting with Human Telomerase Reverse Transcriptase. J. Biol. Chem. 279: 34750–34755
Lei EP und Silver PA. (2002) Protein and RNA export from the nucleus. Dev Cell. 2:261-272.
Lemercier C, Verdel A, Galloo B, Curtet S, Brocard MP and Khochbin S. (2000) mHDA1/HDAC5 Histone Deacetylase Interacts with and Represses MEF2A Transcriptional Activity. J. Biol. Chem. 275: 15594-15599.
Lemmon MA und Ferguson KM. (2000) Signal-dependent membrane targeting by pleckstrin homology (PH) domains. Biochem J. 350:1–18.
Le Clainche, C., and Carlier, M.F., (2005) Regulation of Actin Assembly Associated With Protrusion and Adhesion in Cell Migration. Physiol Rev. 88:489-513
Leisner, Liu, Jaffer, Chernoff, and Parise., (2005) Essential role of CIB1 in regulating PAK1 activation and cell migration.J. Cell Biol.170: 465–476
Lewis AK, Bridgman PC., (1992) Nerve growth cone lamellipodia contain two populations of actin filaments that differ in organization and polarity. J Cell Biol 119: 1219–1243.
Li, Q., Spinelli, A.M., Wang, R., Anfinogenova, Y., Singer, H.A., and Tang, D.D., (2006) Critical Role of Vimentin Phosphorylation at Ser-56 by p21-activated Kinase in Vimentin Cytoskeleton Signaling. J. Biol. Chem. 281: 34716–34724.
Liljedahl M, Maeda Y, Colanzi A, Ayala I, Van Lint J and Malhotra V. (2001) Protein Kinase D regulates the fission of cell surface destined transport carriers from the trans-golgi network. Cell. 104:409-420
Lippincott-Schwartz, J, Snapp, E, and Kenworthy, A. (2001) Studying protein dynamics in living cells. Nat Rev Mol Cell Biol. 2: 444-456.
Macara IG. (2001) Transport into and out of the nucleus. Microbiol Mol Biol Rev. 65:570-594.
Maeda Y, Beznoussenko GV, Van Lint J, Mironov AA, Malhotra V. (2001) Recruitment of protein kinase D to the trans-Golgi network via the first cysteine-rich domain. EMBO J. 20:5982- 5990
Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S. (2002) The protein kinase complement of the human genome. Science. 298:1912-1916.
Marklund U, Lightfoot K and Cantrell D. (2003) Intracellular location and cell context- dependent function of protein kinase D. Immunity 19:491-501.
87 References
Marks P, Rifkind RA, Richon VM, Breslow R, Miller T, Kelly WK. (2001) Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer.1: 194-202
Mattaj IW und Englmeier L. (1998) Nucleocytoplasmic transport: the soluble phase. Annu Rev Biochem. 67:265-306.
Matthews S, Liu P, Spitaler M, Olson EN, McKinsey TA, Cantrell DA and Scharenberg AM.(2006) Essential Role for Protein Kinase D Family Kinases in the Regulation of Class II Histone Deacetylases in B Lymphocytes.Molecular and Cellular Biology. 26: 1569-1577
Matthews SA, Iglesias T, Rozengurt E, Cantrell D. (2000) Spatial and temporal regulation of protein kinase D (PKD). EMBO J 19:2935-2945. Matthews SA, Rozengurt E, Cantrell D. (1999) Characterization of serine 916 as an in vivo autophosphorylation site for protein kinase D/protein kinase Cμ. J Biol Chem. 274:26543-9.
Matthews SA, Rozengurt E, Cantrell D. (2000) Protein kinase D: a selective target for antigen receptors and a downstream target for protein kinase C in lymphocytes. J Exp Med. 191:2075- 2082.
Mellor H and Parker PJ. (1998) The extended protein kinase C superfamily. Biochem J. 332:281- 292.
Mihailovic T, Marx M, Auer A, Van Lint J, Schmid M, Weber C, Seufferlein T. (2004) + Protein kinase D2 mediates activation of nuclear factor κB by Bcr-Abl in Bcr-Abl human myeloid leukemia cells. Cancer Res. 64:8939-8944.
Mischak H, Goodnight JA, Kolch W, Martiny-Baron G, Schaechtle C, Kazanietz MG, Blumberg PM, Pierce JH und Mushinski JF. (1993) Overexpression of protein kinase C δ and ε, in NIH 3T3 cells induces opposite effects of growth, morphology, anchorage dependence, and tumorgenicity. J Biol Chem. 268: 6090-6096
Ma, S., Liu, M.A., Yuan, Y.O., and Erikson, R., (2003) The Serum-Inducible Protein Kinase Snk Is a G1 Phase Polo-Like Kinase That Is Inhibited by the Calcium and Integrin-Binding Protein CIB.Molecular Cancer Research. Vol. 1, 376–384
Mansner, E., Huang, H., Loo, T.H., Chen, X.Q., Dong, J.M., Leung, T., AND Lim, L., (1997) Expression of Constitutively Active α-PAK Reveals Effects of the Kinase on Actin and Focal Complexes. Molecular and Cellular Biology. 17:1129–1143
Meriane, M., Mary, S., Comunale, F., Vignal, E., Fort, P., and Gauthier-Rouvie`re C., (2000) Cdc42Hs and Rac1 GTPases Induce the Collapse of the Vimentin Intermediate Filament Network. J. Biol. Chem. 275: 33046–33052.
Meyer, T., and York, J. D. (1999) Nat. Cell Biol. 1, E93–E95
Mitra, S.K., Hanson, D.A., and Schlaepfer, D.D. (2005) Focal adhesion kinase: in command and control of cell motility. Nat. Rev. Mol. Cell Biol. 6: 56-68.
Mead, P. E., et al. (1998) Proc. Natl. Acad. Sci. USA. 95: 11251– 11256
McGarry, T. J., and Kirschner, M. W. (1998) Cell. 93: 1043–1053
88 References
Musacchio A, Gibson T, Rice P, Thompson J and Saraste M. (1993) The PH domain: a common piece in the structural patchwork of signalling proteins. TIBS. 18:343-8.
Nakai K and Horton P. (1999) PSORT: a program for detecting the sorting signals of proteins and predicting their subcellular localization.Trends Biochem Sci. 24:34-35.
Naik U.P., Patel P.M., and Parise L.V. (1997) Identification of a novel calcium-binding protein that interacts with the integrin alphaIIb cytoplasmic domain. J. Biol. Chem. 272: 4651– 4654.
Naik, U.P., and Naik, M.U., (2003) Calcium- and integrin-binding protein regulates focal adhesion kinase activity during platelet spreading on immobilized fibrinogen. Blood. 102.
Nieminen M., Henttinen, T. , Merinen, M., Marttila–Ichihara, F., Eriksson, J.E, and Jalkanen S., (2006) Vimentin function in lymphocyte adhesion and transcellular migration. Nature Cell Biology. 8:156-162
Newton AC and Johnson JE. (1998) Protein kinase C: a paradigm for regulation of protein function by two membrane-targeting modules. Biochimica et Biophysica Acta. 1376:155-172
Newton AC. (1995) Protein kinase C. Seeing two domains. Curr Biol. 5:973-6.
Newton AC. (1997) Regulation of protein kinase C. Curr Opin Cell Biol. 9:161-167.
Nishi K, Yoshida M, Fujiwara D, Nishikawa M, Horinouchi S, Beppu T. (1994.) Leptomycin B targets a regulatory cascade of Crm1, a fission yeast nuclear protein, involved in control of higher order chromosome structure and gene expression. J Biol Chem. 269:6320-6324.
Nishizuka Y. (1992) Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science. 258:607-614.
Oancea E, Bezzerides VJ, Greka A, Clapham DE. (2003) Mechanism of persistent protein kinase D1 translocation and activation. Dev Cell. 4:561-574.
Obenauer J, Cantley LC, and Yaffe B. (2003) Scansite 2.0: Proteome-wide prediction of cell signaling interactions using short sequence motifs. Nucleic Acids Res. 31: 3635–3641.
Palmantier R, George MD, Akiyama SK, Wolber FM, Olden K and Roberts JD. (2001)Cis- polyunsaturated fatty acids stimulate beta1 integrin-mediated adhesion of human breast carcinoma cells to type IV collagen by activating protein kinases C-epsilon and -mu. Cancer Res. 61:2442-2452.
Pante N and Kann M. (2002) Nuclear pore complex is able to transport macromolecules with diameters of about 39 nm. Mol Biol Cell. 13:425-434.
Parker PJ and Murray-Rust J. (2004) PKC at a glance. J Cell Sci. 117: 131-132.
Parra M, Kasler H, McKinsey TA, Olson EN and Verdin E. (2005) Protein Kinase D1 Phosphorylates HDAC7 and Induces Its Nuclear Export after T-cell Receptor Activation. J. Biol. Chem. 280: 13762-13770.
Pellegrin, S., and H. Mellor. (2007) Actin stress fibres. J Cell Sci. 120:3491-9
89 References
Prigozhina, N.L. and Waterman-Storer, C.M. (2004) Protein kinase D-mediated anterograde membrane trafficking is required for fibroblast motility. Curr. Biol. 14, 88–98. Palmantier, R., M.D. George, S. K. Akiyama, F. M. Wolber, K. Olden, and J. D. Roberts. (2001) Cis-polyunsaturated fatty acids stimulate beta1 integrin-mediated adhesion of human breast carcinoma cells to type IV collagen by activating protein kinases C-epsilon and -mu. Cancer Res. 61:2445-2452
Papazyan R, Doche M, Waldron RT, Rozengurt E, Moyer MP, Rey O. (2008). Protein kinase D activation and localization during mitosis. Exp.Cell Res. 16:3057-3068.
Parise L.V., (1999) Integrin αIIbβ3 signaling in platelet adhesion and aggregation.Current Opinion in Cell Biology. 11:597–601
Praadeep A, Sharma C, Sathyanarayna P, Albanese C, Fleming JV, Wang TC, Wolfe MM, Baker KM, Pestell RG and Rana B. (2004) Gastrin-mediated activation of cyclin D1 transcription involves beta-catenin and CREB pathways in gastric cancer cells. Oncogene. 23: 3689- 3699.
Prestle J, Pfizenmaier K, Brenner J and Johannes FJ. (1996) Protein kinase C mu is located at the Golgi compartment. J Cell Biol. 134:1401-10.
Prigozhina NL and Waterman-Storer CM. (2004) Protein kinase D-mediated anterograde membrane trafficking is required for fibroblast motility. Curr Biol. 14:88-98
Pullen N, Dennis PB, Andjelkovic M, Dufner A, Kozma SC, Hemmings BA, Thomas G. (1998) Phosphorylation and activation of p70S6k by PDK1. Science. 279:707-10.
Pellegrin, S., and Mellor, H. (2007) Actin stress fibres.Journal of Cell Science. 120:3491-9.
Qiang, Y. W., K. Walsh, L. Yao, N. Kedei, P. M. Blumberg, J. S. Rubin, J. Shaughnessy, Jr., and S. Rudikoff. (2005) Wnts induce migration and invasion of myeloma plasma cells. Blood 106:1786-1793.
Qiang, Y.W., Yao, G. Tosato, and S. Rudikoff. (2004) Insulin-like growth factor I induces migration and invasion of human multiple myeloma cells. Blood .103:301- 308.
Rena G, Woods Y, Prescott AR, Peggie M, Unterman TG, Williams MR, Cohen P. (2002.)Two novel phosphorylation sites on FKHR that are critical for its nuclear exclusion. EMBO J. 21: 2263–2271.
Rennecke J, Rehberger PA, Furstenberger G, Johannes FJ, Stohr M, Marks F, Richter KH. (1999) Protein-kinase-Cmu expression correlates with enhanced keratinocyte proliferation in normal and neoplastic mouse epidermis and in cell culture. Int J Cancer. 80:98-103.
Rey O, Sinnett-Smith J, Zhukova E, Rozengurt E. (2001) Regulated nucleocytoplasmic transport of protein kinase D in response to G proteincoupled receptor activation. J Biol Chem. 276:49228-49235.
Rey O, Young SH, Cantrell D, Rozengurt E. (2001) Rapid protein kinase D translocation in response to G protein-coupled receptor activation. Dependence on protein kinase C. J Biol Chem. 276:32616-32626
90 References
Rey O and Rozengurt E. (2001) Protein kinase D interacts with Golgi via its cysteine-rich domain. Biochem Biophys Res Commun. 287:21-6.
Rey O, Zhukova E, Sinnett-Smith J, Rozengurt E. (2003) Vasopressin-induced intracellular redistribution of protein kinase D in intestinal epithelial cells. J Cell Physiol. 196:483-492.
Rey O., Yuan J and Rozengurt E., (2003) Intracellular redistribution of protein kinase D2 in response to G-protein-coupled receptor agonists. Biochem. Biophys. Res. Commun. 302:817-824.
Rout MP and Aitchison JD. (2001) The nuclear pore complex as a transport machine. J Biol Chem. 276:16593-16596.
Rozengurt E, Rey O, Waldron RT. (2005) Protein kinase D signaling.J Biol Chem. 280:3205-8.
Rykx A, De Kimpe L, Mikhalap S, Vantus T, Seufferlein T, Vandenheede JR, Van Lint J. (2003) Protein kinase D: a family affair. FEBS Letters. 546:81-86.
Rottner K, Hall A, and Small JV. (1999) Interplay between Rac and Rho in the control of substrate contact dynamics. Curr Biol 9: 640–648
Ridley, A.J., M.A. Schwartz, K. Burridge, R.A. Firtel, M.H. Ginsberg, G. Borisy, J.T. Parsons, and A.R. Horwitz. (2003) Cell migration: integrating signals from front to back. Science. 302:1704-9.
Riol-Blanco, L., Iglesias, T., Sanchez-Sanchez, N., de la, R.G., Sanchez-Ruiloba, L., Cabrera-Poch, N., Torres, A., Longo, I., Garcia-Bordas, J., Longo, N., Tejedor, A., Sanchez-Mateos, P. and Rodriguez-Fernandez, J.L. (2004) The neuronal proteinKidins220 localizes in a raft compartment at the leading edge of motile immature dendritic cells. Eur. J. Immunol. 34, 108–118.
Sambrook J, Fritsch EF and Maniatis T. (1989) Molecular cloning. A laboratory manual. 2nd ed. Cold Spring Harbor, NY.
Sánchez-Ruiloba L, Cabrera-Poch N, Rodríguez-Martínez M, López-Menéndez C, Martín Jean-Mairet R, Higuero AM and Teresa Iglesias. (2006) Protein Kinase D intracellular localization and activity control Kinase D-Interacting Substrate of 220-kDa traffic through a Postsynaptic Density-95/Discs Large/Zonula Occludens-1-binding Motif. JBC. 281:18888-18900.
Schenk PW and Snaar-Jagalska BE. (1999) Signal perception and transduction: the role of protein kinases. Biochim Biophys Acta. 1449:1-24.
Sigrist C.J. A., Lorenzo Cerutti, Nicolas Hulo, Alexandre Gattiker, Laurent Falquet, Marco Pagni, Amos Bairoch and Philipp Bucher. (2002) Brifings in bioinformatics. 3: 265–274. Seufferlein T, Withers D, Broad S, Herget T, Walsh JH, Rozengurt E. (1995) The human CCKB/Gastrin receptor transfected into Rat1 fibroblasts mediates activation of MAP kinase, p74raf-1 kinase, and mitogenesis. Cell Growth & Diff. 6:383-393
Shindo M, Irie K, Masuda A, Ohigashi H, Shirai Y, Miyasaka K, Saito N. (2003) Synthesis and phorbol ester binding of the cysteine-rich domains of diacylglycerol kinase (DGK) isozymes.
91 References
DGKgamma and DGKbeta are new targets of tumor-promoting phorbol esters. J Biol Chem. 278:18448-54
Sidorenko C, Law S, Klaus K, Chandran M, Takata T, Kurosaki S and Clark E. (1996) Protein Kinase C mu Associates with the B Cell Antigen Receptor Complex and Regulates Lymphocyte Signaling. Immunity. 5: 353-363
Sastry, S. K. & Burridge, K. (2000) Focal adhesions: a nexus for intracellular signaling and cytoskeletal dynamics. Exp.Cell Res. 261, 25-36.
Schlaepfer, D.D., Hauck, C. R., Sieg, D.J, (1999) Signaling through focal adhesion kinase. Progress in Biophysics & Molecular Biology. 71 : 435-478
Shattil, S.J., Kashiwagi, H., and Pampori, N., (1998) Integrin Signaling: The Platelet Paradigm. Blood. 91: 2645-2657
Stabler, S. M., Ostrowski, L. L., Janicki, S. M., and Monteiro, M. J. (1999) A Myristoylated Calcium-binding Protein that Preferentially Interacts with the Alzheimer’s Disease Presenilin 2 Protein J. Cell Biol. 145, 1277–1292
Seki N., Hayashi A., Abe M, Araki R., Saito T., (1998) Chromosomal assignment of the gene for human DNA-PKcs interacting protein (KIP) on chromosome 15q25.3-q26.1 by somatic hybrid analysis and fluorescence in situ hybridization. J Hum Genet. 43:275-277
Sells M.A., Knaus, U.G., Bagrodia, S., Ambrose D.M., Bokoch, G. M., and Chernoff, J., (1997) Human p21-activated kinase (PAK1) regulates actin organization in mammalian cells. Current Biology.
Shock, D. D., Naik, U. P., Brittain, J. E., Alahari, S. K., Sondek, J., and Parise, L. V. (1999) Calcium-dependent properties of CIB binding to the integrin αIIb cytoplasmic domain and translocation to the platelet cytoskeleton. Biochem. J. 342, 729-735
Song DH, Rana B, Wolfe JR, Crimmins G, Choi C, Albanese C, Wang TC, Pestell RG, Wolfe MM. (2003) Gastrin-induced gastric adenocarcinoma growth is mediated through cyclin D1. Am J Physiol Gastrointest Liver Physiol. 285:G217-22
Spitaler M, Emslie E, Wood C, Cantrell D. (2006) Diacylglycerol and Protein Kinase D Localization during T lymphocyte Activation. Immunity, 24: 535-546.
Steeg P,. (2007) Metastasis suppressors alter the signal transduction of cancer cells .Nature Review / Cancer Volume 3: 55-63
Storz P and Toker A. (2003) Protein kinase D mediates a stress-induced NF-kappaB activation and survival pathway. EMBO J. 22:109-20.
Storz P, Doppler H, Toker A. (2004) Protein kinase Cdelta selectively regulates protein kinase D-dependent activation of NF-kappaB in oxidative stress signaling. Mol Cell Biol.24:2614-26.
Storz P, Doppeler H and Toker A. (2005) Protein Kinase D Mediates Mitochondrion-to- Nucleus Signaling and Detoxification from Mitochondrial Reactive Oxygen Species. Mol Cell Biol. 25: 8520–8530.
92 References
Sturany S, Van Lint J, Gilchrist A, Vandenheede JR, Adler G, Seufferlein T. (2002) Mechanism of activation of protein kinase D2 (PKD2) by the CCK(B)/gastrin receptor. J Biol Chem. 277:29431-29436.
Sturany S, Van Lint J, Muller F, Wilda M, Hameister H, Hocker M, Brey A, Gern U, Vandenheede J, Gress T, Adler G, Seufferlein T. (2001) Molecular cloning and characterization of the human protein kinase D2. A novel member of the protein kinase D family of serine threonine kinases. J Biol Chem. 276:3310-3318.
Stukenberg, P. T., et al. (1997) Curr. Biol. 7, 338–348.
Tang, D., Bai, Y., and Gunst, S.J., (2005) Silencing of p21-activated kinase attenuates vimentin phosphorylation on Ser-56 and reorientation of the vimentin network during stimulation of smooth muscle cells by 5-hydroxytryptamine. Biochem. Journal. 388: 773–783.
Taylor SJ, Chae HZ, Rhee SG, Exton JH. (1991) Activation of the beta 1 isozyme of phospholipase C by alpha subunits of the G class of G proteins. Nature 350:516-8.
Taylor SS, Haste NM, Ghosh G. (2005) PKR and eIF2alpha: integration of kinase dimerization, activation, and substrate docking. Cell. 122:823-5.
Tsuboi, T., (2002) Calcium Integrin-binding Protein Activates Platelet Integrin αIIbβ3. J. Biol. Chem. 277:1919–1923.
Tsien R. (1998) The green fluorescent protein. Annual Review of Biochemistry 67: 509-544.
Valverde AM, Sinnett-Smith J, Van Lint J and Rozengurt E (1994) Molecular cloning and characterization of protein kinase D: a distinct target for dacylglycerol and phorbol esters with a distinctive catalytic domain. Proc Natl Acad Sci USA. 91:8572-8576.
Van Lint J, Rykx A, Maeda Y, Vantus T, Sturany S, Malhotra V, Vandenheede JR, Seufferlein T. (2002) Protein kinase D: an intracellular traffic regulator on the move. Trends Cell Biol. 12:193-200.
Van Lint J, Sinnett-Smith J and Rozengurt, E. (1995) Expression and characterization of PKD, a phorbol ester and diacylglycerol-stimulated serine protein kinase. J Biol Chem. 270:1455- 1461.
Varmus and Weinberg., (1993) Genes and the Biology of Cancer. Scientific American Library.
Vasu SK, and Forbes DJ., (2001) Nuclear pores and nuclear assembly. Curr Opin Cell Biol. 13:363-375.
Vallar, L., Melchior, C., Planc¸on, S., Drobecq, H., Lippens, G., Regnault, V., and Kieffer, N., (1999) Divalent Cations Differentially Regulate Integrin aIIb Cytoplasmic Tail Binding to b3 and to Calcium- and Integrin-binding Protein. The Journal of Biological Chemistry. Vol. 274, No. 24, pp. 17257–17266
Vikstrom, K.L., Lira, S.S., Goldman, R.D., and. Borisy, G.G., (1992) Steady State Dynamics of Intermediate Filament Networks. The Journal of Cell Biology. 118: 121-129
93 References
Vertommen DM, Ni Y, Waelkens E, Merlevede W, Vandenheede JR, Van Lint J. (2000) Regulation of protein kinase D by multisite phosphorylation. J Biol Chem. 275: 19567-19576. von Blume J, Auer A, Sturany S; von Wichert G, Van Lint J, Vanderheede J, Adler G. (2005) Role of the regulatory domain of Protein Kinase D2 in phorbol ester binding, catalytic activity and nucleo-cytoplasmic shuttling. MBC 16: 4375-4385. von Blume, U. Knippschild, U., Dequiedt, F., Giamas, G., Beck, A., Auer, A., Van Lint, J., Adler, A., and Seufferlein, T., (2007) Phosphorylation at Ser244 by CK1 determines nuclear localization and substrate targeting of PKD2. 26:4619–4633
Waldron RT, Iglesias T and Rozengurt E. (1999) The pleckstrin homology domain of protein kinase D interacts preferentially with the eta isoform of protein kinase C. J Biol Chem. 274: 9224- 9230.
Waldron RT, Rozengurt E. (2003) Protein kinase C phosphorylates protein kinase D activation loop Ser744 and Ser748 and releases autoinhibition by the pleckstrin homology domain. J Biol Chem. 278:154-163.
Wang,S., Li,X., Parra,M., Verdin,E., Bassel-Duby,R., and Olson,E.N. (2008) Control of endothelial cell proliferation and migration by VEGF signaling to histone deacetylase 7. Proc. Natl. Acad. Sci. U. S. A 105, 7738-7743.
Wang, R., Li, Q., Anfinogenova, Y., and Tang, D.D., (2007) Dissociation of Crk-associated substrate from the vimentin network is regulated by p21-activated kinase on ACh activation of airway smooth muscle. Am J Physiol Lung Cell Mol Physiol. 292: 240–248.
White,D.P., Caswell,P.T., and Norman,J.C. (2007). alphavbeta3 and alpha5beta1 integrin recycling pathways dictate downstream Rho kinase signaling to regulate persistent cell migration. J. Cell Biol. 177: 515-525. White, C., Monteiro, M.J., and FoskettJ.K. (2006) CIB1, a Ubiquitously Expressed Ca2+ binding Protein Ligand of the InsP3 Receptor Ca2+ Release Channel. J Bio Chem. 281: 20825– 20833
Woodhouse, E.C., R.F. Chuaqui, and L.A. Liotta. (1997) General mechanisms of metastasis. Cancer. 80:1529-37
Wang QJ, Fang TW, Yang D, Lewin NE, Van Lint J, Marquez VE, Blumberg PM. (2003) Ligand structure-activity requirements and phospholipid dependence for the binding of phorbol esters to protein kinase D. Mol. Pharmacol. 64:1342–1348.
Wang QJ. (2006) PKD at the crossroads of DAG and PKC signaling. Trends Pharmacol Sci. 27:317-23.
Wang Y, Waldron RT, Dhaka A, Patel A, Riley MM, Rozengurt E, Schiavo G. (2002) The RAS effector RIN1 directly competes with RAF and is regulated by 14-3-3 proteins. Mol Cell Biol. 22:916-926.
Wang X, Grammatikakis, N, Siganou, A and Calderwood, SK. (2003) Regulation of molecular chaperone gene transcription involves the serine phosphorylation, 14-3-3 epsilon binding, and cytoplasmic sequestration of heat shock factor 1. Mol Cell Biol 23: 6013-6026
94 References
Wang AH, Kruhlak MJ, Wu J, Bertos NR, Vezmar M, Posner BI, Bazett-Jones DP and Yang, XJ. (2000) Regulation of Histone Deacetylase 4 by Binding of 14-3-3 Proteins. Mol. Cell. Biol. 20: 6904-6912
Weis K. (2002) Nucleocytoplasmic transport: cargo trafficking across the border. Curr Opin Cell Biol. 14:328-335.
Weis K. (2003) Regulating Access to the Genome: Nucleocytoplasmic Transport throughout the Cell Cycle. Cell. 112:441–51.
Wen W, Meinkoth JL, Tsien RY, Taylor SS. (1995) Identification of a signal for rapid export of proteins from the nucleus. Cell. 82:463-473.
Wood, CD, Marklund U and Cantrell DA. (2005) Dual phospholipase C/diacylglycerol requirement for protein kinase D1 activation in lymphocytes. J. Biol. Chem. 280:6245-6251
Woods AJ, White DP, Caswell PT, Norman JC. (2004) PKD1/PKCμ promotes αvβ3 integrin recycling and delivery to nascent focal adhesions. EMBO J. 23:2531-2543.
Zaidel-Bar R, Ballestrem C, Kam Z, Geiger B. (2003) Early molecular events in the assembly of matrix adhesions at the leading edge of migrating cells. J Cell Sci. 116: 4605–4613.
Zaidel-Bar R, Cohen M, Addadi L, Geiger B. (2004) Hierarchical assembly of cell-matrix adhesion complexes. Biochem Soc Trans 32: 416–420. Zayed, M.B., Yuan, W., Leisner, T.M., Chalothorn, D., McFadden, A.W., Schaller, Hartnett, E., Faber, J.E., Parise L.V., (2007) CIB1 Regulates Endothelial Cells and Ischemia- Induced Pathological and Adaptive Angiogenesis. Circulation Research. 101:1185-1193.
Zamir,E. and Geiger,B., (2001) Components of cell-matrix adhesions. J. Cell Sci. 114, 3577-3579.
Zamir E, Katz M, Posen Y, Erez N, Yamada KM, Katz BZ, Lin S, Lin DC, Bershadsky A, Kam Z, Geiger B. (2000) Dynamics and segregation of cell-matrix adhesions in cultured fibroblasts. NatCell Biol 2: 191–196.
Zhao, Z., Mansner, E., Chen, X., Chong, C., Leung, T., and Lim, L., (1998) A Conserved Negative Regulatory Region in aPAK: Inhibition of PAK Kinases Reveals Their Morphological Roles Downstream of Cdc42 and Rac1. Molecular and Cellular Biology.18: 2153–2163
Zhang SH, Kobayashi R, Graves PR, Piwnica-Worms H and Tonks NK. (1997) Serine Phosphorylation-dependent association of the band 4.1-related Protein-tyrosine Phosphatase PTPH1 with 14-3-3beta Protein. J. Biol. Chem. 272: 27281-27287.
Zhukova E, Sinnett-Smith J, Rozengurt E. (2001) Protein kinase D potentiates DNA synthesis and cell proliferation induced by bombesin, vasopressin or phorbol esters in Swiss3T3 cells. J Biol Chem. 276:40298-40305.
Zugaza JL, Sinnett-Smith J, Van Lint J, and Rozengurt E. (1996) Protein kinase D (PKD) activation in intact cells through a protein kinase C-dependent signal transduction pathway. EMBO J. 15:6220-6230. Yamada, K.M., Pankov, R., and Cukierman, E. (2003) Dimensions and dynamics in integrin function. J. Med. Biol. Res. 36: 959-966
95 References
Yamniuk, A.P., and Vogel, H.J., (2005) Calcium- and magnesium-dependent interactions between calcium- and integrin-binding protein and the integrin aIIb cytoplasmic domain.Protein Science. 14:1429–1437
Yap, K. L., Ames, J. B., Swindells, M. B., and Ikura, M. (1999) Proteins 37:499–507
Yuan, W., Leisner, T., McFadden, A.W., Wang, Z., Larson, M.K., Clark, S., Boudignon- Proudhon, C., Lam, S.C.T., and Parise, L.V., (2006) CIB1 is an endogenous inhibitor of agonist-induced integrin αIIbβ3 activation. J. Cell. Biol172:169–175
Yamada, K. & Geiger, B., (1997) Molecular interactions in cell adhesion complexes. Curr.Opin.Cell Biol. 9: 76-85
Yamada, K.M., Pankov, R.., and. Cukierman E., (2003) Dimensions and dynamics in integrin function. Brasilian Journal of Medical and Biomedical Research. 36: 959-966
Yeaman C, Ayala MI, Wright J, Bard F, Bossard C, Ang a, Mweda Y, Seufferlein T, Mellman I, Nelson JW, Malhotra V. (2004) Protein kinase D regulates basolateral membrane protein exit from Golgi-network. Nature Cell Biology. 6:106-112.
96
ACKNOWLEDGEMENTS
This work was carried out in Departments of Internal medicine I at the University of Ulm, under the supervision of Prof Dr. Thomas Seufferlein, whom I first warmly thank for the guidance, incentive and trust.
I also wish to thank Prof Adler, the director of Internal Medicine I in Ulm for providing me with an opportunity to do my doctoral thesis.
I thank Andreas Brey for introducing me to lab work and for all the answers he has always had to my many questions.
Julia von Blume, Alexandra Auer, Tobias Busch and Alexander Kleger, are specially thanked for their professional support and even more for helping me to assimilate into German (schwabian) society.
I am thankful to Dr Götz von Wichert and his group for introducing me to the microscopy.
All the other colleagues present and past, from the Seuffeleins lab are thanked for joyful atmosphere, helpful discussions and cooperation in common tasks.
My family and my friends are lovingly thanked for all their support, patience and understanding.
97
98
99