DOCSLIB.ORG

Nuclear Factor E2F Mediates Basic Transcription and Trans-Activation by E La of the Human MYC Promoter

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Nuclear Factor E2F Mediates Basic Transcription and Trans-Activation by E La of the Human MYC Promoter Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Nuclear factor E2F mediates basic transcription and trans-activation by E la of the human MYC promoter Karin Thalmeier, 1 Heidi Synovzik, 1 Ronald Mertz, 2 Ernst-Ludwig Winnacker, 1,2 and Martin Lipp 1,3 IInstitut fiir Biochemie, Ludwig-Maximilians-Universitiit, D-8000 Munich 2, FRG; 2Laboratorium ffir Molekulare Biologie--Genzentrum, Am Klopferspitz, D-8033 Martinsried, FRG Transcription from one of the two initiation sites, P1 and P2, of the dual human MYC promoter seems to be essential in all proliferating cells. To identify proteins and target structures for MYC regulation, a DNA region was analyzed that is critical for P2 promoter activity. Here, we show that a nuclear factor binds to a DNA element within P2, which is conserved perfectly between mouse and man and displays a striking homology to the Ela-inducible E2 promoter of adenovirus type 5 (AdS}. We demonstrate that the same transcription factor, defined recently as E2F, which plays an essential role in the activation of adenovirus early promoters and enhancers, also interacts as a dominant nuclear factor with the MYC promoter. The presence of an intact E2F binding site is required for basic expression and for trans-activation of the P2 promoter by Ela proteins. The human MYC promoter is the first cellular target described for E2F. The results suggest that expression of MYC might be regulated via modulation of E2F by cellular 'Ela-like' factors. [Key Words: Transcription activation; gene regulation; protein-DNA interaction; MYC; Ela; E2F] Received November 25, 1988; revised version accepted February 14, 1989. : Ahhough the knowledge of transcriptional control in eu- Klein 1985}. Several studies have attempted to elucidate karyotic cells has advanced during recent years by the the regulation of the MYC gene by 5' deletions, in vivo identification of elementary DNA sequence and nuclear competition, and nuclear run-on transcription elements. factors interacting with these elements, the individual The results suggest that muhiple negative and positive mechanisms leading to tissue-specific regulation during regulatory elements, including transcriptional arrest differentiation or to a characteristic deregulation during within the first noncoding exon, are responsible for the malignant transformation of certain genes are under- steady-state level of MYC RNAs [Bentley and Groudine stood poorly. Recent studies suggest that multiple 1986; Chung et al. 1986; Eick and Bomkamm 1985; factors must cooperate and interact for enhancer- and Yang et al. 1986; Hay et al. 1987; Lipp et al. 1987; for tissue-specific transcriptional regulation and that dif- review, see Piechaczyk et al. 1987). Nevertheless, it is ferent factors may recognize the same consensus se- far from being understood which cellular transcription quence (for review, see Jones et al. 1988). The detection factors mediate repression or activation from the two of a single yeast protein that has the ability of binding to MYC promoters {P1 and P2) and how expression is modu- two distinct DNA sequences has highlighted the puz- lated during differentiation, immortalization, and malig- zling complexity of transcriptional control (Pfeifer et al. nant transformation. In this study, we describe a cellular 1987). transcription factor binding efficiently to an element Viral systems have been analyzed extensively because within the second promoter (P2), which possesses their control elements are organized tightly. Recently, binding specificities nondistinguishable from a nuclear interest has focused also on the regulation of cellular protein, recently defined as E2F [Kovesdi et al. 1987}. oncogenes, some of which are deregulated consistently This factor plays a fundamental role in the activation of and expressed highly in certain types of tumors. Among early promoters and enhancers of adenoviruses by inter- the examples best analyzed are human and mouse MYC acting with the virus-encoded early Ela proteins. We proto-oncogenes. They are activated by characteristic demonstrate that binding of this factor to the second chromosomal translocations in Burkitt's lymphomas MYC promoter increases during adenovirus infection and mouse plasmacytomas, respectively (Klein and and is essential for its trans-activation by Ela. Further- more, our results suggest that the activity of P2 can be modulated by other cellular 'Ela-like' proteins (Imper- ~Corresponding author. iale et al. 1984} via the E2F transcription factor. GENES & DEVELOPMENT 3:527-536 91989 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/89 $1.00 527 Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Thalmeier et al. Results compared to bands A and B. The specificity of the DNA-protein complexes A, B, and C was demonstrated Cell-type-specific binding pattern of nuclear extracts to by competition analysis with a 50-fold excess of unla- a MYC promoter fragment beled homologous promoter fragment (data not shown). The two promoters of the human MYC gene (P~ and P2) However, the weak double band E (Fig. 1) did not disap- are used differentially in certain cell types. P2 dominates pear even with a 200-fold excess of f-mycP2, and there- P~ in most cell lines or tissues analyzed so far. However, fore was considered provisionally as 'unspecific.' in Burkitt's lymphomas, MYC becomes activated by To define more precisely the binding site of nuclear consistent chromosomal translocations, and P~ is used proteins within the 188-bp MYC promoter fragment, we preferentially. We have shown recently by S1 analysis took advantage of synthetic oligonucleotides to compete that transcription initiates efficiently from P2 in 293 for particular sequences. Oligonucleotide myc-9/10 (Fig. cells, a cell line constitutively expressing the E la pro- 2; origin, see Fig. 1, bottom) was chosen, because its se- teins of adenovirus type 5 (ADS) (Lipp et al. 1989). Be- quence is highly conserved between human and mouse cause these differences might reflect the presence or ab- MYC promoters. Of 38 bp of myc-9/10, 34 bp are iden- sence of distinct transcription factors, nuclear extracts tical to the mouse sequence. As shown in Figure 1, of 293 cells and of the Burkitt lymphoma line BL64 were bands A, B, and C disappeared completely when a 60- prepared and tested in gel retardation experiments with fold molar excess of unlabeled double-stranded oligonu- a 188-bp DNA fragment from the MYC promoter, de- cleotide myc-9/10 was added. The pattern of complex noted f-mycP2, encompassing position -141 to +47 bands did not alter in the presence of unrelated oligonu- with respect to the transcriptional start site of P2. As cleotides A1/B1, EW-1/2, K-l/2 (Fig. 2). These results shown in Figure 1, crude nuclear extract of 293 cells demonstrate that crude nuclear extracts from 293 cells gave rise to two specific DNA-protein complexes (A and from Burkitt lymphoma cells form different DNA- and B), whereas the extract of BL64 cells revealed only protein complexes by recognizing a short MYC promoter one complex band (C) with an intermediate mobility sequence of 38 bp represented by the oligonucleotide Figure 1. Gel retardation assay of the fragment f-mycP2 with crude extracts of 293 and BL6r cells. In the presence of 2 gg poly[d(A- T)], 16 fmole of 5' end-labeled f-mycP2 (- 141 to + 47) were incubated with 6 ~g of 293 extract {lanes 1-5) or BL64 extract {lanes 6-10). Competition experiments were done by adding a 60-fold molar excess of unlabeled double-stranded oligonucleotides (for sequence, see Fig. 2), as indicated above each lane. (A-E) DNA-protein complex bands; (D) the unbound fragment. {Bottom) The location of oligonucleotide myc-9/10 within fragment f-mycP2. (*) Homology to the core consensus sequence of transcription factor Spl; {A) homology to the consensus sequence of nuclear factor NFI. 528 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Interaction of E2F with MYC 5"-TGCACCTCCCCACCTTCCCCACCCTCCCCACCCTCCCCAT -3" myc-I/2 3"- GGAGGGGTGGAAGGGGTGGGAGGGGTGGGAGGGGTAGATC-5" 5"-TCGACGCTTGGCGGGAAAAAGAACGGAGGGAGGGAT -3" myc-7/8 3"- GCGAACCGCCCTTTTTCTTGCCTCCCTCCCTAGATC-5" 5"-AGCTCAGAGGCTTGGCGGGAAAAAGAACGGAGGGAGGGAT -3" myc-9/10 3"- GTCTCCGAACCGCCCTTTTTCTTGCCTCCCTCCCTAGATC-5" ATF E2F E2F 5"- GATCCAGATIGACGTAGT T~C G~GC'TTAAAT TT GAGAAAGGGCGCG~CTA iiii:ii!i!i!i!i!:!:!!!i:!!!!! i i!i iiiii:i ii:i:iii:i:iii:i:{!iii:i:iii:~i!:!!!i!:!:! !i!:!! EFI/2 3" - GTCTA~TG~TC~GCGCGAATTTAAACTC TTTC CCGCGCTTTGATCTAG ATF 5"- EF3/4 3"- GTCTACT~A~AAAAGTTCGAATTTAAAC TCTTTCCCGAACTTTGATCTAG E2F E2F 5"- GATC CAGATSATT TAGT'TTTC~GCGC'T::.:<:::::::::::: :::::::::::::::::::::: TAAAT TTGAGAAAG~GCG~G~C:::::::::::::::::::::::::::::::::::::::::: TA EF5/6 3"- GTCTACTAAATC~G~GCGAATTTAAACTCTTTCCCGC:G~iT.TTGATCTAG NFI 5" -AATTCCTTATTTTGGATTGAA~C~TATGATAATGAGG -3" AI/BI 3" - GGAAT~~TAACTT~GTTATAC TATTACTCCCTAG- 5 " NF1 5" "AATTCGGGGCTTr~GGCACTGT~CC~CTGTGTTGTGT.......................................i T -3" El/E2 3" - GCCC CG~~GTGACACGG~TGACACAACACAACTAG- 5 " NF 1 5 "-~rTCCTTT~T~ArTG~QC~TATGA~TGAGG -3" EWI/2 3" GG~~CTAACT~C~GT~ATACTATTAC TCCCTAG- 5 " Spl 5 "-AATTTTTGTGACGTGGCGCGGGGCGTGGGAACGGGGCG ~ -3" K-I/2 3"- ~CACTGCACCGCGCCCCGCACCCTTGCr " CBP 5 "-GATCCGTCTTGTCATiTGGCGAATTCGAACACGCAGATG -3 " TK-I/2 3 "- GCAGAACAG~CCGCTTAAGCTTGTGCGTCTACAGCT-5 " Spl API , w I ................ ' | 5" -AATTCG~I~i~GACTATGGTTG:~TG~C~TTGAGATGCATGCG
Load more

Recommended publications
  • Nuclear Localization of DP and E2F Transcription Factors by Heterodimeric Partners and Retinoblastoma Protein Family Members
    Journal of Cell Science 109, 1717-1726 (1996) 1717 Printed in Great Britain © The Company of Biologists Limited 1996 JCS7086 Nuclear localization of DP and E2F transcription factors by heterodimeric partners and retinoblastoma protein family members Junji Magae1, Chin-Lee Wu2, Sharon Illenye1, Ed Harlow2 and Nicholas H. Heintz1,* 1Department of Pathology, University of Vermont, Burlington VT 05405, USA 2Massachusetts General Hospital Cancer Center, Charlestown MA 02129, USA *Author for correspondence SUMMARY E2F is a family of transcription factors implicated in the showed that regions of E2F-1 and DP-1 that are required regulation of genes required for progression through G1 for stable association of the two proteins were also required and entry into the S phase. The transcriptionally active for nuclear localization of DP-1. Unlike E2F-1, -2, and -3, forms of E2F are heterodimers composed of one polypep- E2F-4 did not accumulate in the nucleus unless it was coex- tide encoded by the E2F gene family and one polypeptide pressed with DP-2. p107 and p130, but not pRb, stimulated encoded by the DP gene family. The transcriptional activity nuclear localization of E2F-4, either alone or in combina- of E2F/DP heterodimers is influenced by association with tion with DP-2. These results indicate that DP proteins the members of the retinoblastoma tumor suppressor preferentially associate with specific E2F partners, and protein family (pRb, p107, and p130). Here the intracellu- suggest that the ability of specific E2F/DP heterodimers to lar distribution of E2F and DP proteins was investigated in localize in the nucleus contributes to the regulation of E2F transiently transfected Chinese hamster and human cells.
    [Show full text]
  • TP63 and TP73 in Cancer, an Unresolved В€Œfamily∕ Puzzle Of
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 588 (2014) 2590–2599 journal homepage: www.FEBSLetters.org Review TP63 and TP73 in cancer, an unresolved ‘‘family’’ puzzle of complexity, redundancy and hierarchy Antonio Costanzo a, Natalia Pediconi b,c, Alessandra Narcisi a, Francesca Guerrieri c,d, Laura Belloni c,d, ⇑ Francesca Fausti a, Elisabetta Botti a, Massimo Levrero c,d, a Dermatology Unit, Department of Neuroscience, Mental Health and Sensory Organs (NESMOS), Sapienza University of Rome, Italy b Laboratory of Molecular Oncology, Department of Molecular Medicine, Sapienza University of Rome, Italy c Center for Life Nanosciences (CNLS) – IIT/Sapienza, Rome, Italy d Laboratory of Gene Expression, Department of Internal Medicine (DMISM), Sapienza University of Rome, Italy article info abstract Article history: TP53 belongs to a small gene family that includes, in mammals, two additional paralogs, TP63 and Received 19 May 2014 TP73. The p63 and p73 proteins are structurally and functionally similar to p53 and their activity as Revised 16 June 2014 transcription factors is regulated by a wide repertoire of shared and unique post-translational mod- Accepted 16 June 2014 ifications and interactions with regulatory cofactors. p63 and p73 have important functions in Available online 28 June 2014 embryonic development and differentiation but are also involved in tumor suppression. The biology Edited by Shairaz Baksh, Giovanni Blandino of p63 and p73 is complex since both TP63 and TP73 genes are transcribed into a variety of different and Wilhelm Just isoforms that give rise to proteins with antagonistic properties, the TA-isoforms that act as tumor- suppressors and DN-isoforms that behave as proto-oncogenes.
    [Show full text]
  • AP-1 in Cell Proliferation and Survival
    Oncogene (2001) 20, 2390 ± 2400 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc AP-1 in cell proliferation and survival Eitan Shaulian1 and Michael Karin*,1 1Laboratory of Gene Regulation and Signal Transduction, Department of Pharmacology, University of California San Diego, 9500 Gilman Drive, La Jolla, California, CA 92093-0636, USA A plethora of physiological and pathological stimuli extensively discussed previously (Angel and Karin, induce and activate a group of DNA binding proteins 1991; Karin, 1995). that form AP-1 dimers. These proteins include the Jun, The mammalian AP-1 proteins are homodimers and Fos and ATF subgroups of transcription factors. Recent heterodimers composed of basic region-leucine zipper studies using cells and mice de®cient in individual AP-1 (bZIP) proteins that belong to the Jun (c-Jun, JunB proteins have begun to shed light on their physiological and JunD), Fos (c-Fos, FosB, Fra-1 and Fra-2), Jun functions in the control of cell proliferation, neoplastic dimerization partners (JDP1 and JDP2) and the closely transformation and apoptosis. Above all such studies related activating transcription factors (ATF2, LRF1/ have identi®ed some of the target genes that mediate the ATF3 and B-ATF) subfamilies (reviewed by (Angel eects of AP-1 proteins on cell proliferation and death. and Karin, 1991; Aronheim et al., 1997; Karin et al., There is evidence that AP-1 proteins, mostly those that 1997; Liebermann et al., 1998; Wisdom, 1999). In belong to the Jun group, control cell life and death addition, some of the Maf proteins (v-Maf, c-Maf and through their ability to regulate the expression and Nrl) can heterodimerize with c-Jun or c-Fos (Nishiza- function of cell cycle regulators such as Cyclin D1, p53, wa et al., 1989; Swaroop et al., 1992), whereas other p21cip1/waf1, p19ARF and p16.
    [Show full text]
  • Targeting the RB-E2F Pathway in Breast Cancer
    Oncogene (2016) 35, 4829–4835 © 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 0950-9232/16 www.nature.com/onc REVIEW Targeting the RB-E2F pathway in breast cancer J Johnson1, B Thijssen1, U McDermott2, M Garnett2, LFA Wessels1 and R Bernards1 Mutations of the retinoblastoma tumor-suppressor gene (RB1) or components regulating the CDK-RB-E2F pathway have been identified in nearly every human malignancy. Re-establishing cell cycle control through cyclin-dependent kinase (CDK) inhibition has therefore emerged as an attractive option in the development of targeted cancer therapy. The most successful example of this today is the use of the CDK4/6 inhibitor palbociclib combined with aromatase inhibitors for the treatment of estrogen receptor- positive breast cancers. Multiple studies have demonstrated that the CDK-RB-E2F pathway is critical for the control of cell proliferation. More recently, studies have highlighted additional roles of this pathway, especially E2F transcription factors themselves, in tumor progression, angiogenesis and metastasis. Specific E2Fs also have prognostic value in breast cancer, independent of clinical parameters. We discuss here recent advances in understanding of the RB-E2F pathway in breast cancer. We also discuss the application of genome-wide genetic screening efforts to gain insight into synthetic lethal interactions of CDK4/6 inhibitors in breast cancer for the development of more effective combination therapies. Oncogene (2016) 35, 4829–4835; doi:10.1038/onc.2016.32; published online 29 February 2016 INTRODUCTION multi-subunit protein complex containing partner (DP), RB-like, To maintain genome integrity, the mammalian cell cycle must be E2F and MuvB (DREAM) represses most if not all cell cycle gene 6 stringently regulated.
    [Show full text]
  • Dialogue Between Estrogen Receptor and E2F Signaling Pathways: the Transcriptional Coregulator RIP140 at the Crossroads*
    Advances in Bioscience and Biotechnology, 2013, 4, 45-54 ABB http://dx.doi.org/10.4236/abb.2013.410A3006 Published Online October 2013 (http://www.scirp.org/journal/abb/) Dialogue between estrogen receptor and E2F signaling pathways: The transcriptional coregulator RIP140 at the * crossroads Marion Lapierre1,2,3,4, Aurélie Docquier1,2,3,4, Audrey Castet-Nicolas1,2,3,4, Stéphan Jalaguier1,2,3,4, Catherine Teyssier1,2,3,4, Patrick Augereau1,2,3,4, Vincent Cavaillès1,2,3,4 1IRCM—Institut de Recherche en Cancérologie de Montpellier, Montpellier, France 2INSERM, U896, Montpellier, France 3Université Montpellier1, Montpellier, France 4Institut Régional du Cancer Montpellier, Montpellier, France Email: [email protected] Received 25 July 2013; revised 25 August 2013; accepted 19 September 2013 Copyright © 2013 Marion Lapierre et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. ABSTRACT Estrogen Receptors; Gene Expression; Cell Proliferation; Breast Cancer; Endocrine Therapies Estrogen receptors and E2F transcription factors are the key players of two nuclear signaling pathways which exert a major role in oncogenesis, particularly 1. ESTROGEN RECEPTOR AND E2F in the mammary gland. Different levels of dialogue SIGNALING PATHWAYS between these two pathways have been deciphered 1.1. Estrogen Signaling in Breast Cancer Cells and deregulation of the E2F pathway has been shown to impact the response of breast cancer cells to endo- Estrogens are steroid hormones that regulate growth and crine therapies. The present review focuses on the differentiation of a large number of target tissues such as transcriptional coregulator RIP140/NRIP1 which is the mammary gland, the reproductive tract and skeletal involved in several regulatory feed-back loops and and cardiovascular systems [1].
    [Show full text]
  • Dissecting the DNA Binding Landscape and Gene Regulatory Network of P63 and P53
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.11.145540; this version posted June 12, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Dissecting the DNA binding landscape and gene regulatory network of p63 and p53 Konstantin Riege1, Helene Kretzmer2, Simon S. McDade3, Steve Hoffmann1, Martin Fischer1,# 1 Computational Biology Group, Leibniz Institute on Aging – Fritz Lipmann Institute (FLI), Beutenbergstraße 11, 07745 Jena, Germany 2 Department of Genome Regulation, Max Planck Institute for Molecular Genetics, Ihnestraße 63-73, 14195 Berlin, Germany 3 Patrick G Johnston Centre for Cancer Research, Queen's University Belfast, 97 Lisburn Road, Belfast BT9 7AE, UK Running title: p63 GRN vs p53 GRN #To whom correspondence should be addressed. Email: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.06.11.145540; this version posted June 12, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract The transcription factor (TF) p53 is the best-known tumor suppressor, but its ancient sibling p63 (ΔNp63) is a master regulator of epidermis development and a key oncogenic driver in squamous cell carcinomas (SCC). Despite multiple gene expression studies becoming available in recent years, the limited overlap of reported p63-dependent genes has made it difficult to decipher the p63 gene regulatory network (GRN).
    [Show full text]
  • P53 and E2f: Partners in Life and Death
    REVIEWS p53 and E2f: partners in life and death Shirley Polager and Doron Ginsberg Abstract | During tumour development cells sustain mutations that disrupt normal mechanisms controlling proliferation. Remarkably, the Rb–E2f and MDM2–p53 pathways are both defective in most, if not all, human tumours, which underscores the crucial role of these pathways in regulating cell cycle progression and viability. A simple interpretation of the observation that both pathways are deregulated is that they function independently in the control of cell fate. However, a large body of evidence indicates that, in addition to their independent effects on cell fate, there is extensive crosstalk between these two pathways, and specifically between the transcription factors E2F1 and p53, which influences vital cellular decisions. This Review discusses the molecular mechanisms that underlie the intricate interactions between E2f and p53. Autophagy The tumour suppressor p53 is a transcription factor suppressor and have a pivotal role in controlling cell cycle A catabolic process involving that is activated in response to virtually all cancer- progression (FIG. 1b). Initially, studies revealed that E2fs the degradation of a cell’s own associated stress signals, including DNA damage determine the timely expression of many genes that components by the lysosomal and oncogene activation. Normally, the levels of p53 are required for entry into and progression through machinery. protein are low, owing to rapid ubiquitin-dependent S phase of the cell cycle. However, it has become clear degradation largely directed by the E3 ubiquitin ligase that transcriptional activation of S phase-associated MDM2, which is also a target of transcriptional regu- genes is only one facet of E2f activity: we now know lation by p53 (REF.
    [Show full text]
  • Control of Cell Cycle Progression by C-Jun Is P53 Dependent
    Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Control of cell cycle progression by c-Jun is p53 dependent Martin Schreiber,1,4 Andrea Kolbus,2 Fabrice Piu,3,5 Axel Szabowski,2 Uta Mo¨hle-Steinlein,1 Jianmin Tian,3 Michael Karin,3 Peter Angel,2 and Erwin F. Wagner1,6 1Research Institute of Molecular Pathology (IMP), A-1030 Vienna, Austria; 2Deutsches Krebsforschungszentrum (DKFZ), Division of Signal Transduction and Growth Control, D-69120 Heidelberg, Germany; 3Department of Pharmacology, University of California at San Diego, La Jolla, California 92093-0636 USA The c-jun proto-oncogene encodes a component of the mitogen-inducible immediate–early transcription factor AP-1 and has been implicated as a positive regulator of cell proliferation and G1-to-S-phase progression. Here we report that fibroblasts derived from c-jun−/− mouse fetuses exhibit a severe proliferation defect and undergo a prolonged crisis before spontaneous immortalization. The cyclin D1- and cyclin E-dependent kinases (CDKs) and transcription factor E2F are poorly activated, resulting in inefficient G1-to-S-phase progression. Furthermore, the absence of c-Jun results in elevated expression of the tumor suppressor gene p53 and its target gene, the CDK inhibitor p21, whereas overexpression of c-Jun represses p53 and p21 expression and accelerates cell proliferation. Surprisingly, protein stabilization, the common mechanism of p53 regulation, is not involved in up-regulation of p53 in c-jun−/− fibroblasts. Rather, c-Jun regulates transcription of p53 negatively by direct binding to a variant AP-1 site in the p53 promoter.
    [Show full text]
  • E2F Activity Is Essential for Survival of Myc-Overexpressing Human Cancer Cells
    Oncogene (2002) 21, 6498 – 6509 ª 2002 Nature Publishing Group All rights reserved 0950 – 9232/02 $25.00 www.nature.com/onc E2F activity is essential for survival of Myc-overexpressing human cancer cells Eric Santoni-Rugiu*,1,3, Dominique Duro1,5, Thomas Farkas1, Ida S Mathiasen2, Marja Ja¨ a¨ ttela¨ 2, Jiri Bartek*,1,4 and Jiri Lukas1 1Department of Cell Cycle and Cancer, Institute of Cancer Biology, Danish Cancer Society, 2100 Copenhagen E., Denmark; 2Apoptosis Laboratory, Institute of Cancer Biology, Danish Cancer Society, 2100 Copenhagen E., Denmark Effective cell cycle completion requires both Myc and Introduction E2F activities. However, whether these two activities interact to regulate cell survival remains to be tested. The tumor suppressors p16INK4A (p16) and p14/ Here we have analysed survival of inducible c-Myc- p19ARF (ARF) are two alternative and structurally overexpressing cell lines derived from U2OS human unrelated products encoded by the INK4A/ARF genetic osteosarcoma cells, which carry wild-type pRb and p53 locus (Duro et al., 1995; Quelle et al., 1995), a frequent and are deficient for p16 and ARF expression. Induced target of inactivation in tumorigenesis (Roussel, 1999). U2OS-Myc cells neither underwent apoptosis sponta- While p16 inhibits the phosphorylation of the retino- neously nor upon reconstitution of the ARF-p53 axis blastoma protein (pRb), ARF stabilizes p53 and and/or serum-starvation. However, they died massively activates p53-mediated growth-inhibitory responses when concomitantly exposed to inhibitors of E2F (reviewed in Sherr and Weber, 2000). Deregulated activity, including a constitutively active pRb (RbDcdk) expression of distinct cell cycle stimulating oncogenes, mutant, p16, a stable p27 (p27T187A) mutant, a such as Myc, E2F-1, E1A, and Ras can upregulate dominant-negative (dn) CDK2, or dnDP-1.
    [Show full text]
  • Heterodimerization of the Transcription Factors E2F-1 and DP-1 Leads to Cooperative Trans-Activation
    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Heterodimerization of the transcription factors E2F-1 and DP-1 leads to cooperative trans-activation Kristian Helin, ~ Chin-Lee Wu, Ali R. Fattaey, Jacqueline A. Lees, Brian D. Dynlacht, Chidi Ngwu, and Ed Harlow Massachusetts General Hospital Cancer Center, Charlestown, Massachusetts 02129 USA The E2F transcription factor has been implicated in the regulation of genes whose products are involved in cell proliferation. Two proteins have recently been identified with E2F-like properties. One of these proteins, E2F-1, has been shown to mediate E2F-dependent trans-activation and to bind the hypophosphorylated form of the retinoblastoma protein {pRB). The other protein, mudne DP-1, was purified from an E2F DNA-affinity column, and it was subsequently shown to bind the consensus E2F DNA-binding site. To study a possible interaction between E2F-1 and DP-1, we have now isolated a cDNA for the human homolog of DP-1. Human DP-1 and E2F-1 associate both in vivo and in vitro, and this interaction leads to enhanced binding to E2F DNA-binding sites. The association of E2F-1 and DP-1 leads to cooperative activation of an E2F-responsive promoter. Finally, we demonstrate that E2F-1 and DP-1 association is required for stable interaction with pRB in vivo and that trans-activation by E2F-1/DP-1 heterodimers is inhibited by pRB. We suggest that "E2F" is the activity that is formed when an E2F-l-related protein and a DP-l-related protein dimerize.
    [Show full text]
  • Stage-Specific Modulation of Skeletal Myogenesis by Inhibitors of Nuclear Deacetylases
    Stage-specific modulation of skeletal myogenesis by inhibitors of nuclear deacetylases Simona Iezzi*, Giulio Cossu†‡, Clara Nervi‡, Vittorio Sartorelli*§, and Pier Lorenzo Puri¶ʈ§ *Laboratory of Muscle Biology, Muscle Gene Expression Group, National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health, Bethesda, MD 20892; †Institute for Stem Cell Research, H. San Raffaele, Via Olgettina 58, I-20133 Milan, Italy; ‡Department of Histology and Medical Embryology, and ¶Laboratory of Gene Expression Fondazione Andrea Cesalpino, University of Rome ‘‘La Sapienza,’’ 00161 Rome, Italy; and ʈClayton Foundation Laboratories for Peptide Biology, The Salk Institute for Biological Studies, La Jolla, CA 92093 Communicated by Renato Dulbecco, The Salk Institute for Biological Studies, San Diego, CA, April 10, 2002 (received for review January 15, 2002) Nuclear acetyltransferases promote and deacetylases inhibit skel- Materials and Methods etal muscle-gene expression, suggesting the potential effective- Cells, Plasmids, Transfections, and Luciferase (luc) Reporter Assay. ness of deacetylase inhibitors (DIs) in modulating skeletal myo- C2C12 skeletal muscle cells and human skeletal myoblasts were genesis. Surprisingly, previous studies have indicated that DIs cultured in DMEM supplemented with 20% FBS (growth me- suppress myogenesis. The recent observations that histone dium, GM) and induced to differentiate with DMEM supple- deacetylases associate with the muscle-regulatory proteins MyoD mented with 2% horse serum and 1ϫ insulin, transferrin, and and MEF2C only in undifferentiated myoblasts prompted us to selenium (differentiation medium, DM). C2C12 stable cell lines evaluate the effect of DIs at distinct stages of the myogenic with integrated reporters are described in ref. 10. The muscle program. We found that exposure of established rodent and creatine kinase (MCK)-luc, 4RE-luc, E2F-luc, MLC1͞3F- human muscle cells to distinct DIs has stage-specific effects.
    [Show full text]
  • RB and Cell Cycle Progression
    Oncogene (2006) 25, 5220–5227 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc REVIEW RB and cell cycle progression C Giacinti1,2 and A Giordano1,2 1Sbarro Institute for Cancer Research and Molecular Medicine, Temple University, Philadelphia, PA, USA and 2Department of Human Pathology and Oncology, University of Siena, Siena, Italy The Rb protein is a tumor suppressor, which plays a of a tumor suppressor. Several human tumors show pivotal role in the negative control of the cell cycle and in mutations and deletions of the Rb gene, and inherited tumor progression. It has been shown that Rb protein allelic loss of Rb confers increased susceptibility to (pRb)is responsible for a major G1 checkpoint, blocking cancer formation (Dunn et al., 1988). The Rb gene is S-phase entry and cell growth. The retinoblastoma family functionally inactivated in most human neoplasms includes three members, Rb/p105, p107 and Rb2/p130, either by direct mutation/deletion, such as in retino- collectively referred to as ‘pocket proteins’. The pRb blastoma, osteosarcoma and small-cell lung carcinoma, protein represses gene transcription, required for transi- or indirectly through altered expression/activity of tion from G1 to S phase, by directly binding to the upstream regulators (Liu et al., 2004). Nevertheless, transactivation domain of E2F and by binding to the the Rb protein plays a pivotal role in the negative promoter of these genes as a complex with E2F. pRb control of the cell cycle and in tumor progression. represses transcription also by remodeling chromatin It has been shown that Rb protein (pRb) is structure through interaction with proteins such as responsible for a major G1 checkpoint (restriction hBRM, BRG1, HDAC1 and SUV39H1, which are point) blocking S-phase entry and cell growth, promot- involved in nucleosome remodeling, histone acetylation/ ing terminal differentiation by inducing both cell cycle deacetylation and methylation, respectively.
    [Show full text]