Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Nuclear factor E2F mediates basic transcription and trans-activation by E la of the human MYC promoter Karin Thalmeier, 1 Heidi Synovzik, 1 Ronald Mertz, 2 Ernst-Ludwig Winnacker, 1,2 and Martin Lipp 1,3 IInstitut fiir Biochemie, Ludwig-Maximilians-Universitiit, D-8000 Munich 2, FRG; 2Laboratorium ffir Molekulare Biologie--Genzentrum, Am Klopferspitz, D-8033 Martinsried, FRG Transcription from one of the two initiation sites, P1 and P2, of the dual human MYC promoter seems to be essential in all proliferating cells. To identify proteins and target structures for MYC regulation, a DNA region was analyzed that is critical for P2 promoter activity. Here, we show that a nuclear factor binds to a DNA element within P2, which is conserved perfectly between mouse and man and displays a striking homology to the Ela-inducible E2 promoter of adenovirus type 5 (AdS}. We demonstrate that the same transcription factor, defined recently as E2F, which plays an essential role in the activation of adenovirus early promoters and enhancers, also interacts as a dominant nuclear factor with the MYC promoter. The presence of an intact E2F binding site is required for basic expression and for trans-activation of the P2 promoter by Ela proteins. The human MYC promoter is the first cellular target described for E2F. The results suggest that expression of MYC might be regulated via modulation of E2F by cellular 'Ela-like' factors. [Key Words: Transcription activation; gene regulation; protein-DNA interaction; MYC; Ela; E2F] Received November 25, 1988; revised version accepted February 14, 1989. : Ahhough the knowledge of transcriptional control in eu- Klein 1985}. Several studies have attempted to elucidate karyotic cells has advanced during recent years by the the regulation of the MYC gene by 5' deletions, in vivo identification of elementary DNA sequence and nuclear competition, and nuclear run-on transcription elements. factors interacting with these elements, the individual The results suggest that muhiple negative and positive mechanisms leading to tissue-specific regulation during regulatory elements, including transcriptional arrest differentiation or to a characteristic deregulation during within the first noncoding exon, are responsible for the malignant transformation of certain genes are under- steady-state level of MYC RNAs [Bentley and Groudine stood poorly. Recent studies suggest that multiple 1986; Chung et al. 1986; Eick and Bomkamm 1985; factors must cooperate and interact for enhancer- and Yang et al. 1986; Hay et al. 1987; Lipp et al. 1987; for tissue-specific transcriptional regulation and that dif- review, see Piechaczyk et al. 1987). Nevertheless, it is ferent factors may recognize the same consensus se- far from being understood which cellular transcription quence (for review, see Jones et al. 1988). The detection factors mediate repression or activation from the two of a single yeast protein that has the ability of binding to MYC promoters {P1 and P2) and how expression is modu- two distinct DNA sequences has highlighted the puz- lated during differentiation, immortalization, and malig- zling complexity of transcriptional control (Pfeifer et al. nant transformation. In this study, we describe a cellular 1987). transcription factor binding efficiently to an element Viral systems have been analyzed extensively because within the second promoter (P2), which possesses their control elements are organized tightly. Recently, binding specificities nondistinguishable from a nuclear interest has focused also on the regulation of cellular protein, recently defined as E2F [Kovesdi et al. 1987}. oncogenes, some of which are deregulated consistently This factor plays a fundamental role in the activation of and expressed highly in certain types of tumors. Among early promoters and enhancers of adenoviruses by inter- the examples best analyzed are human and mouse MYC acting with the virus-encoded early Ela proteins. We proto-oncogenes. They are activated by characteristic demonstrate that binding of this factor to the second chromosomal translocations in Burkitt's lymphomas MYC promoter increases during adenovirus infection and mouse plasmacytomas, respectively (Klein and and is essential for its trans-activation by Ela. Further- more, our results suggest that the activity of P2 can be modulated by other cellular 'Ela-like' proteins (Imper- ~Corresponding author. iale et al. 1984} via the E2F transcription factor. GENES & DEVELOPMENT 3:527-536 91989 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/89 $1.00 527 Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Thalmeier et al. Results compared to bands A and B. The specificity of the DNA-protein complexes A, B, and C was demonstrated Cell-type-specific binding pattern of nuclear extracts to by competition analysis with a 50-fold excess of unla- a MYC promoter fragment beled homologous promoter fragment (data not shown). The two promoters of the human MYC gene (P~ and P2) However, the weak double band E (Fig. 1) did not disap- are used differentially in certain cell types. P2 dominates pear even with a 200-fold excess of f-mycP2, and there- P~ in most cell lines or tissues analyzed so far. However, fore was considered provisionally as 'unspecific.' in Burkitt's lymphomas, MYC becomes activated by To define more precisely the binding site of nuclear consistent chromosomal translocations, and P~ is used proteins within the 188-bp MYC promoter fragment, we preferentially. We have shown recently by S1 analysis took advantage of synthetic oligonucleotides to compete that transcription initiates efficiently from P2 in 293 for particular sequences. Oligonucleotide myc-9/10 (Fig. cells, a cell line constitutively expressing the E la pro- 2; origin, see Fig. 1, bottom) was chosen, because its se- teins of adenovirus type 5 (ADS) (Lipp et al. 1989). Be- quence is highly conserved between human and mouse cause these differences might reflect the presence or ab- MYC promoters. Of 38 bp of myc-9/10, 34 bp are iden- sence of distinct transcription factors, nuclear extracts tical to the mouse sequence. As shown in Figure 1, of 293 cells and of the Burkitt lymphoma line BL64 were bands A, B, and C disappeared completely when a 60- prepared and tested in gel retardation experiments with fold molar excess of unlabeled double-stranded oligonu- a 188-bp DNA fragment from the MYC promoter, de- cleotide myc-9/10 was added. The pattern of complex noted f-mycP2, encompassing position -141 to +47 bands did not alter in the presence of unrelated oligonu- with respect to the transcriptional start site of P2. As cleotides A1/B1, EW-1/2, K-l/2 (Fig. 2). These results shown in Figure 1, crude nuclear extract of 293 cells demonstrate that crude nuclear extracts from 293 cells gave rise to two specific DNA-protein complexes (A and from Burkitt lymphoma cells form different DNA- and B), whereas the extract of BL64 cells revealed only protein complexes by recognizing a short MYC promoter one complex band (C) with an intermediate mobility sequence of 38 bp represented by the oligonucleotide Figure 1. Gel retardation assay of the fragment f-mycP2 with crude extracts of 293 and BL6r cells. In the presence of 2 gg poly[d(A- T)], 16 fmole of 5' end-labeled f-mycP2 (- 141 to + 47) were incubated with 6 ~g of 293 extract {lanes 1-5) or BL64 extract {lanes 6-10). Competition experiments were done by adding a 60-fold molar excess of unlabeled double-stranded oligonucleotides (for sequence, see Fig. 2), as indicated above each lane. (A-E) DNA-protein complex bands; (D) the unbound fragment. {Bottom) The location of oligonucleotide myc-9/10 within fragment f-mycP2. (*) Homology to the core consensus sequence of transcription factor Spl; {A) homology to the consensus sequence of nuclear factor NFI. 528 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Interaction of E2F with MYC 5"-TGCACCTCCCCACCTTCCCCACCCTCCCCACCCTCCCCAT -3" myc-I/2 3"- GGAGGGGTGGAAGGGGTGGGAGGGGTGGGAGGGGTAGATC-5" 5"-TCGACGCTTGGCGGGAAAAAGAACGGAGGGAGGGAT -3" myc-7/8 3"- GCGAACCGCCCTTTTTCTTGCCTCCCTCCCTAGATC-5" 5"-AGCTCAGAGGCTTGGCGGGAAAAAGAACGGAGGGAGGGAT -3" myc-9/10 3"- GTCTCCGAACCGCCCTTTTTCTTGCCTCCCTCCCTAGATC-5" ATF E2F E2F 5"- GATCCAGATIGACGTAGT T~C G~GC'TTAAAT TT GAGAAAGGGCGCG~CTA iiii:ii!i!i!i!i!:!:!!!i:!!!!! i i!i iiiii:i ii:i:iii:i:iii:i:{!iii:i:iii:~i!:!!!i!:!:! !i!:!! EFI/2 3" - GTCTA~TG~TC~GCGCGAATTTAAACTC TTTC CCGCGCTTTGATCTAG ATF 5"- EF3/4 3"- GTCTACT~A~AAAAGTTCGAATTTAAAC TCTTTCCCGAACTTTGATCTAG E2F E2F 5"- GATC CAGATSATT TAGT'TTTC~GCGC'T::.:<:::::::::::: :::::::::::::::::::::: TAAAT TTGAGAAAG~GCG~G~C:::::::::::::::::::::::::::::::::::::::::: TA EF5/6 3"- GTCTACTAAATC~G~GCGAATTTAAACTCTTTCCCGC:G~iT.TTGATCTAG NFI 5" -AATTCCTTATTTTGGATTGAA~C~TATGATAATGAGG -3" AI/BI 3" - GGAAT~~TAACTT~GTTATAC TATTACTCCCTAG- 5 " NF1 5" "AATTCGGGGCTTr~GGCACTGT~CC~CTGTGTTGTGT.......................................i T -3" El/E2 3" - GCCC CG~~GTGACACGG~TGACACAACACAACTAG- 5 " NF 1 5 "-~rTCCTTT~T~ArTG~QC~TATGA~TGAGG -3" EWI/2 3" GG~~CTAACT~C~GT~ATACTATTAC TCCCTAG- 5 " Spl 5 "-AATTTTTGTGACGTGGCGCGGGGCGTGGGAACGGGGCG ~ -3" K-I/2 3"- ~CACTGCACCGCGCCCCGCACCCTTGCr " CBP 5 "-GATCCGTCTTGTCATiTGGCGAATTCGAACACGCAGATG -3 " TK-I/2 3 "- GCAGAACAG~CCGCTTAAGCTTGTGCGTCTACAGCT-5 " Spl API , w I ................ ' | 5" -AATTCG~I~i~GACTATGGTTG:~TG~C~TTGAGATGCATGCG