Progesterone Induces Cell Apoptosis Via the CACNA2D3/Ca2+/P38 MAPK Pathway in Endometrial Cancer

ONCOLOGY REPORTS 43: 121-132, 2020

Progesterone induces cell apoptosis via the CACNA2D3/Ca2+/p38 MAPK pathway in endometrial cancer

XIANGNAN KONG1*, MIN LI2*, KAI SHAO1,3, YINRONG YANG1, QIAN WANG1 and MEIJUAN CAI1

1Department of Clinical Laboratory, 2Department of Gynecology, Qilu Hospital of Shandong University, Jinan, Shandong 250012; 3Qingdao Key Lab of Mitochondrial Medicine, Qilu Hospital of Shandong University (Qingdao), Qingdao, Shandong 266035, P.R. China

Received July 9, 2019; Accepted October 15, 2019

DOI: 10.3892/or.2019.7396

Abstract. Endometrial cancer (EC) is one of the most antitumor role of CACNA2D3 in EC, and revealed the mecha- common malignant gynecological tumors in women. The nism of P4 inhibition of EC progression, which provided a new main treatments for EC (surgery, chemotherapy and radiation target for EC therapy and new evidence for P4 in EC therapy. therapy) produce significant side effects. Thus, it is urgent to identify promising therapeutic targets and prognostic markers. Introduction CACNA2D3, as a member of the calcium channel regulatory α2δ subunit family, is reported to exert a tumor suppres- Endometrial cancer (EC) is one of the most common malig- sive effect in numerous cancers. However, the function of nant gynecological tumors (1) and remains a major cause of CACNA2D3 in EC is not well known. In the present study, cancer‑associated morbidity and mortality among women (2). CACNA2D3 was lowly expressed in EC tissues and cells. The With changes in western lifestyles and the rising prevalence overexpression of CACNA2D3 via lentiviral particle injection of obesity in developing counties, the incidence of EC has significantly blocked the tumor growth in anin vivo xenograft increased, and is becoming increasingly more common in model. In vitro, the overexpression of CACNA2D3 markedly younger individuals in China (3). Current treatments for EC inhibited cell proliferation and migration, and promoted primarily include surgery, chemotherapy and radiation therapy, cell apoptosis and calcium influx. These data revealed that which are associated with notable side effects (4). In addition, CACNA2D3 functions as a tumor suppressor in EC. It was in some young early‑stage patients with EC, preserving their also revealed that the addition of progesterone (P4) blocked fertility is required. Therefore, elucidation of the molecular tumor growth in Ishikawa‑injected nude mice. P4 induced mechanisms underlying EC may assist in identifying and devel- the expression of CACNA2D3 in vivo and in vitro, and the oping promising therapeutic targets and prognostic markers. silencing of CACNA2D3 affected P4‑inhibited cell prolif- The ovarian steroid hormones, estrogen and progesterone are eration and P4‑induced cell apoptosis and calcium influx. In essential regulators of uterine biology (5). The endometrium Ishikawa cells, P4 enhanced the expression of phosphorylated is particularly sensitive to steroid hormones, and long‑term (p)‑p38 MAPK and PTEN, but blocked the levels of p‑PI3K exposure to estrogens, unopposed by progesterone, may be a and p‑AKT. The knockdown of CACNA2D3 blocked the func- predisposing factor to EC (6). Progesterone is a well‑studied tion of P4. These data revealed that P4 promoted cell apoptosis steroid, in response to changes in the physiological condi- via the activation of the CACNA2D3/Ca2+/p38 MAPK tions of the ovary and gonadotropin levels (7). Progesterone pathway, and blocked cell proliferation via suppression of the has been widely used in the patients who request to maintain PI3K/AKT pathway. Collectively, these findings indicated the their fertility and exhibit well‑differentiated early‑stage EC, or patients with recurrent or advanced‑stage EC (8). However, the mechanism underlying progesterone therapy remains elusive. Voltage‑gated Ca2+ channels are protein complexes composed of a main, pore‑forming α1 subunit and auxiliary Correspondence to: Dr Meijuan Cai or Dr Qian Wang, Department α2δ and β subunits (9). α2δ subunits, encoded by one of the of Clinical Laboratory, Qilu Hospital of Shandong University, four genes CACNA2D1‑CACNA2D4, consist of a larger 107 Wenhua Xi Road, Jinan, Shandong 250012, P.R. China extracellular glycosylated α2 peptide linked to a small E‑mail: [email protected] δ E‑mail: [email protected] membrane‑anchored peptide (10). CACNA2D3, located at chromosome 3p21.1, has been reported to function in several *Contributed equally types of cancer (11). Specific single nucleotide polymorphisms of CACNA2D3 (rs589281 and rs6797113) have been associ- Key words: endometrial cancer, CACNA2D3, progesterone, cell ated with poor clinical outcomes in esophageal cancer (12). apoptosis, mitogen‑activated protein kinase pathway Previous studies revealed that CACNA2D3 acts as a putative tumor suppressor in lung cancer (13), renal cell cancer (14) and esophageal squamous cell cancer (ESCC) (15). Recently, it has 122 Kong et al: Progesterone activates the CACNA2D3/Ca2+/p38 MAPK pathway been reported that CACNA2D3 enhances the chemosensitivity Cell culture. Human endometrium epithelial cells (EEC) were of ESCC to cisplatin by inducing Ca2+‑mediated apoptosis and purchased from BeNa Culture Collection (Beijing, China) blocking the PI3K/AKT signaling pathways (16). CACNA2D3 and cultured in Eagle's minimum essential medium with CpG island is frequently methylated, and methylation‑depen- 10% FBS. Human endometrial cancer Ishikawa and RL95‑2 dent transcriptional silencing of CACNA2D3 may contribute to cells were purchased from Shanghai GeneChem Co., Ltd. a metastatic phenotype in breast cancer (17). In nasopharyngeal Cells were cultured in DMEM supplemented with 10% FBS carcinoma, CACNA2D3 may mediate an increase in intracel- at 37̊C in a humidified atmosphere with 5% CO2. For siRNA lular Ca2+ to induce apoptosis via the mitochondrial‑pathway, transfection, when confluence reached 80‑90%, cells were thus reducing proliferation and invasion of cells (18). In addi- transfected with negative control siRNA, (5'‑AGCAUGCAU tion, downregulation of CACNA2D3 is frequently detected in GAGUACCCAGCC‑3') or CACNA2D3 siRNA (5'‑CUGCGU glioma (19). However, there are a few studies examining the UUGCAGACAAUCUAA‑3') using Lipofectamine® 3000 association between CACNA2D3 and development of EC. (Invitrogen; Thermo Fisher Scientific, Inc.) according to the The aim of the present study was to examine the role of manufacturer's protocol. After 48 h, transfected cells were CACNA2D3 in EC progression and determine the asso- prepared for subsequent experiments. ciation between CACNA2D3 and progesterone. Reverse transcription‑quantitative (RT‑qPCR) and western blotting Lentiviral vector construction and packaging. The open were performed to examine the expression of CACNA2D3 in reading frame of CACNA2D3 was inserted into a GV492 EC, and its expression was revealed to be downregulated in plasmid (Ubi‑MCS‑3FLAG‑CBh‑gcGFP‑IRES‑puromycin; EC tissues and cells. In vivo, overexpression of CACNA2D3 Shanghai GeneChem Co., Ltd. 293T cells were purchased from significantly reduced tumor growth in Ishikawa and RL95‑2 BeNa Culture Collection (BNCC102182; Beijing, China) and xenograft mice models. In addition, overexpression of were incubated in 25‑cm2 flasks in 4 ml DMEM containing CACNA2D3 reduced proliferation and migration, but increased 10% FBS. 293T cells were transfected with the GV492 vector apoptosis and Ca2+ influx in Ishikawa and RL95‑2 cells. These or CACNA2D3‑GV492, and the lentivirus package plasmid results revealed that CACNA2D3 exhibited tumor suppressor mixture. After 4 days, the supernatant was collected and filtered functions in EC, and thus highlights a potential novel target for with a 0.45‑µm membrane. Lentiviral particles [(LV‑green treatment of patients with EC. In an in vivo xenograft model, fluorescent protein (GFP) and LV‑CACNA2D3‑GFP)] were the injection of progesterone (P4) into nude mice attenuated harvested for cell infection. Ishikawa‑induced tumor growth and upregulated the expres- Ishikawa or RL95‑2 cells were infected with LV‑GFP or sion of CACNA2D3. In vitro, treatment of cells with P4 LV‑CACNA2D3‑GFP lentiviral particles according to the also induced the expression of CACNA2D3. Knockdown of manufacturer's protocol (Shanghai GeneChem Co., Ltd.). CACNA2D3 significantly reversed the P4‑mediated reduction Ishikawa or RL95‑2 cells were seeded into 6‑well plates and of proliferation and apoptosis. The addition of P4 increased infected with lentiviral particles under the optimum conditions the levels of intracellular Ca2+, phosphorylated (p)‑p38 MAPK, of multiplicity of infection (MOI) of 20 or 30, respectively. phosphatase and tensin homolog (PTEN), and reduced the After infection for 2‑3 days, Puromycin was added to the levels of p‑PI3K and p‑AKT. Silencing of CACNA2D3 cells to a final concentration of 2.5 µg/ml for clone selection. significantly attenuated P4 function. Collectively, these data Medium was replaced every 3‑4 days and puromycin added revealed that progesterone induced cell apoptosis by activation each time, until >95% of the cells were GFP‑positive. Western of the CACNA2D3/Ca2+/p38 MAPK pathway, but prevented blotting was used to examine the expression of target genes. cell proliferation and tumor growth through the inhibition of Cells expressing GFP or CACNA2D3‑GFP were used for the PI3K/AKT pathway. These findings provide new evidence subsequent experiments. concerning the function of progesterone when used as a therapeutic option for patients with EC. Nude mouse xenograft cancer model. A total of 12 female athymic nude mice (BALB/c; body weight, 18‑20 g; age Materials and methods 6‑7 weeks) were purchased from Sino‑British Experiment Animals and divided into two groups: the vector and CACNA2D3 Patients and tissue samples. A total of 15 EC tissues were groups. Mice were housed under specific‑pathogen‑free isolated from patients who had undergone surgical resection or conditions in a laminar air‑flow cabinet maintained at 25̊C biopsies at Qilu Hospital of Shandong University (Shandong, with 50±10% humidity and a 12‑h dark/light cycle. Mice China) between March 2017 and December 2018. The adjacent had free access to water and food throughout the study. All healthy endometrial tissues were used as the controls. None of animal studies were performed in accordance with the proto- patients had undergone hormone therapy, intrauterine device cols approved by the Ethics Committee of Qilu Hospital of usage, chemotherapy or radiotherapy for at least 6 months Shandong University [Approval no. (KYLL‑2016(KS)‑173)]. prior to surgery. All specimens were evaluated by at least Mice in the CACNA2D3 group were subcutaneously injected two pathologists according to the World Health Organization with 1x107 LV‑CACNA2D3‑GFP‑infected cells in 100 µl PBS (WHO) guidelines. The present study was approved by the into the right flank. Mice in the vector group were adminis- Ethics Committees of Qilu Hospital of Shandong University tered with the same volume of cells infected with LV‑GFP. [Approval no. (KYLL‑2016(KS)‑173)]. Permission from all The tumor volume was calculated every 7 days according the patients was obtained prior to the surgery. After operating, to the following formula: Volume (mm3)=width2 x length/2. tissues were immediately frozen and stored in liquid nitrogen After 30 days, tumor tissues were isolated and captured with a for follow‑up experiments. digital camera (Nikon Corp.). ONCOLOGY REPORTS 43: 121-132, 2020 123

RT‑qPCR. Total RNA was extracted from cells using TRIzol® Immunohistochemistry (IHC). Tumor tissues were extracted reagent (Beyotime Institute of Biotechnology). A total of 1 µg from mice and fixed with 4% fresh cold paraformaldehyde at RNA was transcribed into cDNA using M‑MLV Reverse 4̊C overnight. The following morning, tissues were embedded Transcription Kit (BioTeke Corporation). RT‑qPCR was in paraffin wax and cut into 5 to 7‑µm thick sections. Sections performed using a Biosystem StepOne Plus PCR system were treated with 3% hydrogen peroxide in methanol for (Applied Biosystems; Thermo Fisher Scientific, Inc.) with 20 min at room temperature to block the activity of endog- SYBR Green real‑time PCR master mix (Takara Bio, Inc.) enous peroxidases. After blocking with 5% bovine serum using the following thermocycling conditions: 95̊C for 5 min; albumin (Sangon Biotech Co., Ltd.) at room temperature followed by 40 cycles at 95̊C for 20 sec and 60̊C for 20 sec. for 1 h, the sections were incubated with rabbit polyclonal The relative expression of CACNA2D3 was normalized to antibody against CACNA2D3 (ID product code ab102939; GAPDH using the 2‑∆∆Cq method (20). The sequences of the 1:300; Abcam) at 4̊C overnight. After washing with PBS, the primers were: CACNA2D3 forward, 5'‑tccgagggaatgtaacca‑3' sections were probed with goat anti‑rabbit immunoglobulin G and reverse, 5'‑gagacagatggcggtgct‑3'; and GAPDH forward, heavy and light chain horseradish peroxidase (ID product 5'‑gccaaaagggtcatcatctc‑3' and reverse, 5'‑gtagaggcagggatgat- code ab6721; 1:1,000; Abcam) at 37̊C for 1 h. Signals were gttc‑3'. The experiments were performed in triplicate with developed with diaminobenzidine‑H2O2 solution and captured independent experimental samples. with an inverted microscope (Nikon Corporation) from five non‑overlapping high‑powered fields. Positive cells were Colony formation assay. Ishikawa and RL95‑2 cells marked in brown or dark yellow. expressing GFP or CACNA2D3‑GFP were seeded into 6‑well plates at a density of 200 cells/well in a humidified incubator Apoptosis analysis. Apoptosis was evaluated using an with 5% CO2. After 10 days, cells were fixed with methanol Annexin V-fluorescein isothiocyanate (FITC)/propidium for 10 min at room temperature and subsequently stained with iodide (PI) kit (Beyotime Institute of Biotechnology). Cells 0.5% crystal violet (Beyotime Institute of Biotechnology) for in the logarithmic growth phase were seeded into 6‑well 30 min at room temperature. Visible clones were imaged using plates and randomly divided into three groups: Control, P4 a digital camera (Nikon Corporation). Experiments were inde- and P4+CACi groups. Cells in P4 or P4+CACi groups were pendently repeated three times. transfected with NC siRNA or CACNA2D3 siRNA using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, MTT assay and EdU staining. For the MTT assay, Ishikawa Inc.) according to the manufacturer's protocol. After 48 h, the and RL95‑2 cells expressing GFP or CACNA2D3‑GFP in the cells in the P4 or P4+CACi groups were treated with 1 µM logarithmic growth phase were seeded into 96‑well plates at P4. After 2 days, the cells were collected and stained with a density of 1x103 cells/well. After 48, 72 or 96 h, 10 µl MTT 50 µl Annexin V‑FITC and 10 µl PI. After incubation at room solution (5 mg/ml) and 150 µl DMSO was added to each well temperature in the dark for 15 min, 400 µl of 1X binding for 10 min at 37̊C in the dark, after which, the absorbance buffer was added, and flow cytometry was performed using was measured at 562 nm using an automatic microplate reader excitation and emission wavelengths of 488 and 546 nm on (Thermo Fisher Scientific, Inc.). The assay was repeated at a FACSort flow cytometer (BD Biosciences). Each sample least three times. was examined to determine the percentage of cancer cells For EdU staining, Ishikawa and RL95‑2 cells expressing exhibiting Annexin V/PI (+/‑) staining in (early apoptosis) or GFP or CACNA2D3‑GFP in the logarithmic growth phase Annexin V/PI (+/+) staining (late apoptosis or cell death stage). were seeded into 24‑well plates and incubated with 50 µM of EdU for 4 h at 37̊C and fixed with 4% paraformaldehyde solu- Intracellular Ca2+ measurement. Cells were washed with PBS tion for 20 min at room temperature. After washing with PBS, three times and stained with 1 µM Fluo‑3 AM (cat no. S1056; the cells were permeabilized with 0.2% Triton X‑100 in PBS Beyotime Institute of Biotechnology) for 30 min at 37̊C in at 37̊C for 30 min and washed again with PBS. Subsequently, the dark. Fluo‑3 AM can be cleaved by intracellular esterases cells were treated with 100 µl 1X Apollo reaction cocktail to form Fluo‑3 after entering the cell. Fluo‑3 emits green for 30 min, and stained with DAPI (1 µg/ml) for 30 min and fluorescence when Ca2+ binds. Flow cytometric analysis was visualized under a fluorescence microscope (Nikon Corp.). performed to measure the intracellular Ca2+ concentration using a FACSort flow cytometer. Transwell invasion assay. For the Transwell invasion assays, the upper side of an 8‑µm pore, 6.5‑mm polycarbonate Transwell Western blotting. Proteins were isolated from tissues or cells filter (Corning, Inc.) chamber was uniformly coated with with RIPA buffer (Sigma‑Aldrich; Merck KGaA). Protein Matrigel basement membrane matrix (BD Biosciences) for 2 h concentrations were determined using a BCA kit (Pierce at 37̊C prior to the cells being added. A total of 2x105 cells in Biotechnology, Inc.; Thermo Fisher Scientific, Inc.) according 200 µl DMEM without FBS were seeded into the upper well, and to the manufacturer's instructions. Equal amounts of protein 700 µl medium supplemented with 10% FBS was added to the (30 µg/lane) were subjected into 10% sodium dodecyl lower chamber. After incubation at 37̊C for 48 h, the cells which sulfate‑polyacrylamide electrophoresis and transferred onto had adhered to the lower well were fixed with 4% paraformal- polyvinylidene difluoride membranes (EMD Millipore). After dehyde, stained with 0.5% crystal violet (Beyotime Institute of being blocked with 5% non‑fat milk at room temperature for Biotechnology) for 10 min, and counted using an Olympus IX51 1 h, the membranes were incubated with rabbit antibodies inverted microscope in five randomly selected fields of view and against CACNA2D3 (ID product code ab102939; 1:500), images were captured at an x200 magnification. GAPDH (ID product code ab37168; 1:500), extracellular 124 Kong et al: Progesterone activates the CACNA2D3/Ca2+/p38 MAPK pathway signal‑regulated protein kinase 1/2 (ERK1/2; ID product code mice injected with LV‑CACNA2D3‑GFP‑infected cells were ab17942; 1:1,000), p‑ERK1/2 (ID product code ab223500, significantly increased, indicating that CACNA2D3 was 1:400), c‑Jun N‑terminal kinase (JNK; ID product code successfully expressed in vivo as shown in Fig. 2A‑f. Similar ab112501; 1:1,000), p‑JNK (ID product code ab131499; 1:1,000), results were observed following injection with the RL95‑2 p38 mitogen‑activated protein kinase (p38 MAPK; ID product cells (Fig. 2B‑a‑f). Collectively, these data indicated that over- code ab27986; 1:500), p‑p38 MAPK (ID product code ab60999; expression of CACNA2D3 inhibits tumor growth in vivo. 1:500), protein kinase B (AKT1; ID product code ab227100; 1:1,000), p‑AKT1 (ID product code ab8933; 1:500), phosphati- CACNA2D3 suppresses cell proliferation and migration, dylinositol 3‑kinase (PI3K; ab70912, 1:100), p‑PI3K (ID product and induces cell apoptosis and Ca2+ influx. A colony forma- code ab32089; 1:1,000) and PTEN (ID product code ab31392; tion assay, MTT assay, EdU staining, Transwell invasion 1:1,000) (all from Abcam) overnight at 4̊C. The following assay and flow cytometry were used to examine the effect of morning, the membranes were washed with TBST and incu- CACNA2D3 on cell proliferation, migration and apoptosis. bated with goat anti‑rabbit IgG H&L (HRP) (ID product Ishikawa and RL95‑2 cells were infected with LV‑GFP or code ab6721; 1:5,000; Abcam) at 37̊C for 1 h. The membranes LV‑CACNA2D3‑GFP. In Fig. 3A, western blotting results were visualized using an enhanced chemiluminescence system revealed that CACNA2D3 was successfully expressed in (ImageQuant LAS4000) by the normalization to GAPDH. The transfected Ishikawa and RL95‑2 cells. Overexpression of band density was determined by relative densitometry using CACNA2D3 significantly reduced the number of clones formed ImageJ Software version 1.50 (National Institutes of Health). compared with the vector group (Fig. 3B and C; P<0.01), indi- The experiments were conducted in triplicate with independent cating that CACNA2D3 prevents colony formation in Ishikawa experimental samples. and RL95‑2 cells. Optical density (OD) values at 560 nm in the CACNA2D3 group was significantly lower compared Statistical analysis. Data are presented as the mean ± stan- with the vector group (Fig. 3D and E; P<0.01). The number dard deviation of three repeats. Statistical analysis was of EdU‑positive cells in the CACNA2D3 group was also performed using IBM SPSS Statistics 25.0 (IBM Corp.) with significantly decreased (Fig. 3F). The aforementioned results a Student's t‑test. P<0.05 was considered to indicate a statisti- demonstrated that overexpression of CACNA2D3 inhibited cell cally significant difference. proliferation in Ishikawa and RL95‑2 cells. In order to examine the effects of CACNA2D3 on cell invasion, Transwell invasion Results assays were performed (Fig. 3G and H). The number of cells that adhered to the lower well in the CACNA2D3 group was signifi- CACNA2D3 expression is downregulated in EC tissues cantly lower compared with the vector group (P<0.01), indicating and cells. The mRNA and protein expression levels of that CACNA2D3 prevented invasion. The proportion of cells CACNA2D3 were measured in EC tissues compared with characterized as Annexin V/PI (+/‑) and Annexin V/PI (+/+) in the adjacent noncancer tissues using RT‑qPCR and western the CACNA2D3 group was significantly increased compared blotting. Compared with the adjacent noncancer tissues, the with the Vector group (Fig. 4A and B), indicating that overex- mRNA expression levels of CACNA2D3 in EC tissues was pression of CACNA2D3 induced cell apoptosis. Overexpression significantly decreased (Fig. 1A; P<0.01). A similar trend was of CACNA2D3 resulted in an increase in intracellular Ca2+ observed in the protein expression levels in four pairs of EC levels as detected by Fluo‑3 AM staining. Collectively, these cases (Fig. 1B). As revealed in Fig. 1C and D, the mRNA and results indicated that CACNA2D3 inhibited cell proliferation protein expression levels in the human EC cell lines, Ishikawa and migration, and induced apoptosis and Ca2+ influx. and RL95‑2, were significantly decreased compared with the In order to determine the mechanism by which EEC cells (P<0.01). These data revealed that CACNA2D3 CACNA2D3 affected cell proliferation and cell apoptosis, the expression was downregulated in EC tissues and cells. activation of ERK, JNK, MAPK and AKT pathways following overexpression of CACNA2D3 was examined (Fig. 4D‑K). Overexpression of CACNA2D3 inhibits tumor growth in vivo. Compared with the Vector group, overexpression of To examine the effect of CACNA2D3 on tumor growth, CACNA2D3 significantly increased the protein expression LV‑GFP (vector group) and LV‑CACNA2D3‑GFP‑infected levels of CACNA2D3 (Fig. 4E), p‑p38 MAPK (Fig. 4H) and (CACNA2D3 group) cells were subcutaneously injected PTEN (Fig. 4I), and reduced the levels of p‑PI3K (Fig. 4J) into the flanks of 5‑week‑old male nude mice. As revealed and p‑AKT (Fig. 4K). These data revealed that CACNA2D3 in Fig. 2A‑a, green fluorescent signals were observed in the exerted tumor suppressor activity in EC by regulating MAPK vector and CACNA2D3 groups, indicating that Ishikawa and the PI3K/AKT pathways. cells were successfully infected with virus particles. The mRNA and protein expression levels of CACNA2D3 were P4 suppresses tumor growth and cell proliferation via significantly upregulated in the CACNA2D3 group displayed CACNA2D3 and increasing intracellular Ca2+ levels. To eval- in Fig. 2A‑b and c (P<0.01), indicating that CACNA2D3 was uate the anticancer effects of P4 in an in vivo xenograft model, successfully expressed in the CACNA2D3 group. In Fig. 2A‑d nude mice were injected with Ishikawa cells and treated with P4. and e, the tumor volume was calculated every 7 days and tumor Compared with the mice injected with Ishikawa cells alone, the tissues were extracted after 30 days. The results revealed that addition of P4 significantly reduced tumor size (Fig. 5A and B). the tumor size in the CACNA2D3 group was significantly IHC and western blot analysis revealed that CACNA2D3 was smaller compared with the vector group (P<0.01). Compared overexpressed following treatment with P4 (Fig. 5C and D), with the vector group, the protein levels of CACNA2D3 in suggesting that the P4‑mediated reduction in tumor volume ONCOLOGY REPORTS 43: 121-132, 2020 125

Figure 1. CACNA2D3 expression is downregulated in EC tissues and cells. (A and B) mRNA and protein expression levels of CACNA2D3 in EC and non‑tumor tissues. (C and D) mRNA and protein expression levels of CACNA2D3 in EEC, Ishikawa and RL95‑2 cells. EC, endometrial cancer; EEC, endometrial epithelial cell. **P<0.01.

may be associated with upregulation of CACNA2D3. In order P4 activates the p38 MAPK pathway and suppresses the to verify this hypothesis, the effect of P4 on the expression of PI3K/AKT pathway via CACNA2D3. To further investigate CACNA2D3 in Ishikawa cells was determined. As revealed the mechanism by which P4 induced cell apoptosis and in Fig. 5E, P4 application significantly upregulated the protein blocked cell proliferation in Ishikawa cells, the activation expression levels of CACNA2D3 (P<0.01). In addition, of the ERK, JNK, MAPK and AKT pathways was investi- compared with the control group, P4 application reduced the gated following the application of P4. Compared with the OD value at 560 nm (Fig. 5F). However, the knockdown of control group, the addition of P4 significantly increased CACNA2D3 mitigated P4‑mediated reduction in cell prolif- the protein expression levels of CACNA2D3 (Fig. 6B), eration. As revealed in Fig. 5G and H, the apoptotic rate in the p‑p38 MAPK (Fig. 6E) and PTEN (Fig. 6F), but reduced the P4 group was significantly higher compared with the control levels of p‑PI3K (Fig. 6G) and p‑AKT (Fig. 6H). Silencing of group (P<0.01), however, silencing of CACNA2D3 decreased CACNA2D3 significantly reversed the increase in expression the increase in apoptotic rate induced by P4 (P<0.01). The of CACNA2D3, p‑p38 MAPK and PTEN induced by P4, and intracellular Ca2+ levels in the P4 group were significantly resulted in an increase in the levels of p‑PI3K and p‑AKT. increased compared with the control group (Fig. 5I; P<0.01), In addition, neither P4 nor silencing of CACNA2D3 had any whereas knockdown of CACNA2D3 resulted in a decrease in notable effect on the expression of p‑ERK1/2 (Fig. 6C) and intracellular Ca2+ levels. These data revealed that P4 prevents p‑JNK (Fig. 6D). Collectively, P4 activated the p38 MAPK tumor growth via CACNA2D3 and an increase in intracellular and suppressed the PI3K/AKT pathways through the activa- Ca2+ levels. tion of CACNA2D3 (Fig. 6I). 126 Kong et al: Progesterone activates the CACNA2D3/Ca2+/p38 MAPK pathway

Figure 2. Overexpression of CACNA2D3 decreases tumor growth in vivo. Ishikawa and RL95‑2 cells were infected with LV‑GFP or LV‑CACNA2D3‑GFP cells. Cells expressing GFP or CACNA2D3‑GFP were selected for follow‑up experiments. Green fluorescence signals demonstrated successful expression of the target proteins in (A‑a) Ishikawa and (B‑a) RL95‑2 cells. Scale bar, 100 µm. (A‑b and c and B‑b and C) mRNA and protein expression levels of CACNA2D3 were detected. (A‑d and e and B‑d and e) Overexpression of CACNA2D3 reduced tumor growth in mice injected with Ishikawa or RL95‑2 cells expressing GFP or CACNA2D3‑GFP. (A‑f and B‑f) Injection of Ishikawa and RL95‑2 cells expressing GFP or CACNA2D3‑GFP increased the expression levels of CACNA2D3. **P<0.01. GFP, green fluorescent protein.

Discussion It has been reported that CACNA2D3 functions as a tumor suppressor in a number of different types of cancer, such as lung CACNA2D3 is a member of the Ca2+ channel regulatory α2δ cancer (13), breast cancer (17) and renal cell cancer (14). However, subunit family and is localized at chromosome 3p21.1 (14). the function of CACNA2D3 in EC remains unknown. In the ONCOLOGY REPORTS 43: 121-132, 2020 127

Figure 3. CACNA2D3 decreases cell proliferation and migration. (A) CACNA2D3 expression was increased in Ishikawa and RL95‑2 cells infected with CACNA 2D3‑ GF P. **P<0.01. (B and C) Overexpression of CACNA2D3 decreased the number of clones formed by Ishikawa and RL95‑2 cells. Overexpression of CACNA2D3 decreased cell proliferation as detected by (D and E) MTT assay and (F) EdU staining. (G and H) Overexpression of CACNA2D3 decreased invasion. **P<0.01. GFP, green fluorescent protein.

present study, RT‑qPCR and western blot analysis revealed that also function as a putative tumor suppressor in EC. In an in vivo the mRNA and protein expression levels of CACNA2D3 were xenograft model, the overexpression of CACNA2D3 via lentiviral reduced in EC tissues and cells, indicating that CACNA2D3 may infection significantly suppressed tumor growth. Overexpression 128 Kong et al: Progesterone activates the CACNA2D3/Ca2+/p38 MAPK pathway

Figure 4. CACNA2D3 increases apoptosis, intracellular Ca2+ levels and activates the p38 MAPK pathway. (A and B) CACNA2D3 overexpression increased apoptosis as detected by flow cytometry. (C) Overexpression of CACNA2D3 resulted in an increase in intracellular Ca2+ levels. (D‑K) CACNA2D3 regulated the protein expression levels of ERK, JNK, MAPK and AKT. **P<0.01. ONCOLOGY REPORTS 43: 121-132, 2020 129

Figure 5. P4 suppresses tumor growth and cell proliferation by upregulating CACNA2D3 expression and increasing intracellular Ca2+. (A and B) Addition of P4 decreased the tumor volume in mice injected with Ishikawa cells. (C and D) CACNA2D3 expression was increased when treated with P4. (E) Treatment with P4 increased the protein expression levels of CACNA2D3 in Ishikawa cells. (F) P4 reduced proliferation of cells. (G) Flow cytometry was performed to examine cell apoptosis. (H) Apoptotic percentage of cells treated with or without P4. (I) P4 increased the intracellular Ca2+ levels. Cells were incubated with Fluo‑3 AM. Flow cytometric analysis was performed to assess the intracellular Ca2+ concentration. **P<0.01. P4, progesterone. 130 Kong et al: Progesterone activates the CACNA2D3/Ca2+/p38 MAPK pathway

Figure 6. P4 regulates the expression of p‑p38 MAPK, PTEN, p‑PI3K and p‑AKT via CACNA2D3. (A) The effects of P4 and the silencing of CACNA2D3 on ERK, JNK, MAPK and AKT pathways were analyzed by western blotting. (B‑H) The relative expression levels of target proteins are displayed. (I) Schematic diagram demonstrating how P4 induced apoptosis and reduced proliferation in Ishikawa cells. The application of P4 increases the intracellular Ca2+ levels through the upregulation of CACNA2D3, and an increase in Ca2+ increases phosphorylation of p38 MAPK, thus resulting in apoptosis. Therefore, P4 induced cell apoptosis via a CACNA2D3/Ca2+/p38 MAPK pathway. Additionally, P4 increased the expression of PTEN, which in turn reduced p‑PI3K and p‑AKT1 levels via CACNA2D3 and thus decreased proliferation. Thus, P4 blocks proliferation through the suppression of the PI3K/AKT pathway. P4, progesterone. of CACNA2D3 in vitro significantly inhibited cell proliferation EC is a hormone‑regulated cancer, estrogen drives its and migration, and induced cell apoptosis and Ca2+ influx. These growth, and progesterone suppresses its proliferation and data indicated that CACNA2D3 acts as a tumor suppressor in leads to differentiation (21). Insufficient progesterone to EC. The data in the present study demonstrated the function of oppose estrogen‑driven proliferation is one of the primary CACNA2D3 in EC and improved our understanding of the role causes of the development and formation of EC (22). of CACNA2D3 in different types of cancer. These findings high- Therefore, progesterone has been widely used for EC light a novel potential target for treating patients with EC. therapy, especially for younger patients with EC with a ONCOLOGY REPORTS 43: 121-132, 2020 131 desire to remain fertile (23). Progesterone reduces prolifera- proliferation via disruption of the PI3K/AKT pathway through tion and invasion of EC cells by binding to the progesterone CACNA2D3. These findings revealed that progesterone may receptor (24). In the present study, the addition of P4 to function in EC therapy by activating CACNA2D3. However, Ishikawa‑injected nude mice significantly suppressed the there are some limitations in the present study. First, the growth of xenografts in vivo. In addition, P4 reduced cell number of EC patients in the study was relatively small and proliferation and induced cell apoptosis as determined may thus be insufficient. A larger set of patients from multiple using MTT and flow cytometric assays in Ishikawa cells. centers are required to confirm these results. Second, although These results provide new evidence that progesterone P4 upregulated the expression of CACNA2D3 in vivo and prevents the development of EC. However, the mechanism in vitro, the underlying mechanism by which P4 upregulated by which P4 reduced cell proliferation and promoted apop- CACNA2D3 expression requires further study. A previous tosis remains unknown. In vivo and in vitro, the addition of study revealed that P4 function may be mediated through a P4 upregulated the expression of CACNA2D3 and silencing traditional genomic pathway and non‑genomic signaling (34). of CACNA2D3 impaired the function of P4 on cell apop- Whether P4 activates the expression of CACNA2D3 through tosis and proliferation. Previous research has reported that the genomic or non‑genomic pathway remains unknown. CACNA2D3 inhibits cell proliferation and promotes cell apoptosis in glioma (19), nasopharyngeal carcinoma (18) Acknowledgements and esophageal squamous cell carcinoma (16). Therefore, in the present study it was hypothesized that P4 regulation of Not applicable. cell apoptosis and cell proliferation involved CACNA2D3. The MAPK pathways have been demonstrated to serve Funding an important role in the regulation of many cell biological behaviors, such as cell proliferation and cell apoptosis (25). The present research was supported by the National Natural An increase in cytoplasmic Ca2+ levels activates the MAPK Science Fund (no. 81602271), the Qingdao Applied Basic cascade (26,27). Three distinct groups of MAPKs, including Research Source Innovation Plan (no. 17‑1‑1‑43‑jch) and ERK1/2, JNK, and p38 MAPK, are important for cancer cell the Qingdao Outstanding Health Professional Development apoptosis (28). To examine the signaling pathways behind Fund. the effects of CACNA2D3 and P4 on Ishikawa cell apoptosis, the activity of ERK, JNK and p38 MAPK pathways Availability of data and materials was measured following CACNA2D3 overexpression or P4 treatment. The results indicated that the overexpression of The datasets used and/or analyzed during the current study CACNA2D3 induced an increase in intracellular Ca2+ and are available from the corresponding author on reasonable increased the levels of p‑p38 MAPK. These data indicated request. that the p38 MAPK pathway is activated by overexpression of CACNA2D3 and P4 induction. However, silencing of Authors' contributions CACNA2D3 significantly resulted in reduced p‑p38 MAPK levels induced by P4. These findings revealed that P4 induced XK and ML performed the experiments. KS and YY incubated the phosphorylation of p38 MAPK, via CACNA2D3/Ca2+ the cells and constructed the mouse models. QW analyzed the and highlights a novel mechanism by which P4 induced cell data and corrected the manuscript. MC designed the experi- apoptosis in EC. ments and wrote the original manuscript. All authors read and The activation of the PI3K/AKT pathway serves a crucial approved the final manuscript and agree to be accountable for role in control of cell growth and proliferation in endometrial all aspects of the research in ensuring that accuracy or integ- cancer (29). PTEN is one of the most frequently observed rity of any parts of the work are appropriately investigated and tumor suppressor genes in different types of cancer (30). The resolved. PI3K/AKT pathway has been revealed to be negatively regulated by PTEN (31). A previous study reported that increased Ethics approval and consent to participate PTEN expression levels facilitated the reduction in PI3K and AKT activity (32). In the present study, CACNA2D3 overex- All patients signed an informed consent form, and the present pression increased the expression of P4, but reduced the levels study was approved by the Ethics Committees of Qilu Hospital of p‑PI3K and p‑AKT, indicating that CACNA2D3 regulates of Shandong University [Approval no. (KYLL‑2016(KS)‑173)]. the PI3K/AKT pathway. Similarly, it was demonstrated that All animal studies were performed in accordance with the P4 enhanced the expression of PTEN, in agreement with a protocols approved by the Ethics Committee of Qilu Hospital previous study (33). In addition, P4 significantly reduced the of Shandong University [Approval no. (KYLL‑2016(KS)‑173)] levels of p‑PI3K and p‑AKT, and this reduction was mitigated by silencing of CACNA2D3. Therefore, P4 disrupted the acti- Patient consent for publication vation of PI3K/AKT via CACNA2D3. In summary, CACNA2D3 exerted a tumor suppressor Not applicable. function in EC, thus highlighting a potential novel target for the treatment of EC. In addition, it was demonstrated Competing interests that P4 promoted cell apoptosis via the activation of the CACNA2D3/Ca2+/p38 MAPK pathway, and P4 blocked cell The authors declare that they have no competing of interests. 132 Kong et al: Progesterone activates the CACNA2D3/Ca2+/p38 MAPK pathway

References 18. Wong AM, Kong KL, Chen L, Liu M, Zhu C, Tsang JW and Guan XY: Characterization of CACNA2D3 as a putative tumor suppressor gene in the development and progression of nasopha- 1. Amant F, Moerman P, Neven P, Timmerman D, Van Limbergen E ryngeal carcinoma. Int J Cancer 133: 2284‑2295, 2013. and Vergote I: Endometrial cancer. Lancet 366: 491‑505, 2005. 19. Jin Y, Cui D, Ren J, Wang K, Zeng T and Gao L: CACNA2D3 is 2. Su Y, Wang J, Ma Z, Gong W and Yu L: miR‑142 suppresses downregulated in gliomas and functions as a tumor suppressor. endometrial cancer proliferation in vitro and in vivo by targeting Mol Carcinog 56: 945‑959, 2017. cyclin D1. DNA Cell Biol 38: 144‑150, 2019. 20. Livak KJ and Schmittgen TD: Analysis of relative gene expres- 3. Teng F, Tian WY, Wang YM, Zhang YF, Guo F, Zhao J, Gao C sion data using real‑time quantitative PCR and the 2(‑Delta Delta and Xue FX: Cancer‑associated fibroblasts promote the progres- C(T)) method. Methods 25: 402‑408, 2001. sion of endometrial cancer via the SDF‑1/CXCR4 axis. J Hematol 21. Davies C, Pan H, Godwin J, Gray R, Arriagada R, Raina V, Oncol 9: 8, 2016. Abraham M, Medeiros Alencar VH, Badran A, Bonfill X, et al: 4. Liu B, Che Q, Qiu H, Bao W, Chen X, Lu W, Li B and Wan X: Long‑term effects of continuing adjuvant tamoxifen to 10 Elevated MiR‑222‑3p promotes proliferation and invasion of endo- years versus stopping at 5 years after diagnosis of oestrogen metrial carcinoma via targeting ERα. PLoS One 9: e87563, 2014. receptor‑positive breast cancer: ATLAS, a randomised trial. 5. Jiang Y, Chen L, Taylor RN, Li C and Zhou X: Physiological and Lancet 381: 805‑816, 2013. pathological implications of retinoid action in the endometrium. 22. Pfeiffer RM, Park Y, Kreimer AR, Lacey JV Jr, Pee D, J Endocrinol 236: R169‑R188, 2018. Greenlee RT, Buys SS, Hollenbeck A, Rosner B, Gail MH and 6. Chi S, Liu Y, Zhou X, Feng D, Xiao X, Li W, Zhao Y and Hartge P: Risk prediction for breast, endometrial, and ovarian Wang H: Knockdown of long non‑coding HOTAIR enhances the cancer in white women aged 50 y or older: Derivation and sensitivity to progesterone in endometrial cancer by epigenetic validation from population‑based cohort studies. PLoS Med 10: regulation of progesterone receptor isoform B. Cancer Chemother e1001492, 2013. Pharmacol 83: 277‑287, 2019. 23. Cheng M, Michalski S and Kommagani R: Role for growth regula- 7. Adams NR and DeMayo FJ: The role of steroid hormone recep- tion by estrogen in breast cancer 1 (GREB1) in hormone‑dependent tors in the establishment of pregnancy in rodents. Adv Anat cancers. Int J Mol Sci 19: E2543, 2018 Embryol Cell Biol 216: 27‑49, 2015. 24. Yuan DZ, Lei Y, Zhao D, Pan JL, Zhao YB, Nie L, Liu M, Long Y, 8. Park JY, Kim DY, Kim TJ, Kim JW, Kim JH, Kim YM, Kim YT, Zhang JH and Yue LM: Progesterone‑induced miR‑145/miR‑143 Bae DS and Nam JH: Hormonal therapy for women with stage IA inhibits the proliferation of endometrial epithelial cells. Reprod endometrial cancer of all grades. Obstet Gynecol 122: 7‑14, 2013. Sci 26: 233‑243, 2019. 9. Pirone A, Kurt S, Zuccotti A, Ruttiger L, Pilz P, Brown DH, et al 25. Wuertz K, Vo N, Kletsas D and Boos N: Inflammatory and cata- Franz C, Schweizer M, Rust MB, Rubsamen R, : alpha2delta3 bolic signalling in intervertebral discs: The roles of NF‑κB and is essential for normal structure and function of auditory nerve MAP kinases. Eur Cell Mater 23: 103‑120, 2012. synapses and is a novel candidate for auditory processing disor- 26. Cook SJ and Lockyer PJ: Recent advances in Ca(2+)‑dependent ders. J Neurosci 34: 434‑445, 2014. Ras regulation and cell proliferation. Cell Calcium 39: 101‑112, 10. Qin N, Yagel S, Momplaisir ML, Codd EE and D'Andrea MR: 2006. Molecular cloning and characterization of the human voltage‑gated 27. Song Z, Wang Y, Zhang F, Yao F and Sun C: Calcium Signaling calcium channel alpha(2)delta‑4 subunit. Mol Pharmacol 62: Pathways: Key Pathways in the Regulation of Obesity. Int J Mol 485‑496, 2002. Sci 20: pii: E2768, 2019. 11. Davies A, Hendrich J, Van Minh AT, Wratten J, Douglas L and 28. Wei Y, Jin Z, Zhang H, Piao S, Lu J and Bai L: The transient Dolphin AC: Functional biology of the alpha(2)delta subunits receptor potential channel, vanilloid 5, induces chondrocyte of voltage‑gated calcium channels. Trends Pharmacol Sci 28: apoptosis via Ca2+ CaMKII‑Dependent MAPK and Akt/ mTOR 220‑228, 2007. pathways in a rat osteoarthritis model. Cell Physiol Biochem 51: 12. Qin YR, Fu L, Sham PC, Kwong DL, Zhu CL, Chu KK, Li Y and 2309‑2323, 2018. Guan XY: Single‑nucleotide polymorphism‑mass array reveals 29. Malloy KM, Wang J, Clark LH, Fang Z, Sun W, Yin Y, Kong W, commonly deleted regions at 3p22 and 3p14.2 associate with Zhou C and Bae‑Jump VL: Novasoy and genistein inhibit poor clinical outcome in esophageal squamous cell carcinoma. endometrial cancer cell proliferation through disruption of Int J Cancer 123: 826‑830, 2008. the AKT/mTOR and MAPK signaling pathways. Am J Transl 13. Tai AL, Mak W, Ng PK, Chua DT, Ng MY, Fu L, Chu KK, Fang Y, et al Res 10: 784‑795, 2018. Qiang Song Y, Chen M, : High‑throughput loss‑of‑heterozygosity 30. Choi J, Jo M, Lee E, Hwang S and Choi D: Aberrant PTEN study of chromosome 3p in lung cancer using single‑nucleotide expression in response to progesterone reduces endometriotic polymorphism markers. Cancer Res 66: 4133‑4138, 2006. stromal cell apoptosis. Reproduction 153: 11‑21, 2017. 14. Hanke S, Bugert P, Chudek J and Kovacs G: Cloning a calcium 31. Zhuo Z and Yu H: miR‑205 inhibits cell growth by targeting channel alpha2delta‑3 subunit gene from a putative tumor AKT‑mTOR signaling in progesterone‑resistant endometrial suppressor gene region at chromosome 3p21.1 in conventional renal cancer Ishikawa cells. Oncotarget 8: 28042‑28051, 2017. cell carcinoma. Gene 264: 69‑75, 2001. 32. Gao X, Qin T, Mao J, Zhang J, Fan S, Lu Y, Sun Z, Zhang Q, 15. De Preter K, Vandesompele J, Heimann P, Yigit N, Beckman S, et al Song B and Li L: PTENP1/miR‑20a/PTEN axis contributes to Schramm A, Eggert A, Stallings RL, Benoit Y, Renard M, : breast cancer progression by regulating PTEN via PI3K/AKT Human fetal neuroblast and neuroblastoma transcriptome anal- pathway. J Exp Clin Cancer Res 38: 256, 2019. ysis confirms neuroblast origin and highlights neuroblastoma 33. Guzeloglu‑Kayisli O, Kayisli UA, Al‑Rejjal R, Zheng W, candidate genes. Genome Biol 7: R84, 2006. Luleci G and Arici A: Regulation of PTEN (phosphatase and 16. Nie C, Qin X, Li X, Tian B, Zhao Y, Jin Y, Li Y, Wang Q, Zeng D, tensin homolog deleted on chromosome 10) expression by estra- Hong A and Chen X: CACNA2D3 enhances the chemosensitivity diol and progesterone in human endometrium. J Clin Endocrinol of esophageal squamous cell carcinoma to cisplatin via inducing 2 Metab 88: 5017‑5026, 2003. ca +‑mediated apoptosis and suppressing PI3K/Akt pathways. 34. Garg D, Ng SSM, Baig KM, Driggers P and Segars J: Front Oncol 9: 185, 2019. Progesterone‑mediated non‑classical signaling. Trends Endocrinol 17. Palmieri C, Rudraraju B, Monteverde M, Lattanzio L, Gojis O, Metab 28: 656‑668, 2017. Brizio R, Garrone O, Merlano M, Syed N, Lo Nigro C and Crook T: Methylation of the calcium channel regulatory subunit alpha2delta‑3 (CACNA2D3) predicts site‑specific relapse in This work is licensed under a Creative Commons oestrogen receptor‑positive primary breast carcinomas. Br J Attribution-NonCommercial-NoDerivatives 4.0 Cancer 107: 375‑381, 2012. International (CC BY-NC-ND 4.0) License.