bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
1 Identification of NAD-dependent xylitol dehydrogenase from Gluconobacter
2 oxydans WSH-003
3
4 Li Liu1,2,4, Weizhu Zeng1, Guocheng Du1,3, Jian Chen1,2,4, Jingwen Zhou1,2,4*
5
6 1 School of Biotechnology and Key Laboratory of Industrial Biotechnology, Ministry
7 of Education, Jiangnan University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China.
8 2 National Engineering Laboratory for Cereal Fermentation Technology, Jiangnan
9 University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China.
10 3 The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of
11 Education, Jiangnan University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China.
12 4 Jiangsu Provisional Research Center for Bioactive Product Processing Technology,
13 Jiangnan University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China.
14
15 * Corresponding author: Jingwen Zhou
16 Mailing address: School of Biotechnology, Jiangnan University, 1800 Lihu Road, Wuxi,
17 Jiangsu 214122, China
18 Phone: +86-510-85914317, Fax: +86-510-85914317
19 E-mail: [email protected].
20
21 bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
22 Abstract
23 Gluconobacter oxydans plays important role in conversion of D-sorbitol to L-sorbose,
24 which is an essential intermediate for industrial-scale production of vitamin C. In the
25 fermentation process, some D-sorbitol could be converted to D-fructose and other
26 byproducts by uncertain dehydrogenases. Genome sequencing has revealed the
27 presence of diverse genes encoding dehydrogenases in G. oxydans. However, the
28 characteristics of most of these dehydrogenases remain unclear. Therefore, analyses of
29 these unknown dehydrogenases could be useful for identifying those related to the
30 production of D-fructose and other byproducts. Accordingly, dehydrogenases in G.
31 oxydans WSH-003, an industrial strain used for vitamin C production, were examined.
32 An NAD-dependent dehydrogenase, which was annotated as xylitol dehydrogenase 2,
33 was identified, codon-optimized, and expressed in Escherichia coli BL21 (DE3) cells.
+ 34 The enzyme exhibited high preference for NAD as the cofactor, while no activity
35 with NADP+, FAD, or PQQ was noted. Although this enzyme presented high
36 similarity with NAD-dependent xylitol dehydrogenase, it showed high activity to
37 catalyze D-sorbitol to D-fructose. Unlike the optimum temperature and pH for most of
38 the known NAD-dependent xylitol dehydrogenases (30°C–40°C and about 6–8,
39 respectively), those for the identified enzyme were 57°C and 12, respectively. The Km
40 and Vmax of the identified dehydrogenase towards L-sorbitol were 4.92 μM and 196.08
41 μM/min, respectively. Thus, xylitol dehydrogenase 2 can be useful for cofactor
42 NADH regeneration under alkaline conditions or its knockout can improve the
43 conversion ratio of D-sorbitol to L-sorbose.
44
45 Keywords: D-Fructose; D-sorbitol; cofactor regeneration; metabolic pathway.
46 bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
47 Importance
48 Production of L-sorbose from D-sorbitol by Gluconobacter oxydans is the first step
49 for industrial scale production of L-ascorbic acid. G. oxydans contains a lot of
50 different dehydrogenases, among which only several are responsible for the
51 conversion of D-sorbitol to L-sorbose, while others may responsible for the
52 accumulation of byproducts, thus decreased the yield of L-sorbose on D-sorbitol.
53 Therefore, a new xylitol dehydrogenase has been identified from 44 dehydrogenases
54 of G. oxydans. Optimum temperature and pH of the xylitol dehydrogenase are
55 different to most of the known ones. Knock-out of the dehydrogenase may improve
56 the conversion ratio of D-sorbitol to L-sorbose. Besides, the enzyme exhibits high
57 preference for NAD+ and have potential to be used for cofactor regeneration.
58
59
60 bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
61 Introduction
62 The genus Gluconobacter is a part of the group of acetic acid bacteria, which are
63 characterized by their ability to incompletely oxidize a wide range of carbohydrates
64 and alcohols (1). Gluconobacter strains have been successfully used for the industrial
65 production of food-related products, pharmaceuticals, and cosmetics, such as vitamin
66 C (2), miglitol (3), dihydroxyacetone (DHA) (4), and ketogluconates (5). In particular,
67 Gluconobacter oxydans has applications in the production of food additives and
68 sweeteners owing to its ability to synthesize flavoring ingredients from aromatic
69 alcohols, aliphatic alcohols, and 5-ketofructose (6, 7). Besides, G. oxydans enzymes,
70 cell membranes, and whole cells are also used as sensor systems for the detection of
71 polyols, sugars, and alcohols (8-10). In recently years, some G. oxydans strains have
72 been employed for the production of enantiomeric pharmaceuticals and platform
73 compounds; for example, G. oxydans DSM2343 has been employed for the reduction
74 of various ketones used in pharmaceutical, agrochemical, and natural products (11),
75 Gluconobacter sp. JX-05 has been utilized for D-xylulose and xylitol production (12),
76 and G. oxydans DSM 2003 has been used for 3-hydroxypropionic acid production (13).
77 As all of these products are related to the dehydrogenases of G. oxydans, identification
78 of these enzymes in G. oxydans can expand the application of this bacterium.
79 Gluconobacter strains possess numerous dehydrogenases, some of which have
80 been identified, such as alcohol dehydrogenase that could convert ethanol to
81 acetaldehyde (14, 15), NADP-dependent acetaldehyde dehydrogenase that could
82 convert acetaldehyde to acetate (16), PQQ-dependent glucose dehydrogenase that
83 could convert D-glucose to D-gluconate (14), gluconate dehydrogenase that could
84 convert D-gluconate to 2- or 5-ketogluconate (17), 2-ketogluconate dehydrogenase
85 that could convert 2-ketogluconate to 2,5-diketogluconate (14), D-sorbitol bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
86 dehydrogenase that could convert D-sorbitol to L-sorbose or fructose (14, 18-21),
87 sorbose/sorbosone dehydrogenase that could convert L-sorbose to L-sorbosone or
88 2-KLG (22, 23), mannitol dehydrogenase that could convert mannitol to fructose (24,
89 25), quinate dehydrogenase that could convert quinic acid to shikimic acid (26-28),
90 glycerol dehydrogenase that could convert glycerol to DHA (28), etc. In 2005, the
91 complete genome of G. oxydans 621H was sequenced (29), which revealed 75 open
92 reading frames (ORFs) that encode putative dehydrogenases/oxidoreductases of
93 unknown functions. Identification of the functions of these unknown
94 dehydrogenases/oxidoreductases is important to expand the application of G. oxydans.
95 For instance, carbonyl reductase (GoKR) from G. oxydans DSM2343 has been
96 employed for the reduction of various ketones (11), and membrane-bound alcohol
97 dehydrogenase (mADH) and membrane-bound aldehyde dehydrogenase from G.
98 oxydans DSM 2003 have been employed for 3-hydroxypropionic acid production
99 (13).
100 In G. oxydans, the central metabolic pathway, such as citrate cycle and
101 Embden-Meyerhof-Parnas pathway (EMP), is incomplete because of the absence of
102 some genes encoding succinate dehydrogenase, phosphofructokinase,
103 phosphotransacetylase, acetate kinase, succinyl-CoA synthetase, succinate
104 dehydrogenase, isocitratelyase, and malate synthase (30, 31), which may be the reason
105 for the low biomass of G. oxydans when cultured in rich medium. In a previous study,
106 sdhCDABE genes encoding succinate dehydrogenase and flavinylation factor SdhE,
107 ndh gene encoding a type II NADH dehydrogenase, and sucCD from
108 Gluconacetobacter diazotrophicus encoding succinyl-CoA synthetase were expressed
109 in G. oxyda ns to increase its biomass yield (31). However, G. oxydans biomass only
110 increased by 60%, suggesting the presence of some unknown bottleneck. Except for bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
111 the TCA cycle, all the genes were identified to encode enzymes involved in oxidative
112 pentose phosphate and Entner-Doudoroff (ED) pathways (29). The pentose phosphate
113 pathway is believed to be the most important route for phosphorylative breakdown of
114 sugars and polyols to CO2 and provide carbon skeleton. It has been speculated that G.
115 oxydans has the capability to uptake and channelize several polyols, sugars, and sugar
116 derivatives into the oxidative pentose phosphate pathway; however, the gene involved
117 in this process is still unknown. Hence, in the fermentation of sorbitol to sorbose for
118 vitamin C production, some sorbitol must get converted to fructose or other byproduct
119 to enter the pentose phosphate pathway for cell growth. Therefore, it is crucial to
120 balance and control the conversion of sorbitol to fructose for cell growth and sorbose
121 production.
122 Gene disruption and complementation experiments are often used to verify one
123 gene function. Some G. oxydans genes have been identify by using this method, such
124 as PQQ-dependent D-sorbitol dehydrogenase responsible for the oxidation of
125 1-(2-hydroxyethyl) amino-1-deoxy-D-sorbitol to 6-(2-hydroxyethyl)
126 amino-6-deoxy-L-sorbose, which is the precursor of an antidiabetic drug miglitol (3),
127 pyruvate decarboxylase that catalyzes the conversion of pyruvate to acetaldehyde by
128 decarboxylation (32), mADH, membrane-bound inositol dehydrogenase,
129 membrane-bound PQQ-dependent glucose dehydrogenase, etc. (33, 34). However,
130 some G. oxydans genes encoding dehydrogenases are necessary for cell growth, and
131 their knockout resulted in absence of growth (unpublished data). Besides, G. oxydans
132 comprises numerous dehydrogenases, some of which are isoenzymes, such as SldAB1
133 and SldAB2 of G. oxydans WSH-003 (35), or are often associated with a broad range
134 of substrates such as GoKR (11). Hence, the use of gene knockout strategy to identify
135 the functions of some dehydrogenases of G. oxydans, especially the numerous bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
136 unknown dehydrogenases of G. oxydans WSH-003, may not be appropriate. Therefore,
137 in the present study, we expressed numerous unknown dehydrogenases of G. oxydans
138 WSH-003 in Escherichia coli BL21 (DE3) cells and purified the products by one-step
139 affinity chromatography with Ni-NTA agarose column to identify their functions. The
140 results revealed a new xylitol dehydrogenase (NAD-dependent xylitol dehydrogenase
141 2) that could convert sorbitol to fructose. Kinetics analysis of the novel enzyme
142 revealed some unique traits that were quite different from the known xylitol
143 dehydrogenases. The optimum temperature and pH of the identified xylitol
144 dehydrogenase 2 was 57°C and 12, respectively. This novel enzyme provides new
145 insights into G. oxydans dehydrogenases and could have potential applications in
146 xylitol production.
147
148 Results
149 Gene expression and purification of the identified dehydrogenase
150 The selected dehydrogenase from G. oxydans WSH-003 was successfully
151 expressed and purified. Sequence analysis revealed that the purified enzyme,
152 annotated as xylitol dehydrogenase 2, contained a NAD(P)-binding motif and a
153 classical active site motif belonging to the short-chain dehydrogenase family.
154 SDS-PAGE analysis showed an expected single band with a molecular weight of
155 about 38 kDa (Fig. 1A), which was consistent with the calculated molecular mass
156 based on the deduced amino acid sequence (36.6 kDa). The optimum pH and
157 temperature for the purified xylitol dehydrogenase 2 were determined to be pH 12 (50
158 mM glycine-NaOH buffer) and 57°C, respectively (Fig. 1B, C), which are different
159 from those for known xylitol dehydrogenases.
160 bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
161 Identification of cofactor of xylitol dehydrogenase 2
162 In general, dehydrogenases require some cofactors as electron acceptor, such as
163 NAD(P), FAD/FMN, or PQQ. Most of the previously identified membrane
164 dehydrogenases from G. oxydans have been reported to utilize PQQ or FAD as the
165 cofactor. According to the prediction of transmembrane domains, xylitol
166 dehydrogenase 2 from G. oxydans WSH-003 was noted to lack transmembrane
167 domain. Therefore, the cofactor of the identified dehydrogenase was verified by using
168 the purified enzyme to catalyze reactions with different cofactors. The results showed
169 that xylitol dehydrogenase 2 was highly specific for NAD+, and no detectable enzyme
170 activity was observed with NADP+, FAD, or PQQ as the cofactor (Fig. 2).
171
172 Effect of EDTA and metal ions on enzyme activity
173 To determine the effects of chelator and metal ions on NAD-dependent xylitol
174 dehydrogenase 2, EDTA and various ions (0.5 mM Ca2+, Mg2+, Cu2+, Fe2+, Zn2+, Co2+,
175 Ni2+, Mn2+, Cr3+, and Fe3+) were respectively added to the reaction system. EDTA
176 elicited no obvious effect on NAD-dependent xylitol dehydrogenase 2, indicating that
177 the enzyme does not require chelator for its activity. However, the enzyme could be
178 activated by Zn2+, Co2+, and Mn2+, among which Zn2+ improved the enzyme activity
179 by 1.8 times. In contrast, Cu2+ could almost completely inhibit the activity of
180 NAD-dependent xylitol dehydrogenase 2 (Fig. 3), while the rest of the examined
181 metal ions had no obvious impact on the enzyme activity.
182
183 Substrate specificity and kinetic constants
184 In recent years, xylitol dehydrogenase has been used for the industrial production of
185 xylitol, and under enhanced NADH supply, NAD-dependent xylitol dehydrogenase bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
186 can reduce D-xylulose to desired xylitol. In the present study, substrate specificity
187 analysis of NAD-dependent xylitol dehydrogenase 2 revealed that the enzyme was
188 highly specific towards D-sorbitol and xylitol, but showed limited activity towards
189 D-mannitol, sorbose, and glycerol. Moreover, the enzyme showed no activity when
190 glucose, inositol, galactose, sorbitol, mannose, rhamnose, xylose, fructose, glucuronic
191 acid, glucolactone, 2-KLG, gluconic, propanol, isopropanol, methanol, and ethanol
192 were used as substrate (Fig. 4). To determine the kinetic constants, the initial
193 velocities of the enzyme were determined in glycine-NaOH buffer (pH 12) with
194 D-sorbitol (at increasing concentrations from 1 to 500 mM) under standard assay
195 conditions, and the Km and Vmax were noted to be 4.92 μM and 196.08 μM/min,
196 respectively.
197
198 Discussion
199 In this study, a xylitol dehydrogenase from 44 uncharacterized dehydrogenases
200 of G. oxydans WSH-003 was identified and characterized. This novel NAD-dependent
201 xylitol dehydrogenase 2 could convert D-sorbitol to D-fructose, indicating certain
202 correlation of this enzyme with pentose phosphate pathway (31). The optimum
203 temperature and pH for the identified xylitol dehydrogenase 2 revealed its unique
204 characteristics, when compared with some of the previously identified xylitol
205 dehydrogenases. It has been reported that D-fructose is the major byproduct formed
206 during the conversion of D-sorbitol to L-sorbose by G. oxydans in industrial-scale
207 vitamin C production (36), and that knockout of genes involved in D-fructose
208 production can further improve the conversion rate of D-sorbitol to L-sorbose. Owing
209 to its unique characteristics, the NAD-dependent xylitol dehydrogenase 2 identified in
210 the present study can be applied for the production of D-xylitol (12). To characterize bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
211 all the dehydrogenases of G. oxydans WSH-003, the enzymes were predicted and
212 heterologously overexpressed in E. coli BL21 (DE3) cells. Then, the expressed
213 dehydrogenases were purified by one-step affinity chromatography with Ni-NTA
214 agarose column. While most of the dehydrogenases with obvious expression levels in
215 E. coli showed no activities, NAD-dependent xylitol dehydrogenase 2 could
216 efficiently convert D-sorbitol to D-fructose.
217 Previous studies have indicated that majority of the numerous dehydrogenases in
218 G. oxydans are membrane-bound, PQQ- or FAD-dependent enzymes with more than
219 one subunit; for example, alcohol dehydrogenases have three subunits (37), aldehyde
220 dehydrogenases have two subunits (38), D-sorbitol dehydrogenases have one or three
221 subunits (18, 21, 39), and polyol dehydrogenase have two subunits (40). Most of the
222 cytoplasmic soluble polyol dehydrogenases are NADP-dependent with more than one
223 subunit; for instance, NADP-dependent D-sorbitol dehydrogenase have four subunits,
224 NADP-dependent D-sorbitol dehydrogenase have two subunits (41), and
225 NAD-dependent ribitol dehydrogenase have four subunits (42). However, the xylitol
226 dehydrogenase 2 identified in the present study was noted to be NAD-dependent with
227 only one subunit. The amino acid sequence of the NAD-dependent xylitol
228 dehydrogenase 2 showed similarity to those of the enzymes in the MDR superfamily.
229 However, the optimum pH and temperature for the oxidation activity of the
230 NAD-dependent xylitol dehydrogenase 2 were observed to be slightly higher than
231 those reported in earlier studies for the same reaction of xylitol dehydrogenases
232 isolated from different strains of G. oxydans (43). The reason for this variation in the
233 optimum pH and temperature for xylitol dehydrogenase activity could be owing to the
234 different source strains from which the enzymes were isolated.
235 With regard to the substrate specificity of xylitol dehydrogenases, xylitol bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
236 dehydrogenase from G. oxydans ATCC 621 has been noted to present higher catalytic
237 activity towards sorbitol and xylitol (44), whereas xylitol dehydrogenase from G.
238 thailandicus CGMCC1.3748 has been demonstrated to exhibit catalytic activity
239 towards xylitol, D-sorbitol, D-mannitol, and D-fructose (43). Besides, while most of
240 the known xylitol dehydrogenases have been reported to be dependent on cofactor
241 NAD+, an NADP+-dependent xylitol dehydrogenase has been found to increase
242 ethanol production from xylose in recombinant Saccharomyces cerevisiae though
243 protein engineering (45).
244 In most of the identified G. oxydans strains, glycolysis and citric acid cycle are
245 incomplete owing to the lack of phosphofructokinase and succinate dehydrogenase
246 (29), which is the main reason for the low biomass yield of G. oxydans, when
247 compared with other common bacteria, and a major limitation to the use of G. oxydans
248 whole cell biotransformation. It has been reported that pentose phosphate pathway
249 and ED pathway are the main catabolic routes for biomass and energy supply in
250 Gluconobacter strains (46). Despite its industrial application for several decades, the
251 metabolic pathways and regulatory mechanisms of Gluconobacter spp. are not yet
252 fully elucidated (47-49). To improve the biomass of G. oxydans, Krajewski et al.
253 knocked out the membrane-bound glucose dehydrogenase and soluble glucose
254 dehydrogenase, and improved the biomass by 271% (50). An understanding of the
255 mechanisms of catabolism of polyols, sugars, and sugar derivatives into the pentose
256 phosphate pathway is essential for increasing the biomass and catalysis efficiency of G.
257 oxydans strains. As D-sorbitol and L-sorbose cannot directly enter into the pentose
258 phosphate pathway, they must be catabolized via some intermediates. The
259 NAD-dependent xylitol dehydrogenase 2 identified in the present study can catalyze
260 D-sorbitol to D-fructose, which can directly enter the pentose phosphate pathway bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
261 through phosphorylation, suggesting that overexpression of this enzyme may increase
262 the biomass of G. oxydans by utilizing more D-sorbitol.
263 In conclusion, a novel NAD-dependent xylitol dehydrogenase 2 from G. oxydans
264 WSH-003 was identified in this study. Owing to its unique characteristics, such as
265 optimum pH and temperature, the identified dehydrogenase could be used in the
266 production of xylitol or fructose, or in regeneration of cofactor under specific
267 conditions. Although G. oxydans WSH-003 has been mutated from wild-type strain at
268 least 90 times by different methods with reliable records to improve L-sorbose
269 production and tolerance to saccharides and alditols such as L-sorbose and D-sorbitol,
270 generation of D-fructose as the byproduct of the strain could not be resolved.
271 However, knockout of xylitol dehydrogenase and similar dehydrogenases could
272 facilitate further increase in the yield of D-sorbitol to L-sorbose, which could be
273 important for the current industrial-scale production of vitamin C.
274
275 Materials and methods
276 Genes, plasmids, and strains
277 The vector pMD19-T Simple and pET-28a(+) were used for vector construction and
278 protein expression, respectively. E. coli JM109 cells were employed for plasmid
279 construction and E. coli BL21 (DE3) cells were used for protein expression. The
280 dehydrogenase gene (GenBank Accession No.: 29878874) was PCR-amplified from
281 the genomic DNA of G. oxydans WSH-003 using the primer pair
282 CCGGAATTCATGGCTCAAGCTTTGGTTCTGGAAC/CCGCTCGAGTCAGCCT
283 GGAAGCTTAATTTGTAGCTTC, purified, digested, and inserted into EcoRI/XhoI
284 sites of pET-28a(+) to obtain pET-28a-XDH. The recombinant plasmid pET-28a-XDH
285 was transformed into E. coli BL21 (DE3) cells for protein expression. All the bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
286 sequences were verified by Sanger sequencing (Sangon Biotech, Shanghai, China).
287 The transmembrane domains of the protein were predicted by using TMHMM
288 (http://www.cbs.dtu.dk/services/TMHMM/).
289
290 Gene expression and purification of dehydrogenase
291 The recombinant strain was cultured in 250-mL shake flasks containing 25 mL of
292 Terrific broth (TB) medium. After growth to log phase (OD600=0.6), the cells were
293 pre-cooled to 20°C. Then, 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was
294 added to induce protein expression, and the cells were incubated at 20°C for another
295 16 h for protein expression.
296 Subsequently, the cells were collected by centrifugation at 5,000 rpm for 5 min,
297 washed twice with binding buffer (50 mM phosphate buffer), and lysed by sonication
298 at 4°C. The lysate was centrifuged for 20 min at 7,000 rpm at 4°C to obtain a clear
299 supernatant. The supernatant was passed through a 0.45-μm filter, and then applied to
300 a 5-mL nickel-charged Hi-Trap column pre-equilibrated with binding buffer. The
301 column was washed with 15 mL of binding buffer and then with washing buffer (50
302 mM phosphate buffer, 150 mM NaCl, and 50 mM imidazole; pH adjusted to 7.0) until
303 no more protein was eluted. The column was eluted with 20 mL of eluting buffer (50
304 mM phosphate buffer, 150 mM NaCl, and 500 mM imidazole), and the pH of the
305 eluent was adjusted to 7.0. The fractions were combined and dialyzed against dialysis
306 buffer (50 mM phosphate buffer).
307
308 Enzyme assay and identification of cofactor
309 The enzyme activity was measured by determining the increase in absorbance of
310 NADH at 340 nm. The reaction mixture contained 2 mM NAD+, 20 mM sorbitol, 50 bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
311 mM phosphate buffer (pH 12), and enzyme solution to a total volume of 200 μL. One
312 unit of enzyme activity was defined as the amount of enzyme catalyzing the formation
313 of 1 μmol of reduced NAD+ per minute at 30°C under the given conditions.
314
315 Effect of metal ions and EDTA
316 In order to determine the effect of the metal ions and the EDTA on the enzyme,
317 various metal ions (0.5 mM) and EDTA (5 mM) were added individually to the
318 reaction mixture. Relative activity was used to investigate, while the reaction mixture
319 without any additional treatment served as a control (100%).
320
321 Substrate specificity and determination of kinetic constants
322 Substrate specificity of the identified dehydrogenase was tested using 20 mM xylitol,
323 glucose, D-mannitol, inositol, sorbose, galactose, sorbitol, mannose, rhamnose, xylose,
324 fructose, glucuronic acid, glucolactone, 2-KLG, gluconic acid, propanol, glycerol,
325 inopropanol, methanol, and ethanol in the above-mentioned buffers. For kinetics
326 experiments, the substrate concentrations were varied between 1 and 500 mM and the
327 cofactor concentration was 2 mM.
328
329 Determination of optimum temperature and pH for the identified dehydrogenase
330 To determine the optimum pH, the enzyme activity was assessed in a pH range of
331 3–13 in the following buffers (50 mM): NaAc-HAc (pH 3.0–5.0), PBS (pH 5.0–9.0)
332 Tris-HCl (pH 9.0–10.0), and glycine-NaOH (pH 9.0–13). Similarly, the optimal
333 temperature for the identified dehydrogenase was determined by analyzing the
334 enzyme activity from 20°C to 70°C.
335 bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
336 Acknowledgements
337 This work was supported by grants from the National Natural Science Foundation of
338 China (Key Program, 31830068), the National Science Fund for Excellent Young
339 Scholars (21822806), the Fundamental Research Funds for the Central Universities
340 (JUSRP51701A), the National First-class Discipline Program of Light Industry
341 Technology and Engineering (LITE2018-08), the Distinguished Professor Project of
342 Jiangsu Province, and the 111 Project (111-2-06).
343
344 References
345 1. Deppenmeier U, Hoffmeister M, Prust C. 2002. Biochemistry and
346 biotechnological applications of Gluconobacter strains. Appl. Microbiol.
347 Biotechnol. 60:233-242.
348 2. Giridhar R, Srivastava AK. 2000. Model based constant feed fed-batch
349 L-sorbose production process for improvement in L-sorbose productivity.
350 Chem. Biochem. Eng. Q. 14:133-140.
351 3. Yang X-P, Wei L-J, Lin J-P, Yin B, Wei D-Z. 2008. A membrane-bound
352 PQQ-dependent dehydrogenase in Gluconobacter oxydans M5, responsible for
353 production of 6-(2-hydroxyethyl) amino -6-deoxy-L-sorbose. Appl. Microbiol.
354 Biotechnol. 74 5250-5253.
355 4. Poljungreed I, Boonyarattanakalin S. 2017. Dihydroxyacetone production
356 by Gluconobacter frateurii in a minimum medium using fed ‐ batch
357 fermentation. J. Appl. Chem. Biotechnol. 92:2635–2641.
358 5. Li K, Mao X, Liu L, Lin J, Sun M, Wei D, Yang S. 2016. Overexpression of
359 membrane-bound gluconate-2-dehydrogenase to enhance the production of
360 2-keto-D-gluconic acid by Gluconobacter oxydans. Microb. Cell Fact. 15:121 bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
361 6. Siemen A, Kosciow K, Schweiger P, Deppenmeier U. 2018. Production of
362 5-ketofructose from fructose or sucrose using genetically modified
363 Gluconobacter oxydans strains. Appl. Microbiol. Biotechnol. 102:1699-1710.
364 7. Rabenhorst J, DR., Gatfield I, DR., Hilmer J-M, DR. 2001-02-28 2001.
365 Natural, aliphatic and thiocarboxylic acids obtainable by fermentation and a
366 microorganism therefore EP1078990 patent EP1078990.
367 8. Bertokova A, Bertok T, Filip J, Tkac J. 2015. Gluconobacter sp cells for
368 manufacturing of effective electrochemical biosensors and biofuel cells. Chem.
369 Pap. 69:27-41.
370 9. Macauley S, McNeil B, Harvey LM. 2001. The genus Gluconobacter and its
371 applications in biotechnology. Crit. Rev. Biotechnol. 21:1-25.
372 10. Schenkmayerova A, Bertokova A, Sefcovicova J, Stefuca V, Bucko M,
373 Vikartovska A, Gemeiner P, Tkac J, Katrlik J. 2015. Whole-cell
374 Gluconobacter oxydans biosensor for 2-phenylethanol biooxidation
375 monitoring. Anal. Chim. Acta 854:140-144.
376 11. Chen R, Liu X, Wang J, Lin J, Wei D. 2015. Cloning, expression, and
377 characterization of an anti-Prelog stereospecific carbonyl reductase from
378 Gluconobacter oxydans DSM2343. Enzyme Microb. Technol. 70:18-27.
379 12. Qi X, Zhang H, Magocha TA, An Y, Yun J, Yang M, Xue Y, Liang S, Sun
380 W, Cao Z. 2017. Improved xylitol production by expressing a novel
381 D-arabitol dehydrogenase from isolated Gluconobacter sp. JX-05 and
382 co-biotransformation of whole cells. Bioresour. Technol. 235:50-58.
383 13. Zhu J, Xie J, Wei L, Lin J, Zhao L, Wei D. 2018. Identification of the
384 enzymes responsible for 3-hydroxypropionic acid formation and their use in
385 improving 3-hydroxypropionic acid production in Gluconobacter oxydans bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
386 DSM 2003. Bioresour. Technol. 265:328-333.
387 14. Matsushita K, Toyama H, Adachi O. 1994. Respiratory chains and
388 bioenergetics of Acetic Acid Bacteria. Adv. Microb. Physiol. 36:247-301.
389 15. Matsushita K, Yakushi T, Toyama H, Adachi O, Miyoshi H, Tagami E,
390 Sakamoto K. 1999. The quinohemoprotein alcohol dehydrogenase of
391 Gluconobacter suboxydans has ubiquinol oxidation activity at a site different
392 from the ubiquinone reduction site. Biochim. Biophys. Acta, Bioenerg.
393 1409:154-164.
394 16. Schweiger P, Volland S, Deppenmeier U. 2007. Overproduction and
395 characterization of two distinct aldehyde-oxidizing enzymes from
396 Gluconobacter oxydans 621H. J. Mol. Microbiol. Biotechnol. 13:147-155.
397 17. Shinagawa E, Matsushita K, Toyama H, Adachi O. 1999. Production of
398 5-keto-D-gluconate by acetic acid bacteria is catalyzed by pyrroloquinoline
399 quinone (PQQ)-dependent membrane-bound D-gluconate dehydrogenase J.
400 Mol. Catal. B: Enzym. 6:341-350.
401 18. Choi ES, Lee EH, Rhee SK. 1995. Purification of a membrane-bound
402 sorbitol dehydrogenase from Gluconobacter suboxydans. FEMS Microbiol.
403 Lett. 125:45-49.
404 19. Kim T-S, Patel SKS, Selvaraj C, Jung W-S, Pan C-H, Kang YC, Lee J-K.
405 2016. A highly efficient sorbitol dehydrogenase from Gluconobacter oxydans
406 G624 and improvement of its stability through immobilization. Sci. Rep. 6:
407 33438.
408 20. Shibata T, Ichikawa C, Matsuura M, Takata Y, Noguchi Y, Saito Y,
409 Yamashita M. 2000. Cloning of a gene for D-sorbitol dehydrogenase from
410 Gluconobacter oxydans G624 and expression of the gene in Pseudomonas bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
411 putida IFO3738. J. Biosci. Bioeng. 89:463-468.
412 21. Sugisawa T, Hoshino T. 2002. Purification and properties of
413 membrane-bound D-sorbitol dehydrogenase from Gluconobacter suboxydans
414 IFO 3255. Biosci., Biotechnol., Biochem. 66:57-64.
415 22. Asakura A, Hoshino T. 1999. Isolation and characterization of a new
416 quinoprotein dehydrogenase, L-sorbose/L-sorbosone dehydrogenase. Biosci.,
417 Biotechnol., Biochem. 63:46-53.
418 23. Saito Y, Ishii Y, Hayashi H, Imao Y, Akashi T, Yoshikawa K, Noguchi Y,
419 Soeda S, Yoshida M, Niwa M, Hosoda J, Shimomura K. 1997. Cloning of
420 genes coding for L-sorbose and L-sorbosone dehydrogenases from
421 Gluconobacter oxydans and microbial production of 2-keto-L-gulonate, a
422 precursor of L-ascorbic acid, in a recombinant G. oxydans strain. Appl.
423 Environ. Microbiol. 63:454-460.
424 24. Zahid N, Deppenmeier U. 2016. Role of mannitol dehydrogenases in
425 osmoprotection of Gluconobacter oxydans. Appl. Microbiol. Biotechnol.
426 100:9967-9978.
427 25. Adachi O, Toyama H, Matsushita K. 1999. Crystalline NADP-dependent
428 D-mannitol dehydrogenase from Gluconobacter suboxydans. Bioscience
429 Biotechnology and Biochemistry 63:402-407.
430 26. Vangnai AS, Promden W, De-Eknamkul W, Matsushita K, Toyama H.
431 2010. Molecular characterization and heterologous expression of quinate
432 dehydrogenase gene from Gluconobacter oxydans IFO3244. Biochemistry
433 (Moscow) 75:452-459.
434 27. Yakushi T, Komatsu K, Matsutani M, Kataoka N, Vangnai AS, Toyama H,
435 Adachi O, Matsushita K. 2018. Improved heterologous expression of the bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
436 membrane-bound quinoprotein quinate dehydrogenase from Gluconobacter
437 oxydans. Protein Expression Purif. 145:100-107.
438 28. Yakushi T, Terada Y, Ozaki S, Kataoka N, Akakabe Y, Adachi O,
439 Matsutani M, Matsushita K. 2018. Aldopentoses as new substrates for the
440 membrane-bound, pyrroloquinoline quinone-dependent glycerol (polyol)
441 dehydrogenase of Gluconobacter sp. Appl. Microbiol. Biotechnol.
442 102:3159-3171.
443 29. Prust C, Hoffmeister M, Liesegang H, Wiezer A, Fricke WF, Ehrenreich A,
444 Gottschalk G, Deppenmeier U. 2005. Complete genome sequence of the
445 acetic acid bacterium Gluconobacter oxydans. Nat. Biotechnol. 23:195-200.
446 30. Greenfield S, Claus GW. 1972. Nonfunctional tricarboxylic acid cycle and
447 the mechanism of glutamate biosynthesis in Acetobacter suboxydans. J.
448 Bacteriol. 112:1295-1301.
449 31. Kiefler I, Bringer S, Bott M. 2017. Metabolic engineering of Gluconobacter
450 oxydans 621H for increased biomass yield. Appl. Microbiol. Biotechnol.
451 101:5453-5467.
452 32. Peters B, Junker A, Brauer K, Mühlthaler B, Kostner D, Mientus M,
453 Liebl W, Ehrenreich A. 2013. Deletion of pyruvate decarboxylase by a new
454 method for efficient markerless gene deletions in Gluconobacter oxydans.
455 Appl. Microbiol. Biotechnol. 97:2521-2530.
456 33. Peters B, Mientus M, Kostner D, Junker A, Liebl W, Ehrenreich A. 2013.
457 Characterization of membrane-bound dehydrogenases from Gluconobacter
458 oxydans 621H via whole-cell activity assays using multideletion strains. Appl.
459 Microbiol. Biotechnol. 97:6397-6412.
460 34. Mientus M, Kostner D, Peters B, Liebl W, Ehrenreich A. 2017. bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
461 Characterization of membrane-bound dehydrogenases of Gluconobacter
462 oxydans 621H using a new system for their functional expression. Appl.
463 Microbiol. Biotechnol. 101:3189-3200.
464 35. Gao L, Zhou J, Liu J, Du G, Chen J. 2012. Draft genome sequence of
465 Gluconobacter oxydans WSH-003, a strain that is extremely tolerant of
466 saccharides and alditols. J. Bacteriol. 194:4455-4456.
467 36. Macauley-Patrick S, McNeil B, Harvey LM. 2005. By-product formation in
468 the D-sorbitol to L-sorbose biotransformation by Gluconobacter suboxydans
469 ATCC 621 in batch and continuous cultures. Process Biochem. 40:2113-2122.
470 37. Adachi O, Tayama K, Shinagawa E, Matsushita K, Ameyama M. 1978.
471 Purification and characterization of particulate alcohol dehydrogenase from
472 Gluconobacter suboxydans. Agric. Biol. Chem. 42:2045-2056.
473 38. Adachi O, Tayama K, Shinagawa E, Matsushita K, Ameyama M. 1980.
474 Purification and characterization of membrane-bound aldehyde dehydrogenase
475 from Gluconobacter suboxydans. Agricultural and Biological Chemistry
476 44:503-515.
477 39. Shinagawa E, Matsushita K, Adachi O, Ameyama M. 1982. Purification
478 and characterization of D-sorbitol dehydrogenase from membrane of
479 Gluconobacter suboxydans var. α. Agric. Biol. Chem. 46:135-141.
480 40. Matsushita K, Fujii Y, Ano Y, Toyama H, Shinjoh M, Tomiyama N,
481 Miyazaki T, Sugisawa T, Hoshino T, Adachi O. 2003. 5-keto-D-gluconate
482 production is catalyzed by a quinoprotein glycerol dehydrogenase, major
483 polyol dehydrogenase, in Gluconobacter species. Appl. Environ. Microbiol.
484 69:1959-1966.
485 41. Adachi O, Ano Y, Moonmangmee D, Shinagawa E, Toyama H, Theeragool bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
486 G, Lotong N, Matsushita K. 1999. Crystallization and properties of
487 NADPH-dependent L-sorbose reductase from Gluconobacter melanogenus
488 IFO 3294. Biosci., Biotechnol., Biochem. 63:2137-2143.
489 42. Adachi O, Fujii Y, Ano Y, Moonmangmee D, Toyama H, Shinagawa E,
490 Theeragool G, Lotong N, Matsushita K. 2001. Membrane-bound sugar
491 alcohol dehydrogenase in acetic acid bacteria catalyzes L-ribulose formation
492 and NAD-dependent ribitol dehydrogenase is independent of the oxidative
493 fermentation. Biosci., Biotechnol., Biochem. 65:115-125.
494 43. Zhang H, Yun J, Zabed H, Yang M, Zhang G, Qi Y, Guo Q, Qi X. 2018.
495 Production of xylitol by expressing xylitol dehydrogenase and alcohol
496 dehydrogenase from Gluconobacter thailandicus and co-biotransformation of
497 whole cells. Bioresour. Technol. 257:223-228.
498 44. Sugiyama M, Suzuki S, Tonouchi N, Yokozeki K. 2003. Cloning of the
499 xylitol dehydrogenase gene from Gluconobacter oxydans and improved
500 production of xylitol from D-arabitol. Biosci., Biotechnol., Biochem.
501 67:584-591.
502 45. Matsushika A, Watanabe S, Kodaki T, Makino K, Inoue H, Murakami K,
503 Takimura O, Sawayama S. 2008. Expression of protein engineered
504 NADP+-dependent xylitol dehydrogenase increases ethanol production from
505 xylose in recombinant Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol.
506 81:243-255.
507 46. De Muynck C, Pereira CSS, Naessens M, Parmentier S, Soetaert W,
508 Vandamme EJ. 2007. The genus Gluconobacter oxydans: Comprehensive
509 overview of biochemistry and biotechnological applications. Crit. Rev.
510 Biotechnol. 27:147-171. bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
511 47. Klasen R, Bringer-Meyer S, Sahm H. 1992. Incapability of Gluconobacter
512 oxydans to produce tartaric acid. Biotechnol. Bioeng. 40:183-186.
513 48. Rauch B, Pahlke J, Schweiger P, Deppenmeier U. 2010. Characterization of
514 enzymes involved in the central metabolism of Gluconobacter oxydans. Appl.
515 Microbiol. Biotechnol. 88:711-718.
516 49. Gupta A, Qazi GN, Verma V. 1997. Transposon induced mutation in
517 Gluconobacter oxydans with special reference to its direct-glucose oxidation
518 metabolism. FEMS Microbiol. Lett. 147:181-188.
519 50. Krajewski V, Simić P, Mouncey NJ, Bringer S, Sahm H, Bott M. 2010.
520 Metabolic engineering of Gluconobacter oxydans for improved growth rate
521 and growth yield on glucose by elimination of gluconate formation. Appl.
522 Environ. Microbiol. 76:4369–4376.
523
524
525
526
527
528
529
530
531
532
533
534
535 bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
536 Figure legends
537
538 Fig. 1 Optimum pH and temperature for xylitol dehydrogenase 2
539 SDS-PAGE of the identified xylitol dehydrogenase 2 purified from E. coli BL21 (DE3)
540 cells containing pET-28a-XDH. Lane 1: E. coli BL21 containing pET-28a after
541 induction for 16 h at 20°C. Lane 2: Recombinant strain E. coli BL21 containing
542 pET-28a-XDH after induction for 16 h at 20°C. Lane 3: Purified recombinant enzyme.
543 Lane M: Molecular mass markers. (B) Effect of pH on the activity of purified xylitol
544 dehydrogenase 2. (C) Effect of temperature on the activity of purified xylitol
545 dehydrogenase 2.
546
547 Fig. 2 Determination of cofactor of xylitol dehydrogenase 2
548 Catalytic reaction of purified xylitol dehydrogenase 2 (A) without cofactor, (B) with
549 NAD+, (C) with NADP+, (E) with FAD, and (E) with PQQ.
550
551 Fig. 3 Effect of metal ions on the activity of NAD-dependent xylitol
552 dehydrogenase 2
553 Relative activities of the enzyme in the presence of various metal ions, when
554 compared with the control without metal ions.
555
556 Fig. 4 Substrate specificity of NAD-dependent xylitol dehydrogenase 2
557 Relative enzyme activity towards (A) xylitol, (B) glucose, (C) D-mannitol, (E)
558 sorbose, (F) galactose, (G) sorbitol, (H) mannose, (I) rhamnose, (J) xylose, (K)
559 fructose, (L) glucuronic acid, (M) glucolactone, (N) 2-KLG, (O) gluconic acid, (P)
560 propanol, (Q) glycerol, (R) inopropanol, (S) methanol, and (T) ethanol. bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/634238; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.