DOCSLIB.ORG

Final Report V1.2 Q01108 12 NOV 07

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Final Report V1.2 Q01108 12 NOV 07 Rice LabChip Analysis - Q01108 Adaptation Of DNA Analysis Techniques for the Analysis of Basmati Rice Varieties, Adulterant Varieties and other Fragrant Rice Varieties for use on the Agilent 2100 BioAnalyzer Final Technical Report October 2007 12 June 2006 – 20 June 2007 Katherine Steele and Rob Ogden Page 1 of 27 Table of Contents 1. Executive Summary 3 2. Glossary 5 3. Aims and Objectives of the Investigation 6 3.1 Why is enforcement needed for basmati rice? 6 3.2 Existing basmati rice tests with SSR markers 7 3.3 Alternative marker systems for rice 7 3.4 Aims and Objectives 8 4. Experimental Procedures 9 4.1. Sourcing of standard varieties and DNA extraction 9 4.2. Testing INDEL markers in different rice genotypes 10 4.3. Testing Rim2/Hipa and ISSR markers in different rice genotypes 10 4.4. Optimizing multiplex PCRs for INDELS 10 4.5. Developing a SOP for variety analysis of bulk extracts using the LabChip system 10 4.6. Optimizing existing SSRs for LabChip analysis 11 4.7. Evaluating INDEL markers for quantitative testing 11 5. Results and Discussion 12 5.1 Results with INDEL markers 12 5.2 Results with Rim2/Hipa and ISSR markers 12 5.3 Database of markers 14 5.4 Development of INDEL markers for variety testing 16 5.5 Quantitative analysis 16 5.6 Problems encountered when adapting the tests for the Agilent Bioanalyzer 17 6. Acknowledgements 17 7. References 18 Appendices 20 Page 2 of 27 1. Executive Summary Aromatic basmati rice is sold at a premium price on the world market. The Code of Practice for Rice (The Rice Association, 2005) only allows the term „Basmati rice‟ to be applied to certain long grain aromatic rice varieties grown in India and Pakistan. It states that the maximum adulterant levels in basmati rice varieties can not exceed 7%. Procedures for the detection of adulterant rice varieties and the identification of named basmati varieties have been developed and validated previously by the FSA. These methods rely on microsatellite (SSR) markers and require separation of fragments on a DNA sequencer. DNA sequencers are not generally available to most public analysts. A more suitable platform is the Agilent 2100 BioAnalyzer, or LabChip system, which is simpler, more adaptable and cheaper than a DNA sequencer. However, the Agilent 2100 BioAnalyzer does not allow clear separation of all SSR fragments and cannot resolve fragments that differ in size by <4 bp. In this project, alternative rice markers were tested in order to identify a suitable set for testing basmati varieties using the Agilent 2100 BioAnalyzer. Three novel PCR-based marker systems (ISSR, and INDELs, and Rim2/Hipa) were tested on a set of rice standard varieties. Of these systems, INDELs were found to be the most reliable and informative. INDELs gave fragment sizes that were sufficiently different for easy separation using the Agilent 2100 BioAnalyser. A set of INDEL PCR markers were optimized for use with the series II LabChip 1000 system, on the BioAnalyser. Panels of INDEL markers that can be run together in the same PCR (multiplex) were identified that can be used to determine rice varieties present in samples. As with SSR markers, there was no ideal set of markers for identification of all known potential adulterants or separation of all basmati varieties from each other. We did not identify any INDEL markers that could distinguish Yamini from permitted basmatis. Two main criteria were used to select INDELs for variety testing: i) they should detect as many non-permitted varieties as possible and ii) the test should require a minimum of two PCR reactions. For these reasons, additional markers that could distinguish between permitted varieties (e.g Basmati 198 from other basmatis) were not included in the test. A set of 8 INDELs that can be run in two panels was able to detect the non-permitted varieties: Pak 386, Sherbati, Supra, Pusa Sugandha, Superfine, Mugad Sugandha, Basmati 2000, Shaheen Basmati and Pusa 1121. A simplified test using only one multiplex PCR (4 INDELs) was suitable for detecting all of these except Basmati 2000, Shaheen Basmati, and Pusa 1121. This test is highly cost effective and can be used in conjunction with a second PCR to detect these adulterants. The 4 INDEL variety test was validated and shown to give good, clear and reproducible results on the BioAnalyser, and it is highly suited for use by PAs for the detection of rice mixtures containing non-permitted varieties. Page 3 of 27 The existing SSR marker (RM201) was shown to be effective for quantification using the BioAnalyser. In addition, we tested three INDEL markers that could be used for quantitative analysis. One of these (B8) was chosen for development into a second quantitative test because it is highly reproducible and gives clear PCR products on the BioAnalyser (but this test does not detect as many adulterant varieties as the RM201 test). Both quantitative tests were tested in two laboratories and used to compare a range of adulterant mixtures. Both were shown to be useable by PAs because they can give a reasonable estimation of the level of an adulterant present. However, we observed that the levels of accuracy and reproducibility of the tests when carried out on the BioAnalyser were not as high as when the same tests are carried out on a DNA sequencer. The outcomes of this project were met: 1. An existing SSR marker (RM201) was adapted for the quantification of non- permitted rice varieties as adulterants in approved basmati rice using the Agilent 2100 BioAnalyzer (SOP 1). This test can detect and quantify levels of the adulterant varieties Sherbati, Pak 386, Mugad Sugandha and Superfine. 2. A novel INDEL marker (B8) was identified for the quantification of non- permitted rice varieties as adulterants in approved basmati rice and it was optimized for the Agilent 2100 BioAnalyzer (SOP 2). This test can detect and quantify levels of the adulterant varieties Sherbati and Pak 386. 3. A simple 4 INDEL (one-PCR) method for the identification of non-permitted rice varieties and common adulterants in approved basmati rice was developed for the Agilent 2100 BioAnalyzer (SOP 3). This method can be augmented with two additional markers to gain further information about varieties present. 4. All three methods were validated by the developer, Food DNA Services (FDNAS), and by an independent public analyst laboratory, Worcestershire Scientific Services (WSS). They were written up as three separate Standard Operating Procedures (SOPs) for presentation to the FSA. An additional output has been the following publication: Steele K.A., Ogden R., McEwing R. Briggs H. Gorham J.R. (2007) INDEL markers distinguish Basmatis from other fragrant rice varieties. Field Crops Research. DOI: 10.1016/j.fcr.2007.08.001 Page 4 of 27 2. Glossary Adulterant Rice variety not listed as an approved basmati Base pair (bp) Unit of DNA sequence with 1 bp representing one nucleotide Microsatellite Simple sequence repeat INDEL Insertion/deletion. Sequence of DNA that differs between varieties. some varieties contain an extra insertion, others do not contain this, and are said to contain a deletion ISSR Inter simple sequence repeat. PCR primers are based on the repeat sequence itself and multiple fragments are amplified, representing locations of the repeat in different regions throughout the genome. Multiplex PCR where more than one region is amplified simultaneously to give multiple fragments. It requires a combination of primer pairs to be mixed into the reaction and each pair targets one region. PCR Polymerase chain reaction Polymorphism Heritable variants that are present in a population. Usually polymorphic DNA fragments are fixed within a rice variety, so they can be used as markers for that variety. Rim2/Hipa This is a type of repeat sequence known as a transposon sequence. The primers are specific to the transposon which is present in multiple locations throughout the genome. The length of DNA sequence between the primers varies in different locations, and between different varieties, leading to polymorphism. Simple Repetitive DNA sequence or microsatellite; usually a di- sequence nucleotide, e.g. (AT)n or tri-nucleotide (e.g. (GTC)n repeat, repeat (SSR) where n is the number of repeats. In any one variety n is fixed, but it is different in different varieties. The PCR primers used to amplify SSRs are designed from non-repetitive flanking sequences that are unique, so they only target one region of the genome at a time. Standard Approved sample of a named variety from an approved source. Variety standards must be 100% pure. Quantitative standards are made from mixing two variety standards in known proportions by weight. Page 5 of 27 3. Aims and Objectives of the Investigation 3.1 Why is enforcement needed for basmati rice? A code of practice was issued in July 2005 by The Rice Association, 2005. It lists the varieties that are currently approved by the Indian and Pakistani authorities that can use the description „basmati‟, and lays down the minimum specifications and labelling requirements for basmati rice sold in the UK. The maximum limit for non-basmati rice is 7%. This code of practice replaces the FSA‟s previous guidance on the use of the term „basmati‟ and it came into practice for all products labelled after January 1st 2006. There are import duties on rice for entry into Europe as specified by the European Commission Regulation 1549/2004. For premium basmati varieties from India and Pakistan there was complete exemption from EU duty payments in 2004, representing a saving of at least €65 per tonne. The reduction in duty is decreasing, and currently stands at 50%.
Load more

Recommended publications
  • Ecological Differentiation and Incipient Speciation in the Fungal Pathogen Causing
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.02.129296; this version posted June 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 ECOLOGICAL DIFFERENTIATION AND INCIPIENT SPECIATION IN THE FUNGAL PATHOGEN CAUSING 2 RICE BLAST 3 Maud THIERRY1,2,3, Joëlle MILAZZO1,2, Henri ADREIT1,2, Sébastien RAVEL1,2,4, Sonia BORRON1, Violaine 4 SELLA3, Renaud IOOS3, Elisabeth FOURNIER1, Didier THARREAU1,2,5, Pierre GLADIEUX1,5 5 1UMR BGPI, Université de Montpellier, INRAE, CIRAD, Institut Agro, F-34398 Montpellier, France 6 2 CIRAD, UMR BGPI, F-34398 Montpellier, France. 7 3ANSES Plant Health Laboratory, Mycology Unit, Domaine de Pixérécourt, Bâtiment E, F-54220 Malzéville, France 8 4 South Green Bioinformatics Platform, Alliance Bioversity-international CIAT, CIRAD, INRAE, IRD, Montpellier, 9 France. 10 [email protected]; [email protected] 11 12 ABSTRACT 13 Natural variation in plant pathogens has an impact on food security and ecosystem health. The rice 14 blast fungus Pyricularia oryzae, which limits rice production in all rice-growing areas, is structured into 15 multiple lineages. Diversification and the maintenance of multiple rice blast lineages have been 16 proposed to be due to separation in different areas and differential adaptation to rice subspecies. 17 However, the precise world distribution of rice blast populations, and the factors controlling their 18 presence and maintenance in the same geographic areas, remain largely unknown.
    [Show full text]
  • Evaluation of Japonica Rice (Oryza Sativa L.) Varieties and Their Improvement in Terms of Stability, Yield and Cooking Quality by Pure-Line Selection in Thailand
    ESEARCH ARTICLE R ScienceAsia 46 (2020): 157–168 doi: 10.2306/scienceasia1513-1874.2020.029 Evaluation of japonica rice (Oryza sativa L.) varieties and their improvement in terms of stability, yield and cooking quality by pure-line selection in Thailand Pawat Nakwilaia, Sulaiman Cheabuc, Possawat Narumona, Chatree Saensukb, Siwaret Arikita,b, a,b, Chanate Malumpong ∗ a Department of Agronomy, Faculty of Agriculture at Kamphaeng Saen, Kasetsart University, Nakhon Pathom 73140 Thailand b Rice Science Center & Rice Gene Discovery Unit, Kasetsart University, Nakhon Pathom 73140 Thailand c Faculty of Agriculture, Princess of Naradhiwas University, Narathiwat 96000 Thailand ∗Corresponding author, e-mail: [email protected] Received 3 Aug 2019 Accepted 3 Apr 2020 ABSTRACT: Many companies in Thailand have encouraged farmers, especially those in the northern regions, to cultivate DOA1 and DOA2 japonica rice varieties. Recently, the agronomic traits of DOA1 and DOA2 were altered, affecting yield and cooking quality. Thus, the objectives of this study were to evaluate the agronomic traits and cooking quality of DOA1 and DOA2 and those of exotic japonica varieties in different locations, including the Kamphaeng Saen and Phan districts (WS16). DOA2 was improved by pure-line selection. The results showed that the Phan district was better suited to grow japonica varieties than the Kamphaeng Saen district and that DOA2 produced high grain yields in both locations. Furthermore, DOA2 was selected by the pure-line method in four generations, after which five candidate lines, Tana1 to Tana5, were selected for yield trials. The results of yield trials in three seasons (WS17, DS17/18, WS18) confirmed that Tana1 showed high performance in terms of its agronomic traits and grain yield.
    [Show full text]
  • Comparison of Aroma Active and Sulfur Volatiles in Three Fragrant Rice Cultivars Using GC–Olfactometry and GC–PFPD ⇑ Kanjana Mahattanatawee A, , Russell L
    Food Chemistry 154 (2014) 1–6 Contents lists available at ScienceDirect Food Chemistry journal homepage: www.elsevier.com/locate/foodchem Comparison of aroma active and sulfur volatiles in three fragrant rice cultivars using GC–Olfactometry and GC–PFPD ⇑ Kanjana Mahattanatawee a, , Russell L. Rouseff b a Department of Food Technology, Faculty of Science, Siam University, 38 Petchkasem Road, Phasi-Charoen, Bangkok 10160, Thailand b Institute of Food and Agricultural Sciences, Citrus Research and Education Center, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA article info abstract Article history: Aroma volatiles from three cooked fragrant rice types (Jasmine, Basmati and Jasmati) were characterised Received 13 October 2013 and identified using SPME GC–O, GC–PFPD and confirmed using GC–MS. A total of 26, 23, and 22 aroma Received in revised form 21 December 2013 active volatiles were observed in Jasmine, Basmati and Jasmati cooked rice samples. 2-Acetyl-1-pyrroline Accepted 30 December 2013 was aroma active in all three rice types, but the sulphur-based, cooked rice character impact volatile, Available online 8 January 2014 2-acetyl-2-thiazoline was aroma active only in Jasmine rice. Five additional sulphur volatiles were found to have aroma activity: dimethyl sulphide, 3-methyl-2-butene-1-thiol, 2-methyl-3-furanthiol, dimethyl Keywords: trisulphide, and methional. Other newly-reported aroma active rice volatiles were geranyl acetate, PCA b-damascone, b-damascenone, and A-ionone, contributing nutty, sweet floral attributes to the aroma of Cooked rice Headspace SPME cooked aromatic rice. The first two principal components from the principal component analysis of sulphur volatiles explained 60% of the variance.
    [Show full text]
  • 2015 Top 100 Founders Whether It’S in Plant Breeding Or Business, Policy Or Marketing, Sales Or Education, Leadership in the Seed Industry Takes Many Forms
    FOUNDERS SERIES PART 6 OF 6 2015 Top 100 Founders Whether it’s in plant breeding or business, policy or marketing, sales or education, leadership in the seed industry takes many forms. Meet the most transformational men and women in the seed industry during the past 100 years. From all across the globe, they shape your world. THESE ARE THE individuals his first batch of okra seeds research stations and farmers’ fields of Mexico that Borlaug who have provided leadership to his neighbors, his com- developed successive generations of wheat varieties with broad during trying times, insight to pany contracts with more and stable disease resistance, broad adaptation to growing con- complex issues, and a com- than 100,000 growers. Since ditions across many degrees of latitude and with exceedingly mitment to something larger then, seed distribution in India high yield potential. These new wheat varieties and improved than self. has grown 40-fold. In 1998, crop management practices transformed agricultural produc- The 100 founders of the he received the World Food tion in Mexico during the 1940s and 1950s and later in Asia and seed industry that we’ve Prize award and invested that Latin America, sparking the Green Revolution. Because of his chosen to represent the money into research pro- achievements and efforts to prevent hunger, famine and misery dramatic changes during the grams for hybrid rice varieties. around the world, it is said that Borlaug has saved more lives past century have all left a than any other person who has ever lived. tremendous mark — be it in Henry Beachell plant breeding, technology, Creator of IR8 Rice Kent Bradford business or the policy arena — Today, most of the rice Launched the Seed Biotechnology Center that impacts the seed indus- grown in the world comes Through workshops and courses, the try.
    [Show full text]
  • Understanding G × E Interaction of Elite Basmati Rice (Oryza Sativa L.) Genotypes Under North Indian Conditions Using Stability Models - 5863
    Jain et al.: Understanding G × E interaction of elite basmati rice (Oryza sativa L.) genotypes under north Indian conditions using stability models - 5863 - UNDERSTANDING G × E INTERACTION OF ELITE BASMATI RICE (ORYZA SATIVA L.) GENOTYPES UNDER NORTH INDIAN CONDITIONS USING STABILITY MODELS JAIN, B. T.1 – SARIAL, A. K.2 – KAUSHIK, P.3* 1Department of Genetics & Plant Breeding, CCS Haryana Agriculture University, Hisar, Haryana 125001, India 2CSK Himachal Pradesh Krishi Vishvavidyala, Palampur, Himachal Pradesh 176062, India 3Instituto de Conservación y Mejora de la Agrodiversidad Valenciana, Universitat Politècnica de València, Valencia 46022, Spain *Corresponding author e-mail: [email protected], [email protected]; phone: +34-96-387-7000 (Received 14th Jan 2019; accepted 6th Mar 2019) Abstract. Information regarding the stability of genotypes is critical in expanding the adaptability of released genotypes. But, this information regarding the basmati (scented) rice genotypes cultivated under north Indian conditions are not well known. Therefore, here we have evaluated the twenty-two basmati rice genotypes for stability, based on important traits, and different production system. Genotypes were evaluated for two consecutive Kharif seasons under open field conditions in a randomized complete block design (RCBD). The genotypes were evaluated under four production systems namely, transplanted rice (TPR), system of rice intensification (SRI), direct seeded rice (DSR) in both settings, i.e. wet DSR (W) and dry DSR (D). The stability of genotypes was determined via Eberhart and Russell model, additive main effects and multiplicative interaction (AMMI), and genotype × environment interaction (GGE) biplot model. The stability and adaptability studied using Eberhart and Russell model, AMMI and GGE biplot identified Basmati-370 as the most stable genotype for biological weight; Pusa RH-10 for filled spikelet; CSR-30 for spikelet Number; and Traori Basmati for test grain weight.
    [Show full text]
  • A Study on the Preparation of Modified Starch from Broken Rice
    J. Myanmar Acad. Arts Sci. 2020 Vol. XVIII. No.1C A STUDY ON THE PREPARATION OF MODIFIED STARCH FROM BROKEN RICE Htet Htet Aung1, Khin Hla Mon2, Ohnmar Kyi3, Mon Mon Maung4,Aye Aye Aung5 Abstract This research was emphasized on the preparation of modified broken rice starch using both acid treatment method and cross-link method. Broken rice (Paw Hsan Hmwe) was collected from Bago Township, Bago Region. The most suitable parameters for the preparation of native starch were 1:8 (w/v) ratio of broken rice to water at 4 hr settling time. The optimum conditions for the preparation of modified broken rice starch by acid treatment were 1 mL of 10% HCl, 1mL of 1% NaOH at reaction temperature 65C for 15 min of reaction time. In cross-link method, the optimum parameters were 5mL of 2.5% sodium tripolyphosphate,5mL of 1% NaOH, 5mL of 5 % HCl at 45C for 10 min. The characteristics of modified starch such as ash, moisture, pH and gelatinization temperature, solubility, swelling power, amylose and amylopectin content were determined. The morphology properties, molecular components and structures of native and modified broken rice were determined with Scanning Electron Microscopy (SEM) and FT-IR Analysis. Keywords: Native starches, acid treatment method, cross-link method Introduction Starch is a basis of food and plays a major role in industrial economy. The most abundant substance in nature is starch. Starch consists of semi crystalline carbohydrate synthesized in plant roots, seeds, rhizomes and tubers. It is a polymer of glucose and consists of two types of glucose polymers such as amylose and amylopectin.
    [Show full text]
  • (Genetically Modified Organisms (Plants) Genetically Engineered Plants)) Why Create Transgenic Plants?
    Transgenic Plants (Genetically modified organisms (plants) Genetically engineered plants)) Why create transgenic plants? When there is no naturally occurring genetic variation for the target trait. Examples: 1. Glyphosate herbicide resistance in soybean, corn 2.Vitamin A in rice 3.Blue roses What genes to transfer? 1. One gene to a few genes - the CP4 ESPS example 2. Multiple genes - Golden Rice and Applause rose 3. In principle, any gene (or genes) ORIGIN 1 cctttcctac tcactctgga caggaacagc tgtctgcagc cacgccgcgc ctgagtgagg 61 agaggcgtag gcaccagccg aggccaccca gcaaacatct atgctgactc tgaatgggcc 121 cagtcctccg gaacagctcc ggtagaagca gccaaagcct gtctgtccat ggcgggatgc 181 cgggagctgg agttgaccaa cggctccaat ggcggcttgg agttcaaccc tatgaaggag 241 tacatgatct tgagtgatgc gcagcagatc gctgtggcgg tgctgtgtac cctgatgggg 301 ctgctgagtg ccctggagaa cgtggctgtg ctctatctca tcctgtcctc gcagcggctc CP4 EPSPS: The gene conferring resistance to the herbicide Roundup The gene was found in Agrobacterium tumefaciens and transferred to various plants Coincidentally, this organism is also used for creating transgenic plants TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT
    [Show full text]
  • Genetic and Molecular Analysis of Utility of Sd1 Alleles in Rice Breeding
    Breeding Science 57 : 53–58 (2007) Genetic and Molecular Analysis of Utility of sd1 Alleles in Rice Breeding Kenji Asano1), Tomonori Takashi2), Kotaro Miura1), Qian Qian3), Hidemi Kitano1), Makoto Matsuoka1) and Motoyuki Ashikari*1) 1) Bioscience and Biotechnology Center, Nagoya University, Furo-cho, Chikusa, Nagoya, Aichi 464-8601, Japan 2) Honda Research Institute Japan Co., Ltd., 2-1-4 Kazusa-Kamatari, Kisarazu, Chiba 292-0818, Japan 3) China National Rice Research Institute, Hangzhou, Zhejiang 310006, China The widespread adoption of the high-yielding semi-dwarf rice variety, IR8, led to the “green revolution” in Asia in the 1960s. The short stature of this variety is due to a loss-of-function of the SD1 gene that encodes a GA20 oxidase-2 (GA20ox-2) which catalyzes late steps of gibberellin biosynthesis. In this study, we inves- tigated how widely sd1 mutations have been employed in the generation of semi-dwarf varieties of rice. Ge- netic and molecular analyses revealed that the sd1 allele of IR8 has been used in the production of japonica varieties. Sequence analysis of the SD1 locus of 57 semi-dwarf varieties showed that at least 7 sd1 alleles have been used in the breeding of semi-dwarf rice varieties in China, USA and Japan. The utilization of such a high number of different alleles all controlling the same target trait highlights that mutations in GA20ox-2 induce an agronomically advantageous architecture in rice. Key Words: rice, semi-dwarf, sd1, IR8. Introduction (IRRI), contributed to the green revolution in Asia. IR8 was bred by crossing between a Taiwanese native semi-dwarf In the 1960s, the rapid expansion of the world popula- variety, Dee-geo-woo-gen (DGWG), which carries the semi- tion and dramatic decrease in cultivated lands raised concern dwarf 1 (sd1) gene, and an Indonesian good-taste variety, that food production would not meet the growing demand, Peta (Hargrove and Cabanilla 1979, Dalrymple 1986).
    [Show full text]
  • Genetic Variability and Association Studies on Bpt-5204 Based Rice Mutants Under Saline Stress Soil
    Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2441-2450 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 9 Number 2 (2020) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2020.902.279 Genetic Variability and Association Studies on Bpt-5204 Based Rice Mutants under Saline Stress Soil C. Prashanth1*, K. Mahantashivayogayya1, J. R. Diwan2, P. H. Kuchanur3 and J. Vishwanath1 1Agricultural Research Station, Gangavati, University of Agricultural Sciences, Raichur - 584104, India. 2Department of Genetics and Plant Breeding, College of Agriculture, University of Agricultural Sciences, Raichur- 584104, India 3Department of Genetics and Plant Breeding, College of Agriculture, Bheemarayangudi, University of Agricultural Sciences, Raichur - 584104, India *Corresponding author ABSTRACT Present investigation was carried out with 12 advanced (M7) mutants developed using gamma rays on two varieties i.e., BPT-5204 and RP Bio-226 along with checks (Gangavati Sona and CSR-22) at Agricultural Research Station Gangavati, Karnataka state, India K e yw or ds during kharif 2018. Analysis of variance revealed highly significant differences among the mutant lines for all morpho-physiological characters under study viz., Days to 50 per cent Variability, BPT- flowering, Plant height, Panicle length, Number of grains per panicle, Panicle weight, 5204 mutants, Association, Productive tillers per hill, Length of flag leaf and Grain yield per plant. Higher magnitude of heritability (broad sense) and genetic advance as percentage of mean were observed for Salinity tolerance in rice number of grains per panicle, productive tillers per hill, spikelet sterility, test weight, grain + + yield per plant, grain yield per ha and Na /K ratio indicating presence of additive gene Article Info action and fixation of genes.
    [Show full text]
  • Cheese Selection from Around the World Selection of Charcuterie and Seafood Selection of Specialty Grocery Selection of Desserts
    Cheese Selection from Around the World Selection of Charcuterie and Seafood Selection of Specialty Grocery Selection of Desserts & Pastry Ingredients Catalog Software by www.clevercatalogs.com -- The Professional Product Catalog Builder. Catalog Software by www.clevercatalogs.com -- The Professional Product Catalog Builder. Cheese selection from Around the World CHIMAY CLASSIC 5# HALLOUMI FONTINA DANISH Chimay Kynthos Denmark's Finest Belgium Cyprus Denmark Big earthy flavor from Enjoy this three milk blend, A semi-soft, smooth textured unskimmed, scalded cow semi-firm cheese fried or cow's milk cheese. Mellow, milk and a monastery grilled! sweet, aromatic & delicate washed rind. Made by the buttery flavor, with a hint of monks of Scarmont who also wild honey. Melts well, try in make Chimay beer, a nice fondue or sauces, also great Pack 1/4.5# companion beverage. Earthy, Pack 12/8.8Z Pack 1/10# with crusty breads & fruits. Supc#: 1722257 semi-soft with natural rind. Supc#: 7035154 Supc#: 7203623 FAVRSKOV DANISH BLUE BELLETOILE BULK 70% COMTE WEDGE 4-6 MONTH No Specified Brand Belletoile No Specified Brand Denmark France France Traditional Danish Blue White mold rind soft Made from raw cow milk in wheel is characterized by a ripening brie style triple the French-Comte of Jura. sharp, piquant and salty creme. Very buttery and Aged about 6 mos., it is firm, taste. It has a creamy white much richer than traditional dense, and bursting with big paste with blue mold brie, but in the very same Swiss flavor. Natural rind cultures. Pair with dessert shape. with straw color interior. Pack 1/6# wines or cider, figs, pears and Pack 1/6.61# Pack 2/10# One of best cheeses to use in Supc#: 2747290 honey.
    [Show full text]
  • Rice Novel Semidwarfing Gene D60 Can Be As Effective As
    plants Article Rice Novel Semidwarfing Gene d60 Can Be as Effective as Green Revolution Gene sd1 Motonori Tomita 1,* and Keiichiro Ishimoto 2 1 Research Institute of Green Science and Technology, Shizuoka University, 836 Ohya, Suruga-ku, Shizuoka City, Shizuoka 422-8529, Japan 2 Faculty of Agriculture, Tottori University, 4-101 Koyama Minami, Tottori 680-8550, Japan; [email protected] * Correspondence: [email protected] Received: 3 September 2019; Accepted: 7 October 2019; Published: 30 October 2019 Abstract: Gene effects on the yield performance were compared among promising semidwarf genes, namely, novel gene d60, representative gene sd1 with different two source IR8 and Jukkoku, and double dwarf combinations of d60 with each sd1 allele, in a Koshihikari background. Compared with the culm length of variety Koshihikari (mean, 88.8 cm), that of the semidwarf or double dwarf lines carrying Jukkoku_sd1, IR8_sd1, d60, Jukkoku_sd1 plus d60, or IR8_sd1 plus d60 was shortened to 71.8 cm, 68.5 cm, 65.7 cm, 48.6 cm, and 50.3 cm, respectively. Compared with the yield of Koshihikari (mean, 665.3 g/m2), that of the line carrying Jukkoku_sd1 allele showed the highest value (772.6 g/m2, 16.1% higher than Koshihikari), while that of IR8_sd1, d60 and IR8_sd1 plus d60, was slightly decreased by 7.1%, 5.5%, and 9.7% respectively. The line carrying Jukkoku_sd1 also showed the highest value in number of panicles and florets/panicle, 16.2% and 11.1% higher than in Koshihikari, respectively, and these effects were responsible for the increases in yield.
    [Show full text]
  • Rice Free Diet Rice Is One of the Most Common Causes of Food Protein Induced Enterocolitis Syndrome (FPIES) in Australia
    Departments of Nutrition & Dietetics and Allergy/Immunology Rice Free Diet Rice is one of the most common causes of food protein induced enterocolitis syndrome (FPIES) in Australia. It is an extremely rare cause of immediate food allergy. .. It is important to avoid all forms of rice if you have been diagnosed with a rice allergy. Rice can be found in unexpected foods, so you must always read food labels carefully. Foods that must be avoided: All kinds of rice: brown, white, jasmine, basmati, wild, Arborio, sticky, jasmati, glutinous etc. All kinds of rice flour: brown, rice, Cereals: rice bran, puffed rice, rice bread/wraps, rice pasta, rice noodles, rice paper Oils: rice bran oil Sauces: mirin, rice vinegar, thickening agents. Where you are likely to find rice: Biscuits and crackers e.g. shortbread, rice crackers, rice cakes. Breads e.g. breads containing rice flour, rice bread, rice mountain bread. Foods from diverse cultures e.g. paella, risotto, arancini balls, fried rice, biryani, burritos, fajitas, burger patties, fritters, sushi, nougat, dumplings. Cereals e.g. rice bubbles, muesli, rice puffs, muesli bars. Drinks: rice milk Gluten free and health food products e.g. cake mixes, breads, packaged foods. Puddings e.g. rice pudding, black rice pudding, cakes made with rice flour. Packaged foods e.g. muesli bars, biscuits, rice wheels, rice sticks. Party foods e.g. chocolate crackles, slices, cakes. Noodles and pasta e.g. vermicelli, rice noodles. Wrappings e.g. rice paper rolls, rice paper (sweet). Mineral and vitamin tablets Sausages (many will have rice flour as a filler) What you can use: It is best to discuss with your doctor which other grains apart from rice your child can have.
    [Show full text]