DOCSLIB.ORG

Inhibition of the Catalytic Activity of HIF-1Α-Prolyl Hydroxylase 2 by a MYND-Type Zinc Finger

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Inhibition of the Catalytic Activity of HIF-1Α-Prolyl Hydroxylase 2 by a MYND-Type Zinc Finger Molecular Pharmacology Fast Forward. Published on September 9, 2005 as DOI: 10.1124/mol.105.015271 Molecular PharmacologyThis article Fasthas not Forward. been copyedited Published and formatted. on TheSeptember final version 9,may 2005 differ asfrom doi:10.1124/mol.105.015271 this version. MOL(15271) Regulation of PHD2 activity by MYND-Zn finger Inhibition of the catalytic activity of HIF-1α-prolyl hydroxylase 2 by a MYND-type zinc finger Downloaded from molpharm.aspetjournals.org Kyung-Ok Choi, Taekyong Lee, Naery Lee, Ji-Hyun Kim, Eun Gyeong Yang, Jung Min Yoon, Jin Hwan Kim, Tae-Gyu Lee, and Hyunsung Park Department of Life Science, University of Seoul, Seoul 130-743, Korea (K.-O. C., T. at ASPET Journals on September 26, 2021 L., N. L., H. P.), Life Science Division, Korea Institute of Science and Technology, Seoul 130-650, Korea (J.-H. K., E. G. Y.), and The Division of Drug Discovery, CrystalGenomics, Inc., Daejeon City, 305-390, Korea (J. M. Y, J. H. K., T.-G. L.) 1 Copyright 2005 by the American Society for Pharmacology and Experimental Therapeutics. Molecular Pharmacology Fast Forward. Published on September 9, 2005 as DOI: 10.1124/mol.105.015271 This article has not been copyedited and formatted. The final version may differ from this version. MOL(15271) Regulation of PHD2 activity by MYND-Zn finger Running title page a) Running title : Regulation of PHD2 activity by MYND-Zn finger b) Corresponding author. (Hyunsung Park) Mailing address: Department of Life Science, University of Seoul, 90 Cheonnong-dong, Tongdaemun-gu, Seoul 130-743, Downloaded from Korea. Phone: 82-2-2210-2622. Fax: 82-2-2210-2888. E-mail:[email protected]. c) The number of text pages (19), molpharm.aspetjournals.org number of tables (0), number of figures (7), references (31), at ASPET Journals on September 26, 2021 the number of words in the Abstract ( 191) the number of words in the Introduction ( 555) the number of words in the Discussion ( 671) d) A list of nonstandard abbreviations used : bHLH, basic helix-loop-helix; HIF-1α, hypoxia-inducible factor-1α; HRE, hypoxia-responsive element; GST, glutathione-S- transferase; MYND, Myeloid translocation protein 8, Nervy, and DEAF1; ODD, Oxygen dependent degradation domain; PAS, Per-Arnt-Sim; PHD, HIF-1α-specific prolyl hydroxylase; TPEN, N, N, N', N'-tetrakis (2-pyridylmethyl) ethylenediamine; VHL, von Hippel Lindau. 2 Molecular Pharmacology Fast Forward. Published on September 9, 2005 as DOI: 10.1124/mol.105.015271 This article has not been copyedited and formatted. The final version may differ from this version. MOL(15271) Regulation of PHD2 activity by MYND-Zn finger Abstract Hypoxia-induced gene expression is initiated when the hypoxia-inducible factor-1α (HIF-1α) subunit is stabilized in response to a lack of oxygen. An HIF-1α-specific prolyl hydroxylase (PHD) catalyzes hydroxylation of the proline-564 and/or 402 residues of HIF-1α by an oxygen molecule. The hydroxyproline then interacts with the Downloaded from ubiquitin E3 ligase, von Hippel Lindau (VHL) protein, and is degraded by an ubiquitin- dependent proteasome. PHD2 is the most active of three PHD isoforms in hydroxylating molpharm.aspetjournals.org HIF-1α. Structural analysis showed that the N-terminal region of PHD2 contains a MYND-type zinc finger domain whereas the catalytic domain is located in its C- terminal region. We found that deletion of the MYND domain increased the activity of both recombinant PHD2 protein and in vitro translated PHD2. The zinc chelator, N, N, at ASPET Journals on September 26, 2021 N', N'-tetrakis (2-pyridylmethyl) ethylenediamine (TPEN) augmented the activity of wild type PHD2-F but not that of PHD2 lacking the MYND domain, confirming that the zinc finger domain is inhibitory. Overexpression of PHD2 lacking the MYND domain caused a greater reduction in the stability and function of HIF-1α than did overexpression of wild type PHD2, indicating that the MYND domain also inhibits the catalytic activity of PHD2 in vivo. 3 Molecular Pharmacology Fast Forward. Published on September 9, 2005 as DOI: 10.1124/mol.105.015271 This article has not been copyedited and formatted. The final version may differ from this version. MOL(15271) Regulation of PHD2 activity by MYND-Zn finger Introduction Hypoxia is the most common type of cell injury in various human diseases including myocardial infarction, stroke, acute renal failure and solid tumors. However, organisms have evolved mechanisms for adapting to hypoxia. Thus, hypoxia leads to up-regulation of the transcription of genes involved in anaerobic ATP production and Downloaded from oxygen delivery. Hypoxia-inducible factor-1(HIF-1) is a widespread transcription factor that promotes expression of hypoxia-inducible genes such as vascular endothelial molpharm.aspetjournals.org growth factor, erythropoietin, glucose transporters and glycolytic enzymes (Masson and Ratcliffe, 2003; Seagroves et al., 2001). It consists of HIF-1α and HIF-1β subunits, both of which belong to the basic helix-loop-helix (bHLH) Per-Arnt-Sim (PAS) family. Arnt (HIF-1β) is a partner of the aryl hydrocarbon receptor (AhR), as well as of HIF-1α and at ASPET Journals on September 26, 2021 other bHLH-PAS proteins. HIF-1α is rapidly degraded under normoxic condition by the ubiquitin-proteasome system, whereas the level of Arnt is constant (Huang et al., 1998; Kallio et al., 1999). Hydroxylation of proline-564 and/or 402 residues in the oxygen- dependent degradation domain (ODD) of HIF-1α initiates its ubiquitination and subsequent proteasomal degradation (Masson and Ratcliffe, 2003). Prolyl hydroxylation of HIF-1α is catalyzed by a novel HIF-1α-specific prolyl hydroxylase which requires 2+ O2, 2-oxoglutarate, vitamin C, and Fe (Bruick and McKnight, 2001; Epstein et al., 2001; Ivan et al., 2001; Jaakkola et al., 2001). The tumor suppressor, von Hippel-Lindau (VHL) protein, which functions as an E3 ubiquitin ligase, interacts with the hydroxylated prolines of HIF-1α and brings about the assembly of a complex that activates a ubiquitin-dependent proteasome (Maxwell et al., 1999; Min et al., 2002; Ohh et al., 2000). When cells lack oxygen, proline hydroxylation ceases and HIF-1α protein 4 Molecular Pharmacology Fast Forward. Published on September 9, 2005 as DOI: 10.1124/mol.105.015271 This article has not been copyedited and formatted. The final version may differ from this version. MOL(15271) Regulation of PHD2 activity by MYND-Zn finger accumulates. In mammalian cells, a family of HIF-1α specific prolyl-4 hydroxylases has been identified and given the acronyms PHD1 (HPH3, EGLN2), PHD2 (HPH2, EGLN1), and PHD3 (HPH1, EGLN3) (Huang et al., 2002; Metzen et al., 2005; Taylor, 2001). Although all three PHDs hydroxylate prolines of HIF-1α in vitro, there is evidence that PHD2 has the primary role in vivo (Appelhoff et al., 2004; Berra et al., Downloaded from 2003; Hirsila et al., 2003; Huang et al., 2002). Thus, experiments employing short interfering RNAs revealed that silencing of PHD2 is enough to stabilize and activate molpharm.aspetjournals.org HIF-1α in normoxic cells (Berra et al., 2003). Moreover PHD2 is the most abundant of the three isoforms in most normoxic cells (Appelhoff et al., 2004). These findings suggest that each PHD has its own specific substrate, and that PHD2 is the major form responsible for hydroxylating HIF-1α, and therefore the critical oxygen sensor at ASPET Journals on September 26, 2021 maintaining the low steady state level of HIF-1α in normoxic conditions (Freeman et al., 2003; Huang et al., 2002; Masson et al., 2004; Masson and Ratcliffe, 2003). In addition to hypoxia, Co(II) ion and iron chelators, which inhibit the catalytic activity of PHDs, as well as other agents such as growth factors and the oncogenes Ras, active Src and Akt, have been reported to activate HIF-1α under normoxia (Chan et al., 2002; Karni et al., 2002; Zundel et al., 2000). It is not clear whether these non-hypoxic stimuli repress the catalytic activity of PHD2, to stabilize HIF-1α, or act in some other way. In this study we investigated whether the activity of PHD2 is regulated. By analyzing the catalytic activity of purified PHD2 and truncated mutants, we found that the N-terminal region of PHD2 contains a MYND-type Zn finger domain which inhibits catalytic activity. 5 Molecular Pharmacology Fast Forward. Published on September 9, 2005 as DOI: 10.1124/mol.105.015271 This article has not been copyedited and formatted. The final version may differ from this version. MOL(15271) Regulation of PHD2 activity by MYND-Zn finger Materials and Methods Cells, cDNAs and reagents Human epithelial HeLa cells were cultured in DMEM supplemented with 10% fetal bovine serum (Bio Whittaker), gentamicin (5 µg/ml, Life Technologies Gibco BRL) and Fungizone (0.25 µg/ml, Life Technologies Gibco BRL) Downloaded from in humidified air containing 5% CO2 at 37°C. Cells were made hypoxic by incubation in an anaerobic incubator (Model 1029, Forma Scientific, Inc.) in 5% CO2, 10% H2, and 85% N2 at 37°C or Multi-gas incubator (Model : NU-4950G, NuAire, Inc). We used the molpharm.aspetjournals.org following human cDNAs in expression vectors, transfection assays and in vitro transcription and translation experiments; PHD1 (AJ310544), PHD2 (AJ310543), PHD3 (AJ310545), HIF-1α (U22431), VHL (AF010238). The p(HRE)4-luc reporter plasmid contained 4 copies of the erythropoietin hypoxia-responsive element 5’- at ASPET Journals on September 26, 2021 GATCGCCCTACGTGCTGTCTCA-3’; nucleotides 3449-3470). Anti-HIF-1α was obtained from Transduction Laboratories. We obtained N, N, N’, N’-tetrakis (2- pyridylmethyl) ethylenediamine (TPEN) from Calbiochem, and all remaining chemicals from Sigma Chemical Co. Culture media were purchased from Gibco BRL, fetal bovine serum from Bio Whittaker. Expression of PHDs and HIF-1α Full-length cDNAs for PHD1, 2, and 3 were cloned from a human lymphocyte cDNA library into pcDNA3.1B(+) (Invitrogen).
Load more

Recommended publications
  • Plant SET Domain-Containing Proteins: Structure, Function and Regulation
    Biochimica et Biophysica Acta 1769 (2007) 316–329 www.elsevier.com/locate/bbaexp Review Plant SET domain-containing proteins: Structure, function and regulation Danny W-K Ng, Tao Wang, Mahesh B. Chandrasekharan 1, Rodolfo Aramayo, ⁎ Sunee Kertbundit 2, Timothy C. Hall Institute of Developmental and Molecular Biology and Department of Biology, Texas A&M University, College Station, TX 77843-3155, USA Received 27 October 2006; received in revised form 3 April 2007; accepted 4 April 2007 Available online 12 April 2007 Abstract Modification of the histone proteins that form the core around which chromosomal DNA is looped has profound epigenetic effects on the accessibility of the associated DNA for transcription, replication and repair. The SET domain is now recognized as generally having methyltransferase activity targeted to specific lysine residues of histone H3 or H4. There is considerable sequence conservation within the SET domain and within its flanking regions. Previous reviews have shown that SET proteins from Arabidopsis and maize fall into five classes according to their sequence and domain architectures. These classes generally reflect specificity for a particular substrate. SET proteins from rice were found to fall into similar groupings, strengthening the merit of the approach taken. Two additional classes, VI and VII, were established that include proteins with truncated/ interrupted SET domains. Diverse mechanisms are involved in shaping the function and regulation of SET proteins. These include protein–protein interactions through both intra- and inter-molecular associations that are important in plant developmental processes, such as flowering time control and embryogenesis. Alternative splicing that can result in the generation of two to several different transcript isoforms is now known to be widespread.
    [Show full text]
  • Computational Investigation of Thiol-Based Redox Modifications in Proteins: Redox-Active Disulfides, Zn2+ Sites and Their Associations
    THESIS SUBMITTED IN TOTAL FULFILLMENT OF THE REQUIREMENTS OF THE DEGREE OF DOCTOR OF PHILOSOPHY Computational investigation of thiol‐based redox modifications in proteins: redox‐active disulfides, 2+ Zn sites and their associations Application of tools of bioinformatics in health and disease Dhakshinari Vihara Kumari Hulugalle March 2013 Victor Chang Cardiac Research Institute School of Medical Sciences, Faculty of Medicine, University of New South Wales PLEASE TYPE THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: HULUGALLE First name: DHAKSHINARI Other name/s: VIHARA KUMARI PhD Abbreviation for degree as given in the University calendar: School: SCHOOL OF MEDICAL SCIENCES Faculty: MEDICINE Title: Computational investigation of thiol-based redox modifications in proteins: redox-active disulfides, Zn2+ sites and their associations Abstract 350 words maximum: (PLEASE TYPE) Thiol based redox signalling is an emerging area of research in protein science. Reversible disulfide bonding and Zn2+ expulsion are two important but less explored oxidative thiol modifications associated with redox signalling. They have numerous implications in health and disease. Three computational methods have previously been developed to predict redox-active disulfides in proteins: redox pair protein (RP) method, ‘forbidden disulfides’ (FD) method and torsional energy (TE) method. These methods and other tools of bioinformatics are used in my study to investigate redox-active disulfides, Zn2+ sites and the association between FDs and Zn fingers in protein structures. The first objective of my study was to apply the RP method to predict novel proteins containing likely redox-active disulfides. Over 300 novel RP proteins were found during this study. Significant conformational changes associated with disulfide redox activity in RP protein structures were also identified.
    [Show full text]
  • Hub Domains and Intrinsically Disordered Proteins
    REVIEWS αα-Hub domains and intrinsically disordered proteins: A decisive combo Received for publication, October 7, 2020, and in revised form, December 22, 2020 Published, Papers in Press, December 29, 2020, https://doi.org/10.1074/jbc.REV120.012928 Katrine Bugge1,2 , Lasse Staby1,2 , Edoardo Salladini1 , Rasmus G. Falbe-Hansen1 , Birthe B. Kragelund1,2,* , and Karen Skriver1,* From the 1REPIN and The Linderstrøm-Lang Centre for Protein Science; 2Structural Biology and NMR Laboratory, Department of Biology, University of Copenhagen, Copenhagen, Denmark Edited by Ronald Wek Hub proteins are central nodes in protein–protein interaction adaptability, multivalency, and high chemical modification networks with critical importance to all living organisms. potential (9–11). Indeed, ID appears to be a prerequisite for Recently, a new group of folded hub domains, the αα-hubs, was fidelity in signaling pathways through exploitation of the many defined based on a shared αα-hairpin supersecondary structural different mechanisms encoded in these properties (12, 13). foundation. The members PAH, RST, TAFH, NCBD, and HHD Recognition of IDRs in and by hubs depends on short linear are found in large proteins such as Sin3, RCD1, TAF4, CBP, and motifs (SLiMs), which are stretches of 2 to 12 residues with harmonin, which organize disordered transcriptional regulators only a few highly conserved positions (14, 15). It has been and membrane scaffolds in interactomes of importance to hu- proposed that the eukaryotic SLiMome consists of up to 1 man diseases and plant quality. In this review, studies of struc- million different SLiMs (16), but SLiMs active in hub in- tures, functions, and complexes across the αα-hubs are described teractions have very similar features (17).
    [Show full text]
  • Atlas Journal
    Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 12, Number 5, Sep-Oct 2008 Previous Issue / Next Issue Genes XAF1 (XIAP associated factor-1) (17p13.2). Stéphanie Plenchette, Wai Gin Fong, Robert G Korneluk. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (5): 668-673. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/XAF1ID44095ch17p13.html WWP1 (WW domain containing E3 ubiquitin protein ligase 1) (8q21.3). Ceshi Chen. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (5): 674-680. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/WWP1ID42993ch8q21.html TSPAN1 (tetraspanin 1) (1p34.1). David Murray, Peter Doran. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (5): 681-683. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/TSPAN1ID44178ch1p34.html TCL1B (T-cell leukemia/lymphoma 1B) (14q32.13). Herbert Eradat, Michael A Teitell. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (5): 684-686. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/TCL1BID354ch14q32.html PVRL4 (poliovirus receptor-related 4) (1q23.3). Marc Lopez. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (5): 687-690. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/PVRL4ID44141ch1q23.html PTTG1IP (pituitary tumor-transforming 1 interacting protein) (21q22.3). Vicki Smith, Chris McCabe. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (5): 691-694.
    [Show full text]
  • Antibodies Products
    Chapter 2 : Gentaur Products List • WDSUB1 contains 1 SAM sterile alpha motif domain 1 U Defects in DLG3 are the cause of mental retardation X • Sodium hydrogen exchangers NHEs such as SLC9A8 are box domain and 7 WD repeats The function of WDSUB1 linked type 90 MRX90 integral transmembrane proteins that exchange extracellular remains unknown • SLC25A20 is one of several closely related mitochondrial Na for intracellular H NHEs have multiple functions including • RNF217 is an E3 ubiquitin protein ligase which accepts membrane carrier proteins that shuttle substrates between intracellular pH ho ubiquitin from E2 ubiquitin conjugating enzymes in the form cytosol and the intramitochondrial matrix space It mediates • SLCO1C1 is a member of the organic anion transporter of a thioester and then directly transfers the ubiquitin to the transport of acylcarn family SLCO1C1 is a transmembrane receptor that mediates targeted substrates • The sodium iodide symporter NIS or SLC5A5 is a key the sodium independent uptake of thyroid hormones in brain • TRIM60 contains a RING finger domain a motif present in a plasma membrane protein that mediates active I uptake in tissues This protein has part variety of functionally distinct proteins and known to be thyroid lactating breast and other tissues with an • SLC35A5 belongs to the nucleotide sugar transporter involved in protein protein and protein DNA interactions The electrogenic stoichiometry of 2 Na family SLC35A subfamily It is a multi pass membrane protein encoded by thi • SLC2A9 is a member of the SLC2A
    [Show full text]
  • AML1-ETO Decreases ETO-2 (MTG16) Interactions with Nuclear Receptor Corepressor, an Effect That Impairs Granulocyte Differentiation
    [CANCER RESEARCH 64, 4547–4554, July 1, 2004] AML1-ETO Decreases ETO-2 (MTG16) Interactions with Nuclear Receptor Corepressor, an Effect That Impairs Granulocyte Differentiation Vinzon Iban˜ez,1 Arun Sharma,1 Silvia Buonamici,1 Amit Verma,1 Sudhakar Kalakonda,3 Jianxiang Wang,4 ShriHari Kadkol,2 and Yogen Saunthararajah1 1Section of Hematology/Oncology, Department of Medicine, and 2Department of Pathology, University of Illinois, Chicago, Illinois; 3Department of Ophthalmology, University of Maryland, Baltimore, Maryland; and 4Laboratory of Hematological Malignancy, State Key Laboratory of Experimental Hematology, Institute of Hematology, Chinese Academy of Medical Sciences ABSTRACT mology domain. NHR2 is an amphipathic helix structure that mediates homodimerization and binding of ETO to homologous family mem- The t(8;21) chromosome abnormality in acute myeloid leukemia targets bers (2). NHR3 is a coiled-coiled region that plays a role in interac- the AML1 and ETO genes to produce the leukemia fusion protein AML1- tions with N-CoR (3). NHR4 contains two MYND zinc finger motifs, ETO. Another member of the ETO family, ETO-2/MTG16, is highly which are necessary for binding to N-CoR (3–7); it is also known as expressed in murine and human hematopoietic cells, bears >75% homol- ogy to ETO, and like ETO, contains a conserved MYND domain that the MYND domain. interacts with the nuclear receptor corepressor (N-CoR). AML1-ETO ETO-2, like ETO, demonstrates corepressor function (8). This prevents granulocyte but not macrophage differentiation of murine function is likely to be mediated through the interactions of ETO-2 32Dcl3 granulocyte/macrophage progenitors. One possible mechanism with histone deacetylases 1, 2, 3, 6, and 8 and the ubiquitously is recruitment of N-CoR to aberrantly repress AML1 target genes.
    [Show full text]
  • Targeted Inhibition of the Plasmodium Falciparum Vitamin B6 Producing Enzyme Pdx1 and the Biochemical and Functional Consequences Thereof
    Targeted inhibition of the Plasmodium falciparum Vitamin B6 producing enzyme Pdx1 and the biochemical and functional consequences thereof Shaun Bernard Reeksting Submitted in partial fulfilment of the requirements for the degree Philosophiae Doctor in the Faculty of Natural and Agricultural Sciences Department of Biochemistry University of Pretoria South Africa June 2013 © University of Pretoria Submission declaration I, Shaun Bernard Reeksting, declare that this thesis, which I hereby submit for the degree Philosophiae Doctor in the Department of Biochemistry, at the University of Pretoria, is my own work and has not previously been submitted by me for a degree at this or any other tertiary institution. Signature: …………………………… Date: ………………………… ii © University of Pretoria Plagiarism declaration I understand what plagiarism is and am aware of the University‘s policy in this regard. I declare that this thesis is my own original work. Where other people‘s work has been used (either from printed source, internet or any other source), this has been properly acknowledged and referenced in accordance with departmental regulations. I have not used work previously produced by another student or any other person to hand in as my own. I have not allowed and will not allow anyone to copy my work with the intention of passing it off as his or her own work. Student‘s signature Date iii © University of Pretoria Summary Malaria is caused by the parasite Plasmodium falciparum and still plagues many parts of the world. To date, efforts to control the spread of the parasites have been largely ineffective. Due to development of resistance by the parasites to current therapeutics there is an urgent need for new classes of therapeutics.
    [Show full text]
  • Suppression of Neuroblastoma Tumorigenesis Using Enu Mutagenesis in the Th-Mycn Mouse Model of Neuroblastoma
    SUPPRESSION OF NEUROBLASTOMA TUMORIGENESIS USING ENU MUTAGENESIS IN THE TH-MYCN MOUSE MODEL OF NEUROBLASTOMA A thesis submitted to the University of New South Wales in fulfilment of the requirements for the degree of Doctor of Philosophy Jayne Murray Children’s Cancer Institute and School of Women’s and Children’s Health Faculty of Medicine University of New South Wales December 2017 i THESIS/DISSERTION SHEET PLEASE TYPE THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: Murray First name: Jayne Other name/s: Elizabeth Abbreviation for degree as given in the University calendar: PhD School: School of Women’s and Children’s Health Faculty: Faculty of Medicine Title: Suppression of neuroblastoma tumorigenesis using ENU mutagenesis in the Th-MYCN mouse model of neuroblastoma Abstract 350 words maximum: (PLEASE TYPE) Neuroblastoma, a disease of the neural crest and the most common solid tumour of infancy, accounts for 7-10% of all childhood cancer. The disease arises from primitive cells within the neural crest, and can develop at any point along the sympathetic nervous system, including sites within the abdomen, pelvis, neck and thoracic cavity. Neuroblastoma tumours with MYCN oncogene amplification are highly aggressive, leading to a dismal outcome in most patients. A mouse model of neuroblastoma previously generated by targeting the human MYCN oncogene to neural crest cells (Th-MYCN), leads to 100% of MYCN homozygous mice developing tumours at an early age. This thesis describes a forward genetic screen involving the use of N-ethyl-N-nitrosourea (ENU) to generate heritable mutations causing delayed tumorigenesis in this model, as well as genomic sequencing to identify the mutated gene(s) responsible for the delayed tumorigenesis observed.
    [Show full text]
  • (12) Patent Applicatio in Publication (10) Pub
    US 20070202 107A1 (19) United States (12) Patent Applicatio in Publication (10) Pub. No.: US 2007/0202107 A1 Whyte et al. (43) Pub. Date: Aug. 30, 2007 (54) NOVEL KINASES Publication Classification (75) Inventors: Davids Whyte, Belmont, CA (US); (51) Int . Cl. Gerard Manning, Menlo Park, CA A6IK 38/55 (2006.01) (US): Sean Caenepeel, Walnut Creek, CI2O I/68 (2006.01) CA (US) GOIN 33/574 (2006.01) C07H 21/04 (2006.01) Correspondence Address: CI2P 21/06 (2006.01) FOLEY AND LARDNER LLP A61 K 39/395 (2006.01) SUTE 500 CI2N 9/12 (2006.01) 3000 K STREET NW (52) U.S. Cl. .................... 424/146.1; 435/723: 435/69.1; WASHINGTON, DC 20007 (US) 435/194; 435/320.1; 435/325: 9 514/2; 530/388.26; 536/23.2; (73) Assignee: Sugen, Inc. 435/6 21) Appl. No.: 11/407,888 (21) App (57) ABSTRACT (22) Filed: Apr. 21, 2006 Related U.S. ApplicationO Data Theotide present sequences invention encoding relates the kinaseto kinase polypeptides, polypeptides, as wellnucle R he diagnosis an (62) Pig- - - of applit N 10/618,941,10 filede on Jul. varioustreatment products of various and kinase-related methods useful diseases for t and conditions.gnosis s , no Through the use of a bioinformatics strategy, mammalian (60) Provisional application No. 60/395,632, filed on Jul. members of the of PTK's and STK's have been identified 15, 2002. and their protein structure predicted. >CRIKH SEQID#NA GAACCCATTGCCAGCCGGGCCTCCAGGCTGAATCTGTTCTTCCAGGGGAAACCACCCTTTATGACTCAACAGCAGATGTCTCCTCTTTCCCGAGAAGGGATAGGGCGGAACAGATCGCAGACCTGGGGGTTCGCAGAGCCGCCAGTGGGGAGATGTTGAAGTTCAAATATGGAGCGCGGAATCCTTTGGATGCTGGTGCTGCT
    [Show full text]
  • A New Gene Inventory of the Ubiquitin and Ubiquitin-Like Conjugation Pathways in Giardia Intestinalis
    ORIGINAL ARTICLE Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 115: e190242, 2020 1|12 A new gene inventory of the ubiquitin and ubiquitin-like conjugation pathways in Giardia intestinalis Isabel Cristina Castellanos1, Eliana Patricia Calvo2/+, Moisés Wasserman3 1Universidad Escuela de Administración de Negocios, Departamento de Ciencias Básicas, Bogotá, Colombia 2Universidad El Bosque, Laboratorio de Virología, Bogotá, Colombia 3Universidad Nacional de Colombia, Laboratorio de Investigaciones Básicas en Bioquímica, Bogotá, Colombia BACKGROUND Ubiquitin (Ub) and Ub-like proteins (Ub-L) are critical regulators of complex cellular processes such as the cell cycle, DNA repair, transcription, chromatin remodeling, signal translation, and protein degradation. Giardia intestinalis possesses an experimentally proven Ub-conjugation system; however, a limited number of enzymes involved in this process were identified using basic local alignment search tool (BLAST). This is due to the limitations of BLAST’s ability to identify homologous functional regions when similarity between the sequences dips to < 30%. In addition Ub-Ls and their conjugating enzymes have not been fully elucidated in Giardia. OBJETIVE To identify the enzymes involved in the Ub and Ub-Ls conjugation processes using intelligent systems based on the hidden Markov models (HMMs). METHODS We performed an HMM search of functional Pfam domains found in the key enzymes of these pathways in Giardia’s proteome. Each open reading frame identified was analysed by sequence homology, domain architecture, and transcription levels. FINDINGS We identified 118 genes, 106 of which corresponded to the ubiquitination process (Ub, E1, E2, E3, and DUB enzymes). The E3 ligase group was the largest group with 82 members; 71 of which harbored a characteristic RING domain.
    [Show full text]
  • Characterization of the Protein Lysine Methyltransferase Smyd2
    CHARACTERIZATION OF THE PROTEIN LYSINE METHYLTRANSFERASE SMYD2 Sylvain Lanouette Thesis submitted to the Faculty of Graduate and Postdoctoral Studies in partial fulfillment of the requirements for the Doctorate in Philosophy degree in Biochemistry Department of Biochemistry, Microbiology and Immunology Faculty of Medicine University of Ottawa © Sylvain Lanouette, Ottawa, Canada, 2015 ABSTRACT Our understanding of protein lysine methyltransferases and their substrates remains limited despite their importance as regulators of the proteome. The SMYD (SET and MYND domain) methyltransferase family plays pivotal roles in various cellular processes, including transcriptional regulation and embryonic development. Among them, SMYD2 is associated with oesophageal squamous cell carcinoma, bladder cancer and leukemia as well as with embryonic development. Initially identified as a histone methyltransferase, SMYD2 was later reported to methylate p53, the retinoblastoma protein pRb and the estrogen receptor ER and to regulate their activityOur proteomic and biochemical analyses demonstrated that SMYD2 also methylates the molecular chaperone HSP90 on K209 and K615. We also showed that HSP90 methylation is regulated by HSP90 co-chaperones, pH, and the demethylase LSD1. Further methyltransferase assays demonstrated that SMYD2 methylates lysine K* in proteins which include the sequence [LFM]-₁-K*-[AFYMSHRK]+₁-[LYK]+₂. This motif allowed us to show that SMYD2 methylates the transcriptional co-repressor SIN3B, the RNA helicase DHX15 and the myogenic transcription factors SIX1 and SIX2. Finally, muscle cell models suggest that SMYD2 methyltransferase activity plays a role in preventing premature myogenic differentiation of proliferating myoblasts by repressing muscle-specific genes. Our work thus shows that SMYD2 methyltransferase activity targets a broad array of substrates in vitro and in situ and is regulated by intricate mechanisms.
    [Show full text]
  • Full Text (PDF)
    Int. J. Dev. Biol. 53: 335-354 (2009) DEVELOPMENTALTHE INTERNATIONAL JOURNAL OF doi: 10.1387/ijdb.082717ph BIOLOGY www.intjdevbiol.com Mechanisms of transcriptional repression by histone lysine methylation PHILIP HUBLITZ#, MAREIKE ALBERT## and ANTOINE H.F.M. PETERS* Friedrich Miescher Institute for Biomedical Research, Basel, Switzerland ABSTRACT During development, covalent modification of both, histones and DNA contribute to the specification and maintenance of cell identity. Repressive modifications are thought to stabilize cell type specific gene expression patterns, reducing the likelihood of reactivation of lineage-unrelated genes. In this report, we review the recent literature to deduce mechanisms underlying Polycomb and H3K9 methylation mediated repression, and describe the functional interplay with activating H3K4 methylation. We summarize recent data that indicate a close relationship between GC density of promoter sequences, transcription factor binding and the antagonizing activities of distinct epigenetic regulators such as histone methyltransferases (HMTs) and histone demethylases (HDMs). Subsequently, we compare chromatin signatures associated with different types of transcriptional outcomes from stable repression to highly dynamic regulated genes, strongly suggesting that the interplay of different epigenetic pathways is essential in defining specific types of heritable chromatin and associated transcriptional states. KEY WORDS: transcriptional control, histone lysine methylation, methyltransferase, demethylase, polycomb Genetic and epigenetic mechanisms ensure that complex devel- transcription factor occupancy in relation to transcriptional ON opmental programs are correctly executed. One important post- and OFF states. We mainly focus on the dynamics of activating translational modification that regulates transcriptional outcomes, H3K4 and repressive H3K27 methylation marks at promoter genome integrity and cellular identity is histone lysine methyla- sequences.
    [Show full text]