(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau „ (10) International Publication Number (43) International Publication Date Χ t it t t l December 20ll (0l.l2.20ll) 2U11/15U1U5 A2

(51) International Patent Classification: MAN, Karen B. [US/US]; 308 Ashton Lane, Mill Valley, CI2P 21/06 (2006.01) California 94941 (US). (21) International Application Number: (74) Agent: SCHERER, David C ; Bozicevic, Field & Fran PCT/US201 1/037969 cis LLP, 1900 University Avenue, Suite 200, East Palo Alto, California 94303 (US). (22) International Filing Date: 25 May 201 1 (25.05.201 1) (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, (25) Filing Language: English AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, (26) Publication Language: English CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (30) Priority Data: HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, 61/349,081 27 May 2010 (27.05.2010) US KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, 61/379,321 1 September 2010 (01 .09.2010) US ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, 61/383,679 16 September 2010 (16.09.2010) us NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, 61/415,321 18 November 2010 (18.1 1.2010) us SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/426,301 22 December 2010 (22.12.2010) us TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (71) Applicant (for all designated States except US): BIO- (84) Designated States (unless otherwise indicated, for every TIME INC. [US/US]; 1301 Harbor Bay Parkway, kind of regional protection available): ARIPO (BW, GH, Alameda, California 94502 (US). GM, KE, LR, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, (72) Inventors; and ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, (75) Inventors/ Applicants (for US only): WEST, Michael D. TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, [US/US]; 308 Ashton Lane, Mill Valley, California EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, 9494 1 (US). STERNBERG, Hal [US/US]; 1735 Spruce LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Street, #4, Berkeley, California 94709 (US). CHAP¬ SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG).

[Continued on next page]

(54) Title: IMPROVED METHODS OF SCREENING EMBRYONIC PROGENITOR CELL LINES (57) Abstract: Aspects of the present invention include methods and compositions related to the production and use of numerous clonal lineages of embryonic progenitor cell lines derived from differentiating cultures of primor = dial stem cells with diverse molecular markers and having been cultured for > 2 1 doublings of clonal expansion. The robustness of these clonally-purified lines, their abil ity to expand for >40 passages while maintaining their ------pattern of gene expression, lack of tumorigenicity, and their embryonic pattern of gene expression offers novel compositions and methods for modeling numerous differ = entiation pathways for the first time in vitro, and for the manufacture of purified product not existing in such a pu = rified state in nature or using other manufacturing modal ≡ ities. Representative progenitor cell lines described herein are capable of development into cutaneous adipocytes, blood-brain barrier cells, neuronal cells, or smooth mus cle cells each with therapeutic potential. < © o

Fig. 1

o w o 2011/150105 A2 1II 11 II II 11 I III I I II I III I III I III II I II

s e — with sequence listing part of description (Rule 5.2(a)) — without international search report and to be republished upon receipt of that report (Rule 48.2(g)) IMPROVED METHODS OF SCREENING EMBRYONIC PROGENITOR CELL LINES

BACKGROUND Advances in stem cell technology, such as the isolation and propagation in vitro of primordial stem cells, including embryonic stem cells ("ES" cells including human ES cells ("hES" cells)) and related primordial stem cells including but not limited to, iPS, EG, EC, ICM, epiblast, or ED cells (including human iPS, EG, EC, ICM, epiblast, or ED cells), constitute an important new area of medical research. hES cells have a demonstrated potential to be propagated in the undifferentiated state and then to be induced subsequently to differentiate into likely any and all of the cell types in the human body, including complex tissues. In addition, many of these primordial stem cells are naturally telomerase positive in the undifferentiated state, thereby allowing the cells to be expanded indefinately. This expansion potential allows these primordial cells to be genetically modified followed by clonal expansion, thus permittting the production of numerous homogeneous populations of genetically modified primordial stem cells. Since the telomere length of many of these cells is comparable to that observed in sperm DNA (approximately 10-18 kb TRF length), differentiated cells derived from these immortal lines once they begin differentiation (generally associated with the repression of the expression of the catalytic component of telomerase (TERT)) display a long initial telomere length providing the cells with a long replicative capacity compared to fetal or adult-derived tissue. This has led to the suggestion that many diseases resulting from the dysfunction of cells may be amenable to treatment by the administration of hES-derived cells of various differentiated types (Thomson et al., Science 282:1145-1147 (1998)). Nuclear transfer studies have demonstrated that it is possible to transform a somatic differentiated cell back to a primordial stem cell state such as that of embryonic stem ("ES") cells (Cibelli et al., Nature Biotech 16:642-646 (1998)) or embryo-derived ("ED") cells. The development of technologies to reprogram somatic cells back to a totipotent ES cell state, such as by the transfer of the genome of the somatic cell to an enucleated oocyte and the subsequent culture of the reconstructed embryo to yield ES cells, often referred to as somatic cell nuclear transfer ("SCNT") or through analytical reprogramming technology, offers methods to transplant ES-derived somatic cells with a nuclear genotype of the patient (Lanza et al, Nature Medicine 5:975-977 (1999)). In addition to SCNT, other techniques exist to address the problem of transplant rejection, including the use of gynogenesis and androgenesis (see U.S. application nos. 60/161,987, filed October 28, 1999; 09/697,297, filed October 27, 2000; 09/995,659, filed November 29, 2001; 10/374,512, filed February 27, 2003; PCT application no. PCT/USOO/29551, filed October 27, 2000; the disclosures of which are incorporated by reference in their entirety). In the case of a type of gynogenesis designated parthenogenesis, pluripotent stem cells may be manufactured without antigens foreign to the gamete donor and therefore useful in manufacturin g cells that can be transplanted without rejection. In addition, parthenogenic stem cell lines can be assembled into a bank of cell lines homozygous in the HLA region (or corresponding MHC region of nonhuman animals) to reduce the complexity of a stem cell bank in regard to HLA haplotypes. In addition, cell lines or a bank of said cell lines can be produced that are hemizygous in the HLA region (or corresponding MHC region of nonhuman animals; see PCT application Ser. No. PCT/US2006/040985 filed October 20, 2006 entitled "Totipotent, Nearly Totipotent or Pluripotent Mammalian Cells Homozygous or Hemizygous for One or More Histocompatibility Antigen Genes", incorporated herein by reference). A bank of hemizygous cell lines provides the advantage of not only reducing the complexity inherent in the normal mammalian MHC gene pool, but it also reduces the gene dosage of the antigens to reduce the expression of said antigens without eliminating their expression entirely, thereby not stimulating a natural killer response. In addition to SCNT, parthenogenesis, and the construction of banks of cells with homozygous or hemizygous HLA alleles, other techniques exist to address the problem of transplant rejection, including the use of technologies to reprogram somatic cells using transcriptional regulators (see PCT application Ser. No. PCT/US2006/030632 filed on August 3, 2006 and titled "Improved Methods of Reprogramming Animal Somatic Cells", incorporated herein by reference). In regard to differentiating primordial stem cells into desired cell types, the potential to clonally isolate lines of human embryonic progenitor (hEP) cell lines provides a means to propagate novel highly purified cell lineages useful in the production of diverse secreted factors, for research, and for the manufacture of cell-based therapies (see PCT application Ser. No. PCT/US2006/013519 filed on April 11, 2006 and titled "Novel Uses of Cells With Prenatal Patterns of Gene Expression"; U.S. patent application Ser. No. 11/604,047 filed on November 21, 2006 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby"; and U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", each incorporated herein by reference). Nevertheless, there remains a need for improved methods to discover the differentiation potential of said hEP cell lines when exposed to diverse differentiation-inducing factors or other differentiation conditions that induce such differentiation under conditions which are compatible in either a general laboratory setting or in a good manufacturing processes ("GMP") cell manufacturing facility where there is adequate documentation as to the purity and genetic normality of the cells at advanced passages (>1 8-21 doublings of clonal expansion).

SUMMARY OF THE INVENTION We have previously demonstrated that the long initial telomere length of hES cells, together with the unexpected robust proliferative capacity of primitive hES-derived progenitor cell types, facilitates the industrial expansion and characterization of >140 diverse and scalable clonal lineages with diverse defined homeobox gene expression as well as diverse transcriptional regulators (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, incorporated herein by reference, including supplemental information; and U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety). The robustness of these clonally-purified lines, their ability to expand for >40 passages while maintaining their pattern of gene expression, lack of tumorigenicity, and their embryonic pattern of gene expression offers novel compositions and methods for modeling numerous differentiation pathways for the first time in vitro, and for the manufacture of purified product not existing in such a purified state in nature or using other manufacturing modalities. We disclose novel compositions and methods related to these cells, including novel screening methods and conditions that differentiate human embryonic progenitors into numerous terminally-differentiated cell types of use in medical research and therapy.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1: Levels of induction of COL2A1 in assayed lines before and after 14 days of chondrogenic micromass conditions. Figure 2 : An example of the Safranin O staining of adipose tissue stem cells compared to the lines 4D20.8 at passage 14 compared to MSCs at passage 6 all at day 2 1 of differentiation as a pellet and immunostaining with isotype controls in day 14 pellets of the line 4D20.8 and MSCs. Figure 3: Comparison of endothelial tubes fomed by HUVECs and the line W10.

DETAILED DESCRIPTION O F THE INVENTION Abbreviations AFP Alpha fetoprotein BMP Bone Morphogenic Protein BRL Buffalo rat liver BSA Bovine serum albumin CD Cluster Designation cGMP Current Good Manufacturing Processes CNS Central Nervous System DMEM Dulbecco's modified Eagle's medium DMSO Dimethyl sulphoxide DPBS Dulbecco's Phosphate Buffered Saline EC Embryonal carcinoma EC Cells Embryonal carcinoma cells; hEC cells are human embryonal carcinoma cells ECAPCs Embryonic cutaneous adipocyte progenitor cells ECM - Extracellular Matrix ED Cells - Embryo-derived cells; hED cells are human ED cells EDTA - Ethylenediamine tetraacetic acid EG Cells - Embryonic germ cells; hEG cells are human EG cells EP Cells - Embryonic progenitor cells are cells derived from primordial stem cells that are more differentiated than primordial stem cells, in that they no longer display markers such as SSEA4, TRAl-60 or TRA-1-81 seropositivity in the case of the human species, but have not fully differentiated. Embryonic progenitor cells correspond to the embryonic stages as opposed to the postnatal stage of development. ES Cells - Embryonic stem cells; hES cells are human ES cells FACS - Fluorescence activated cell sorting FBS - Fetal bovine serum GFP - Green Fluorescent Protein GMP - Good Manufacturing Practices hED Cells - Human embryo-derived cells hEG Cells - Human embryonic germ cells are stem cells derived from the primordial germ cells of fetal tissue. hEP Cells - Human embryonic progenitor cells are embryonic progenitor cells from the human species. hiPS Cells - Human induced pluripotent stem cells are cells with properties similar to hES cells obtained from somatic cells after exposure to hES-specific transcription factors such as SOX2, KLF4, OCT4, MYC, or NANOG, LIN28, OCT4, and SOX2, HSE - Human skin equivalents are mixtures of cells and biological or synthetic matrices manufactured for testing purposes or for therapeutic application in promoting wound repair. HUVEC - Human umbilical vein endothelial cell ICM - Inner cell mass of the mammalian blastocyst-stage embryo. iPS Cells - Induced pluripotent stem cells are cells with properties similar to hES cells obtained from somatic cells after exposure to ES-specific transcription factors such as SOX2, KLF4, OCT4, MYC, or NANOG, LIN28, OCT4, and SOX2. LOH - Loss of Heterozygosity MEM - Minimal essential medium miRNA - Micro RNA NT - Nuclear Transfer PBS - Phosphate buffered saline PS fibroblasts - Pre-scarring fibroblasts are fibroblasts derived from the skin of early gestational skin or derived from ED cells that display a prenatal pattern of gene expression in that they promote the rapid healing of dermal wounds without scar formation. RA - Retinoic acid RFU - Relative Fluorescence Units SCNT - Somatic Cell Nuclear Transfer SFM - Serum-Free Medium SPF - Specific Pathogen-Free SV40 - Simian Virus 40 Tag - Large T-antigen T-EDTA - Trypsin EDTA

Definitions The term "analytical reprogramming technology" refers to a variety of methods to reprogram the pattern of gene expression of a somatic cell to that of a more pluripotent state, such as that of an iPS, ES, ED, EC or EG cell, wherein the reprogramming occurs in multiple and discrete steps and does not rely simply on the transfer of a somatic cell into an oocyte and the activation of that oocyte (see U.S. application nos. 60/332,5 10, filed November 26, 2001 ; 10/304,020, filed November 26, 2002; PCT application no. PCT/US02/37899, filed November 26, 2003; U.S. application no. 60/705625, filed August 3, 2005; U.S. application no. 60/729173, filed August 20, 2005; U.S. application no. 60/818813, filed July 5, 2006, PCT/US06/30632, filed August 3, 2006, the disclosure of each of which is incorporated by reference herein). The term "blastomere/morula cells" refers to blastomere or morula cells in a mammalian embryo or blastomere or morula cells cultured in vitro with or without additional cells including differentiated derivatives of those cells. The term "cell expressing gene X", "gene X is expressed in a cell" (or cell population), or equivalents thereof, means that analysis of the cell using a specific assay platform provided a positive result. The converse is also true (i.e., by a cell not expressing gene X, or equivalents, is meant that analysis of the cell using a specific assay platform provided a negative result). Thus, any gene expression result described herein is tied to the specific probe or probes employed in the assay platform (or platforms) for the gene indicated. The term "cell line" refers to a mortal or immortal population of cells that is capable of propagation and expansion in vitro. The term "cellular reconstitution" refers to the transfer of a nucleus of chromatin to cellular cytoplasm so as to obtain a functional cell. The term "clonal" refers to a population of cells obtained the expansion of a single cell into a population of cells all derived from that original single cells and not containing other cells. The term "colony in situ differentiation" refers to the differentiation of colonies of cells (e.g., hES, hEG, hiPS, hEC or hED) in situ without removing or disaggregating the colonies from the culture vessel in which the colonies were propagated as undifferentiated stem cell lines. Colony in situ differentiation does not utilize the intermediate step of forming embryoid bodies, though embryoid body formation or other aggregation techniques such as the use of spinner culture may nevertheless follow a period of colony in situ differentiation. The term "cytoplasmic bleb" refers to the cytoplasm of a cell bound by an intact or permeabilized but otherwise intact plasma membrane, but lacking a nucleus. The term "differentiated cells" when used in reference to cells made by methods of this invention from pluripotent stem cells refer to cells having reduced potential to differentiate when compared to the parent pluripotent stem cells. The differentiated cells of this invention comprise cells that could differentiate further (i.e., they may not be terminally differentiated). The term "direct differentiation" refers to process of differentiating: blastomere cells, morula cells, ICM cells, ED cells, or somatic cells reprogrammed to an undifferentiated state (such as in the process of making iPS cells but before such cells have been purified in an undifferentiated state) directly without the intermediate state of propagating isolated undifferentiated stem cells such as hES cells as undifferentiated cell lines. A nonlimiting example of direct differentiation would be the culture of an intact human blastocyst into culture and the derivation of ED cells without the generation of a human ES cell line as was described (Bongso et al, 1994. Human Reproduction 9:2110). The term "embryonic stem cells" (ES cells) refers to cells derived from the inner cell mass of blastocysts, blastomeres, or morulae that have been serially passaged as cell lines while maintaining an undifferentiated state (e.g. expressing TERT, OCT4, and SSEA and TRA antigens specific for ES cells of the species). The ES cells may be derived from fertilization of an egg cell with sperm or DNA, nuclear transfer, parthenogenesis, or by means to generate hES cells with hemizygosity or homozygosity in the MHC region. While ES cells have historically been defined as cells capable of differentiating into all of the somatic cell types as well as germ line when transplanted into a preimplantation embryo, candidate ES cultures from many species, including human, have a more flattened appearance in culture and typically do not contribute to germ line differentiation, and are therefore called "ES-like cells." It is commonly believed that human ES cells are in reality "ES-like", however, in this application we will use the term ES cells to refer to both ES and ES-like cell lines. The term "histotypic culture" refers to cultured cells that are aggregated to create a three- dimensional structure with tissue-like cell density such as occurs in the culture of some cells over a layer of agar or such as occurs when cells are cultured in three dimensions in a collagen gel, sponge, or other polymers such as are commonly used in tissue engineering. The term "human embryo-derived" ("hED") cells refers to blastomere -derived cells, morula- derived cells, blastocyst-derived cells including those of the inner cell mass, embryonic shield, or epiblast, or other totipotent or pluripotent stem cells of the early embryo, including primitive endoderm, ectoderm, mesoderm, and neural crest and their derivatives up to a state of differentiation correlating to the equivalent of the first eight weeks of normal human development, but excluding cells derived from hES cells that have been passaged as cell lines (see, e.g., U.S. Patents 7,582,479; 7,217,569; 6,887,706; 6,602,711; 6,280,718; and 5,843,780 to Thomson, incorporated herein by reference). The hED cells may be derived from preimplantation embryos produced by fertilization of an egg cell with sperm or DNA, nuclear transfer, or chromatin transfer, an egg cell induced to form a parthenote through parthenogenesis, analytical reprogramrning technology, or by means to generate hES cells with hemizygosity or homozygosity in the HLA region. The term "human embryonic germ cells" (hEG cells) refer to pluripotent stem cells derived from the primordial germ cells of fetal tissue or maturing or mature germ cells such as oocytes and spermatogonial cells, that can differentiate into various tissues in the body. The hEG cells may also be derived from pluripotent stem cells produced by gynogenetic or androgenetic means, i.e., methods wherein the pluripotent cells are derived from oocytes containing only DNA of male or female origin and therefore will comprise all female-derived or male-derived DNA (see U.S. application nos. 60/161,987, filed October 28, 1999; 09/697,297, filed October 27, 2000; 09/995,659, filed November 29,2001 ; 10/374,5 12, filed February 27, 2003; PCT application no. PCT/US/00/2955 1, filed October 27, 2000; the disclosures of which are incorporated herein in their entirety). The term "human embryonic stem cells" (hES cells) refers to human ES cells. The term "human iPS cells" refers to cells with properties similar to hES cells, including the ability to form all three germ layers when transplanted into immunocompromised mice wherein said iPS cells are derived from cells of varied somatic cell lineages following exposure to de- differentiation factors, for example hES cell-specific transcription factor combinations: KLF4, SOX2, MYC, and OCT4 or SOX2, OCT4, NANOG, and LIN28. Any convenient combination of de- differentiation factors may be used to produce iPS cells. Said iPS cells may be produced by the expression of these genes through vectors such as retroviral, lentiviral or adenoviral vectors as is known in the art, or through the introduction of the factors as proteins, e.g., by permeabilization or other technologies. For descriptions of such exemplary methods see: PCT application number PCT/US2006/030632, filed on August 3, 2006; U.S. Application Ser. No. 11/989,988; PCT Application PCT/US2000/0 18063, filed on June 30, 2000; U.S. Applciation Ser. No. 09,736,268 filed on December 15, 2000; U.S. Applciation Ser. No. 10/831,599, filed April 23, 2004; and U.S. Patent Publication 20020142397 (App. Ser. No. 10/015,824, entitled "Methods for Altering Cell Fate"); U.S. Patent Publication 20050014258 (App. Ser. No. 10/910,156, entitled "Methods for Altering Cell Fate"); U.S. Patent Publication 20030046722 (App. Ser. No. 10/032,191, entitled "Methods for cloning mammals using reprogrammed donor chromatin or donor cells"); and U.S. Patent Publication 20060212952 (App. Ser. No. 11/439,788, entitled "Methods for cloning mammals using reprogrammed donor chromatin or donor cells") all of which are incorporated herein by reference in their entirety. The term "ICM cells" refers to the cells of the inner cell mass of a mammalian embryo or the cells of the inner cell mass cultured in vitro with or without the surrounding trophectodermal cells. The term "oligoclonal" refers to a population of cells that originated from a small population of cells, typically 2-1000 cells, that appear to share similar characteristics such as morphology or the presence or absence of markers of differentiation that differ from those of other cells in the same culture. Oligoclonal cells are isolated from cells that do not share these common characteristics, and are allowed to proliferate, generating a population of cells that are essentially entirely derived from the original population of similar cells. The term "organotypic culture" refers to cultured cells that are aggregated to create a three- dimensional structure with tissue-like cell density such as occurs in the culture of some cells over a layer of agar, cultured as teratomas in an animal, otherwise grown in a three dimensional culture system but wherein said aggregated cells contain cells of different cell lineages, such as, by way of nonlimiting examples, the combination of epidermal keratinocytes and dermal fibroblasts, or the combination of parenchymal cells with their corresponding tissue stroma, or epithelial cells with mesenchymal cells. The term "pluripotent stem cells" refers to animal cells capable of differentiating into more than one differentiated cell type. Such cells include hES cells, blastomere/morula cells and their derived hED cells, hiPS cells, hEG cells, hEC cells, and adult-derived cells including mesenchymal stem cells, neuronal stem cells, and bone marrow-derived stem cells. Pluripotent stem cells may be genetically modified or not genetically modified. Genetically modified cells may include markers such as fluorescent proteins to facilitate their identification within the egg. The term "pooled clonal" refers to a population of cells obtained by combining two or more clonal populations to generate a population of cells with a uniformity of markers such as markers of gene expression, similar to a clonal population, but not a population wherein all the cells were derived from the same original clone. Said pooled clonal lines may include cells of a single or mixed genotypes. Pooled clonal lines are especially useful in the cases where clonal lines differentiate relatively early or alter in an undesirable way early in their proliferative lifespan. The term "primordial stem cells" refers to animal cells capable of differentiating into more than one differentiated cell type. Such cells include hES cells, blastomere/morula cells and their derived hED cells, hiPS cells, hEG cells, hEC cells, and adult-derived cells including mesenchymal stem cells, neuronal stem cells, and bone marrow-derived stem cells. Primordial stem cells may be genetically modified or not genetically modified. Genetically modified cells may include markers such as fluorescent proteins to facilitate their identification in vitro or in vivo. Before the present invention is described in greater detail, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention. Certain ranges are presented herein with numerical values being preceded by the term "about." The term "about" is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative illustrative methods and materials are now described. All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed. It is noted that, as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation. As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.

METHODS In addition to the methods described below, methods that find use in the production and use of the cell lines described herein can be found in the following: U.S. Patent Publication 20080070303, entitled "Methods to accelerate the isolation of novel cell strains from pluripotent stem cells and cells obtained thereby"; U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby"; U.S. provisional application Ser. No. 61/226,237 filed on July 16, 2009 and titled "Methods and Compositions Useful for In Vitro and In Vivo Chondrogenesis Using Embryonic Progenitor Cell Lines"; and PCT Application PCT/US2006/013519, filed on April 11, 2006, entitled "NOVEL USES OF CELLS WITH PRENATAL PATTERNS OF GENE EXPRESSION", each of which is incorporated by reference herein in its entirety. hES cell culture and generation of candidate cultures. The hES cell lines used were previously described H9 (National Institutes of Health- registered as WA09) and the line (MA03) derived at Advanced Cell Technology (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308). hES cells were routinely cultured in hES medium (KO-DMEM (Invitrogen, Carlsbad, CA), IX nonessential amino acids (Invitrogen, Carlsbad, CA), IX Glutamax-1 (Invitrogen, Carlsbad, CA), 55 uM beta-mercaptoethanol (Invitrogen, Carlsbad, CA), 8% Knock-Out Serum Replacement (Invitrogen, Carlsbad, CA), 8% Plasmanate, 10 ng/ml LIF (Millipore, Billerica, MA), 4 ng/ml bFGF (Millipore, Billerica, MA), 50 unit/ml Penicillin - 50 units/ml Streptomycin (Invitrogen, Carlsbad, CA). The hES cell lines were maintained at 37deg C in an atmosphere of 10% C02 and 5% 0 2 on Mitomycin-C treated mouse embryonic fibroblasts (MEFs) and passaged by trypsinization or periodic manual selection of colonies. For the production of clonal embryonic progenitors, hES cells were plated at 500-10,000 cells per 15 cm dish and then differentiated under a two-step protocol, the first step being the differentiation of hES cells under an array of conditions to yield diverse heterogeneous cultures of cells called "candidate cultures." The generation of candidate cultures was performed with either adherent hES cells grown on MEFs (colony in situ differentiation) or with hES-derived embryoid bodies (EB). For colony in situ differentiation experiments, hES cells were allowed to grow to confluence and differentiated by a variety of methods (as described in Supplementary Table I from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety). By way of nonlimiting example, in the case of colony in situ differentiation in DMEM with 10% FCS, culture medium was aspirated from cultures of hES cell colonies on mouse feeders, and the media was replaced with DMEM medium containing 10% FBS for differentiation and after various time periods (1, 2, 3, 4, 5, 7, and 9 days in differentiation medium). The cells were then dissociated with 0.25% trypsin (Invitrogen, Carlsbad, CA) and plated in 150 cm2 flasks for expansion. The candidate cells from each time point in the 150 cm2 flasks were plated out for cloning and expansion as described below. For EB differentiation experiments, confluent hES cultures were treated for 15 minutes at 37 deg C with 1 mg/ml Collagenase IV (in DMEM, Invitrogen, Carlsbad, CA) to release the colonies. The detached, intact colonies were scraped and collected by centrifugation (150xg for 5 minutes), resuspended in differentiation medium described in Supplementary Table I (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) and transferred to a single well of a 6-well Ultra-Low Binding plate (Corning, distributed by Fisher Scientific, Pittsburgh, PA) containing the same differentiation medium. The Ebs were allowed to differentiate, depending on the experiment, from 4-7 days and the differentiated Ebs dissociated with 0.25% trypsin, plated in 6-well plates containing various expansion medium. The candidate cultures in the 6 well plates are allowed to grow to confluence and plated out for cloning and expansion as described below.

Isolation and expansion of clonal cell lines. The partially differentiated candidate cell cultures described above were dissociated with 0.25% trypsin to single cells and plated onto duplicate 15 cm gelatin coated plates at cloning densities of approximately 500 and/or 1,000 and/or 2,000 and/or 5,000 cells per plate for further differentiation and expansion in a variety of growth media shown in Supplementary Table I (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety). The clonal density cells were allowed to grow, undisturbed, for 10-14 days and colonies that develop were identified and collected with cloning cylinders and trypsin using standard techniques. The cloned colonies were transferred onto gelatin-coated 24 well plates for expansion. As the clones become confluent in the 24 well plates (but without letting the cells remain confluent for more than 2 days), they were sequentially expanded to 12 well, 6 well, T-25 flask, T-75 flask, T- 150 or T-225 flasks and, finally, roller bottles. Clonal cell lines that expand to the roller bottle stage are assigned a unique ACTC identification number, photographed and cryopreserved in aliquots for later use. Once cells reached a confluent 6 well dish, they were passaged to a T-25 flask and a fraction of the cells (5 x 105) were removed for plating in a gelatinized 6 cm dish for gene expression profile analysis. Alternatively, some cells were first passaged to T-225 flasks, then a fraction of the cells (5 x 105) were removed for plating in a gelatinized 6 cm dish for gene expression profile analysis. The population doublings that the cells had undergone were therefore determined to be 18- 2 1 PDs. Following removal of the cell clones from the cloning plates, remaining colonies were visualized by Crystal violet staining (Sigma HT9132-1L) in 100% ethanol per manufacturer's instructions. Cell Culture media utilized in experiments and described in text and Table III: Smooth muscle cell basal medium (Cat# C-22062B) and growth supplement (Cat# C-39267), Skeletal muscle basal medium (Cat# C-22060B) and growth supplement (Cat# C-39365), Endothelial cell basal medium (Cat# C-22221) and growth supplement (Cat# C-39221), Melanocyte cell basal medium (Cat# C-24010B) and growth supplement (Cat# C-39415) were obtained from PromoCell GmbH (Heidelberg, Germany). Epi-Life, calcium free/phenol red free medium (Cat# M-EPIcf/PRF-500) and low serum growth supplement (Cat# S-003-10) were purchased from Cascade Biologies (Portland, Oregon). Mesencult basal medium (Cat# 05041) and supplement (Cat# 5402) were obtained from Stem Cell Technologies (Vancouver, BC). Dulbecco's modified Eagle's medium (Cat# 11960-069) and Fetal bovine serum (Cat# SH30070-03) were purchased from Invitrogen (Carlsbad, CA) and Hyclone (Logan, UT) respectively. Medium and supplements were combined according to manufacturer's instructions.

Clonal Embryonic Progenitor Line Nomenclature: The cell lines of the present invention along with their alternative designations are listed in Table VI along with synonyms that represent minor modifications that result from the manipulation of the names resulting from bioinformatics analysis, including the substitution of "-" for "." and vice versa, the inclusion of an "x" before cell line names beginning with an arabic number, and suffixes such as "biol" or "bio2" that indicate biological replicates of the same line which are examples of cases where a frozen ampule of the same line was thawed, propagated, and used in a parallel analysis and "Repl" or "Rep2" which indicate technical replicates wherein RNA isolated from a given cell line is utilized a second time for a repeat analysis without thawing or otherwise beginning with a new culture of cells. Passage number (which is the number of times the cells have been trypsinized and replated) for the cell lines is usually designated by the letter "P" followed by an arabic number, and in contrast, the population doubling number (which refers to the number of estimated doublings the cell lines have undergone in clonal expansion from one cell) is designated by the letters "PD" followed by an arabic number. The number of PDs in a passage varied from experiment to experiment but generally each trypsinization and replating was at a 1:3 to 1:4 ratio (corresponding to an increase of PDs of 1.5 and 2 respectively). In the expansion of clones, the original colonies were removed from tissue culture plates with cloning cylinders, and transferred to 24-well plates, then 12- well, and 6-well as described above. First confluent 24 well is designated PI, the first confluent 12 well culture is P2, the first 6-well culture is P3, then the six well culture was then split into a second 6 well plate (P4) and a T25 (P4). The second 6 well at P4 is utilized for RNA extraction (see U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety) and represents about 18-21 PD of clonal expansion. Typical estimated subsequent passages and PDs are the following split to a T75 flask (19.5-22.5 PD), the P6 passage of the cells to a T225 flask (21-24 PD), then P7 being the transfer of the cells to a roller bottle (850cm2, 23-26 PD), and P8 the split into 4 rollers (25-28 PD). The ranges shown above in parenthesis represent estimated ranges in cell counts due to cell sizes, attachment efficiency, and counting error.

Propagation of Clonal, Pooled Clonal, Oligoclonal, and Pooled Oligoclonal Cell Lines. Aspects of the invention provide methods for identifying and differentiating embryonic progenitor cell lines that are derived from a single cell (clonal) or cell lines that are "pooled clonal" meaning that cell lines cloned have indistinguishable markers, such as gene expression markers, and are combined to produce a single cell culture often for the purpose of increasing the number of cells in a culture, or are oligoclonal wherein a line is produced from a small number, typically 2-1,000 similar cells and expanded as a cell line, or "pooled oligoclonal" lines which are lines produced by combining two or more oligoclonal cell lines that have indistinguishable markers such as patterns of gene expression. Said clonal, pooled clonal, oligoclonal, or pooled oligoclonal cell lines are then propagated in vitro through removal of the cells from the substrate to which they are affixed, and the re-plating of the cells at a reduced density of typically 1/3 to 1/4 of the original number of cells, to facilitate further proliferation. Examples of said cell lines and their associated cell culture media is disclosed in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby"; and West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, both of which aree incorporated herein by reference, including supplemental information. The compositions and methods of the present invention relate to said cell lines cultured as described but for greater than 2 1 doublings of clonal expansion.

Gene Expression Analysis To reduce variations in gene expression due to cell cycle artifacts, and to capture an early gene expression profile of the cells, upon being expanded to six well plates, on the day the cells reached confluence, the cells were placed in media with a reduction of serum to 0.5% in the case where the original serum concentration was >5%. In all other cases, serum and/or other growth factors was reduced to 10% of their original values. These quiescence conditions were imposed for five days and all cultures were re-fed two days prior to harvest to reduce feeding difference artifacts. So, by way of example, if the original media was DMEM medium with 10% FCS, then the quiescence synchronization media was DMEM with 0.5% FCS. Total RNA was extracted directly from cells growing in 6-well or 6 cm tissue culture plates using Qiagen Rneasy mini kits according to the manufacturer's instructions. RNA concentrations were measured using a Beckman DU530 or Nanodrop spectrophotometer and RNA quality determined by denaturing agarose gel electrophoresis or an Agilent 2100 bioanalyzer. Whole-genome expression analysis was carried out using Affymetrix Human Genome U133 Plus 2.0 GeneChip® system, Illumina Human-6 vl and HumanRef-8 vl Beadchips (Illumina 1), and Illumina Human-6 v2 Beadchips (Illumina 2), and RNA levels for certain genes were confirmed by quantitative PCR. For Illumina BeadArrays, total RNA was linearly amplified and biotin-labeled using Illumina TotalPrep kits (Ambion), and cRNA was quality controlled using an Agilent 2100 Bioanalyzer. cRNA was hybridized to Illumina BeadChips, processed, and read using a BeadStation array reader according to the manufacturer's instructions (Illumina). Relative Fluorescence Unit (RFU) values for all of the cell lines with common probe sets were quantile normalized. In Supplementary Tables II-IV (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which are incorporated by reference herein in their entirety) the genes are displayed in rank order (highest-lowest) for the ratio of (highest RFU value observed for the gene in the entire set of cell lines - Average RFU value)/Ave RFU value. In Supplementary Table V (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) the top 45 differentially expressed genes rank ordered (highest- lowest) for the ratio of (highest RFU value observed for the gene in the individual cell line/Ave RFU value for all cell lines. In Supplementary Table VI (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) the genes corresponding to recognized CD antigens are displayed in rank order (highest-lowest) and also (lowest to highest) for the ratio of highest RFU value observed for the gene in the entire set of cell lines/Ave RFU value and lowest RFU value observed for the gene in the entire set of cell lines/Ave RFU value respectively. In Supplementary Table VII (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) the genes corresponding to secreted proteins are displayed in rank order (highest-lowest) for the ratio of highest RFU value observed for the gene in the entire set of cell lines/Ave RFU value.

Low Throughput Screening and qPCR The clonal, oligoclonal, or pooled clonal or pooled oligoclonal embryonic progenitor cell lines of the present invention at either <21 or preferably >21 doublings of clonal or oligoclonal expansion, most preferably at 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 doublings of clonal expansion (since before 29 doublings of clonal expansion the cells are available only in limited quantities, and beyond 70 doublings the cells normally approach senescence) are screened simultaneously in 1, 2, 3, 4, 5, or preferably 10 or more diverse differentiation conditions. Said differentiation conditions may include without limitation, all combinations of the human embryonic progenitor cell lines listed in Table I (showing gene expression markers at 18-21 doublings of clonal expansion), together with culture conditions as listed in Table II, exposed to the culture media listed in Table III, and supplemented factors listed in Table IV. The cells are cultured in said differentiation conditions for 1-6 weeks, most preferably two to four weeks. The readout of the assay can be mRNA markers of differentiation such as those listed in Table V and measured by hybridization to arrayed target sequences, including but not limited to microarrays or by PCR. Detection can also be at the level of peptides or proteins that may be detected through the use of specific antibodies, through the use of enzyme assays, mass spectroscopy, or other similar means well known in the art. In the case of qPCR, protocols may vary and are well-known in the art. By way of nonlimiting example, samples for testing are prepared in standard Optical 96-well reaction plates (Applied Biosystems Carlsbad, CA, PN 4306737) consisting of 30ng of RNA equivalent of cDNA, 0.4uM per primer, Ultra-Pure distilled water (Invitrogen), diluted 1:1 with 12.5ul of Power SYBR Green PCR Master Mix (Applied Biosystems Carlsbad, CA, Cat# 4367659) incorporating AmpliTaq Gold DNA polymerase in a total reaction volume of 25ul. Real-Time qPCR is run using Applied Biosystems 7500 Real-Time PCR System employing SDSvl.2 software. Amplification conditions are set at 50°C for 2 min. (stage 1), 95°C for 10 min. (stage 2), 40 cycles of 95°C for 15 sec then

60°C for 1 min (stage 3), with a dissociation stage at 95°C for 15 sec, 60°C for 1 min, and 95°C for

15 sec (stage 4). Ct values for amplification products of genes of interest are normalized to the average Ct value of 3 housekeeping genes (GAPD, RPS10, and GUSB).

Medium Throughput Screen of the Fate Space of Clonal or Oligoclonal Embryonic Progenitors. The clonal, oligoclonal, or pooled clonal or pooled oligoclonal embryonic progenitor cell lines of the present invention at either <21 or preferably >21 doublings of clonal or oligoclonal expansion, most preferably at 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 doublings of clonal expansion (since before 29 doublings of clonal expansion the cells are available only in limited quantities, and beyond 70 doublings the cells normally approach senescence) are screened simultaneously in 10, 20, 30, 40, 50, or preferably 100 or more diverse differentiation conditions. Said differentiation conditions may include without limitation, all combinations of the human embryonic progenitor cell lines listed in Table I (showing gene expression markers at 18-21 doublings of clonal expansion), together with culture conditions as listed in Table II, exposed to the culture media listed in Table III, and supplemented factors listed in Table IV. The cells are cultured in said differentiation conditions for 1-6 weeks, most preferably four weeks. The readout of the assay can be mRNA markers of differentiation such as those listed in Table V and measured by hybridization to arrayed target sequences, including but not limited to microarrays or PCR. Detection can also be at the level of peptides or proteins that may be detected through the use of specific antibodies, through the use of enzyme assays, mass spectroscopy, or other similar means well known in the art.

Medium Throughput qPCR Screen ofhEP Cell Differentiation The clonal, oligoclonal, or pooled clonal or pooled oligoclonal embryonic progenitor cell lines of the present invention, including but not limited to those shown in Table I, at either <21 or preferably >21 doublings of clonal or oligoclonal expansion, most preferably at 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 doublings of clonal expansion are plated in 6 well culture plates with each well having 10 micromasses of 250,000 cells (i.e. 2.5 million cells per well).

Alternatively the cells are treated with other culture conditions as listed in Table II using the same number of cells, exposed to any combination of the culture media listed in Table III, and supplemented factors listed in Table IV or detailed protocols listed in Table VIII. The cells are cultured in said differentiation conditions for 1-6 weeks, most preferably four weeks. RNA is prepared from cell lysates using the Rneasy mini kits (Qiagen) according to the manufacturer's instructions. Briefly, cell cultures (micromasses) are rinsed in PBS, then lysed in a minimal volume of the RLT lysis buffer. After incubation on ice, the cell debris is removed by centrifugation and the lysate is mixed with RLT buffer, after which ethanol is added to the mixture. The combined mixture is then loaded onto the Rneasy spin column and centrifuged; the loaded column is then washed and the purified RNA is released from the column with a minimal volume of DEPC-treated water (typically 30 ul or less). The concentration of RNA in the final eluate is determined by absorbance at 260 nm. cDNA synthesis is performed using the Superscript First Strand cDNA kit (InVitrogen; Carlsbad, CA). Briefly, 2.5 ug of purified RNA is heat denatured in the presence of random hexamers. After cooling, the first strand reaction is completed using SuperSript reverse transcriptase enzyme and associated reagents from the kit. The resulting product is further purified using QIAquick PCR Purification kits (Qiagen) according to the manufacturer's instructions. Briefly, PB buffer is added to the first strand cDNA reaction products, then the mixture is loaded onto the QIAquick spin column and centrifuged. The column is washed with PE buffer and the purified cDNA is eluted from the column using a minimal volume of water (20 ul). qPCR primer pairs are synthesized for each target gene. Briefly, primer pairs for a target gene are designed to amplify only the target mRNA sequence and optimally have annealing temperatures for their target sequences that lie in the range of 65-80 °C and unique amplification products in the size range of 100-500 bp. Primer pairs are supplied at working concentrations (10 uM) to BioTrove, Inc. (Woburn, MA) for production of a custom qPCR Open Array plate. OpenArray plates are designed to accommodate 56-336 primer pairs and the final manufactured plate with dried down primer pairs is provided to the service provider. Purified cDNA reaction products (2.) and Syber green master mix are loaded into individual wells of the OpenArray plate using OpenArray autolader device (BioTrove). The plate is sealed and the qPCR and loaded into the NT Imager/Cycler device (BioTrove) for amplification. Ct values for each sample are calculated using the OpenArray application software. Markers of differentiation are not those present in embryonic progenitor cell lines, but are present in later stages of differentiation. It is not obvious to what an effective array of such markers would be. For example, COL2A1 is not expressed in the clonal embryonic progenitor cell lines, but is markedly induced >100-fold in a subset of the cell lines of the present invention. Previous attempts to invent an array of differentiation markers were not useful in the context of the present invention because they included a majority of markers that were expressed in both embryonic progenitor cell types and in terminally-differentiated cell types (Luo, Y., Cai, J., Ginis, I., Sun, Y., Lee, S., Yu, S.X., Hoke, A., and Rao, M. 2003. Designing, testing, and validating a focused stem cell microarray for characterization of neural stem cells and progenitor cells. Stem Cells, 21:575-587). An example of a list of said markers useful in determining that a particular differentiation condition induced terminal differentiation in embryonic progenitor cell lines a majority of which are not expressed in embryonic progenitor cell lines are shown in Table VI.

Isolation of secreted or extracellular matrix proteins Secreted Protein Isolation Protocol 1 - Conditioned medium Cells were grown in either their normal propagation medium (West et al., 2008, Regen Med vol. 3(3) pp. 287-308) or the differentiation conditions described herein. To obtain conditioned medium on a smaller scale (typically 1-2 L or less), the cells were grown in monolayer cultures in T150, T175 or T225 flasks (Corning or BD Falcon) in a 37°C incubator with 10% C0 2 atmosphere. For larger volume medium collections, the cells were typically grown either in 2 L roller bottles, on microcarrier suspensions (porous such as Cytodex varieties from Sigma-Aldrich, St. Louis, MO, or non-porous such as from SoloHill Engineering, Ann Arbor, MI) in spinner flasks or other bioreactors, or in hollow fiber cartridge bioreactors (GE Healthcare, Piscataway, NJ). Prior to conditioned medium collection, the cultures were rinsed twice with PBS and then incubated for 2 hours at 37°C in the presence of serum-free medium wherein the medium is the same basal medium as described herein for the propagation or differentiation of the cells, in order to remove fetal serum proteins. The serum-free medium was then removed and replaced with fresh medium, followed by continued as described herein at 37°C for 24-48 hours. The culture-conditioned medium was then collected by separation from the cell-bound vessel surface or matrix (e.g., by pouring off directly or after sedimentation) and processed further for secreted protein concentration, enrichment or purification. As deemed appropriate for the collection volume, the culture medium was first centrifuged at 500 to 10,000 xg to remove residual cells and cellular debris in 15 or 50 ml centrifuge tubes or 250 ml bottles. It was then passaged through successive 1 µ or 0.45 µ and 0.2 µ filter units (Corning) to remove additional debris, and then concentrated using 10,000 MW cutoff ultrafiltration in a stirred cell or Centricon centrifuge filter (Amicon-Millipore) for smaller volumes, or using a tangential flow ultrafiltration unit (Amicon-Millipore) for larger volumes. The retained protein concentrate was then dialyzed into an appropriate buffer for subsequent purification of specific proteins, and further purified using a combination of isoelectric focusing, size exclusion chromatography, ion exchange chromatography, hydrophobic or reverse phase chromatography, antibody affinity chromatography or other well-known methods appropriate for the specific proteins. During the various steps in the purification process, collection fractions were tested for the presence and quantity of the specific secreted protein by ELISA (e.g., using BMP-2 or BMP-7 ELISA kits from R&D Systems, Minneapolis, MN). The purified proteins were then kept in solution or lyophilized and then stored at 4 or minus 20-80°C. Secreted Protein Isolation Protocol 2 - Urea-mediated protein extraction In the case of some secreted proteins, interactions with the cell or ECM components may reduce the simple diffusion of factors into the medium as described above in Secreted Protein Isolation Protocol 1. A simple comparison of the yield in the two protocols will suffice to determine which protocol provides the highest yield of the desired factors. In the case of Secreted Protein Isolation Protocol 2, a low concentration of urea is added to facilitate the removal of factors. In the case of the examples provided, all urea extractions were performed two days subsequent to feeding. On the second day, cell monolayers in T-150 cell culture flasks were rinsed twice with CMF-PBS and then incubated for two hours at 37°C in the presence of serum-free medium. The rinse with CMF-PBS and the incubation in serum-free medium together aid in the removal of fetal serum proteins from the surface of the cells. The serum-free medium was then removed and 10 ml /T150 of freshly made 200 mM urea in CMF-PBS was added. The flasks were then placed on a rocker at 37°C. for 6.0 hours. The urea solution was then removed and immediately frozen at -70°C.

Extracellular Matrix Isolation Protocol 1 - DOC-Mediated Preparation

Extracellular matrix proteins can be extracted using the method of Hedman et al, 1979 (Isolation of the pericellular matrix of human fibroblast cultures. J. Cell Biol. 81: 83-91). Cell layers are rinsed three times with CMF-PBS buffer at ambient temperature and then washed with 30 mL of 0.5% sodium deoxycholate (DOC), 1 mM phenylmethylsulfonylfluride (PMSF, from 0.4M solution in EtOH), CMF-PBS buffer 3 X 10 min. on ice while on a rocking platform. The flasks were then washed in the same manner with 2mM Tris-HCI, pH 8.0 and 1 mM PMSF 3 X 5 min. The protein remaining attached to the flask was then removed in 2 mL of gel loading buffer with a rubber policeman.

Screening of secreted or extracellular matrix proteinsfor biological activity The cell lines of the present invention are also useful as a means of screening diverse embryonic secretomes for varied biological activities. The cell lines of the present invention cultured at 18-21 doublings of clonal expansion express a wide array of secreted soluble and extracellular matrix genes (see US Patent Application Publication 2010/0184033 entitled "METHODS TO ACCELERATE THE ISOLATION OF NOVEL CELL STRAINS FROM PLURIPOTENT STEM CELLS AND CELLS OBTAINED THEREBY" filed on July 16, 2009, incorporated herein by reference). At 2 1 or more doublings of clonal expansion, the cells of the present invention differentially express secreted soluble and extracellular matrix genes shown in Table IX. These proteins, proteoglycans, cytokines, and growth factors may be harvested from the cell lines of the present invention by various techniques known in the art including but not limited to Secreted Protein Isolation Protocol 1 or 2. These pools of secreted and extracellular matrix proteins may be further purified or used as mixtures of factors and used in varied in vitro or in vivo assays of biological activity as is known in the art.

Applications The disclosed methods for the culture of animal cells and tissues are useful in generating cells or progeny thereof in mammalian and human cell therapy, such as, but not limited to, generating human cells useful in treating dermatological, retinal, cardiac, neurological, endocrinological, muscular, skeletal, articular, hepatic, neurological, renal, gastrointestinal, pulmonary, and blood and vascular cell disorders in humans and nonhuman animals. In certain embodiments of the invention, single cell-derived and oligoclonal cell-derived cells derived by methods of this invention, are utilized in research and treatment of disorders relating to cell biology, cell-based drug discovery and in cell therapy. The single cell-derived cell populations derived using the methods of the present invention may already have received the requisite signals to be directed down a differentiation pathway. For example, some paraxial or somatopleuric single cell-derived populations of cells may express genes consistent with dermal fibroblast gene expression, in particular, a prenatal pattern of gene expression useful in promoting scarless wound repair and in promoting elastogenesis. Such cells include, for example, including but not limited to: cells of the heart; cells of the musculo-skeletal system; cells of the nervous tissue; cells of the respiratory system; cells of the endocrine system including preadipocytes or adipocytes including but not limited to cutaneous white and brown preadipocytes or adipocytes capable of causing weight loss, increasing insulin sensitivity, lowering blood glucose, and thereby reducing the risk of vascular disease a other symptoms of Type II diabetes, in a human or nonhuman mammal; cells of the vascular system; cells of the hematopoietic system; cells of the integumentary system; cells of the urinary system; cells of the joint such as articular chondrocytes, tendons, synovial membrane, and meniscus; or cells of the gastrointestinal system. Such cells may be stably grafted in a histocompatible host when the cells are grafted into the tissue into which the cells would normally differentiate. Such tissues include, but are not limited to: endoderm-embryonic tissues; mesoderm- embryonic tissues; ectoderm-embryonic tissues; or extraembryonic cells. In certain embodiments of the invention, single cell-derived and oligoclonal cell-derived cells are introduced into the tissues in which they normally reside in order to exhibit therapeutic utility. In certain embodiments of the invention, single cell-derived and oligoclonal cell-derived cells, derived by methods of this invention, are utilized in inducing the differentiation of other pluripotent stem cells. The generation of single cell-derived populations of cells capable of being propagated in vitro while maintaining an embryonic pattern of gene expression is useful in inducing the differentiation of other pluripotent stem cells. Cell-cell induction is a common means of directing differentiation in the early embryo. Many potentially medically-useful cell types are influenced by inductive signals during normal embryonic development, including spinal cord neurons, cardiac cells, pancreatic beta cells, and definitive hematopoietic cells. Single cell-derived populations of cells capable of being propagated in vitro while maintaining an embryonic pattern of gene expression can be cultured in a variety of in vitro, in ovo, or in vivo culture conditions to induce the differentiation of other pluripotent stem cells to become desired cell or tissue types. Induction may be carried out in a variety of methods that juxtapose the inducer cell with the target cell. By way of nonlimiting examples, the inducer cells may be plated in tissue culture and treated with mitomycin C or radiation to prevent the cells from replicating further. The target cells are then plated on top of the mitotically- inactivated inducer cells. Alternatively, single cell-derived inducer cells may be cultured on a removable membrane from a larger culture of cells or from an original single cell-derived colony and the target cells may be plated on top of the inducer cells or a separate membrane covered with target cells may be juxtaposed so as to sandwich the two cell layers in direct contact. The resulting bilayer of cells may be cultured in vitro, transplanted into a SPF avian egg, or cultured in conditions to allow growth in three dimensions while being provided vascular support (see, for example, international patent publication number WO/2005/068610, published July 28, 2005, the disclosure of which is hereby incorporated by reference). The inducer cells may also be from a source of pluripotent stem cells, including hES or hED cells, in which a suicide construct has been introduced such that the inducer cells can be removed at will. Cell types useful in single cell-derived and oligoclonal cell- derived induction may include cases of induction well known in the art to occur naturally in normal embryonic development. In certain embodiments of the invention, single cell-derived cells and oligoclonal cell-derived cells, derived by methods of this invention, are used as "feeder cells" to support the growth of other cell types, including pluripotent stem cells. The use of single cell- derived cells and oligoclonal cell-derived cells of the present invention as feeder cells alleviates the potential risk of transmitting pathogens from feeder cells derived from other mammalian sources to the target cells. The feeder cells may be inactivated, for example, by gamma ray irradiation or by treatment with mitomycin C, to limit replication and then co-cultured with the pluripotent stem cells. In certain embodiments of the invention, the extracellular matrix (ECM) of single cell- derived and oligoclonal cell-derived cells, derived by methods of this invention, may be used to support less differentiated cells (see Stojkovie et al., Stem Cells (2005) 23(3):306-14). Certain cell types that normally require a feeder layer can be supported in feeder-free culture on a matrix (Rosier et al., Dev Dyn. (2004) 229(2):259-74). The matrix can be deposited by preculturing and lysing a matrix-forming cell line (see WO 99/20741), such as the STO mouse fibroblast line (ATCC Accession No. CRL-1503), or human placental fibroblasts. In certain embodiments of the invention, the conditioned media of single cell-derived and oligoclonal cell-derived cell cultures may be collected, pooled, filtered and stored as conditioned medium. This conditioned medium may be formulated and used for research and therapy. Such conditioned medium may contribute to maintaining a less differentiated state and allow propagation of cells such as pluripotent stem cells. In certain embodiments of the invention, conditioned medium of single cell-derived and oligoclonal cell-derived cell cultures derived by the methods of this invention can be used to induce differentiation of other cell types, including pluripotent stem cells. The use of conditioned medium of single cell-derived and oligoclonal cell-derived cell cultures may be advantageous in reducing the potential risk of exposing cultured cells to non-human animal pathogens derived from other mammalian sources (i.e. xenogeneic free). In another embodiment of the invention, single cell-derived and oligoclonal cell-derived paraxial mesoderm, neural crest mesenchyme, or somatopleuric mesoderm, derived by methods of this invention, can be used to induce embryonic ectoderm or single cell-derived embryonic ectoderm into keratinocytes for use in skin research and grafting for burns, wound repair, and drug discovery. In another embodiment of the invention, the use of single cell-derived and oligoclonal cell-derived prechordal plate mesoderm, derived by methods of this invention, to induce embryonic ectoderm or single cell-derived or oligoclonal cell-derived embryonic ectoderm into neuroectodermal cells capable of generating CNS cells, may be useful in neuron research and grafting for neurodegenerative diseases, as well as drug discovery. The single cell-derived and oligoclonal cell- derived prechordal plate mesoderm can be identified by transcript analysis as described herein through the expression of, for example, lim-1. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived notochord mesodermal cells, derived by methods of this invention, are identified by their expression of brachyury. In normal development, notochordal cells induce the floor of the neural plate mesoderm (which induces the spinal chord) to make sonic hedgehog ("SHH"), a ventralizing signal, that induces the floor of the neural tube to express SHH as well, which induces the expression of FP1, FP2, and SCI by the floor plate of the neural tube. Therefore, notochordal mesodermal cells can be used to induce neural plate ectodermal cells or neural tube neuroepithelial cells to differentiate into spinal cord neurons. Such neurons may be identified and confirmed by assaying the gene expression assays described herein for cells expressing FP1, FP2, or SCI. These cells expressing one or more of these markers could be useful in spinal cord regeneration. Our discovery that various single cell-derived and oligoclonal cell-derived cells in early embryonic lineages may be propagated without the loss of their embryonic phenotype allows numerous types of mesodermal inducer cells to induce differentiation in embryonic ectoderm or endoderm. However, single cell-derived and oligoclonal cell-derived cells from endoderm and ectodermal lineages, derived by methods of this invention, may be useful in induction as well. For example, surface ectoderm and notochord express Shh and thereby induce somites to become sclerotome mesodermal cells that express M-twist and Pax-1 and surface ectoderm. Also, as another example, notochord expresses extracellular proteins of the Wnt family and thereby induces other somite mesodermal cells to become dermatome mesodermal cells that express gMHox, and dermo-1. The juxtaposition of the inducer and target cells provides a useful in vitro model of differentiation that can be used for research into early embryonic differentiation, for drug screening, and for studies of teratology. The target cells differentiated by the single cell-derived inducer cells may also be used for research, drug discovery, and cell-based therapy. In certain embodiments of the invention, the single cell-derived and oligoclonal cell-derived cells, derived by methods of this invention, may be used to generate skin equivalents, as well as to reconstitute full-thickness human skin, according to the methods described in U.S. application nos. 09/037,191, filed March 9, 1998 (U.S. publication no. 2001/0048917, published December 6, 2001); 10/013124, filed December 7, 2001 (U.S. publication no. 2002/0120950, published August 29, 2002); 10/982,186, filed November 5, 2004 (U.S. publication no. 2005/01 18146, published June 2, 2005); the disclosure of each of which is incorporated herein by reference. For example, the single cell-derived and oligoclonal cell-derived cells may be incorporated into a layered cell sorted tissue that includes a discrete first cell layer and a discrete second cell layer that are formed in vitro by the spontaneous sorting of cells from a homogenous cell mixture. The first cell layer may include any cell type, but preferably includes epithelial cells, in particular, keratinocytes. Other cell types that may be used in the first cell layer are CaCo2 cells, A431 cells, and HUC18 cells. The second cell layer may also include cells of any type, but preferably includes mesenchymal cells, in particular, fibroblasts. The layered cell sorted tissue possesses an epidermal-dermal junction that is substantially similar in structure and function to its native counterpart. That is, the tissue expresses the necessary integral proteins such as hemidesmosomes and collagen I, collagen IV, and collagen VII, to attach the epidermal and dermal layers with the proper basement membrane morphology. The single cell-derived and oligoclonal cell-derived cells may then sort to form an epidermal layer that contacts the connective tissue component. The layered cell sorted tissues comprising the single cell- derived and oligoclonal cell-derived cells may be used as a skin graft that could be used on graft sites such as traumatic wounds and burn injury. In another embodiment of the invention, single cell-derived and oligoclonal cell-derived cells of this invention may be used as a means to identify and characterize genes that are transcriptionally activated or repressed as the cells undergo differentiation. For example, libraries of gene trap single cell-derived or oligoclonal cell-derived cells may be made by methods of this invention, and assayed to detect changes in the level of expression of the gene trap markers as the cells differentiate in vitro and in vivo. The methods for making gene trap cells and for detecting changes in the expression of the gene trap markers as the cells differentiate are reviewed in Durick et al. (Genome Res. (1999) 9:1019-25), the disclosure of which is incorporated herein by reference). The vectors and methods useful for making gene trap cells and for detecting changes in the expression of the gene trap markers as the cells differentiate are also described in U.S. pat. no. 5,922,601 (Baetscher et al.), U.S. pat. no. 6,248,934 (Tessier-Lavigne) and in U.S. patent publication No. 2004/0219563 (West et al.), the disclosures of which are also incorporated herein by reference. Methods for genetically modifying cells, inducing their differentiation in vitro, and using them to generate chimeric or nuclear-transfer cloned embryos and cloned mice are developed and known in the art. To facilitate the identification of genes and the characterization of their physiological activities, large libraries of gene trap cells having gene trap DNA markers randomly inserted in their genomes may be prepared. Efficient methods have been developed to screen and detect changes in the level of expression of the gene trap markers as the cells differentiate in vitro or in vivo. In vivo methods for inducing single cell-derived or oligoclonal cell-derived cells to differentiate further include injecting one or more cells into a blastocyst to form a chimeric embryo that is allowed to develop; fusing a stem cell with an enucleated oocyte to form a nuclear transfer unit (NTU), and culturing the NTU under conditions that result in generation of an embryo that is allowed to develop; and implanting one or more clonogenic differentiated cells into an immune-compromised or a histocompatible host animal (e.g., a SCID mouse, or a syngeneic nuclear donor) and allowing teratomas comprising differentiated cells to form. In vitro methods for inducing single cell-derived or oligoclonal cell-derived cells to differentiate further include culturing the cells in a monolayer, in suspension, or in three-dimensional matrices, alone or in co-culture with cells of a different type, and exposing them to one of many combinations of chemical, biological, and physical agents, including co-culture with one or more different types of cells, that are known to capable of induce or allow differentiation. In another embodiment of the invention, cell types that do not proliferate well under any known cell culture conditions may be induced to proliferate such that they can be isolated clonally or oligoclonally according to the methods of this invention through the regulated expression of factors that overcome inhibition of the cell cycle, such as regulated expression of SV40 virus large T-antigen (Tag), or regulated Ela and/or Elb, or papillomavirus E6 and/or E7, or CDK4 (see, e.g., U.S. patent application Ser. No. 11/604,047 filed on November 21, 2006 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference). In another embodiment of the invention, the factors that override cell cycle arrest may be fused with additional proteins or protein domains and delivered to the cells. For example, factors that override cell cycle arrest may be joined to a protein transduction domain (PTD). Protein transduction domains, covalently or non-covalently linked to factors that override cell cycle arrest, allow the translocation of said factors across the cell membranes so the protein may ultimately reach the nuclear compartments of the cells. PTDs that may be fused with factors that override cell cycle arrest include the PTD of the HIV transactivating protein (TAT) (Tat 47-57) (Schwarze and Dowdy 2000 Trends Pharmacol. Sci. 21: 45-48; Krosl et al. 2003 Nature Medicine (9): 1428-1432). For the HIV TAT protein, the amino acid sequence conferring membrane translocation activity corresponds to residues 47-57 (Ho et al., 2001, Cancer Research 61: 473-477; Vives et al., 1997, . Biol. Chem. 272: 16010-16017). These residues alone can confer protein translocation activity. In another embodiment of the invention, the PTD and the cycle cycle arrest factor may be conjugated via a linker. The exact length and sequence of the linker and its orientation relative to the linked sequences may vary. The linker may comprise, for example, 2, 10, 20, 30, or more amino acids and may be selected based on desired properties such as solubility, length, steric separation, etc. In particular embodiments, the linker may comprise a functional sequence useful for the purification, detection, or modification, for example, of the fusion protein. In another embodiment of the invention, single cell-derived or oligoclonal cell-derived cells of this invention may be reprogrammed to an undifferentiated state through novel reprogramming technique, as described in U.S. application no. 60/705,625, filed August 3, 2005, U.S. application no. 60/729,173, filed October 20, 2005; U.S. application no. 60/818,813, filed July 5, 2006, the disclosures of which are incorporated herein by reference. Briefly, the cells may reprogrammed to an undifferentiated state using at least a two, preferably three-step process involving a first nuclear remodeling step, a second cellular reconstitution step, and finally, a third step in which the resulting colonies of cells arising from step two are characterized for the extent of reprogramming and for the normality of the karyotype and quality. In certain embodiments, the single cell-derived or oligoclonal cell-derived cells of this invention may be reprogrammed in the first nuclear remodeling step of the reprogramming process by remodeling the nuclear envelope and the chromatin of a differentiated cell to more closely resemble the molecular composition of an undifferentiated or a germ-line cell. In the second cellular reconstitution step of the reprogramming process, the nucleus, containing the remodeled nuclear envelope of step one, is then fused with a cytoplasmic bleb containing requisite mitotic apparatus which is capable, together with the transferred nucleus, of producing a population of undifferentiated stem cells such as ES or ED-like cells capable of proliferation. In the third step of the reprogramming process, colonies of cells arising from one or a number of cells resulting from step two are characterized for the extent of reprogramming and for the normality of the karyotype and colonies of a high quality are selected. While this third step is not required to successfully reprogram cells and is not necessary in some applications, the inclusion of the third quality control step is preferred when reprogrammed cells are used in certain applications such as human transplantation. Finally, colonies of reprogrammed cells that have a normal karyotype but not sufficient degree of programming may be recycled by repeating steps one and two or steps one through three. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived cells may be used to generate ligands using phage display technology (see U.S. application no. 60/685,758, filed May 27, 2005, and PCT US2006/020552, filed May 26, 2006, the disclosures of which are hereby incorporated by reference). In another embodiment of the invention, the single cell-derived or oligoclonal cell-derived cells of this invention may exhibit unique patterns of gene expression such as high levels of factors, e.g. secreted factors, that promote the development or formation of specific tissue types either in vitro or in vivo (e.g., angiogenic factors, neurotrophic factors, etc). Such cells may be useful for the delivery of these factors to tissues to promote the formation of specific cell/tissue types where those cells/tissues are therapeutic. For example, in the case of the angiogenic factors, cell lines that express high levels of such factors including VEGFA, B, C, or D or angiopoietin-1 or -2 can be transplanted using delivery technologies appropriate to the target tissue to deliver cells that express said angiogenic factor(s) to induce angiogenesis for therapeutic effect. In another embodiment of the invention, cells may produce large quantities of PTN (Accession number NM_002825.5), MDK (Accession number NM_002391.2), or ANGPT2 (Accession number NM_00 1147.1), or other angiogenesis factors and therefore may be useful in inducing angiogenesis when injected in vivo as cell therapy, when mitotically inactivated and then injected in vivo, or when combined with a matrix in either a mitotically-inactivated or native state for use in inducing angiogenesis. PTN-producing cells described in the present invention are also useful when implanted in vivo in either a native or mitotically-inactivated state for delivering neuro-active factors, such as in preventing the apoptosis of neurons following injury to said neurons. As another example, a cell produced by the methods of this invention could produce large amounts of BMP2, BMP7, BMP3b or other members of the BMP family, and this cell could therefore be useful in inducing bone formation (as described below). The expression of genes of the cells of this invention may be determined. Measurement of the gene expression levels may be performed by any known methods in the art, including but not limited to, microarray gene expression analysis, bead array gene expression analysis and Northern analysis. The gene expression levels may be represented as relative expression normalized to the ADPRT (Accession number NM_001618.2), GAPD (Accession number NM_002046.2), or other housekeeping genes known in the art. The gene expression data may also be normalized by a median of medians method. In this method, each array gives a different total intensity. Using the median value is a robust way of comparing cell lines (arrays) in an experiment. As an example, the median was found for each cell line and then the median of those medians became the value for normalization. The signal from the each cell line was made relative to each of the other cell lines. Based on the gene expression levels, one would expect the expression of the corresponding proteins by the cells of the invention. For example, in the case of cell clone ACTC60 (or B-28) of Series 1, relatively high levels of DKKl, VEGFC and IL1R1 were observed. Therefore, the ability to measure the bioactive or growth factors produced by said cells may be useful in research and in the treatment of disease. In the case of neutrophic factors, the cells made by the methods of this invention may be used to induce the innervation of tissue such as to improve the sensory innervation of the skin in wound repair or regeneration, or other sensory or motor innervation. For example, the cell clone number 1 (ACTC61/B30) displays a high level of expression of pleiotrophin (PTN) and may therefore be formulated for this use using delivery and formulation technologies well known in the art including by way of nonlimiting example, humans and veterinary animal applications where the dosage will be between 102 - 106 cells and the formulation can be, by way of nonlimiting example, a cell suspension in isosmotic buffer or a monolayer of cells attached to an layer of extracellular matrix such as contracted gelatin. Such use of cells that promote angiogenesis or neurite outgrowth may further be combined with an adjunct therapy that includes young hemangioblasts or angioblasts in the case of angiogenesis or neuronal precursors of various kinds in the case of neurite outgrowth. Such combined therapy may have particular utility where the mere administration of angiogenic factors or neurite outgrowth promoting factors by themselves are not sufficient to generate a response due to the fact that there is a paucity of cells capable of responding to the stimulus. In the case of angiogenesis, the senescence of the vascular endothelium or circulating endothelial precursor cells such as hemangioblasts may blunt the response to angiogenic stimulus. The co-administration of young hemangioblasts by various modalities known in the art based on the size of the animal and the target tissue along with cells capable of delivering an angiogenic stimulus will provide an improved angiogenic response. Such an induction of angiogenesis can be useful in promoting wound healing, the vascularization of tissues prone to ischemia such as aged myocardium, skeletal, or smooth muscle, skin (as in the case of nonhealing skin ulcers such as decubitus or stasis ulcers), intestine, kidney, liver, bone, or brain. Measurement of the gene expression levels may be performed by any known methods in the art, including but not limited to, microarray gene expression analysis, bead array gene expression analysis and Northern analysis. The gene expression levels may be represented as relative expression normalized to the ADPRT (Accession number NM_001618.2), GAPD (Accession number NM_002046.2), or other housekeeping genes known in the art. The gene expression data may also be normalized by a median of medians method. In this method, each array gives a different total intensity. Using the median value is a robust way of comparing cell lines (arrays) in an experiment. As an example, the median was found for each cell line and then the median of those medians became the value for normalization. The signal from the each cell line was made relative to each of the other cell lines. In another embodiment of the invention, the single cell-derived or oligoclonal cell-derived cells of this invention may express unique patterns of CD antigen gene expression, which are cell surface antigens. The differential expression of CD antigens on the cell surface may be useful as a tool, for example, for sorting cells using commerically available antibodies, based upon which CD antigens are expressed by the cells. The expression profiles of CD antigens of some cells of this invention are shown in West et al., 2008, Regene Med vol. 3(3) pp. 287-308, incorporated herein by reference, including supplemental information. For example, there are CD antigens that are expressed in ES cells and not (or in some cases, at reduced levels) in the relatively more differentiated cell lines of this invention. This could be a very useful tool for selecting, sorting, purifying and/or characterizing ES cells. Since the CD antigens are expressed on the cell surface and antibodies to them are, generally speaking, commercially available, antibodies (or specific combinations of them) can be used to purify pure populations of ES cells or cells of this invention out of a heterogeneous mixture of cells. This could be useful in various strategies to grow ES cells or cells of this invention, or prepare these cells for various commercial purposes. There are several CD antigens that are robustly expressed in the relative more differentiated cells of this invention, but are not expressed in ES cells (or in some cases at markedly reduced levels). The antigens that fall into this category include: CD73, CD97, CD140B, CD151, CD172A, CD230, CD280, CDw210b. These antigens may be useful in a negative selection strategy to grow ES cells. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived cells, derived by methods of this invention, may be injected into mice to raise antibodies to differentiation antigens. Antibodies to differentiation antigens would be useful for both identifying the cells to document the purity of populations for cell therapies, for research in cell differentiation, as well as for documenting the presence and fate of the cells following transplantation. In general, the techniques for raising antibodies are well known in the art. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived cells may be used for the purpose of generating increased quantities of diverse cell types with less pluripotentiality than the original stem cell type, but not yet fully differentiated cells. mRNA or miRNA can then be prepared from these cell lines and microarrays of their relative gene expression can be performed as described herein. In another embodiment of the invention, the single cell- derived and oligoclonal cell-derived cells may be used in animal transplant models, e.g. transplanting escalating doses of the cells with or without other molecules, such as ECM components, to determine whether the cells proliferate after transplantation, where they migrate to, and their long-term differentiated fate in safety studies. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived cells generated according to the methods of the present invention are useful for harvesting mRNA, microRNA, and cDNA from either single cells or a small number of cells (i.e., clones) to generate a database of gene expression information. This database allows researchers to identify the identity of cell types by searching for which cell types in the database express or do not express genes at comparable levels of the cell type or cell types under investigation. For example, the relative expression of mRNA may be determined using microarray analysis as is well known in the art. The relative values may be imported into a software such as Microsoft Excel and gene expression values from the different cell lines normalized using various techniques well known in the art such as mean, mode, median, and quantile normalization. Hierarchical clustering with the single linkage method may be performed with the software such as The R Projectfor Statistical Computing as is well known in the art. An example of such documentation may be found at http(colon)//sekhon(dot)berkeley(dot)edu/stats/htrnl/hclust.html. A hierarchical clustering analysis can then be performed as is well known in the art. These software programs perform a hierarchical cluster analysis using a group of dissimilarities for the number of objects being clustered. At first, each object is put in its own cluster, then iteratively, each similar cluster is joined until there is one cluster. Distances between clusters are computed by Lance-Williams dissimilarity update formula (Becker, R. A., Chambers, J. M. and Wilks, A. R. (1988) The New S Language. Wadsworth & Brooks/Cole. (S version.); Everitt, B. (1974). Cluster Analysis. London: Heinemann Educ. Books). Typically the vertical axis of the dendograms displays the extent of similarity of the gene expression profiles of the cell clones. That is, the farther down they branch apart, the more similar they are. The verticle axis is a set of n-1 non-decreasing real values. The clustering height is the value of the criterion associated with the clustering method for the particular agglomeration. In order to determine if a new cell line is identical to existing cell lines, two types of replicates are performed: biological and technical replicates. Biological replicates require that new cell lines be grown, mRNA harvested, and then the analysis compared. Technical replicates, on the other hand, analyze the same RNA twice. A line cutoff is then drawn just above where the replicates branch such that cells branching below the cutoff line are considered the same cell type. Another source of data for the database described above may be microRNA profiles of the single cell-derived and oligoclonal cell-derived cells generated according to the methods of the present invention. MicroRNAs (miRNA) are endogenous RNAs of -22 nucleotides that play important regulatory roles in animals & plants by targeting mRNAs for cleavage or translational repression. More than 700 miRNAs have been identified across species. Their expression levels vary among species and tissues. Low abundant miRNAs have been difficult to detect based on current technologies such as cloning, Northern hybridization, and the modified Invader® assay. In the present invention, an alternative approach using a new real-time quantitation method termed looped-primer RT-PCR was used for accurate and sensitive detection of miRNAs as well as other non-coding RNA (ncRNA) molecules present in human embryonic stem cells and in cell lines differentiated from human embryonic stem cells. In another embodiment of the invention, gene expression analysis may be used to identify the developmental pathways and cell types for in vitro differentiated hES cells. Gene expression analysis of single cells or a small number of cells from human or nonhuman embryonic or fetal tissues provides another means to generate a database of unique gene expression profiles for distinct populations of cells at different stages of differentiation. Gene expression analysis on single cells isolated from specific tissues may be performed as previously described by Kurimoto et al., Nucleic Acids Research (2006) Vol. 34, No. 5, e42. Thus, cellular miRNA profiles on their own or in conjunction with gene expression profiles, immunocytochemistry, and proteomics provide molecular signatures that can be used to identify the tissue and developmental stage of differentiating cell lines. This technique illustrates that the database may be used to accurately identify cell types and distinguish them from other cell types. The cells of the present invention are also useful in providing a subset of gene expression markers that are expressed at relatively high levels in some cell lines while not be expressed at all in other cell lines as opposed to genes expressed in all cell lines but at different levels of expression. This subset of "all-or none" markers can be easily identified by comparing the levels of expression as measured for instance through the use of oligonucleotide probes or other means know in the art, and comparing the level of a gene's expression in one line compared to all the other lines of the present invention. Those genes that are expressed at relatively high levels in a subset of lines, and not at all in other lines, are used to generate a short list of gene expression markers. When applied to the cells and gene expression data described herein, where negative expression in Illumina 1 is <170RFU and positive expression is >500RFU, negative expression in Illumina 2 is <160RFU and positive expression is >300RFU, and negative expression in Affy is <50RFU and positive expression is >250RFU, a nonlimiting example of such genes is ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEX1, CFB, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COL21A1, COMP, COP1, CRIPl, CRLF1, CRYAB, CXADR, DI02, METTL7A, DKK2, DLK1, DPT, EGR2, EMID1, FGFR3, TMEM100, FMOl, FM03, FOXF1, FOXF2, FST, GABRBI, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, IFIT3, IGF2, IGFBP5, IL1R1, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT19, KRT34, LAMC2, TMEM119, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MGP, MMP1, MSX1, MSX2, MX1, MYBPH, MYH3, MYH11, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PODN, POSTN, PRELP, PRG4, PROM1, PRRX1, PRRX2, PTGS2, PTN, PTPRN, RARRES1, RASD1, RELN, RGMA, RGS1, RPS4Y2, S100A4, SERPINA3, SFRP2, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, SOX11, SRCRB4D, STMN2, SYT12, TAC1, TFPI2, RSP03, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1, and ZIC2.

Neural Differentiation Medium 2 The cell line to be tested is plated in six well plates at two different densities 5xl0 5 cells/well. The cells are grown under standard growth conditions until they reach confluence. The media is then replaced with 50% DMEM 50% F12 media supplemented with N2 containing and MEM-NEAA, 2 mg/ml heparin, 1 mM cAMP, 200 ng/ml ascorbic acid, 50 ng/ml IGF-1, 10 ng/ml GDNF, 10 ng/ml BDNF).

Safranin O Staining Assay The well-known techniques of staining of formalin-fixed, paraffin-embedded tissue sections with Safranin O are commonly used in the detection of cartilage-related proteoglycans, however, the assay is not absolutely specific to cartilage since it also stains mucin, mast cell granules, and likely other substances in other cell types. A nonlimiting example of the protocol where cartilage and mucin will be stained orange to red, and the nuclei will be stained black and the background stained green uses formalin-fixed micromasses, pellets, or similar aggregations of cells. Reagents used include Weigert's Iron Hematoxylin Solution: in which Stock Solution A composed of 1 gram of Hematoxylin in 100 ml of 95% Alcohol; Stock Solution B composed of 4 ml of 29% Ferric chloride in water diluted in 95 ml of Distilled water and 1.0 ml of concentrated Hydrochloric acid; Weigert' s Iron Hematoxylin Working Solution composed of equal parts of stock solution A and B and used within four weeks; 0.001% Fast Green (FCF) Solution composed of 0.01 gram of Fast green, FCF, C.I. 42053 in 1000 ml Distilled water; 1% Acetic Acid Solution composed of 1.0 ml glacial acetic acid in 99 ml Distilled water; and 0.1% Safranin O Solution composed of 0.1 gram Safranin O, C.I. 50240 in 100 ml Distilled water. Samples are Deparaffinized and hydrated with distilled water. They are stained with Weigert 's iron hematoxylin working solution for 10 minutes, then washed in running tap water for 10 minutes, stained with fast green (FCF) solution for 5 minutes, rinsed quickly with 1% acetic acid solution for no more than 10 -15 seconds, stained in 0.1% safranin O solution for 5 minutes, dehydrated and cleared with 95% ethyl alcohol, absolute ethyl alcohol, and xylene, using 2 changes each, 2 minutes each, mounted using resinous medium, and imaged and analyzed for stains as described above. Cartilage -related proteoglycan stains dark red-orange.

Human Embryonic Chondrogenic Progenitor Line Markers The gene expression markers of the human embryonic progenitor cell lines capable of differentiating into chondroblasts and then chondrocytes expressing higher levels of COL2A1 than normal early passage cultured human articular chondrocytes when said human embryonic progenitor cell lines have undergone 18-21 doublings of clonal expansion following isolation from human ES or similar human primordial stem cell-derived cells are:

The cell line SM30 is positive for the markers: COL15A1, CRYAB, DYSF, FST, GDF5, HTRA3, TMEM119, MMP1, MSX1, MSX2, MYL4, POSTN, SERPINA3, SRCRB4D and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN11, CNTNAP2, COMP, DI02, METTL7A, DKK2, DLK1, DPT, FGFR3, TMEM100, FMOl, FM03, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSPA6, ID4, IFI27, IL1R1, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, PRRX1, PTN, RARRES 1, RASD 1, RELN, RGS 1, SLITRK6, SMOC 1, SMOC2, SNAP25 , STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and WISP2.

The cell line X4D20.8 is positive for the markers: BEX1, CDH6, CNTNAP2, COL21A1, CRIPl, CRYAB, DI02, DKK2, GAP43, ID4, LAMC2, LHX8, MMP1, MSX2, S100A4, SOX11 and THY1 and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN11, COP1, CRLF1, DLK1, DPT, FMOl, FM03, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, KRT14, KRT17, KRT34, MASP1, MEOX2, MSX1, MX1, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PDE1A, PRG4, PROM1, PTN, PTPRN, RARRES1, RGS1, SNAP25, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2, ZIC1 and ZIC2.

The group of cell lines SKll, SK44, SK50 and SK52 are positive for the markers: BEXl , COL21Al , FST, ICAM5, IL1R1, TMEM119, PTPRN, SERPINA3, SFRP2 and ZIC1 and are negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, ATP8B4, C6, C20orfl03, CCDC3, CDH3, CLDN11, CNTNAP2, DI02, DKK2, EMIDl, GABRBI, GSC, HOXA5, HSPA6, IFI27, INA, KRT14, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MMP1, MX1, MYH3, MYH11, IL32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PROM1, PTN, RARRES1, RASD1, RELN, RGS1, SMOC1, SMOC2, STMN2, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH and TUBB4.

The cell line MEL2 is positive for the markers: AKR1C1, AQP1, COL21A1, CRYAB, CXADR, DI02, METTL7A, DKK2, DLK1, DLX5, HAND2, HSD17B2, HSPB3, MGP, MMP1, MSX2,

PENK, PRRX1, PRRX2, S100A4, SERPINA3, SFRP2, SNAP25, SOX1 1, TFPI2 and THY1 and is negative for the markers: ACTC, ALDH1A1, AREG, CFB, C3, C20orfl03, CD24, CDH3, CDH6, CNTNAP2, COL15A1, COMP, COP1, CRLF1, FGFR3, FMOl, FM03, FOXF2, FST, GABRB1, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSPA6, ICAM5, KCNMBl, KRT14, KRT17, KRT19, KRT34, MASP1, MEOX1, MEOX2, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PDE1A, PITX2, PRG4, PTN, PTPRN, RASD1, RELN, RGS1, SMOC1, STMN2, TAC1, TNFSF7, TRH, TUBB4, WISP2, ZIC1 andZIC2.

The cell line X7SM0032 is positive for the markers: ACTC, BEXl, CDH6, COL21A1, CRIPl, CRLF1, DI02, DLK1, EGR2, FGFR3, FOXF1, FOXF2, FST, GABRBI, IGFBP5, KIAA0644, KRT19, LAMC2, TMEM119, MGP, MMP1, MSX1, MSX2, PODN, POSTN, PRG4, PRRX2, PTN,

RGMA, S100A4, SERPINA3, SOX 11 and SRCRB4D and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, ATP8B4, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CLDN11, CNTNAP2, COL15A1, COP1, CXADR, METTL7A, DKK2, DPT, EMIDl, TMEM100, FMOl, FM03, GDF5, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, IL1R1, INA, KCNMBl, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MYBPH, MYH3, MYH11, MYL4, IL32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PITX2, PRELP, PROM1, PTPRN, RASD1, RGS1, SFRP2, SMOC1, SMOC2, SOD3, STMN2, SYT12, TAC1, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2.

The cell line E15 is positive for the markers: ACTC, BEXl, PRSS35, CRIPl, CRYAB, GAP43, GDF5, HTRA3, KRT19, MGP, MMP1, POSTN, PRRX1, S100A4, SOX11, SRCRB4D and THY1 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COP1, CXADR, METTL7A, DLK1, DPT, EGR2, EMIDl, TMEMIOO, FMOl, FM03, FOXFl, FOXF2, GABRBI, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, INA, KRT14, TMEM119, IGFL3, LOC92 196, MFAP5 , MASP 1, MEOX 1, MEOX2, MSX 1, MX1, MYBPH, MYH3, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, PTPRN, RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC1.

Tissue Engineered Constructs In certain embodiments, cells of the present invention are employed in therapeutic applications to repair, replace, or enhance tissue function in a subject (e.g, a mammal, e.g., a human patient). A number of therapies that employ cells incorporated in engineered matrices have been described, a few of which are summarized below. The cells of the present invention may be embedded in such matrices to prvide form and function as is well-known in the art. In certain embodiments, synthetic matrices or biological resorbable immobilization vehicles (sometimes referred to as "scaffolds") may be impregnated with cells of the present invention. A variety of synthetic carrier matrices have been used to date and include: three-dimensional collagen gels (U.S. Pat. No. 4,846,835; Nishimoto (1990) Med. J. Kinki University 15; 75-86; Nixon et al. (1993) Am. J. Vet. Res. 54:349-356; Wakitani et al. (1989) J. Bone Joint Surg. 71B:74-80; Yasui (1989) J. Jpn. Ortho. Assoc. 63:529-538); reconstituted fibrin-thrombin gels (U.S. Pat. Nos. 4,642,120; 5,053,050 and 4,904,259); synthetic polymer matrices containing polyanhydride, polyorthoester, polyglycolic acid and copolymers thereof (U.S. Pat. No. 5,041,138); and hyaluronic acid-based polymers (Robinson et al. (1990) Calcif. Tissue Int. 46:246-253). For example, the cells of the present invention may be employed in tissue reconstruction as described in Methods of Tissue Engineering (2002), edited by Anthony Atala and Robert P. Lanza and published by Academic Press (London), incorporated by reference herein for its description of tissue reconstruction (see, e.g, pages 1027 to 1039). As described therein, cells may be placed into a molded structure (e.g., by injection molding) and transplanted into an animal. Over time, tissue produced by the cells of the present invention will replace the molded structure, thereby producing a formed structure (i.e., in the shape of the initial molded structure). Exemplary mold materials for the molded structure include hydrogels (e.g., alginate, agarose, polaxomers (Pluronics)) and natural materials (e.g., type I collagen, type II collagen, and fibrin). In certain embodiments, cells of the present invention may be cultured in vitro to form a synthetic tissue-like material. The resulting tissue may be implanted subsequently into a subject at the site of the defect. This type of approach has the advantage that the development of the synthetic tissue may be monitored prior to implantation. In addition, the resulting tissue may be characterized biochemically and morphologically prior to implantation. Numerous different procedures have been developed for growing synthetic tissue in vitro, including growing cells in an anchorage-dependent or an anchorage-independent manner. In the anchorage-independent manner, cells may be cultured as colonies within an agarose gel. See for example: Benya et al. (1982) Cell 30:215-224; Aydlotte et al. (1990) in Methods and Cartilage Research Chapter 23:pp. 90-92; Aulthouse et al. (1989) In Vitro Cellular and Developmental Biology 25:659-668; Delbruck et al. (1986) Connective Tissue Res. 15:1550-172; and Bohme et al. (1992) J. Cell Biol. 116:1035-1042. Alternatively, in another anchorage- independent method, cells may be cultured as colonies in suspension culture. See for example, Franchimont et al. (1989) J. Rheumatol. 16:5-9; and Bassleer et al. (1990) in "Methods and Cartilage Research", Academic Press Ltd., Chapter 24. In the anchorage-dependent method, primary cultures of cells may be grown as monolayers attached to the surface of a cell culture flask. See for example: Yoshihashi (1983) J. Jpn. Ortho. Assoc. 58:629-641; and U.S. Pat. No. 4,356,261, incorporated by reference herein in its entirety. In certain embodiments, a cartilage therapy of the invention includes those described in U.S. Patents 5,723,331 and 5,786,217 (entitled "Methods and compositions for the repair of articular cartilage defects in mammals", both of which are incorporated by reference herein in their entirety). These patents describe methods for preparing in vitro a synthetic cartilage patch for the repair of a cartilage defect. When the cartilage-producing cells of the present invention are employed, the methods include the steps of: (1) seeding cartilage-producing cells of the present invention into a pre- shaped well having a cell contacting, cell adhesive surface; and (2) culturing the cartilage-producing cells of the present invention in the well for a time sufficient to permit the cells to secrete an extracellular matrix, thereby to form a three-dimensional, multi cell-layered patch of synthetic cartilage. The resulting synthetic cartilage (e.g., synthetic articular cartilage), contains cartilage- producing cells of the present invention dispersed within an endogenously produced and secreted extracellular matrix. The resulting synthetic cartilage patch may be used subsequently for the repair (or replacement) of a cartilage defect in a subject (e.g., a mammal). The cells of the present invention thus find use in numerous therapeutic applications for treating diseases or conditions characterized by tissue damage or degeneration as well as for complete replacement of those tissues. Diseases and conditions include, but are not limited to osteoarthritis, chondromalacia, chondromalacia patella, hallux rigidus, hip labral tear, torn meniscus, cartilage replacement (ear, nose), nervous disorders, endocrine disorders, muscle disease, injuries to tendons and ligaments, etc.

Direct injection of cells to impart tissue regeneration Direct injection of cells, such as the cell lines of the present invention are also of therapeutic utility. Doses and formulation will vary depending on the route of administration, tissue type, and nature of the pathology to be treated as is known in the art, but in the case of humans and most veterinary animals species, the dosage will be between 102 - 106 cells and the formulation can be, by way of nonlimiting example, a cell suspension in isosmotic buffer or a monolayer of cells attached to an layer of extracellular matrix such as contracted gelatin. Cellular compositions of the present invention may further comprise an acceptable carrier, such as a hydrophilic, e.g., pharmaceutically acceptable, carrier.

SYSTEMS AND K ITS

Also provided by the subject invention are systems and kits that include the cells of the invention for use in various applications, as described herein. The systems and kits may further include reagents and materials for the propagation and use of the cells for research and/or therapeutic applications as described herein.

Biological Deposits Cell lines described in this application have been deposited with the American Type Culture Collection ("ATCC"; P.O. Box 1549, Manassas, VA 20108, USA) under the Budapest Treaty. The cell line 4D20.8 (also known as ACTC84) was deposited at the ATCC at passage 11 on July 23, 2009 and has ATCC Accession No. PTA- 10231. The cell line SM30 (also known as ACTC256) was deposited at the ATCC on July 23, 2009 at passage 12 and has ATCC Accession No. PTA- 10232. The cell line 7SM0032 (also known as ACTC278) was deposited at the ATCC at passage 12 on July 23, 2009 and has ATCC Accession No. PTA-10233. The cell line E15 (also known as ACTC98) was deposited at the ATCC at passage number 20 on September 15, 2009 and has ATCC Accession No. PTA- 10341. The cell line MEL2 (also known as ACTC268) was deposited at the ATCC at passage number 22 on July 1, 2010 and has ATCC Accession No. PTA-1 1150. The cell line SKI 1 (also known as ACTC250) was deposited at the ATCC at passage number 13 on July 1, 2010 and has ATCC Accession No. PTA-11152. The cell line 7PEND24 (also known as ACTC283) was deposited at the ATCC at passage number 11 on July 1, 2010 and has ATCC Accession No. PTA-1 1149.

EXAMPLES The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.

Example 1 As described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby" (incorporated herein by reference in its entirety), the gene expression markers of cell lines cultured as described show evidence of marked diversity. Also described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, is the observation that said gene expression markers vary with cell culture passage. Therefore the markers were described as useful in identifying said cell lines at the point in clonal or oligoclonal passage described, specifically, the markers shown in Table I herein were taught as useful markers when the cell lines were at 18-21 population doublings of clonal expansion (i.e. the first cell being doubling zero, the first doubling being two cells, the second doubling being four cells, the twentieth doubling being approximately one million cells). The cell line Zl 1 (also known as ACTC194) described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, and whose gene expression markers are disclosed in Table 1 as being positive for ATP8B4, CD24, DLK1, FOXF1, FST (NM_01 3409.1), HTRA3, IGF2 (Illumina probe ID 2413956), IGFBP5, IL1R1, MSX1, NLGN4X (NM_181332.1), OSR2 (NM_053001.1), PODN, PROM1, PRRX2, PTN, SOD3, SOX11, SRCRB4D, STMN2 and TFPI2 and negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, CFB, C6, C7, PRSS35, CCDC3, CDH3, CLDN11, CNTNAP2, COMP, CRIPl, CRLF1, DI02 (NM_000793.2), DKK2, DPT, EMID1, FMOl, FM03 (NM_006894.3), GAP43, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, LAMC2 (NM_005562.1), IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH11, MYL4 (NM_002476.2), IL32, NPPB, OLRl, PAX2, PITX2, RARRESl, RASDl, RGSl, SMOCl, SMOC2, SNAP25, TACl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZIC1 andZIC2 at 18-21 doublings of clonal expansion was passaged in Promocell Smooth Muscle medium (Cat# C-22062B) with supplements as per manufacturer's instructions. At passage 18 (corresponding to a total of approximately 45 doublings of clonal expansion) the cells were plated in conditions to synchronize in quiescence as described herein, and microarray analysis of gene expression was performed as described herein. At this number of doublings, the line expressed similar markers, being positive for ATP8B4, CD24, DLK1, FOXF1, FST (NM_013409.1), IGF2 (Illumina probe ID 2413956), IGFBP5, IL1R1, MSX1, PODN, PROM1, PRRX2, PTN, SOD3, SOX11, STMN2 and TFPI2 and negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, CFB, C6, C7, PRSS35, CCDC3, CLDN11, CNTNAP2, COMP, CRIPl, CRLF1, DI02, DKK2, EMID1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSPB3, IFI27, INA, KCNMB 1, KIAA0644, KRT14, KRT17, KRT34, LAMC2 (NM_005562.1), IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MXl, MYBPH, MYH3, MYH11, IL32, NPPB, PAX2, PITX2, RARRES1, RASD1, RGS1, SMOC1, SMOC2, SNAP25, TAC1, TRH, TUBB4, UGT2B7, WISP2, ZIC1, ZIC2, and little to no expression of PRSS35, but unlike the cells at 18-21 doublings, the cells at PI 8 (45-50 doublings of clonal expansion) lost expression of HTRA3, NLGN4X (NM_181332.1) and little to no detectible OSR2 (NM_053001.1) and SRCRB4D and were positive for the expression of CDH3, DPT, OLR1 , TNNT2, they were positive for FM03 accession numbers NM_00 1002294.1 and NM_006894.4 and showed a low but positive expression of FMOl and MYL4 (NM_002476.2). The cells were FST positive for NM_013409.1 but low or negative for NM_006350.2, not inconsistent with earlier findings.

Example 2. The discovery of muscle progenitors. The cell line Z l 1 (also known as ACTC194) described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, and whose gene expression markers at 18-21 doublings of clonal expansion are disclosed in Table 1 and in Example 3 (where markers at both 18-21 and 45-50 doublings of clonal expansion are disclosed), was passaged in Promocell Smooth Muscle medium (Cat# C-22062B) with supplements as per manufacturer's instructions. At passage 18 (corresponding to a total of approximately 45-50 doublings of clonal expansion) the cells were plated as micromasses of approximately 250,000 cells for 14 days under conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII, that are expected to cause chondrogenic differentiation in cells capable of such differentiation. Despite the expression of markers such as DLX5 and MSX1 (markers of mandibular mesenchyme), Zll did not differentiate into chondrocytes, instead, surprisingly, such conditions induced the cell line Zll to differentiate into cells with markers of muscle cells, including the up-regulation of MYH11 (106RFUs (background levels and consistent with them being negative for this marker at 18-21 doublings of clonal expansion) in control cultures to 9067 RFUs at day 14), (DES from RFU value of 104 (background level) to RFU of 824), and (ACTA1 from 103 (background level) to 202).

Example 3. Low Throughput screen for chondrogenic progenitors Scoring by qPCR The cell lines of the present invention designated 7SM0032, W10, 7PEND24, 7SM007, 4D20.8, SM28, EN2, Z11,EN13, EN31, EN47, EN55, MW1, Wll, E44, E68, El 11, MEL2, EN1, EN26, Zl, Z2, EN4, RAPEND18, 7PEND30, E33, SM2, SM30, EN7, EN42, T14, U31, F15, W8, E164, T43, 7PEND9, RAD20.16, T44, EN51, RAPEND15, EN16, B16, 7SM0025, RAD20.6, E69, SM33, SK11, EN18, SK25, SM35, 7PEND12, SK47, CM02, SK17, 7SKEL4, SK49, SK46, RASKEL18, E15, RASM019, T7, SM8, SM22, SK18, SK31, Z3, T42, 7SM009, 10RPE8, RAD20.24, 7SM007, RASM012, T36, RAD20.5, T20, E120, 4D20.9, E85, C4ELSR10, C4ELSR5. 1, C4ELS5.6, RAD20. 19, and 4.4 were expanded in vitro > 2 1 doublings of clonal expansion since they were isolated from hES-derived cells, synchronized in quiescence by growing to confluence and replacing the media with media supplemented with a 10-fold reduction in serum or other mitogens as described herein. RNA was extracted from these cells as a control. In a low throughput screen for cells capable of chondogenesis in vitro, cells were cultured in micromass conditions to induce chondrogenesis as described herein for 14 days. RNA from each of these two conditions was converted to cDNA and then examined for expression of genes commonly associated with chondrogenesis (i.e. COL2A1, COMP, CILP, SCX, CRTL1, SOX9, BARX2). Gene-specific primer pair probes were obtained from Invitrogen. Samples for testing were prepared in standard Optical 96-well reaction plates (Applied Biosystems Carlsbad, CA, PN 4306737) consisting of 30ng of RNA equivalent of cDNA, 0.4uM per primer, Ultra-Pure distilled water (Invitrogen), diluted 1:1 with 12.5ul of Power SYBR Green PCR Master Mix (Applied Biosystems Carlsbad, CA, Cat# 4367659) incorporating AmpliTaq Gold DNA polymerase in a total reaction volume of 25ul. Real- Time qPCR was run using Applied Biosystems 7500 Real-Time PCR System employing SDSvl.2 software. Amplification conditions were set at 50°C for 2 min. (stage 1), 95°C for 10 min. (stage 2), 40 cycles of 95°C for 15 sec then 60°C for 1 min (stage 3), with a dissociation stage at 95°C for 15 sec, 60°C for 1 min, and 95°C for 15 sec (stage 4). Ct values for amplification products of genes of interest were normalized to the average Ct value of 3 housekeeping genes (GAPD, RPS10, and GUSB), and gene expression analyzed relative to that of early passage knee-Normal Human Articular Chondrocytes (Lonza) and cultured human bone marrow mesenchymal stem cells. The primer sets used to detect chondrogenic genes were (" ' is forward primer; "r" is reverse primer): COL2A1 r3 CGATAACAGTCTTGCCCCACTT 10 COL2A1 f4 TGGCCTGAGACAGCATGA 11 COL2A1 r4 AGTGTTGGGAGCCAGATTG 12 CEP68 f 1 ATCCGTAGAGAGCACGGAGA 13 CEP68 r 1 GGACTCTCCATGGGACAAGA 14 SOX9 f 1 TACGACTACACCGACCACCA 15 SOX9 r 1 TCAAGGTCGAGTGAGCTGTG 16 SCXA f 1 TCCAGCTACATCTCG CACCT 17 SCXA r 1 CGGTCCTTGCTCAACTTTCT 18 BARX2 f 1 GGACTTGGCTCAGTCTCTGG 19 BARX2 r 1 TGGGGATGGAGTTCTTCTTG 20

GAPDH f2 GGCCTCCAAGGAGTAAGACC 2 1 GAPDH r2 AGGGGTCTACATGGCAACTG 22 RPS1 0 f 1 ATTTGGTCGTGGACGTGGT 23 RPS1 0 r 1 TTTGGCTGTAAGTTTATTCAATGC 24 GUSB f 1 AAACGATTGCAGGGTTTCAC 25 GUSB r 1 CTCTCGTCGGTGACTGTTCA 26 C0L2A1 f 1 TCTACCCCAATCCAGCAAAC 27 C0L2A1 r 1 GTTGGGAGCCAGATTGTCAT 28 C0L2A1 f2 CACACTGGTAAGTGGGGCAAGACCG 29 C0L2A1 r2 ACGAGGTCCTCACTGGTGAA 30

ACAN f 1 TGAGTCCTCAAGCCTCCTGT 3 1 ACAN r 1 TGGTCTG CAGCAGTTGATTC 32 ACAN f2 ACAGCTGGGGACATTAGTGG 33 ACAN r2 GTGGAATGCAGAGGTGGTTT 34 COL1 0A1 f 1 GCTAAGGGTGAAAGGGGTTC 35 COL1 0A1 r 1 CTCCAGGATCACCTTTTG GA 36 BGN f 1 GGACTCTGTCACACCCACCT 37 BGN r 1 AGCTCGGAGATGTCGTTGTT 38 COL9A2 f 1 AGCATCATTCGG CTGTTACC 39 COL9A2 r 1 CTGAGGGGTGGAACTGTAGC 40

CDMP1 f 1 CCCATCAGCATCCTCTTCAT 4 1 CDMP1 r 1 TGTAGATGCTCCTGCCACAG 42 VERSICAN f 1 ACCACGCTTCCTATGTG ACC 43 VERSICAN r 1 TGTTGTAACTGGGTGGCAAA 44

C0L1 1A 1 f 1 TCGAGG GTTTGATGGACTTC 45

C0L1 1A 1 r 1 CATCTTCTCCCCTCATTCCA 46 DCN f 1 TGGCAACAAAATCAGCAGAG 47 DCN r 1 GCCATTGTCAACAGCAGAGA 48 FMOD f 1 CCTCCAAGGCAATAGGATCA 49 FMOD r 1 GCTGCGCTTGATCTCGTTC 50

LUM f 1 TGATCTGCAGTGGCTCATTC 5 1 LUM r 1 AAAAGAGCCCAGCTTTGTGA 52

COL1 A 1 f 1 GTGCTAAAGGTGCCAATGGT 53

COL1 A 1 r 1 ACCAGGTTCACCG CTGTTAC 54

COL1 A 1 f2 GTGCTAAAGGTGCCAATGGT 55

COL1 A 1 r2 CTCCTCG CTTTCCTTCCTCT 56 PRELP f 1 TCCCAATCTTGCCTTCATTC 57 PRELP r 1 GTCATGGAACG CCACTAG GT 58 ACAN f3 TCGAGGACAGCGAGGCC 59 ACAN r3 TCGAGGGTGTAGCGTGTAGAGA 60

COL1 0A1 f2 CAAGG CACCATCTCC AGGAA 6 1

COL1 0A1 r2 AAAGGGTATTTGTGGCAGCATATT 62 CRTL1 f2 TTCCACAAGCACAAACTTTACACAT 63 CRTL1 r2 GTGAAACTGAGTTTTGTATAACCTCTCAGT 64 LUM f2 ACCAGATTGACCATATTGATGA 65 LUM r2 GGACAGATCCAGCTCAACC 66 SOX9 f2 AGGCAAGCAAAGGAGATGAA 67 SOX9 r2 TGGTGTTCTGAGAGGCACAG 68 SOX9 f3 ACTGAGTCATTTGCAGTGTTTTCTGCC 69 SOX9 r3 GTGGGCTGATCCCCTCCAGGT 70

SOX5 f 1 TGGCACTGCACTGGGTAGGA 7 1 SOX5 r 1 AAGGCTGGGAGCCCGTCACT 72 AGC1 /ACAN f4 TGAGTCCTCAAGCCTCCTGT 73 AGC1 /ACAN r4 CCTCTGTCTCCTTGCAGGTC 74 IHH f 1 GGCCGGGAGACCGTGTGTTG 75 IHH r 1 TGGGGCTCGCGGTCCAGTAA 76 IHH f2 TACGCCTGGAGAGTGGGGCG 77 IHH r2 TGGGGCTCGCGGTCCAGTAA 78 COL2A1 f5 TCGTGGGTCCCAGGGGTGAA 79 COL2A1 r5 GACCTGGAGGGCCCTGTGCG 80

COL2A1 f6 TGCTGCCCCATCTGCCCAAC 8 1 COL2A1 r6 CCTGCAGGTCCCTGAGGCCC 82 COL2A1 f7 AGGGCCAGGATGTCCGGCAA 83 COL2A1 r7 TCTGCCACGAGGTCCAGGGG 84 CRTAC1 (CEP-68) f2 CGGGGCGATGGCACCTTTGT 85 CRTAC1 (CEP-68) r2 GATAGAGGCGGTGGGGGCCA 86 COMP f 1 ACAATGACGGAGTCCCTGAC 87 COMP r 1 TCTGCATCAAAGTCGTCCTG 88 BARX2 f2 GAGTCAGAGACGGAACAGCC 89 BARX2 r2 AGTCCCAGAGACTGAGCCAA 90

CHM1 (LECT1 ) f 1 GCGCAAGTGAAGGCTCGTAT 9 1 CHM1 (LECT1 ) r 1 GTTTGGAGGAGATGCTCTGTTTG 92

Col2Al expression expressed as fold-expression compared to cultured early passage normal human articular chondrocytes for the lines screened is shown in Figure 1. Early passage normal human articular chondrocytes (NHAC) set as 1.0 in value. The expression level of COL2A1, quantified as fold-induction compared to NHACs, was not markedly elevated in the majority of the cell lines but strikingly elevated in a small subset of the lines, namely, 7SM0032 technical replicate 2 (154x NHAC expression), 7SM0032 biological replicate 2 (137x NHAC expression), 4D20.8 biological replicate 2 (130x NHAC expression), SM30 (1287x NHAC expression), SM30 biological replicate 2 (13,494x NHAC expression), SM30 technical replicate 2 (1168x NHAC expression), E15 (10,809x NHAC expression), E15 technical replicate 2 (9810x NHAC expression), MEL2 (22x NHAC expression), and SK11 (4x NHAC expression). Surprisingly, there was little if any correlation of COL2A1 induction with commonly-used markers for chondrogenic mesenchyme such as SOX9. Similarly, markers such as AQP1 speculated to be a marker of chondrogenic mesenchymal cells was present at an RFU value of foreskin dermal fibroblasts that did not induce COL2A1 in micromass chondrogenic conditions and was absent in the cell lines of the present invention prior to and after differentiation. For instance, prior to differentiation, AQP1 expression was absent (RFU 135 which is background) in the line SM30, absent (RFU of 126) in SK11, and absent (RFU 139) in the line E15, at 18-21 doublings of clonal expansion (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, supplementary Table II). Neither was the level of expression of SOX9 in the undifferentiated cell lines of the present invention of predictive value in forecasting whether a cell line of the present invention was capable of chondrogenesis. Indeed, no genes could be found in the undifferentiated lines prior to differentiation that correlated sufficiently with the potential of these lines to become chondrocytes to predict such an outcome. The diversity of gene expression markers within the group of SK11, 7SM0032, 4D20.8, MEL2, SM30, and El 5 including site-specific homeobox gene expression, suggest that each line represents a unique and distinguishable type of chondrogenic progenitor. Also surprising was that many of the genes commonly used as markers of in vitro chrondrogenesis such as COMP and CILP were induced in the culture conditions in a nonspecific manner in virtually any cell type including cultured dermal fibroblasts, regardless of whether said dermal fibroblast, for instance, was capable of undergoing true chondrogenesis under the same conditions as evidenced by the expression of COL2A1 and showing histological evidence of cartilage formation. In addition, the cell lines SK11, 7SM0032, 4D20.8, MEL2, SM30, and E15 were clearly distinguishable from cultured bone marrow MSCs in regard to gene expression markers both before and after differentiation. While the bone marrow MSC is commonly described as ALCAM (CD166) positive, the cell lines of the present invention in the undifferentiated state such as SK11, 7SM0032, 4D20.8, MEL2, SM30, and E15 showed CD166 expression was absent (RFU 125 which is background) in the line SM30, absent (RFU of 164) in SKI 1 (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, supplementary Table II). Additional differences of the cell lines of the present invention when compared to MSCs, by way of nonlimiting example, is the expression of CD74 that has been demonstrated to be a more precise marker of MSCs than many of the commonly-used markers that are actually not specific (Ishii et al, 2005 BBRC 332:297-303). As shown in Table VII, undifferentiated MSCs indeed expressed very high levels of CD74 transcript, adipocyte stem cells expressed CD74 as well at lower levels, dental pulp stem cells expressed CD74 at the limits of detection, but the transcript was not detected at all in undifferentiated cells of the present invention capable of inducing COL2A1 including SK11, 7SM0032, 4D20.8, MEL2, SM30, and E15, nor in cultured dermal fibroblasts or in the nonchondrogenic embryonic progenitor line 7SM007. An additional nonlimiting example demonstrating the diversity of the lines and the striking differences with the adult stem cell types studied herein, is the expression of the developmental gene NNAT (NM_181689.1) expressed at high levels in the cell line E15, but not in adult stem cells such as MSCs, adipocyte stem cells, dental pulp stem cells, or dermal fibroblasts. Yet another nonlimiting example of the salient differences of the cell lines of the present invention capable of inducing COL2A1 expression from stem cell types in the art, can be seen by measuring the expression of the gene KCNK2 (NM_001017425.2) known to be a marker of MSCs. As shown in Table VII, KCNK2 is expressed at high levels in MSCs, adipocyte stem cells, and dental pulp stem cells, but was not detectible in several of the lines of the present invention capable of inducing the expression of COL2A1 such as SM30, E15, 4D20.8, MEL2, and SK11. A striking difference of the cell lines of the present invention and bone marrow-derived MSCs is also seen in genes that indicate important therapeutic differences in the cell types. MSCs suffer from undergoing transformation into hypertrophic chondrocytes when they differentiate in vitro. Hypertrophic chondrocytes express genes useful in inducing angiogenesis and provide a temporary matrix that is later invaded by osteoblasts to make bone. Therefore, MSCs do not perform well when injected into the joint, or otherwise transplanted into articular cartilage, in an effort to regenerate that tissue for the treatment of joint cartilage trauma, arthritis, or related uses. The cell lines of the present invention when induced by the chondrogenic conditions herein, induced very little if any expression of IHH, a marker of hypertrophic chondrocytes, while MSCs expressed very high levels of IHH transcript. Similarly, the line 4D20.8 did not express detectable levels of COL10A1, another marker of hypertrophic condrocytes, while MSCs expressed very high levels of the transcript. Therefore, the cell lines of the present invention such as 7SM0032, 4D20.8, SM30, and El 5 show markers that they are superior to MSCs in their ability to differentiate into permanent cartilage for the repair of joint cartilage pathology. Further nonlimiting examples of the differences in the lines SKll, 7SM0032, 4D20.8, MEL2, SM30, and E15 compared with cultured human bone marrow MSCs, adipocyte stem cells, adult dental pulp stem cells is, is shown in Table VII or can be seen by comparing the gene expression markers of the cells with those described herein such as in Table I. Therefore, these results suggest that the cell lines identified in this screen are novel, that the markers commonly used to identify MSCs are not predictive of chondrogenic capacity in human embryonic progenitor cell lines, and that there currently exists no markers that would have predicted that said cell lines would have been the small subset of lines that would respond to chrondrogenic stimuli in expressing true markers of chondrogenesis. Evidence is provided in Example 7 of histological evidence of cartilage formation.

Example 4. Histological and Immunochemical Confirmation of Cartilage Formation. Cell lines of the present invention, such as those discovered in the low throughput screen in Example 6 above as showing moderate to robust induction of COL2A1 such as 7PEND24,

7SM0032, MEL2, SM30, E15, SKI 1, and 4D20.8 as well as controls such as MSCs, adipocyte stem cells, and other cell lines such as foreskin dermal fibroblasts, Zl 1, dental pulp stem cells, 7SM007, E44 and others were exposed to micromass and pellet chondrogenic conditions as described herein for varying times including 1,8,14, and 2 1 days, and a subset of said pellets when transferred into the kidney capsule of SCID mice to promote extended differentiation. Said micromasses and pellets were fixed in formalin and analyzed histologically with H&E stains, Safranin O staining of proteoglycans as described herein, and for immunoreactive COL2A1 using specific antibody and nonspecific antibody as a control. Strong reactivity to Safranin O and/or COL2A1 immunoreactivity was observed in day 14 and 2 1 pellets of the line 4D20.8 and strong Safranin O staining in day 14 micromasses of the line E15. Surprisingly, the cell line RAD20.6 showed immunoreactivity to COL2A1 and Safranin O staining in a day 14 pellet. Figure 2 shows an example of the Safranin O staining of adipose tissue stem cells compared to the lines 4D20.8 at passage 14 compared to MSCs at passage 6 all at day 2 1 of differentiation as a pellet and immunostaining with isotype controls in day 14 pellets of the line 4D20.8 and MSCs.

Example 5. Cell lines of the present invention capable of chondrogenesis are tested for capacity to repair articular cartilage as follows: donated human articular tissue is explanted. 5 X 105 cells of the lines 7PEND24, 7SM0032, MEL2, SM30, E15, SKll, and 4D20.8 were spun down in 15 ml conical tube at 400 X g for 5 min in 10% FBS/DMEM/F12, and incubated overnight to generate cell aggregates. Six mm diameter cylindrical plugs were cored out from the articular explants with Arthrex Single Use OATS System (Naples, Fl). A surgical curette was used to make partial thickness defects approximately 2 mm in size in the articular surface. The defects were filled with cell aggregates of 7PEND24, 7SM0032, MEL2, SM30, E15, SK11, and 4D20.8. The cartilage explants were incubated in 10% FBS/DMEM/F12, in the presence or absence of ΤΟΕβ3. After 4 weeks, explants were fixed, paraffin-embedded, sectioned, and stained with Safranin O for scoring.

Example 6. The discovery of neural crest cells capable of differentiation into dopaminergic cells. The regulator of G-protein signaling 5 (RGS5) accession number NM_003617.2, UDP-N- acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GALNT14) accession number NM_024572.2, hairy/enhancer-of-split related with YRPW motif 2 (HEY2) accession number NM_012259.1, EPH receptor A5 (EPHA5) accession number NM_004439.4, ankyrin 1, erythrocytic (ANKl ) accession number NM_020478.3, cAMP-regulated phosphoprotein, 21kDa (ARPP21) accession number NM_0 16300.4, and neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) accession number NM_00 1007097.1 positive cell line U31 (also known as ACTC236), which is described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, and whose additional gene expression markers at 18-21 doublings of clonal expansion are disclosed in Table 1. The line is distinguishable from fetal neuronal stem cells in that fetal neuronal stem cells did not express GALNT14, RGS5, EPHA5, or NTRK2. To determine the differentiation potential of the line U31, the line was passaged to P17 and PI 8. The cells were plated as micromasses of approximately 250,000 cells for 14 days in the presence of the conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII. Surprisingly, the line U31 did not differentiate into chondrocytes under these culture conditions but instead differentiated into cells with markers of dopaminergic cells with GABA transporters. Said dopaminergic markers include the markers protein phosphatase 1, regulatory (inhibitor) subunit IB (PPP1R1B aka DARPP-32 accession number NM_1 81505.1, cAMP-regulated phosphoprotein, 21kDa (ARPP21) accession number NM_0 16300.4, and tyrosine hydroxylase (TH) accession numnber NM_199293.2, as well as other markers of the nervous system such as the neuropeptide galanin (GAL) accession number NM_015973.3. Said GABA transporters include: solute carrier family 6 (neurotransmitter transporter, GABA), member 1 (SLC6A1) also known as GAT-1 accession number NM_003042.2, solute carrier family 6 (neurotransmitter transporter, GABA), member 13 (SLC6A13) also known as GAT-2 accession number NM_016615.2, solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 (SLC6A12) also known as BGT-1 accession number NM_003044.2. Clonal, oligoclonal, or polyclonal embryonic progenitors with a pattern of gene expression of the cell line of the present invention U31 are useful in screening for pharmaceutically-active agents targeting transporters such as SLC6A1 useful in the treatment of anxiety (Thoeringer CK, et al, 2009 The GABA transporter 1 (SLC6A1): a novel candidate gene for affective disorders including anxiety ( Neural Transm. Jun;116(6):649-57. Epub 2008 Jul 8), neuropathic pain (Gosselin RD et al, 2010. Upregulation of the GABA transporter GAT-1 in the gracile nucleus in the spared nerve injury model of neuropathic pain, Neurosci. Lett. 480:132), and SLC6A13, and SLC6A12 for agents useful in the treatment of epilepsy, stroke, schizophrenia, Huntington's disease Parkinson's disease (Madsen KK et al, 2009 Synaptic and extrasynaptic GABA transporters as targets for anti-epileptic drugs. J

Neurochem. 109: Suppl 1: 139-144.; Clarkson AN et al, 2010 Reducing excessive GABA-mediated tonic inhibition promotes functional recovery after stroke. Nature 468:305; Kleppner, SR and Tobin, AJ 2001 GABA signalling: therapeutic targets for epilepsy, Parkinson's disease and Huntington's disease Expert Opinion on Therapeutic Targets April 2001, Vol. 5, No. 2 : Pages 219-239). Said hES or hiPS-derived clonal, oligoclonal, or polyclonal cultured embryonic progenitor cells where the culture is assayed positive for a pattern of gene expression of: NTRK2, RGS5, ANK1, GALNT14, HEY2, EPHA5, and ARPP21 can be formulated for therapeutic use such as by injection into the brain, peripheral nervous system, or spinal cord as cells in an saline, or other solutions well known in the art. In the case of ischemic disease such as stroke, the cells may be injected directly into the stroke cavity where the cells and the trophic effects of the cells can be used to improve neuroplasticity and clinical outcome in peri-infarct tissue. Specifically, the cells may by combined with biopolymer hydrogels designed to increased stability and survival during transport and engraftment, thereby reducing the need for multiple injections, and reduce the distribution of the cells to peripheral organs. Hyaluronan gels have mechanical properties similar to brain tissue and do not promote local scarring or tissue reaction, including but not limited to Zhong J, et al, 2010 Hydrogel matrix to support stem cell survival after brain transplantation in stroke (Neurorehabil Neural Repair. 24(7):636-44. Epub 2010 Apr 27) incorporated herein by reference. In brief, A hyaluronan- heparin-collagen hydrogel (HyStem-HP, Glycosan, Salt Lake City, UT) is polymerized with thiol-modified sodium hyaluronate, heparin sulfate, and gelatin that is cross-linked with polyethylene glycol diacrylate. Therapeutically-useful doses of cells with a pattern of gene expression of the cell line of the present invention U31 such as100,000, 500,000, 1 million, 5 million, 10 million, 50 million, 100 million, or 500 million cells are mixed in 1, 5, 10, 20, 30, 40, or 50 mL volume respectively of hyaluronan/heparin sulfate, gelatin, and cross-linker to form a stem-cell-hydrogel formulation.

Example 7. The discovery of additional cells capable of differentiation into smooth muscle cells. The HAND2 and SCARA5 positive cell line W10 (also known as ACTC196) whose most distal HOX gene expression was HOXA4, B7, which is described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, and whose gene expression markers at 18-21 doublings of clonal expansion are disclosed in Table 1, was passaged to PI4. The cells were plated as micromasses of approximately 250,000 cells for 14 days under conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII, that are expected to cause chondrogenic differentiation in cells capable of such differentiation. Surprisingly, the line W10 did not differentiate into chondrocytes under these conditions but instead differentiated into cells with markers of smooth muscle cells, including the markers MYH11 and GNA14. The presence of MYH11 was confirmed by immunocytochemistry. A comparison of alternative differentiation conditions including two weeks of culture in the presence of 1.0 uM all trans retinoic acid also showed an induction of MYH11 in the W10 cell line.

Example 8. The discovery of cells capable of differentiation into derivatives of intermediate mesoderm. The WT1 and NPNT positive cell line RASM012 (also known as ACTC154), which displayed distal HOX gene expression of HOXA4, HOXB8, and HOXC8 as a result of differentiation in the presence of retinoic acid as described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, and whose gene expression markers at 18-21 doublings of clonal expansion are disclosed in Table 1, was passaged to P14. The cells were plated as micromasses of approximately 250,000 cells for 14 days under conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII, expected to cause chondrogenic differentiation in cells capable of such differentiation. Surprisingly, the line RASM012 did not differentiate into chondrocytes under these conditions but instead differentiated into cells with markers of nephrogenic mesenchyme, including an induction of MSX1 and SALL1.

Example 9. The discovery of cells capable of expressing EGFL6.The secreted protein encoded by the gene EGF-like-domain, multiple 6 (EGFL6) also known as MAEG, is a member of the epidermal growth factor (EGF) repeat superfamily. It is expressed in fetal tissues and numerous tumors including those of the lung and meninges. It has also been shown to promote adipogenesis and hair follicle growth in normal tissues. The ability of Egfl6 to promote mitogenesis in meningeal and epidermal cell types and to promote adipogenesis makes a source of the factor useful as a means to promote epithelial tissue growth, e.g., skin keratinocyte regeneration and hair follicle growth stimulation, repair of meninges resulting from trauma or CNS surgery, and to promote adipogenesis such as in the case of age-related atrophy of subcutaneous fat, such as commonly occurs on the dorsal aspect of the hands and if the tissue surrounding the globe of the eye. Cell lines naturally producing the factor can be used to manufacture the protein in vitro wherein the protein is extracted by means known in the art such as Secreted Protein Extraction Method 1 or Extracellular Matrix Extraction Methods 1 and 2 and purified for research or therapeutic use or the cells could be transplanted at the site of injury or disease to produce the factor in vivo. Such in vivo use may utilize cells in a variety of formulations described herein including engineered matrices combined with the cells that are viable or cells that have been mitotically inactivated in order to allow the cells to produce the factor for a limited duration. Research uses of the factor include the use of the factor to enhance proliferation of varied cells in vitro including epithelial and meningeal cells, and to promote adipocyte differentiation in vitro. The protein can be purified by Secreted Protein Extraction Methodx 1 or 2 or Extracellular Matrix Extraction Method 1 (as described hereinabove) or left as an intact ECM on tissue culture plastic for use in cell culture. To identify cells of the present invention useful in producing EGFL6, the lines of the present invention were exposed to diverse differentiation conditions as described herein and the levels of EGFL6 expression by microarray analysis was scored. The clonal human embryonic progenitor cell line 7SMQQ32 which was observed to expresses the metabotropic glutamate receptor GRML the nicotinic cholinergic receptor CHRNA3, the transcription factors LHX1 and MSX2, and the genes BBOX1, DLK1, and BMP5, expressed EGFL6 in both the undifferentiated state as well as most differentiation conditions, such as Micromass 1.

Example 10. In vitro model of stabilization using mural cells of the present invention. Cell lines expressing RGS5 are detected by microarray, PCR, immunocytochemistry, or other means known in the art (see, e.g., Uemura AK, Kusuhara S et al (2006) Angiogenesis in the mouse retina: a model system for experimental manipulation. Exp Cell Res 312(5):676-683). For example, the cell lines CM02, E33, El 11 (which express the gene expression markers MAL, EYA4, RGS5, MEOX1, CLDN2, UGT2B7, ELF3, ANKRD34B, and ZBED2), E164, SM28, and l express RGS5 (relative fluorescence values of >150 being considered positive). Additional markers for these cell lines can be found in Table I.

Example 11. Embryonic progenitors to the blood brain barrier Aspects of the rpesent invention include embryonic progenitors of blood brain barrier cells. These cells find use in numerous therapeutic applications, e.g., repair of blood brain barrier cells, as well as in drug screening asays.

The blood-brain barrier is formed by the brain capillary endothelium and excludes from the brain -100% of large-molecule neurotherapeutics and more than 98% of all small-molecule drugs, thus making it a bottleneck in brain drug development that limits the growth of neurotherapeutics (see, e.g., Pardridge, NeuroRx. 2005 January; 2(1): 3-14 entitled "The Blood-Brain Barrier: Bottleneck in Brain Drug Development"; incorporated herein by reference in its entirety). In view of this bottle-neck, the development of in vitro assays for screening therapeutic agents that can cross the blood brain barrier, or agents that can facilitate the crossing of other therepeutic agents that cannot themselves cross the blood breain barrier, is needed.

A number of different genes have been identified that play a role in transport of molecules, including therapeutic agents, across cells, incuding cells of the blood brain barrier. These genes include those that encode so called transporters, e.g., eflux and uptake (or influx) transporters. Exemplary transporter genes include efflux trasnporters ABCB1, ABCG2 and ABCC2, as well as uptake (or influx) transporters SLC01B1, SLC02B1 and SLC22A1 (the organic anion transporting polypeptides (OATP) family of influx transporters). (For further description of transporters, see the following exemplary references, which are incorporated herein by reference: Rodrigues et al., Acta Pharmacol Sin. 2009 Jul;30(7):956-64 "The expression of efflux and uptake transporters are regulated by statins in Caco-2 and HepG2 cells."; Luo et al., Amino Acids. 2010 Apr 11. "Design and recombinant expression of insulin-like peptide 5 precursors and the preparation of mature human INSL5."; and Kalliokoski, et al., Br J Pharmacol. 2009 Oct;158(3):693-705 "Impact of OATP transporters on pharmacokinetics.")

Example 12. Preadipocytes and their uses. At least three distinct types of adipocytes are known in mammals; namely, visceral white adipocytes, and subcutaneous white and brown adipocytes. While an increased mass of visceral white adipocytes is thought to play a role in type 2 diabetes mellitus, dyslipidemia, cholesterol gallstones, hypertension, atherosclerosis, and hepatic steatosis, an increased number of subcutaneous white and brown adipocytes is thought to lead to improved glucose metabolism and energy consumption potentially leading to overall loss of body fat. Brown fat is a source of heat through uncoupling reactions. It has recently been speculated that the transplantation of certain non-visceral white or brown adipocytes, preadipocytes, or similar adipocyte progenitor cells could be useful in improving insulin sensitivity, and decreasing body fat with numerous potential health benefits (Tran and Kahn, 2010. Nat. Rev. Endocrinol. 6(4): 195-213). However, said cell-based therapies require a robust source of purified and specific cells useful in supplying such activity. Markers known in the art as useful in identifying adipocyte progenitors include PPARG. MYF5 has been reported to be a marker of brown adipocyte progenitors with PRDM16 and CEBPB being critical transcription factors in brown adipocyte differentiation (Seale P, et al. PRDM16 controls a brown fat/ skeletal muscle switch. Nature 2008;454:961-8). However, many cell types express these factors and therefore one skilled in the art would not be able to identify primordial stem cell-derived clonal embryonic progenitors capable of differentiating into visceral white, cutaneous white, or brown adipocyte based on markers known in the art. To obtain hES-derived clonal progenitor lines of the present invention capable of differentiating into cutaneous white and brown adipocytes, designated herein as clonal embryonic cutaneous adipocyte progenitor cells (ECAPCs), progenitor lines expressing EYA4 were identified. Among other differentiated cell types, EYA4 is expressed in primitive dermatome progenitors. The cell lines of the present invention designated C4ELSR2, C4ELS5.1, El 11, E120, J16 (expressing ADH1A, ADH1B, EYA4, FABP4, CD36, PPARG, ANGPT2, EBF2, and DBC1), and RAD20.5 are differentiated according to adipogenesis protocols 1 and 2 (Table VIII), RNA is harvested after 3, 5, 7, and 14 days, and gene expression is analyzed as described herein to detect EYA4 positive embryonic progenitors capable of undergoing differentiation into cutaneous adipocytes and useful for the study of adipocyte differentiation, in transplantation for cosmetic surgery, for imparting weight loss, and for alleviating the symptoms of Type II diabetes as described herein. Preadipocytes (ECAPC) and their differentiated progeny (e.g., cutaneous adipocytes) are useful in numerous autologous and allogeneic transplantation into an animal for both comsmetic and therepeutic purposes. For ECAPCs, differentiation takes place in vivo by means of factors either naturally in the environment and/or introduced factors. In certain embodiments, the site of transplantation is a diseased organ or tissue in need of cosmesis. In other embodiments the site of transplantation is subcutaneous, intraperitoneal, topical, intrasynovial, vaginal, rectal, or intrathecal. Preferably, the subject is mammalian, more preferably, the subject is human. The cell of the invention can be induced to differentiate in vitro or after implantation into a patient. In certain aspects of the invention, the ECAPCs are introduced along with support cells that provide an environment suitable for the in vivo differentiation of the ECAPCs. The support cells can be derived from any source, e.g., from primary cultures and/or cell lines. In some embodiments, the support cells are obtained autologously. In other embodiments, the support cells are obtained allogeneically. In certain embodiments, an ECAPC is provided to a subject in combination with a pharmaceutically acceptable carrier for a therapeutic application to an animal, including but not limited to imparting weight loss, for alleviating the symptoms of Type II diabetes, tissue repair, regeneration, reconstruction or enhancement, and the like. The ECAPC can, in an alternative embodiment, be administered to a host in a two- or three-dimensional matrix for a desired therapeutic purpose. In certain embdoiments, the ECAPCs are encapsulated in a biomaterial compatible with transplantation into a mammal, preferably a human and then transplanting the encapsulated cells into an animal. The encapsulation material should be selected not hinder the release of desired proteins secreted by the cells. The materials used include but are not limited to collagen derivatives, hydrogels, calcium alginate, agarose, hyaluronic acid, poly-lactic acid/poly-glycolic acid derivatives and fibrin. In certain embodiments, transplanted cells and/or their progeny are evaluated histologically for evidence of rejection, teratoma formation, and efficacy. Example 13. Discovery of embryonic progenitor cell lines expressing BMP2 and BMP7. Loss of bone mass such as occurs in age-related osteoporosis or osteonecrosis is a large and growing health care problem despite the availability of recombinant growth factors such as BMP2 and BMP7 (also known as osteogenic protein-1 (OP-1)) that are capable of inducing new bone formation. Cell lines of the present invention capable of expressing relatively high levels of these factors could provide novel therapies wherein these and other useful osteogenic factors are administered through cell transplantaion where the cell lines of the present invention continuously secrete osteogenic factors over an extended period of time. The cell line Z2 (PI 2) was differentiated for 14 days in the presence of recombinant human EGF (lOOng/ml). The expression of BMP2 by microarray showed a RFU value of 1015, and BMP an RFU value of 1084 where an RFU value >150 was considered positive. The cell lines of the present invention 7SM007 (also designated ACTC298 and used at P18), C4.4 (also designated ACTC87 and used at P14), E44 (also designated ACTC170 and used at P18), E69 (also designated ACTClOl and used at P15), SK17 (also designated ACTC162 and used at P14), SK31 (also designated ACTC164 used at P15), SM35 (also designated ACTC260 used at P12), T36 (also designated ACTC198 used at P19), T43 (also designated ACTC120 used at P17), W l 1 (also designated ACTC197 used at P12), and Z2 (also designated ACTC255 used at P12), are cultured to five day quiescence as described herein or alternatively exposed to differentiation conditions of Differentiation Factor Protocol I in Table VIII. Individual differentiation factors from Table III tested in this example included 1.0 uM all-trans retinoic acid (Sigma R2625), lOng/mL SCF, lOng/mL bFGF, 100 ng/mL Activin, 100 ng/mL Noggin, 20 ng/mL HGF, 100 ng/mL EGF, or 100 ng/mL NGF for 7 days in the case of 7SM007, E44, and T43, and 14 days in the case of C4.4SK17 E69, SK17, SK31, SM35, T36, Wll, and Z2. RNA was isolated as described herein and analyzed by Illumina microarrays. At five days of quiescence, the line Z2 differentially expressed gene expression markers such as UGT2B17 (Illumina probe ID 6860392, accession number NM_001077.2), copy-number variation of which is associated with susceptibility to osteoporosis, UGT2B10, MASP1, Amelotin (AMTN) which is specifically expressed in maturation-stage ameloblasts, and FOXQ1. The most distal HOX gene expression is HOXC6, these markers being rarely observed in the other cell clonal embryonic progenitor cell lines of the present invention. Surprisingly, in the case of the cell line Z2 (P12) differentiation for 14 days in the presence of recombinant human EGF (lOOng/ml) led to marked expression of both BMP2 and BMP7 transcripts where BMP2 by microarray showed a RFU value of 1015, and BMP7 an RFU value of 1084 where an RFU value >150 was considered positive. Still significant, though lower amounts of BMP7 expression were observed with cells treated for 14 days in l.OuM retinoic acid (271 RFU) and 10 ng/mL of bFGF (196 RFU). While BMP2 transcript was seen in several lines, BMP7 was not previously observed in the cell lines of the present invention, not even in numerous adult-derived cells such as osteoblasts, bone marrow mesenchymal stem cells, dermal fibroblasts, or articular chondrocytes. This is also surprising since there is no knowledge in the art that cells hES-derived clonal progenitors with the gene expression markers of the line Z2 would be capable of expressing these two genes at such relatively high levels. Such cells can be useful in the treatment of disorders associated with poor bone formation, poor repair of fractures, osteonecrosis, or spinal trauma wherein fusion of vertebrae would stabilize the spinal cord. Treatments include the use of the cells of the present invention as transplant therapy into the site requiring osteogenesis, or the use of the cells in vitro as a means of manufacturing the factors, such as the use of Secreted Protein Isolation Protocol 1 or Secreted Protein Isolation Protocol 2 described herein.

Example 14. Renin-expressing cell lines. Renin is a regulatory component of the renin-angiotensin system. It plays an important role in the regulation of blood pressure and fluid balance. Renin is expressed in the juxtaglomerular cells (JG cells, also known as granular cells) of the kidney which synthesize, store, and secrete the enzyme. It is also occasionally expressed in interlobular and perinrenal arteries. When released, renin cleaves angioteninogen to produce angiotensin I which may be further processed by angiotensin converting enzyme (ACE) to produce angiotensin II that has multiple activities that ultimately elevate systemic blood pressure and electrolyte retention by the kidney. Juxtaglomerular cells are specialized smooth muscle cells in the wall of afferent renal arterioles that deliver blood to the glomerulus. The cell lines of the present invention 7SM007 (also designated ACTC298 and used at PI 8), C4.4 (also designated ACTC87 and used at P14), E44 (also designated ACTC170 and used at P18), E69 (also designated ACTClOl and used at P15), SK17 (also designated ACTC162 and used at P14), SK31 (also designated ACTC164 used at P15), SM35 (also designated ACTC260 used at P12), T36 (also designated ACTC198 used at P19), T43 (also designated ACTC120 used at P17), Wll (also designated ACTC197 used at P12), and Z2 (also designated ACTC255 used at P12), and cultured to five day quiescence as described herein or alternatively exposed to differentiation conditions of Differentiation Factor Protocol I in Table VIII. Individual differentiation factors from Table III tested in this example included 1.0 uM all-trans retinoic acid (Sigma R2625), lOng/mL SCF, lOng/mL bFGF, 100 ng/mL Activin, 100 ng/mL Noggin, 20 ng/mL HGF, 100 ng/mL EGF, or 100 ng/mL NGF for 7 days in the case of 7SM007, E44, and T43, and 14 days in the case of

C4.4SK17 E69, SK17, SK31, SM35, T36, Wl 1, and Z2. RNA was isolated as described herein and analyzed by Illumina microarrays. At five days of quiescence, the line SK17 differentially expressed skeletal muscle markers such as MYOD1 (Illumina probe ID 5570307, accession number NM_002478.4), MYOG (Illumina probe ID 4200224, accession number NM_002479.4), CDH15 (Illumina probe ID 5090195, accession number NM_004933.2), MYLPF (Illumina probe ID 6840092, accession number NM_013292.3), ART3 (Illumina probe ID 7040497, accession number NM_001 179.3), SHD (Illumina probe ID 730093, accession number NM_020209.2), JPH1 (Illumina probe ID 5490025, accession number NM_020647.2), and MYH3 (Illumina probe ID 1070541, accession number NM_002470.2) rarely observed in the other cell clonal embryonic progenitor cell lines of the present invention. Surprisingly, after day 14 the addition of retinoic acid to SK17 markedly upregulated the smooth muscle marker MYH11 (Illumina probe ID6280133, accession numberNM_002474.2) to 1715 RFUs as well as renin (REN; Illumina probe ID 780768, accession number NM_000537.2) not previously observed in the cell lines of the present invention. This is also surprising since while the embryological origins of renin-expressing cells is a matter of dispute, it is generally believed that they arise from metanephric blastema (Maria Luisa S. et al, 2001. Embryonic origin and lineage of juxtaglomerular cells Am J Physiol Renal Physiol 281: F345-F356), and therefore would not be expected to differentiate from a clonal embryonic progenitor cell line expressing skeletal muscle progenitor markers. Such cells can be useful in the treatment of disorders associated with low or dysfunction renin expression including but not limited to renal tubular dysgenesis. Treatments include the use of the cells of the present invention as transplant therapy into dysfunctional kidney or elsewhere in the body to replace lost or dysfunctional renin-secreting cells, or the use of the cells in vitro as a means of manufacturing renin.

Example 15 - Unique fate space of l 1 The clonal human embryonic progenitor cell line Wl 1 was derived from the registered parental hES cell line H9 (WA09) as described (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308). It expresses killer cell lectin-like receptor subfamily C, member 2 and 3 (KLRC2, KLRC3), and Sulfotransferase 1C2 (SULT1C4) that Catalyzes the sulfate conjugation of many drugs and therefore useful in drug discovery. It also expresses BMP5. The most distal HOX gene expression is HOXB2, C6. Upon differentiation under conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII, the line up-regulates smooth muscle markers such as MYH11.

Example 16 - Unique fate space of SK3 1 The clonal human embryonic progenitor cell line SK31 was derived from the registered parental hES cell line H9 (WA09) as described (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308). It expresses ART3, CSAG3A, CSAG3B and oculocutaneous albinism II (OCA2). The most distal HOX gene expression is HOXA5, HOXB8, HOXD13. Upon differentiation under conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII, the line up-regulates tyrosinase-related protein 1 (TYRP1). Example 17 - Unique fate space of SM35 The clonal human embryonic progenitor cell line SM35 was derived from the registered parental hES cell line H9 (WA09) as described (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308). It expresses KLF5, CCDC3, NCAM1, and AMTN. The most distal HOX gene expression is HOXC6. Upon differentiation under conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII. The line up-regulates LAIR2 implicated in the modulation of mucosal tolerance.

Example 18 - The discovery of novel endothelial progenitors There is a widespread interest in understanding the biology of angiogenesis and the invention of means to induce vasculogenesis, neoangiogenesis, and vascular repair in vivo for therapeutic effect. To discover which of the cell lines of the present invention are capable of differentiation into vascular endothelium, As described in Example 10, the cell line W10 (also known as ACTC196) which when cultured > 2 1 doublings of clonal expansion since derivation expresses the differential markers: HAND2 (Illumina probe ID 4640563, accession number NM_021973.2), GPR44 (Illumina probe ID 940519, accession number NM_004778.2), SLC7A14 (Illumina probe ID 6100717, accession number NM_020949.1), ACTN3 (Illumina probe ID 830348, accession number NM_00 1104.1), SULT1C4 (Illumina probe ID 4610593, accession number NM_006588.2), AMOT (Illumina probe ID 3290646, accession number NM_133265.2), FOXF1 (Illumina probe ID 3800554, accession number NM_00145 1.2), NOVAl (Illumina probe ID 3780402, accession number NM_006491.2), and SCARA5 (Illumina probe ID 1030477, accession number NM_173833.4), positive cell line W10 whose most distal HOX gene expression was HOXA4, B7, which is described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, and whose gene expression markers at 18-

2 1 doublings of clonal expansion are disclosed in Table 1, and which is capable of differentiation into smooth muscle cells expressing MYH11, was assayed for capacity to differentiate into endothelial cells using the Endothelial Formation Protocol (Tube Formation) described in Table VIII, using HUVECs as a positive control. In brief, W10 and HUVEC cells were cultured in 12 wells (24well plate) coated with 250 ml of matrigel for each cell line. lxlO 5 cells wwere plated per well (12 wells per cell line). The cells were cultured in EGM2 medium (containing VEGF, IGF and EGF as growth factors), as well as in their corresponding growth media lacking endothelial growth factors. The cell lines W10 and were routinely grown in endothelial medium with no VWF or CHD5 expression while in the undifferentiated state. One of the differential markers of this cell line is HAND2 generally thought to be a marker of neural crest lineages that are believed to be incapable of endothelial differentiation. The cell W10 also did not express KDR as judged by microarray expression using Illumina probe ID 5270452 (accession number NM_002253.1) which is known in the art as one of the earliest markers of endothelial cell fate. However, surprisingly, when incubated 16 hours at 37°C. using the Endothelial Formation Protocol (Tube Formation), W10 cells formed endothelial tubes similar to that of HUVECs (see Figure 3). Cell lines with markers of cell line W10 allow a direct scalability of vascular progenitors and are therefore useful in the scale up of cells for research and therapy. They are also useful as cells delivered intraveneously to induce angiogenesis in tissues such as ischemic myocatdial or other tissues as occurs in aging or peripheral artery disease, or non healing cutaneous ulcers. The cells can be enhanced to target particular tissues when administered intraveneously through the addition of cell surface associated antibodies or peptides such as peptides designed to target diseased or ischemic tissue such as those described in US Patents 6,180,084 and 6,491,894; both to Rouslahti Erkki, et al. and titled "NGR receptor and methods of identifying tumor homing molecules that home to angiogenic vasculature using same" and US Patent 6,576,239, to Rouslahti Erkki, et al. and titled "Angiogenic homing molecules and conjugates derived therefrom" each of which is incorporated herein by reference. In addition, the cells are useful in targeting tumor vascualture to deliver suicide constructs to destroy tumors as described in WO2003/061591 to West entitled "Stem Cell-Derived Endothelial Cells Modified to Disrupt Tumor Angiogenesis" and incorporated herein by reference. Cell lines with the differential markers of the line W10 as described herein are also useful for research in angiogenesis including the study of alterations in gene expression, miRNA expression, and protein composition in cells during the differentiation of cells into varied types of endothelial cells. One skilled in the art would also understand that such cells may be transfected with promoter constructs including CDH5 or other endothelial-specific genes driving the expression of a marker gene or constitutively expressing a marker genes including but not limited to GFP, luciferase, beta galactosidase, or other similar markers in order to track the integration of said cells into the tissues or vascularization of animals, including humans for basic research and for the diagnosis of vascular disorders and cancer wherein cancers display an enhanced vascular turnover. One skilled in the art would also understand that said cells expressing the molecular markers of the cell line W10 capable of undergoing endothelial differentiation can also be generated from pluripotent stem cells such as hES, hiPS, and other primordial stem cells including but not limited to cell banks made under GMP conditions or cells engineered to excape immune surveillance such as by the modification of placental HLA genes such as HLAG or HLAH as described in WO2008/121 894 to Hantash entitled "Endogenous expression of HLA-G and/or HLA-E by Mesenchymal Cells" incorporate herein by reference for the purpose of making said cells more suitable of transplant therapy in humans.

Example 19 - The discovery of novel bioactive secreted protein formulations The cell lines 7SM0032, W10, 7PEND24, 7SM007, 4D20.8, SM28, EN2, Z11,EN13, EN31, EN47, EN55, MWl, Wll, E44, E68, Elll, MEL2, ENl, EN26, Zl, 72, EN4, RAPEND18, 7PEND30, E33, SM2, SM30, EN7, EN42, T14, U31, F15, W8, E164, T43, 7PEND9, RAD20.16, T44, EN51, RAPEND15, EN16, B16, 7SM0025, RAD20.6, E69, SM33, SK11, EN18, SK25, SM35, 7PEND12, SK47, CM02, SK17, 7SKEL4, SK49, SK46, RASKEL18, E15, RASM019, T7, SM8, SM22, SKI 8, SK31, Z3, T42, 7SM009, 10RPE8, RAD20.24, 7SM007, RASM012, T36, RAD20.5, T20, E120, 4D20.9, E85, C4ELSR10, C4ELSR5.1, C4ELS5.6, RAD20.19, and 4.4 are expanded in vitro > 2 1 doublings of clonal expansion since they were isolated from hES-derived cells, synchronized in quiescence by growing to confluence and replacing the media with media supplemented with a 10-fold reduction in serum or other mitogens as described herein. Secreted and extracellular matrix pooled proteins from the cell lines are prepared and screened as described in the method titled Screening of secreted or extracellular matrix proteins for biological activity above. Pooled proteins are mixed with HyStem matrix as described herein and screened for the ability of reducing scarring and improving healing in murine models of wound repair.

Example 20. Screening for cells with osteogenic potential. The cells of the present invention are screened for osteogenic potential by means known in the art, or means simulating conditions leading to bone in normal embryogenesis. By way of nonlimiting example, tissue culture plates were exposed to 12ug/mL of Type I collagen (gelatin) and 12 ug/mL of vitronectin for 24 hours. This gelatin/vitronectin solution was then aspirated and the cell lines of the present invention: CM02, E15, E33, E68, SK11, 4SKEL20, 4D20.8, SM30, J16, and mesenchymal stem cells were plated to confluence and exposed to osteogenic media as described in Table VIII Osteogenic Protocol 1 for 15-21 days. Osteogenesis was scored based on the intensity of calcium deposit staining by Alizarin Red and visualized by phase contrast as described in Table VIII. The cell lines E15, SK11, 4D20.8, showed strong staining, providing evidence that they are capable of producing bone. Such bone-forming cells are useful in research in the embryological origins of diverse types of bone and for therapy, such as in the repair of fractured or otherwise injured bone resulting from trauma or surgery, or from bone forming disorders including age-related osteoporosis.

Example 21. Discovery of the differentiation potential of cells with the pattern of gene expression of the cell line B16. The cell line of the present invention designated B 16 (ACTC59) that expresses the unique pattern of markers MKX (accession number NM_173576. 1), CDH10 (accession number NM_006727.2), MEG3 (accession number NR_002766.1), SCUBE3 (accession number NM_152753.2), and distal HOX genes HOXA11 (accession number NM_000522.3), and HOXD11 (accession number NM_021 192.2) when synchronized at quiescence as described herein by culturing 5 days at confluence in DMEM medium with 0.5% serum at passage 16-19 was differentiated in micromass conditions and in a hydrogel containing crosslinked hyaluronic acid and gelatin with supplemented growth factors from Table III as described in Table VIII under the headings "In vitro conditions to induce chondrogenenesis - Micromass Culture" and "Differentiation in gels containing crosslinked hyaluronic acid and gelatin" in the presence of TGFP3 and retinoic acid as also described in Table VIII under the subheadings "Differentiation in Hydrogels Containing Crosslinked Hyaluronic Acid and Gelatin to Induce Chondrogenesis" and "Retinoic acid and EGF-Containing HyStem-CSS" respectively. Differentiation under conditions described in Table VIII under the headings "In vitro conditions to induce chondrogenenesis - Micromass Culture" led to a profound upregulation of ANGPTL7 (accession number NM_021 146.2), INSL5 (accession number NM_005478.3), the tendon marker TNMD (accession number NM_022144.1), and the tendon marker THBS4 (accession number NM_003248.3). The resulting cells are therefore useful in the treatment of tendon injuries and tendonitis, or inhibit angiogenesis in a given tissue, such as to prevent neovascularization in the cornea, retina, and to inhibit angiogenesis and thereby the growth of malignant tumors. In the differentiation conditions described in Table VIII as "Differentiation in gels containing crosslinked hyaluronic acid and gelatin" in the presence of TGFP3 led to a similar upregulation of ANGPTL7 (accession number NM_021 146.2), INSL5 (accession number NM_005478.3), and the tendon marker TNMD (accession number NM_022144.1). In the differentiation conditions described in Table VIII as "Differentiation in gels containing crosslinked hyaluronic acid and gelatin" in the presence of retinoic acid led to a marked upregulation of natriuretic peptide precursor B (NPPB, accession number NM_002521.2) to 11,851 RFUs of expression. The natriuretic protein encoded by NPPB would be useful in the treatment of heart failure in a manner similar to the exogenous, often intravenous administration of the recombinant protein Nesiritide (Scios) encoded by NPPB is useful for the treatment of heart failure by causing vasodilation and reducing blood pressure and the load on the heart. Unlike the intravenous administration of the natriuretic protein encoded by NPPB, stable engraftment of cells expressing the protein can be utilized to provide a more stable level of expression of the protein over time.

Table I: Exemplary progenitor cell lines and associated gene expression markers at 18-21 doublings of clonal expansion The group of cell lines X2. 1 (also known as 2.1 and ACTC63), X2.2 (also known as X2.2Repl and X2.2Rep2 and 2.2 and ACTC62) are positive for the markers: CFB, CLDN1 1, COMP, CRLFl, EGR2, FST, KRT14, KRT19, KRT34, MFAP5, MGP, PENK, PITX2, POSTN, PTGS2, RARRES1, S100A4, SOD3, TFPI2, THY1 and ZIC1 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, C6, C7, C20orfl03, CCDC3, CDH3, CDH6, CNTNAP2, COP1, CXADR, DI02, METTL7A, DKK2, DLK1, EMID1, FGFR3, FM03, FOXF1, FOXF2, GABRB1, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, IGFBP5, INA, KCNMB1, IGFL3, LOC92196, MEOX1, MSX2, MX1, MYBPH, MYH1 1, MYL4, NLGN4X, NPPB, PAX2, PAX9, PDE1A, PRELP, PROM1, RASD1, RELN, RGS1, RPS4Y2, SFRP2, SMOC1, SMOC2, SNAP25, SYT12, TAC1, RSP03, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC2. The cell line Bl is positive for the markers: CD24, CDH6, HTRA3, INA, KRT17, KRT19, LAMC2, MMP1, IL32, TAGLN3, PAX2, RELN, UGT2B7 and ZIC2 and is negative for the markers: ACTC, AGC1, ALDHlAl, APCDDl, ATP8B4, BEX1, CFB, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CDH3, CNTNAP2, COL15A1, COL21A1, COP1, CRLF1, DI02, METTL7A, DKK2, DLK1, DPT, EGR2, EMID1, FGFR3, TMEM100, FMOl, FM03, FOXF1, FOXF2, FST, GABRB1, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, KCNMB1, KIAA0644, KRT14, TMEM1 19, IGFL3, LOC92196, MFAP5, MASP1, MEOX2, MGP, MYBPH, MYH3, MYH1 1, MYL4, NPASl, OGN, OLRl, OSR2, PAX9, PDEIA, PENK, POSTN, PRELP, PRG4, PROMl, PRRX1, PRRX2, PTN, PTPRN, RARRES1, RASDl, RGMA, RGSl, SERPINA3, SLITRK6, SMOCl, SMOC2, SNAP25, SOD3, STMN2, TACl, RSP03, TNNT2, TRH, TSLP, TUBB4, WISP2 and ZICl . The group of cell lines X4. 1, X4.3 and BIO are positive for the markers: MMP1, AQP1, CDH6, HTRA3, INA, KRT19, LAMC2, IL32, TAGLN3, NPPB and UGT2B7 and are negative for the markers: AGC1, ALDHlAl, APCDDl, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CNTNAP2, COL21A1, COMP, COP1, CRLF1, DI02, METTL7A, DKK2, DLK1, DPT, EMID1, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRB1, GAP43, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGF2, KRT14, TMEM1 19, LOC92196, MASP1, MEOX2, MGP, MYBPH, MYH3, MYL4, OGN, OSR2, PAX9, PDEIA, PENK, PRELP, PRRX2, PTN, RARRES1, RGMA, RGSl, RPS4Y2, SERPINA3, SLITRK6, SMOCl, SMOC2, TACl, RSP03, TNNT2, TRH, TUBB4 and WISP2. The group of cell lines Bl l , B25, B26 and B3 are positive for the markers: AKR1C1, CFB, BMP4, CLDN1 1, FST, GDF5, HTRA3, IL1R1, KRT14, KRT19, KRT34, MGP, MMP1, PODN, POSTN, PRG4, RARRES1, S100A4, THYl and ZICl and are negative for the markers: ACTC, ALDHlAl, APCDDl, C6, C7, C20orfl03, CCDC3, CD24, CXADR, DI02, DKK2, DLK1, EMID1, FGFR3, FMOl, FM03, FOXF1, FOXF2, GABRB1, GDF10, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, INA, KCNMB1, IGFL3, LOC92196, MEOX1, MSX1, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, TAGLN3, NPPB, OLRl, PAX2, PAX9, PROMl, RASDl, RGSl, RPS4Y2, SLITRK6, SMOCl, SMOC2, SNAP25, TACl, RSP03, TUBB4, UGT2B7, ZD52F10 and ZIC2. The group of cell lines B12 and B4 are positive for the markers: CLDN1 1, FST, GDF5, HTRA3, KRT19, KRT34, MFAP5, MGP, MMP1, POSTN, PTGS2, S100A4, THYl and ZICl and are negative for the markers: AGC1, ALDHlAl, APCDDl, AREG, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CDH3, CNTNAP2, COP1, CXADR, DI02, DKK2, DLK1, DPT, EMID1, FMOl, FM03, FOXF1, FOXF2, GABRB1, GDF10, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IGFBP5, IGFL3, LOC92196, MEOX1, MYBPH, MYH3, MYH1 1, MYL4, NPASl, NPPB, OLRl, PAX2, PAX9, PITX2, PROMl, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, TACl, RSP03, TNNT2, TRH, TUBB4, ZD52F10 and ZIC2. The group of cell lines B20 and B15 are positive for the markers: BMP4, CD24, CRIPl, HTRA3, KRT19, LAMC2, MGP, MMP1, POSTN, RELN, S100A4, THYl and UGT2B7 and are negative for the markers: AGC1, ALDHlAl, ANXA8, AREG, ATP8B4, CFB, C6, C7, C20orfl03, CNTNAP2, DI02, METTL7A, DLK1, DPT, EMID1, TMEM100, FMOl, FM03, FOXF2, GABRBI, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, KRT14, KRT34, IGFL3, MASP1, MEOX1, MEOX2, MYBPH, MYH3, MYL4, NPASl, NPPB, OGN, OLRl, OSR2, PAX9, PDEIA, PENK, PROMl, PRRX2, RGSl, SLITRK6, SMOCl, SMOC2, STMN2, TACl, TNNT2, TRH, TUBB4, WISP2 and ZICl . The group of cell lines B16Biolb, B16Bio2b, E72 and E75 are positive for the markers: AKR1C1, BMP4, CLDN1 1, FST, GDF5, HTRA3, IL1R1, KRT19, KRT34, MFAP5, MGP, MMP1, OSR2, PODN, POSTN, PRG4, PRRX1, RARRES1, S100A4, SOD3, THYl and ZICl and are negative for the markers: ACTC, AGC1, ALDHlAl, AREG, C6, C7, C20orfl03, CCDC3, CDH3, CNTNAP2, DKK2, EMID1, FGFR3, FM03, FOXF1, FOXF2, GABRB1, GDF10, HSD1 1B2, HSD17B2, HSPA6, ID4, IGF2, INA, LAMC2, IGFL3, LOC92196, MEOX1, MSX1, MYBPH, MYH1 1, MYL4, NLGN4X, NPASl, NPPB, OLRl, PAX2, PAX9, PROMl, PTPRN, RASDl, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, TACl, RSP03, TNNT2, TUBB4, ZD52F10 and ZIC2. The group of cell lines B17Biolb, B17Bio2c and B17Bio3c are positive for the markers: BEX1, COL15A1, CRIPl, CRYAB, HTRA3, KCNMB1, KRT19, MGP, POSTN, S100A4, SFRP2, THYl and TNFSF7 and are negative for the markers: , AGC1, ALDHlAl, APCDDl, AREG, ATP8B4, C6, C7, CNTNAP2, METTL7A, DLK1, DPT, EMID1, FMOl, FM03, FOXF1, GABRB1, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, IFI27, KRT14, KRT34, IGFL3, MASP1, MEOX1, MEOX2, MYBPH, MYH3, MYL4, NPPB, OGN, PAX9, PDEIA, PENK, PROMl, RASDl, RGSl, SLITRK6, SMOCl, SMOC2, STMN2, TACl, TRH, TSLP, TUBB4 and ZICl . The group of cell lines B2, B7 and X6.1 are positive for the markers: AKR1C1, CFB, BMP4, C3, CLDNl l , COL21A1, FST, GDF5, HTRA3, ICAM5, IL1R1, KRT19, MGP, MMPl, PENK, PODN, POSTN, PRG4, RARRES1, RGMA, S100A4, SERPINA3, SOD3, STMN2, THYl and WISP2 and are negative for the markers: ACTC, AGC1, ALDH1A1, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CXADR, DI02, DLKl, EMIDl, FGFR3, FM03, FOXF1, FOXF2, GABRBI, GDF10, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, INA, IGFL3, LOC92196, MEOX1, MYH1 1, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PAX9, PITX2, PROM1, PTPRN, RASD1, RGS1, RPS4Y2, SLITRK6, SMOC1, SMOC2, SNAP25, SOX1 1, TAC1, RSP03, TUBB4, UGT2B7, ZD52F10 and ZIC2. The group of cell lines B22, CM30.2 and X6 are positive for the markers: BMP4, CLDNl l , CRIPl, CRYAB, HTRA3, KRT19, S100A4, SFRP2, SRCRB4D, THYl and UGT2B7 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COL21A1, COPl, DI02, METTL7A, DKK2, DLKl, DPT, FMOl, FM03, FOXF1, FOXF2, GABRB1, GSC, HOXA5, HSD1 1B2, HSPA6, IFI27, IFIT3, IGF2, KRT14, MASP1, MEOX2, MYBPH, MYH3, MYH1 1, NPPB, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PROM1, RGS1, SMOC1, SNAP25, STMN2, TAC1, TRH, TSLP, TUBB4 and WISP2. The group of cell lines B27, B9, CM10. 1, X2, X4.2 and X4.4 are positive for the markers: HTRA3, KRT19, LAMC2, IL32, TAGLN3, PAX2, RELN and UGT2B7 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CCDC3, CDH3, CNTNAP2, COL21A1, COPl, CRLFl, DI02, METTL7A, DLKl, DPT, EMIDl, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRB1, GAP43, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, IFI27, IGF2, KIAA0644, KRT14, IGFL3, LOC92196, MASP1, MEOX2, MGP, MYH3, MYH1 1, MYL4, NPAS1, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PRELP, PTN, RARRES1, RGMA, RGS1, SERPINA3, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, TAC1, RSP03, TNNT2, TRH, TUBB4 and WISP2. The cell line B28 is positive for the markers: CFB, BMP4, COL15A1, CRIPl, CRYAB, FST, GAP43, IL1R1, KCNMBl, KRT14, KRT19, KRT34, MFAP5, MGP, MMPl, IL32, PODN, POSTN, S100A4, THYl and ZICl and are negative for the markers: ACTC, ALDH1A1, ANXA8, AREG, ATP8B4, BEX1, C3, C6, C7, C20orfl03, CCDC3, CNTNAP2, CXADR, DI02, METTL7A, DKK2, DLKl, EMIDl, FGFR3, FMOl, FM03, FOXF1, FOXF2, GABRB1, GDF10, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, IGFBP5, INA, IGFL3, LOC92196, MASP1, MEOX1, MYBPH, MYH3, MYL4, NLGN4X, NPAS1, NPPB, OLR1, PAX9, PDE1A, PITX2, PROM1, PTPRN, RASD1, RGS1, RPS4Y2, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, TRH, TSLP, TUBB4, ZD52F10 and ZIC2. The cell line B29 is positive for the markers: ANXA8, AQP1, CD24, CDH6, CRIPl, GJB2, HTRA3, KRT17, KRT19, LAMC2, IL32, TAGLN3, PAX2, RELN, S100A4, SFRP2, SRCRB4D, THYl, TNFSF7, UGT2B7, ZD52F10 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, BEX1, C3, C6, C7, C20orfl03, CCDC3, CLDNl l , CNTNAP2, COL21A1, COPl, CRLFl, DI02, METTL7A, DLKl, DPT, EMIDl, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRB1, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, KRT14, KRT34, IGFL3, MFAP5, MASP1, MEOX2, MMPl, MSX1, MYBPH, MYH3, MYL4, NPAS1, NPPB, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PITX2, POSTN, PRG4, PROM1, PRRX2, PTPRN, RARRES1, RASD1, RGS1, RPS4Y2, SERPINA3, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, TAC1, RSP03, TRH, TSLP, TUBB4, WISP2 and ZICl . The cell line B30 is positive for the markers: PRSS35, CDH6, COL21 Al, CRIPl, CRYAB, DKK2, GAP43, KCNMBl, KRT17, KRT19, PRRX1, PTN, RGMA, S100A4, SOX1 1 and ZIC2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CD24, CDH3, CLDNl l , CNTNAP2, COL15A1, COMP, COPl, CRLFl, METTL7A, DPT, EGR2, EMIDl, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MSX1, MYBPH, MYH3, MYL4, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, PTPRN, RARRES1, RASD1, RELN, RGS1, RPS4Y2, SFRP2, SLITRK6, SMOC1, SNAP25, STMN2, TAC1, TFPI2, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZICl . The cell line B6 is positive for the markers: CCDC3, CDH6, COL15A1, CRIPI, DKK2, FST, GDF10, HTRA3, KRT19, LOC92196, MYL4, NLGN4X, S100A4, SOX1 1, SRCRB4D, THY1, ZIC1 and ZIC2 and are negative for the markers: AGCl, AKRICI, ALDHlAl, AREG, ATP8B4, BEXl, CFB, C3, C6, C7, CNTNAP2, COMP, COP1, DI02, METTL7A, DLK1, DPT, EMID1, TMEM100, FM03, FOXF1, FOXF2, GABRB1, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, KRT14, TMEM1 19, MFAP5, MASP1, MEOX1, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, PTPRN, RASD1, RGS1, RPS4Y2, SLITRK6, SMOC1, SNAP25, STMN2, TAC1, TRH, TSLP, TUBB4, UGT2B7, WISP2 and ZD52F10. The cell line C4ELS5. 1 is positive for the markers: AKRICI , C7, CDH6, COL15A1, DI02, FMOl, FM03, FOXF2, IGF2, IL1R1, KRT19, LAMC2, TMEM1 19, PODN, PRRX1, PRRX2, RGMA, SFRP2, TAC1, TFPI2 and RSP03 and are negative for the markers: ACTC, AGCl, ALDHlAl, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEXl, CFB, BMP4, C3, C20orfl03, CCDC3, CDH3, CLDN1 1, CNTNAP2, COMP, COP1, CRLF1, CRYAB, CXADR, DKK2, DLK1, EGR2, EMID1, FGFR3, FOXF1, GABRB1, GAP43, GDF10, GJB2, HOXA5, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MMP1, MSX1, MSX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PROM1, PTPRN, RARRES1, RELN, RGS1, RPS4Y2, SMOC1, SMOC2, STMN2, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line C4ELS5.5 is positive for the markers: BEXl, BMP4, C7, PRSS35, CDH6, DKK2, FM03, FOXF2, FST, GDF10, HSD17B2, IGF2, TMEM1 19, PITX2, PODN, PRRX1, SERPINA3, SFRP2, TFPI2 and ZIC2 and are negative for the markers: AGCl, ALDHlAl, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C20orfl03, CD24, CDH3, CNTNAP2, COMP, COP1, CRLF1, CXADR, DLK1, DPT, EMID1, FGFR3, TMEM100, FOXF1, GJB2, HOXA5, HSD1 1B2, HSPA6, HSPB3, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT34, IGFL3, MFAP5, MEOX1, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, MYH1 1, IL32, NLGN4X, TAGLN3, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PTPRN, RARRES1, RASD1, RELN, RGS1, SMOC2, STMN2, TAC1, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZD52F10 and ZIC1 . The cell line C4ELSR.12 is positive for the markers: C7, CDH6, COL21A1, DI02, FMOl, FM03, FOXF2, FST, IGF2, IL1R1, TMEM1 19, PRRX1, PRRX2, PTN, RGMA, SFRP2, SRCRB4D, TAC1, TFPI2, RSP03, UGT2B7 and ZIC2 and are negative for the markers: ACTC, AGCl, ALDHlAl, ANXA8, APCDD1, AQP1, ATP8B4, C3, C20orfl03, CD24, CDH3, CNTNAP2, COMP, COP1, CRLF1, CXADR, DPT, EMID1, FGFR3, TMEM100, FOXF1, GABRB1, GAP43, GJB2, HOXA5, HSPA6, HSPB3, ICAM5, IFI27, INA, KRT14, KRT17, KRT34, IGFL3, MFAP5, MEOX1, MEOX2, MGP, MMP1, MX1, MYBPH, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, POSTN, PRELP, PROM1, PTPRN, RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOC2, STMN2, SYT12, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZD52F10 and ZIC1 . The group of cell lines C4ELSR2, C4ELSR2Bio2 and C4ELSR2Bio2. 1 are positive for the markers: C7, CDH6, COL21A1, DKK2, FM03, FST, GSC, IGF2, TMEM1 19, PITX2, SFRP2, TFPI2 and ZIC2 and are negative for the markers: ACTC, AGCl, ALDHlAl, APCDD1, AQP1, ATP8B4, CFB, C3, C6, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, COP1, CRLF1, CRYAB, DLK1, DPT, EMID1, FGFR3, TMEM100, FOXF1, GABRB1, GJB2, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, KIAA0644, KRT14, KRT17, KRT34, IGFL3, MFAP5, MEOX1, MGP, MSX2, MX1, MYBPH, MYH3, MYH1 1, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, POSTN, PRELP, PROM1, PTPRN, RARRES1, RASD1, RELN, RGS1, SMOC1, SMOC2, STMN2, THY1, TNFSF7, TRH, TSLP, TUBB4, ZD52F10 and ZIC1 . The group of cell lines CMO.2 and E31 are positive for the markers: AQP1, CD24, CDH6, HTRA3, KRT19, KRT34, TAGLN3, RELN, S100A4, SFRP2, SRCRB4D and UGT2B7 and are negative for the markers: AGCl, ALDHlAl, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COMP, COP1, CRLF1, DI02, METTL7A, DLK1, DPT, EMID1, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRB1, GAP43, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, KRT14, MFAP5, MASP1, MEOX2, MYH3, NPAS1, OGN, OLR1 , OSR2, PAX9, PDE1A, PENK, PRG4, PROM1, PTPRN, RARRES1, RASD1, RGS1, SERPINA3, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, TAC1, TRH, TSLP, TUBB4 and WISP2. The group of cell lines CMO.2, CMO.5 and CM50.5 are positive for the markers: PRSS35, CLDN1 1, CRIPl, CRYAB, FST, KRT19, KRT34, MFAP5, MEOX2, MGP, MMP1, PODN, POSTN, PRRX1, S100A4, THYl and ZIC1 and are negative for the markers: ACTC, ALDHlAl, APCDDl, AREG, ATP8B4, BEX1, C3, C6, C7, C20orfl03, CCDC3, CDH3, CNTNAP2, CXADR, DI02, DKK2, DLK1, EMID1, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRB1, GDFIO, GJB2, GSC, HSD1 1B2, HSD17B2, HSPA6, IGF2, IGFBP5, INA, LAMC2, IGFL3, LOC92196, MEOXl, MXl, MYBPH, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, PAX2, PAX9, PDE1A, PENK, PITX2, PROM1, PTPRN, RASD1, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, RSP03, TRH, TSLP, TUBB4, ZD52F10 and ZIC2. The group of cell lines CM10.4, CM20.4, CM30.5 and X2.3 are positive for the markers: CLDN1 1, COMP, CRIPl, FST, KRT19, KRT34, MFAP5, MGP, PITX2, POSTN, S100A4 and THYl and are negative for the markers: ACTC, ALDHlAl, AQPl, ATP8B4, C6, C7, C20orfl03, CCDC3, CDH3, CNTNAP2, COP1, CXADR, METTL7A, DLK1, DPT, EMID1, FGFR3, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRBI, GDFIO, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IGF2, IGFL3, LOC92196, MEOXl, MXl, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, TAGLN3, NPPB, PAX2, PAX9, PDE1A, PRELP, PROM1, PTPRN, RASD1, RELN, RGS1, SLITRK6, SMOC2, SNAP25, STMN2, TAC1, RSP03, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC2. The group of cell lines El 11 and El 1lBio2 are positive for the markers: CD24, CDH6, CRIPl, HTRA3, INA, TAGLN3, SFRP2, SRCRB4D, UGT2B7 and ZIC2 and are negative for the markers: AGCl, AKRICI, ALDHlAl, APCDDl, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COP1, CRLF1, DI02, METTL7A, DLK1, DPT, EMID1, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRB1, GAP43, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, IGF2, KRT14, LAMC2, MASP1, MEOX2, MXl, MYBPH, MYH3, MYH1 1, NPAS1, OGN, OLR1, PAX9, PDE1A, PENK, PRG4, PROM1, PRRX2, PTPRN, RARRES1, RASD1, RGMA, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, TNNT2, TRH, TUBB4 and WISP2. The cell line E120 is positive for the markers: ACTC, BEX1, CLDN1 1, COL15A1, CRIPl, CRYAB, FST, GDFIO, GJB2, HTRA3, IGFL3, MGP, MXl, IL32, POSTN, S100A4, SFRP2, THYl, TNFSF7, ZD52F10 and ZIC2 and are negative for the markers: AGCl, AKRICI, ALDHlAl, APCDDl, AQPl, AREG, ATP8B4, BMP4, C3, C6, C7, PRSS35, C20orfl03, CD24, CDH3, CNTNAP2, COL21A1, COMP, COP1, CRLF1, CXADR, DI02, METTL7A, DKK2, DLK1, EMID1, FGFR3, FMOl, FM03, FOXF1, FOXF2, GABRB1, GAP43, GDF5, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IGF2, INA, KRT14, LAMC2, TMEM1 19, MASP1, MEOX2, MMP1, MSX2, MYBPH, MYH3, MYH1 1, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PODN, PRG4, PROM1, RASD1, RELN, RGMA, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNNT2, TRH, TUBB4, UGT2B7 and WISP2. The cell line E15 is positive for the markers: ACTC, BEX1, PRSS35, CRIPl, CRYAB, GAP43, GDF5, HTRA3, KRT19, MGP, MMP1, POSTN, PRRX1, S100A4, SOX1 1, SRCRB4D and THYl and are negative for the markers: AGCl, AKRICI, ALDHlAl, ANXA8, APCDDl, AQPl, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COP1, CXADR, METTL7A, DLK1, DPT, EGR2, EMID1, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRB1, GDFIO, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, ΓΝΑ, KRT14, TMEM1 19, IGFL3, LOC92196, MFAP5, MASP1, MEOXl, MEOX2, MSX1, MXl, MYBPH, MYH3, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, PTPRN, RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC1 . The cell line E164 is positive for the markers: AQPl, CD24, CDH6, CRIPl, HTRA3, KRT17, KRT19, IL32, TAGLN3, PAX2, RELN, S100A4, SFRP2, SRCRB4D, THYl, TNFSF7, UGT2B7, ZD52F10 and ZIC2 and are negative for the markers: ACTC, AGCl, ALDHlAl, ANXA8, APCDDl, AREG, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CDH3, CLDN1 1, CNTNAP2, COL15A1, COL21A1, COMP, COP1, CRLF1, DI02, METTL7A, DKK2, DLK1, DPT, EGR2, EMID1, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRB1, GAP43, GDF5, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, KCNMB1, KRT14, KRT34, TMEM1 19, MFAP5, MASP1, MEOX2, MGP, MSX2, MYBPH, MYH3, MYH1 1, MYL4, NPAS1, NPPB, OGN, OLR1, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PRG4, PRRX1, PRRX2, PTGS2, PTPRN, RARRES1, RASD1, RGMA, RGS1, SERPINA3, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, TAC1, TNNT2, TRH, TUBB4 and WISP2. The group of cell lines E69 and E169 are positive for the markers: BEXl, CDH6, CRIPl, FST, GDF5, HTRA3, MMP1, POSTN, PTN, S100A4 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, BMP4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COMP, CRLFl, CXADR, DLK1, DPT, EGR2, EMIDl, FMOl, FM03, FOXF1, FOXF2, GABRBl, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IGF2, INA, KRT14, IGFL3, LOC92196, MASP1, MEOX1, MEOX2, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PROMl, RARRESl, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10. The cell line E19 is positive for the markers: ACTC, BEXl, PRSS35, CLDN1 1, CRIPl, CRYAB, DKK2, HTRA3, ICAM5, KRT17, KRT19, KRT34, MX1, POSTN, THY1, ZIC1 and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COL21A1, COP1, CXADR, METTL7A, DLK1, DPT, EGR2, EMIDl, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, IGF2, IL1R1, KIAA0644, TMEM1 19, IGFL3, LOC92196, MASP1, MEOX1, MEOX2, MGP, MYBPH, MYH3, NLGN4X, TAGLN3, OGN, PAX2, PAX9, PDE1A, PENK, PRG4, PROMl, PRRX2, RARRESl, RASDl, RELN, RGMA, RGSl, SFRP2, SLITRK6, SMOCl, SMOC2, SNAP25, SOD3, STMN2, SYT12, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2 and ZD52F10. The group of cell lines E3, E30, E20Bio2, E67, E73, E57 and E84 are positive for the markers: KRT19, KRT34, MFAP5, MGP, MMP1, S100A4, THY1 and ZIC1 and are negative for the markers: ALDH1A1, AREG, ATP8B4, C7, C20orfl03, CDH3, CNTNAP2, DKK2, DLK1, DPT, FMOl, FM03, FOXF1, FOXF2, GDF10, GSC, HOXA5, HSD17B2, IGF2, MEOX1, TAGLN3, NPPB, PAX9, PROMl, PTPRN, RGSl, SMOCl, SNAP25, STMN2, TAC1, TUBB4 and ZIC2. The cell line E33 is positive for the markers: AQP1, PRSS35, CD24, CDH6, CLDN1 1, CRIPl, CRYAB, DKK2, HTRA3, KRT17, KRT19, KRT34, LOC92196, MFAP5, MGP, MYH1 1, TAGLN3, POSTN, S100A4, SRCRB4D, UGT2B7, ZIC1 and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COMP, COP1, CRLFl, DI02, METTL7A, DLK1, DPT, EMIDl, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRBl, GDF5, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, TMEM1 19, IGFL3, MASP1, MX1, MYBPH, NPAS1, NPPB, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMl, PTPRN, RARRESl, RASDl, RGMA, RGSl, SERPINA3, SFRP2, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, TAC1, RSP03, TRH, TSLP, TUBB4, WISP2 and ZD52F10. The cell line E40 is positive for the markers: BEXl, CDH6, CLDN1 1, CRIPl, CRYAB, DKK2, FST, HTRA3, KRT17, KRT19, MMP1, POSTN, S100A4, SRCRB4D and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COMP, COP1, CRLFl, CXADR, METTL7A, DLK1, DPT, EGR2, EMIDl, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRBl, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, KIAA0644, KRT14, IGFL3, LOC92196, MASP1, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMl, PRRX2, PTPRN, RARRESl, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, SYT12, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZD52F10 and ZIC1 . The cell line E44 is positive for the markers: BEXl, CLDN1 1, CRIPl, FST, GDF5, HTRA3, IFI27, IFIT3, MGP, MMP1, MSX1, MX1, IL32, PRRX2, PTN, S100A4, SOD3 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, AREG, ATP8B4, BMP4, C6, C7, C20orfl03, CDH3, CDH6, CNTNAP2, COL21A1, COMP, CRLFl, DKK2, DPT, EGR2, EMIDl, FGFR3, FMOl, FM03, FOXF2, GABRBl, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IGF2, INA, KCNMB1, KRT14, KRT34, TMEM1 19, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PRG4, PROMl, RASDl, RELN, RGMA, RGSl, RPS4Y2, SFRP2, SLITRK6, SMOCl, SMOC2, SNAP25, SRCRB4D, STMN2, SYT12, TAC1, RSP03, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10 and ZIC1 . The cell line E45 is positive for the markers: AQP1, CD24, CDH6, COL21 Al, CRIPl, DKK2, HTRA3, KRT17, KRT19, MGP, TAGLN3, PRRXl, S100A4, SOX1 1, UGT2B7, ZIC1 and ZIC2 and are negative for the markers: AGCl, ALDHlAl, ANXA8, APCDDl, AREG, ATP8B4, BEXl, BMP4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COL15A1, COMP, COPl, CRLFl, METTL7A, DLKl, DPT, EMIDl, TMEMIOO, FMOl, FM03, FOXF1, FOXF2, GABRB1, GAP43, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ID4, IFI27, KRT14, LAMC2, IGFL3, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MYBPH, MYH3, MYH1 1, NPASl, NPPB, OGN, OLR1, OSR2, PAX9, PDEIA, PENK, PITX2, PRG4, PROMl, PTPRN, RARRES1, RASD1, RELN, RGS1, SERPINA3, SFRP2, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, RSP03, TRH, TSLP, TUBB4, WISP2 and ZD52F10. The cell line E50 is positive for the markers: ACTC, BEXl, CD24, CDH6, COL21A1, CRIPl, CRYAB, DKK2, FST, KRT17, KRT19, LOC92196, POSTN, PTN, S100A4, SFRP2, SRCRB4D, ZIC1 and ZIC2 and are negative for the markers: AGCl, AKR1C1, ALDHlAl, APCDDl, AQP1, AREG, ATP8B4, CFB, BMP4, C6, C7, CDH3, CLDN1 1, CNTNAP2, COMP, COPl, CRLFl, METTL7A, DLKl, DPT, EMIDl, TMEMIOO, FM03, FOXF1, FOXF2, GABRB1, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, KRT14, KRT34, LAMC2, TMEM1 19, IGFL3, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MYH3, NLGN4X, NPASl, NPPB, OGN, OLR1, PAX2, PAX9, PENK, PRG4, PROMl, PTGS2, PTPRN, RARRES1, RASD1, RELN, RGS1, SERPINA3, SLITRK6, SMOC1, SMOC2, STMN2, SYT12, TAC1, TFPI2, RSP03, TRH, TSLP, TUBB4, UGT2B7, WISP2 and ZD52F10. The cell line E51 is positive for the markers: PRSS35, CCDC3, CDH6, CRIPl, CRYAB, DI02, DKK2, HTRA3, ID4, KCNMB1, KRT17, KRT19, KRT34, MGP, MYH1 1, POSTN, PRRXl, S100A4, SOX1 1 and ZIC2 and are negative for the markers: AGCl, AKR1C1, ALDHlAl, APCDDl, AREG, ATP8B4, BMP4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COPl, CRLFl, CXADR, METTL7A, DLKl, DPT, EMIDl, FMOl, FM03, FOXF1, FOXF2, GABRB1, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, IGFBP5, TMEM1 19, IGFL3, LOC92196, MASP1, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYL4, NLGN4X, TAGLN3, NPASl, NPPB, OGN, OLR1, PAX2, PAX9, PDEIA, PENK, PRG4, PROMl, PTPRN, RARRES1, RASD1, RELN, RGS1, SFRP2, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TAC1, TFPI2, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2 and ZD52F10. The group of cell lines E68 and E68Bio2 are positive for the markers: CD24, CRIPl, CRYAB, HTRA3, KRT17, KRT19, TAGLN3, UGT2B7, ZIC1 and ZIC2 and are negative for the markers: AGCl, AREG, ATP8B4, C6, C7, CDH3, COPl, CRLFl, DLKl, DPT, TMEMIOO, FMOl, FM03, FOXF1, FOXF2, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, IGF2, LAMC2, IGFL3, MEOX1, MEOX2, MMP1, MYBPH, MYH3, NPASl, OGN, PAX9, PITX2, PRG4, PROMl, RARRES1, RGS1, SMOC2, TAC1, RSP03, TRH, TSLP and WISP2. The group of cell lines C4ELS5.6 and C4ELS5.6Bio2 are positive for the markers: BMP4, COPl, METTL7A, TMEMIOO, FOXF1, HSD17B2, HTRA3, IGF2, IGFBP5, IL1R1, KRT19, MASP1, OLR1, PITX2, PODN and TSLP and are negative for the markers: ACTC, AGCl, ALDHlAl, AQP1, CFB, C6, C7, C20orfl03, CDH3, CDH6, CLDN1 1, CNTNAP2, COL21A1, COMP, CRLFl, DKK2, DPT, EGR2, EMIDl, FM03, FOXF2, GABRB1, GAP43, GDF10, GSC, HOXA5, HSPA6, HSPB3, ID4, IFI27, INA, KRT17, KRT34, LAMC2, TMEM1 19, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MSX1, MYH3, MYH1 1, MYL4, IL32, NLGN4X, TAGLN3, NPASl, NPPB, OGN, PAX2, PAX9, PDEIA, PENK, PRG4, PROMl, PRRXl, PRRX2, PTPRN, RARRES1, RASD1, RELN, RGMA, RGS1, SFRP2, SMOC1, SMOC2, SNAP25, SOD3, SYT12, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line C4ELS5.8 is positive for the markers: AKR1C1 , ALDHlAl, BMP4, C3, COPl, METTL7A, TMEMIOO, FOXF1, HSD17B2, HTRA3, ICAM5, IFIT3, IGF2, IGFBP5, IL1R1, KRT19, MASP1, MX1, OLR1, PODN, STMN2, TFPI2 and THY1 and are negative for the markers: ACTC, AGCl, APCDDl, BEXl, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COL21A1, COMP, CRIPl, CRLFl, DKK2, DLKl, DPT, EMIDl, FGFR3, FM03, FOXF2, GABRB1, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ID4, INA, KCNMB1, KRT14, KRT17, TMEM1 19, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MSX2, MYH3, MYH1 1, MYL4, IL32, NLGN4X, TAGLN3, NPPB, OGN, PAX2, PAX9, PDEIA, PENK, POSTN, PRRXl, PRRX2, PTPRN, RARRES1, RASD1, RELN, RGMA, RGS1, SLITRK6, SMOC1, SMOC2, SOD3, SOX1 1, SYT12, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line C4ELSR13 is positive for the markers: AKR1C1, ANXA8, AREG, BMP4, C3, COP1, METTL7A, FM03, FOXFl, HTRA3, IFI27, IFIT3, IGF2, IL1R1, KRT19, MASP1, MX1, MYBPH, OLRl, PITX2, PODN, S100A4 and TFPI2 and are negative for the markers: AGC1, APCDD1, AQP1, ATP8B4, C6, C20orfl03, CD24, CDH3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COL21A1, COMP, CRIPl, CRLF1, CRYAB, DKK2, DLK1, DPT, EGR2, EMID1, FGFR3, TMEM100, FMOl, FOXF2, GABRB1, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, INA, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MSX1, MSX2, MYH3, MYH1 1, MYL4, IL32, NLGN4X, TAGLN3, NPASl, NPPB, OGN, OSR2, PAX2, PAX9, PDEIA, PENK, POSTN, PROMl, PRRXl, PTPRN, RARRES1, RASD1, RELN, RGMA, RGS1, RPS4Y2, SERPINA3, SLITRK6, SMOC2, SNAP25, SOD3, SOX1 1, STMN2, SYT12, TAC1, RSP03, THY1, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line C4ELSR18 is positive for the markers: AQP1, BEX1, BMP4, C20orfl03, CDH6, FST, HOXA5, IGF2, IGFBP5, OLRl, OSR2, PDEIA, PRRX2, S100A4, SFRP2, SLITRK6, TFPI2 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, ATP8B4, CFB, C6, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COL15A1, COMP, COP1, CRLF1, CRYAB, DLK1, DPT, EGR2, EMID1, TMEM100, FOXFl, GABRB1, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, 1FI27, IFIT3, KCNMB1, KRT14, KRT17, KRT34, TMEM1 19, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MSX1, MSX2, MX1, MYH3, MYH1 1, MYL4, IL32, NPASl, NPPB, OGN, PAX2, PAX9, PENK, PITX2, PODN, PRG4, PTPRN, RARRES1, RASD1, RELN, RGS1 , SERPINA3, SMOC1, SMOC2, SOD3, SOX1 1, STMN2, SYT12, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10 and ZIC1 . The group of cell lines EN1 1 and W10 are positive for the markers: DLK1, FOXFl, FST, GABRBI, GDF5, HTRA3, IGF2, IGFBP5, IL1R1, POSTN, PTN, SOX1 1, SRCRB4D and TFPI2 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, BMP4, C3, C6, C7, CCDC3, CD24, CDH6, CLDN1 1, CNTNAP2, COL15A1, COMP, COP1, CRYAB, DKK2, DPT, EGR2, EMID1, FGFR3, FMOl, FM03, FOXF2, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPASl, NPPB, OLRl, PAX2, PAX9, PENK, PITX2, PRELP, PROMl, RARRES1, RASD1, RELN, RGS1, SMOC1, SMOC2, STMN2, SYT12, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2. The group of cell lines EN7, EN13Biolb, EN13Bio2c and EN13Bio3c are positive for the markers: CDH6, DLK1, FOXFl, FST, HTRA3, IGF2, IL1R1, MSX1, POSTN, SOD3, ZIC1 and ZIC2 and are negative for the markers: ACTC, ALDH1A1, ANXA8, ATP8B4, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, CRYAB, DI02, DKK2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MMP1, MX1, MYH3, MYH1 1, MYL4, IL32, NPAS l , NPPB, OLRl, PAX2, PAX9, PDEIA, PENK, PITX2, PROMl, RELN, SFRP2, SMOC2, STMN2, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4 and ZD52F10. The cell line EN16 is positive for the markers: COL15A1, DI02, DPT, FM03, FOXFl, FOXF2, FST, HSPB3, HTRA3, IGF2, IL1R1, TMEM1 19, MGP, MMP1, PODN and PRRX2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1„ AREG, ATP8B4, BEX1, CFB, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, CRIPl, CRLF1, DKK2, EMID1, FGFR3, TMEM100, GABRB1, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, TAGLN3, NPASl, NPPB, PAX2, PAX9, PENK, PITX2, POSTN, PTGS2, PTPRN, RARRES1, RASD1, RGS1, SMOC1, SMOC2, SNAP25, STMN2, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The group of cell lines EN1, ENlBio2 and EN18 are positive for the markers: DI02, DLK1, FOXFl, GDF5, HTRA3, IGF2, IL1R1, MGP, POSTN, PRRX2 and SRCRB4D and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, CFB, C20orfl03, CCDC3, CD24, CLDN1 1, CNTNAP2, CRYAB, CXADR, DKK2, GABRB1, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYH3, MYH1 1, MYL4, NPASl, NPPB, PAX2, PAX9, PENK, PITX2, PROMl, RASD1, RGS1, SMOC1, SMOC2, STMN2, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line EN19 is positive for the markers: CDH6, COL15A1, COL21A1, DLK1, FOXF1, FST, GDF5, IGF2, TMEM1 19, MSX1, RGMA, SERPINA3, SOD3, ZIC1 and ZIC2 and are negative for the markers: ACTC, AGC1, ANXA8, AQP1, ATP8B4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDNl l , CNTNAP2, CRIPl, CXADR, DI02, DKK2, EMIDl, TMEMIOO, GABRB1, GAP43, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MGP, MXl, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OLRl, OSR2, PAX2, PAX9, PDE1A, PENK, PROM1, RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10. The cell line EN2 is positive for the markers: FST, GDF5, HTRA3, IGF2, IGFBP5, IL1R1, PRRX2, PTN, SFRP2, SOX1 1, SRCRB4D, TFPI2 and RSP03 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH6, CLDNl l , COMP, COPl, CRLFl, CXADR, DKK2, DPT, EGR2, EMIDl, TMEMIOO, FMOl, FOXF2, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, INA, KRT14, KRT17, KRT19, KRT34, TMEM1 19, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MXl, MYBPH, MYH3, MYHl l , MYL4, NLGN4X, TAGLN3, NPASl, NPPB, OGN, OLRl, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PRG4, PTGS2, RARRES1, RASD1, RELN, RGS1, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TAC1, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line EN25 is positive for the markers: CDH6, CNTNAP2, COL15A1, COL21 Al, DLK1, FOXF1, FST, HTRA3, IGF2, SERPINA3, SRCRB4D, TFPI2, ZIC1 and ZIC2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, AQP1, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDNl l , CRIPl, DI02, DKK2, EMIDl, FOXF2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MGP, MMPl, MXl, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OLRl, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, PRRX1, PTN, RARRES1, RASD1, RELN, SFRP2, SLITRK6, SMOC2, STMN2, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10. The cell line EN26 is positive for the markers: DI02, DPT, FM03, FOXF1, FOXF2, FST, GDF5, HTRA3, IGF2, IL1R1, TMEM1 19, PODN, PRRX1, PRRX2, SFRP2, SOD3 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, ATP8B4, BEX1, C3, C6, C7, C20orfl03, CCDC3, CD24, CLDNl l , CNTNAP2, COL21A1, COMP, CRIPl, CXADR, DKK2, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MMPl, MXl, MYBPH, MYH3, MYHl l , MYL4, NLGN4X, NPASl, NPPB, PAX2, PAX9, PENK, PITX2, PROM1, PTGS2, PTPRN, RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOC1, SMOC2, STMN2, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line EN27 is positive for the markers: DI02, FM03, FOXF1, FOXF2, FST, HSPB3, HTRA3, IGF2, IL1R1, TMEM1 19, MSX2, OGN, PODN, PRELP, PRRX2, SERPINA3 and SLITRK6 and are negative for the markers: , ACTC, AGC1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CDH6, CLDNl l , CNTNAP2, CRIPl, CRLFl, DKK2, EMIDl, FGFR3, TMEMIOO, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ICAM5, ID4, IFI27, IFIT3, IGFBP5, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASP1, MEOXl, MEOX2, MMPl, MXl, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPASl, NPPB, OLRl, PAX2, PAX9, PENK, PITX2, PROM1, RARRES1, RASD1 , RELN, RGS1, SFRP2, SMOC1, SMOC2, STMN2, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line EN28 is positive for the markers: COL15A1, COL21 Al, DI02, FOXF1, FOXF2, FST, HSPB3, HTRA3, IGF2, IGFBP5, IL1R1, TMEM1 19, PODN, PRRX1, PTN, SFRP2 and SOX1 1 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CDH6, CLDNl l , CNTNAP2, COPl, CRIPl, DKK2, EMIDl, TMEMIOO, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, 1FI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MGP, MMPl, MXl, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OLRl, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PRG4, PROM1, PTGS2, RARRES1, RELN, RGS1, SLITRK6, SMOC1, SMOC2, STMN2, SYT12, TAC1, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line EN31 is positive for the markers: CDH6, COL21A1, DLKl, FM03, FOXFl, FST, GDF5, HTRA3, IGF2, IL1R1, MSX1, MSX2, OGN, OSR2, PRRX2, SERPINA3, SLITRK6, SOD3, TSLP, ZIC1 and ZIC2 and are negative for the markers: ACTC, AGC1 , ALDH1A1, ANXA8, AQP1, ATP8B4, BEX1, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, CRIPl, CRLF1, CRYAB, CXADR, DI02, DKK2, EMID1, TMEM100, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, INA, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PROM1, PTGS2, RARRES1, RASDl, RELN, SFRP2, SMOC2, SNAP25, STMN2, SYT12, TACl, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10. The cell line EN38 is positive for the markers: BEX1, CDH6, COL21 Al, DLKl, FOXFl, FST, GDF5, HTRA3, IGF2, IL1R1, TMEM1 19, MGP, MSX1, OGN, PODN, POSTN, PRRX1, PRRX2, RGMA, SERPINA3, SOD3 and TSLP and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1 Al, ANXA8, AQP1, AREG, ATP8B4, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, CRIPl, DI02, DKK2, DPT, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROM1, RASDl, RELN, RGSl, SFRP2, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, SYT12, TACl, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, ZD52F10, ZIC1 and ZIC2. The cell line EN4 is positive for the markers: COL21A1, DLKl, FMOl, FM03, FOXFl, FOXF2, FST, GDF5, HTRA3, IGF2, IGFBP5, IL1R1, TMEM1 19, MGP, MSX1, OGN, PODN, PRRX1, PRRX2, PTN, RGMA, SOD3 and TSLP and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, CRIPl, DI02, DKK2, DPT, EMID1, FGFR3, TMEM100, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PROM1, PTGS2, RARRES1, RASDl, RGSl, SFRP2, SMOCl, SMOC2, SNAP25, STMN2, TACl, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10. The cell line EN42 is positive for the markers: COL15A1, COL21 Al, FM03, FOXFl, FST, GDF5, HTRA3, IGF2, IL1R1, TMEM1 19, MGP, OGN, PODN, PRRX1, PRRX2, PTN, RGMA, SERPINA3, SNAP25 and SOD3 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1 Al, ANXA8, AQP1, ATP8B4, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, CXADR, DI02, DKK2, DPT, EMID1, FGFR3, TMEM100, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX9, PENK, PITX2, PRG4, PROM1, RARRES1, RASDl, RELN, RGSl, SMOCl, SMOC2, STMN2, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line EN47 is positive for the markers: CDH6, COP1, DLKl, FM03, FOXFl, FST, HTRA3, IGF2, IL1R1, MSX1, POSTN, PTPRN, RGSl, SOD3, TFPI2, TSLP, ZIC1 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, DI02, DKK2, FOXF2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, TMEM1 19, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, RARRES1, SFRP2, SMOC2, STMN2, TACl, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10. The cell line EN5 is positive for the markers: COL21A1, DLKl, FM03, FOXFl, FOXF2, FST, HTRA3, IGF2, IL1R1, KIAA0644, TMEM1 19, MGP, MSX1, MSX2, OGN, PRRX1 and PRRX2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, CRIPl, CRLF1, CRYAB, CXADR, DKK2, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MX1, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, PAX2, PAX9, PENK, PITX2, PRELP, PRG4, PROM1, RASDl, RELN, RGSl, SMOCl, SMOC2, STMN2, SYT12, TACl, TFPI2, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10 and ZIC1 . The cell line EN50 is positive for the markers: BEX1, CDH6, COL21 Al, DI02, FMOl, FOXF1, FOXF2, FST, GDF5, HTRA3, IGF2, IGFBP5, IL1R1, KRT19, TMEM1 19, MASP1, MGP, MSX1, PODN, PRRX2, PTPRN, SERPINA3, SOD3, WISP2, ZIC1 and ZIC2 and are negative for the markers: ACTC, AGCl, ALDHlAl, APCDD1, AQP1, BMP4, C3, C6, C20orfl03, CDH3, CLDN1 1, CNTNAP2, COMP, DKK2, DPT, EGR2, EMID1, TMEM100, GABRB1, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, IFI27, KIAA0644, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PROMl, PRRX1, RARRESl, RASDl, RGSl, SMOC2, SNAP25, STMN2, SYT12, TACl, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10. The cell line EN51 is positive for the markers: CDH6, DLK1, FMOl, FM03, FOXF1, FST, HTRA3, IGF2, IL1R1, MSX1, MSX2, OGN, SERPINA3, SOD3, TSLP, ZIC1 and ZIC2 and are negative for the markers: ACTC, AGCl, AKR1C1, ALDHlAl, ANXA8, APCDD1, AQP1, ATP8B4, CFB, C3, C6, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CRIPl, CRYAB, CXADR, DI02, DKK2, DPT, EMID1, TMEM100, FOXF2, GABRB1, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MMP1, MX1, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PROMl, PTGS2, RARRESl, RASDl, RELN, RGSl, SFRP2, SMOC2, STMN2, TACl, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10. The cell line EN53 is positive for the markers: BEX1, COL21A1, FST, GDF5, HTRA3, ICAM5, KRT19, TMEM1 19, PTPRN, SERPINA3, SOD3 and ZIC2 and are negative for the markers: ACTC, AGCl, ALDHlAl, APCDD1, AQP1, ATP8B4, BMP4, C3, C6, C7, C20orfl03, CCDC3, CDH3, CLDN1 1, CNTNAP2, COP1, CRYAB, DI02, DKK2, DPT, EMID1, FGFR3, TMEM100, FM03, FOXF2, GABRBI, GAP43, GJB2, GSC, HOXA5, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PROMl, PTN, RASDl, RELN, RGSl, SLITRK6, SMOC2, STMN2, SYT12, TACl, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10 and ZIC1 . The cell line EN55 is positive for the markers: DI02, FOXF1, FOXF2, FST, GDF5, HTRA3, IGF2, IL1R1, KIAA0644, MGP, MSX2, PODN, PRRX2, PTN, SLITRK6 and SRCRB4D and are negative for the markers: ACTC, AGCl, AKR1C1, ALDHlAl, ANXA8, AQP1, ATP8B4, CFB, BMP4, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, CRIPl, CRYAB, DKK2, FGFR3, FMOl, GABRB1, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PROMl, PRRX1, PTGS2, RARRESl, RASDl, RELN, RGSl, SFRP2, SMOC1, SMOC2, SOD3, STMN2, SYT12, TACl, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The group of cell lines H9.Biol and H9.Bio2 are positive for the markers: ACTC, BEX1, CD24, CDH3, CNTNAP2, CXADR, METTL7A, FGFR3, FST, GAP43, ΓΝΑ, KRT19, NLGN4X, PROMl, PTN, PTPRN, RGMA, SFRP2, SOXl l , SRCRB4D, ZD52F10 and ZIC2 and are negative for the markers: AGCl, ALDHlAl, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, C6, C7, PRSS35, C20orfl03, CDH6, CLDN1 1, COL15A1, COL21A1, COP1, DI02, DKK2, DPT, EGR2, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRB1, GDF10, GJB2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, IL1R1, KRT14, KRT17, KRT34, TMEM1 19, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MMP1, MSX1, MSX2, MX1, MYBPH, MYH3, MYH1 1, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, POSTN, PRELP, PRG4, PRRX1, PTGS2, RARRESl, RELN, RGSl, SERPINA3, SLITRK6, SMOC1, SNAP25, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and WISP2. The cell line J13 is positive for the markers: CDH6, CLDN1 1, FST, GDF5, IGF2, MMP1, PRRX1, PRRX2, RGMA, SLITRK6, TFPI2 and ZIC2 and are negative for the markers: ACTC, AGCl, ALDHlAl, ANXA8, AQP1, AREG, ATP8B4, CFB, C3, C6, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CNTNAP2, COL15A1, COMP, COP1, CRLF1, CRYAB, DI02, METTL7A, DKK2, DLK1, DPT, EGR2, EMID1, FGFR3, TMEM100, FMOl, FOXF1, GABRBI, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IGFBP5, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MYBPH, MYH3, MYH1 1, MYL4, IL32, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PRG4, PROMl, PTGS2, PTPRN, RARRESl, RASDl, RELN, RGSl, RPS4Y2, SFRP2, SMOC1, SMOC2, SRCRB4D, STMN2, TACl, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10 and ZIC1 . The cell line J16Bio2 is positive for the markers: BEX1, BMP4, CCDC3, CDH6, CLDN1 1, COL21A1, CRYAB, FM03, FST, ICAM5, IGF2, KRT17, TMEM1 19, POSTN, SERPINA3, SFRP2, SYT12, TFPI2, UGT2B7 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C20orfl03, CD24, CDH3, CNTNAP2, COMP, CRLF1, METTL7A, DLK1, DPT, EMID1, FGFR3, TMEM100, FMOl, FOXFl, FOXF2, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, HTRA3, ID4, IFI27, KIAA0644, KRT14, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MSX1, MYBPH, MYH3, NLGN4X, NPPB, OGN, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROMl, PTPRN, RARRES1, RASD1, RELN, RGS1, SMOC1, SMOC2, STMN2, TAC1, THYl, TNFSF7, TRH, TUBB4, WISP2 and ZD52F10. The cell line J8 is positive for the markers: BEX1, BMP4, CLDN1 1, CRYAB, IGF2, INA, KRT19, MX1, IL32, TAGLN3, SFRP2, TSLP and UGT2B7 and is negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, ATP8B4, CFB, C3, C6, C7, C20orfl03, CCDC3, CDH3, CNTNAP2, COL15A1, COL21A1, COMP, COP1, CRLF1, DI02, METTL7A, DKK2, DLK1, DPT, EGR2, EMID1, FGFR3, TMEM100, FMOl, FM03, FOXFl, FOXF2, GABRBl, GAP43, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ID4, IFI27, IGFBP5, KCNMB1, KIAA0644, KRT14, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MGP, MMP1, MSX1, MYH3, MYH1 1, MYL4, NPAS1, NPPB, OGN, OLRl, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROMl, PRRX1, PTGS2, PTN, PTPRN, RARRES1, RGMA, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2 and ZD52F10. The cell line MW1 is positive for the markers: APCDD1, BEX1, BMP4, C3, CD24, CDH3, CRLF1, CRYAB, DI02, METTL7A, TMEM100, FOXFl, FST, GJB2, IGF2, IGFBP5, IL1R1, KIAA0644, KRT19, TMEM1 19, OLRl, PODN, PROMl, SERPINA3, SNAP25, SRCRB4D, STMN2, TFPI2 and THYl and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, AQP1, AREG, ATP8B4, C6, C7, PRSS35, C20orfl03, CCDC3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COL21A1, COMP, COP1, CXADR, DKK2, DLK1, DPT, EGR2, EMID1, FGFR3, FMOl, FM03, FOXF2, GABRBl, GAP43, GDF5, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OSR2, PAX2, PAX9, PENK, POSTN, PRELP, PRG4, PRRX1, PRRX2, PTGS2, PTPRN, RARRES1, RELN, RGS1, SFRP2, SLITRK6, SMOC1, SMOC2, SOD3, SYT12, TAC1, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line MW2 is positive for the markers: C6, C7, CRLF1, DI02, METTL7A, FMOl, FM03, FOXFl, FOXF2, HTRA3, IGF2, IL1R1, TMEM1 19, MGP, OGN, PRRX2, RGMA, SFRP2, SYT12 and TFPI2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, CFB, C3, C20orfl03, CCDC3, CD24, CDH3, CNTNAP2, COMP, COP1, CRYAB, CXADR, DKK2, DLK1, EMID1, FGFR3, GABRBl, GAP43, GDF5, GDF10, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MSX1, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NPAS1, NPPB, OLRl, OSR2, PAX2, PAX9, PENK, PITX2, POSTN, PROMl, PRRX1, PTPRN, RASD1, RELN, RGS1, SMOC1, SMOC2, STMN2, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line MW6 is positive for the markers: BEX1, C6, C7, DI02, DPT, FOXFl, FST, HTRA3, IGF2, IL1R1, TMEM1 19, PITX2, POSTN, PRRX2, SERPINA3, SFRP2, SRCRB4D and SYT12 and are negative for the markers: AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, BMP4, C20orfl03, CCDC3, CDH3, CNTNAP2, COP1, CXADR, DKK2, DLK1, EMID1, FGFR3, TMEM100, GABRBl, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MSX1, MX1, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OLRl, PAX2, PAX9, PENK, PRELP, PROMl, PRRX1, RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, TAC1, TFPI2, THYl, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZIC1 and ZIC2. The cell line Q4 is positive for the markers: AREG, BEX1, CRYAB, FMOl, FST, HTRA3, ICAM5, IGF2, IL1R1, KRT19, TMEM1 19, PTPRN, SERPINA3, SOD3, SRCRB4D, ZD52F10 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, APCDD1 , ATP8B4, CFB, BMP4, C20orfl03, CCDC3, CDH3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COMP, COP1, DI02, DKK2, DPT, EGR2, EMID1, FM03, GAP43, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFIT3, INA, KCNMB1, KIAA0644, KRT17, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OLRl, OSR2, PAX2, PAX9, PENK, PROMl, PRRX2, PTGS2, RARRES1, RELN, RGMA, RGS1, SLITRK6, SMOC1, SMOC2, STMN2, SYT12, TAC1, RSP03, THYl, TNFSF7, TNNT2, TRH, TSLP, TUBB4 and UGT2B7. The cell line Q6 is positive for the markers: AREG, BEX1, COL21A1, DLK1, FMOl, FST, GDF10, ICAM5, IL1R1, TMEM1 19, MYL4, OGN, POSTN, SERPINA3, SFRP2, SOD3, SRCRB4D, ZIC1 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, C3, C6, C20orfl03, CD24, CDH3, CDH6, CLDN1 1, CNTNAP2, COMP, COP1, CXADR, DI02, DKK2, DPT, EMID1, FGFR3, FM03, FOXF1, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, IFI27, ΓΝΑ, KCNMBl, KIAA0644, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MMPl, MXl, MYBPH, MYH3, MYH1 1, IL32, NLGN4X, NPPB, OLRl, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROMl, PTN, PTPRN, RARRESl, RASDl, RELN, RGSl, SMOC1, SMOC2, SYT12, TAC1, TFPI2, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4 and WISP2. The cell line Q7 is positive for the markers: AREG, BEX1, COL15A1, COL21A1, COMP, EGR2, FST, GDF10, HSD17B2, IGF2, SERPINA3, ZIC1 and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, AQP1, ATP8B4, CFB, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, DI02, DKK2, DLK1, EMID1, FGFR3, TMEM100, FMOl, FM03, GABRB1, GDF5, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ID4, IFI27, KCNMBl, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMPl, MSX2, MXl, MYBPH, MYH3, MYH1 1, IL32, NLGN4X, NPAS1, NPPB, OGN, OLRl, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PODN, POSTN, PRELP, PROMl, PRRX2, PTGS2, PTN, RARRESl, RASDl, RELN, RGMA, RGSl, SLITRK6, SMOC2, SNAP25, STMN2, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and WISP2. The cell line RAD20. 16 is positive for the markers: ACTC, CD24, CRIPl, CRYAB, FST, HOXA5, HTRA3, KRT19, LAMC2, MFAP5, MASPl, MGP, MMPl, MSX1, POSTN, S100A4, SRCRB4D and THY1 and is negative for the markers: AGC1, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C6, C7, C20orfl03, CCDC3, CDH3, CLDN1 1, CNTNAP2, COL15A1, COL21A1, CRLF1, DLK1, DPT, TMEM100, FMOl, FM03, FOXF2, GABRB1, GDF10, GJB2, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IGF2, KCNMBl, KRT14, TMEM1 19, IGFL3, LOC92196, MEOXl, MEOX2, MSX2, MXl, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMl, PRRX1, RARRESl, RASDl, RGSl, SFRP2, SMOC1, SMOC2, SOD3, STMN2, TAC1, TFPI2, RSP03, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2. The cell line RAD20. 19 is positive for the markers: ACTC, BEX1, CD24, CRIPl, CRYAB, FST, HOXA5, INA, KRT19, KRT34, LAMC2, MFAP5, MASPl, MMPl, MSX1, NPPB, PTPRN and THY1 and is negative for the markers: AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, CFB, C6, C7, C20orfl03, CDH3, CNTNAP2, COL15A1, COL21A1, COP1, CRLF1, DI02, METTL7A, DKK2, DLK1, DPT, EGR2, EMID1, TMEM100, FMOl, FM03, FOXF2, GABRBI, GDF10, GJB2, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IGF2, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MEOXl, MEOX2, MGP, MXl, MYBPH, MYH3, NLGN4X, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PROMl, PRRX1, PTN, RARRESl, RASDl, RGMA, RGSl, SFRP2, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNFSF7, TRH, TSLP, TUBB4, WISP2, ZIC1 and ZIC2. The cell line RAD20.5 is positive for the markers: AKR1C1, CRIPl, METTL7A, FOXF1, HOXA5, HTRA3, KIAA0644, KRT19, MASPl, MMPl, MSX1, POSTN, PTPRN, S100A4, SRCRB4D and THY1 and is negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEX1, CFB, C6, C7, PRSS35, C20orfl03, CCDC3, CDH3, CLDN1 1, CNTNAP2, COL15A1, COL21A1, COMP, CRLF1, CNTNAP2, DKK2, DLK1, DPT, EGR2, EMID1, TMEM100, FMOl, FM03, FOXF2, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, KCNMBl, KRT14, KRT34, IGFL3, LOC92196, MEOXl, MEOX2, MGP, MSX2, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OGN, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROMl, RARRESl , RGMA, RGSl, SFRP2, SLITRK6, SMOC1, SMOC2, SOD3, STMN2, SYT12, TAC1, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2. The cell line RAPEND17 is positive for the markers: ANXA8, BEX1, C3, CD24, CRIPl, CRYAB, METTL7A, FST, HOXA5, HTRA3, ICAM5, IFIT3, IGF2, IL1R1, KRT19, LAMC2, MFAP5, MASPl, OLRl, POSTN, PTN, PTPRN and TFPI2 and is negative for the markers: ACTC, AGC1, APCDD1, AQP1, ATP8B4, CFB, C6, C7, PRSS35, C20orfl03, CCDC3, CDH3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COL21A1, DKK2, DLK1, DPT, EGR2, EMID1, TMEM100, FMOl, FM03, FOXF2, GABRBI, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, KCNMBl, KRT14, KRT17, IGFL3, LOC92196, MEOXl, MEOX2, MGP, MSX2, MYH3, MYH1 1, NLGN4X, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PROMl, PRRX1, PRRX2, RARRESl, RELN, RGMA, RGSl, SFRP2, SLITRK6, SMOC1, SMOC2, SOD3, SYT12, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line RASKEL18 is positive for the markers: AREG, CD24, CRYAB, METTL7A, DPT, FST, GJB2, HTRA3, IGF2, IGFBP5, IL1R1, PTN, PTPRN, SERPINA3, SOX1 1, SRCRB4D and RSP03 and is negative for the markers: ACTC, AKRICI, ALDH1 Al, ANXA8, AQP1, CFB, C7, PRSS35, C20orfl03, CDH6, CLDN1 1, CNTNAP2, COMP, COP1, DI02, DKK2, DLKl, EGR2, EMID1, FGFR3, FMOl, FM03, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, TMEM1 19, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MMPl, MSX2, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PENK, PRELP, PRG4, PROM1, PRRX1, PRRX2, PTGS2, RARRES1, RASD1, RELN, RGMA, RGS1, SLITRK6, SMOC1, SMOC2, STMN2, SYT12, TAC1, TFPI2, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZIC1 and ZIC2. The cell line RASKEL6 is positive for the markers: AREG, BEXl, C3, CRLF1, CRYAB, METTL7A, FST, HTRA3, IGF2, IL1R1, TMEM1 19, PITX2, SERPINA3 and TFPI2 and is negative for the markers: ACTC, AKRICI, ALDH1A1, ANXA8, AQP1, CFB, BMP4, C6, CCDC3, CDH3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COMP, COP1, CXADR, DKK2, DLKl, EGR2, EMID1, FMOl, FM03, FOXF2, GAP43, GDF10, GSC, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGFBP5, INA, KIAA0644, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MMPl, MSX2, MYBPH, MYH3, MYHl l , IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, POSTN, PRELP, PROM1, PRRX1, PRRX2, RARRES1, RELN, RGMA, RGS1, SLITRK6, SMOC1, SMOC2, STMN2, SYT12, TAC1, RSP03, THY1, TNFSF7, TRH, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2. The cell line RASKEL8 is positive for the markers: AREG, BEXl, C7, CRIPl, CRLF1, CRYAB, FST, HOXA5, HTRA3, ICAM5, IGF2, IL1R1, KRT19, LAMC2, PITX2, POSTN, PTPRN, SERPINA3 and TFPI2 and is negative for the markers: ACTC, AGC1, ALDH1 Al, AQP1, ATP8B4, CFB, C6, PRSS35, C20orfl03, CCDC3, CDH3, CDH6, CLDN1 1, CNTNAP2, COMP, COP1, DKK2, DLKl, DPT, EMID1, FMOl, FM03, FOXF2, GABRB1, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IGFBP5, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOXl, MEOX2, MGP, MMPl, MSX2, MX1, MYH3, MYHl l , NLGN4X, TAGLN3, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROM1, PRRX1, PRRX2, PTN, RARRES1 , RELN, RGMA, RGS1, SFRP2, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZIC1 and ZIC2. The cell line SKI is positive for the markers: AKRICI, BEXl, C6, C7, COL21 Al, CRIPl, METTL7A, DLKl, TMEM100, FMOl, FM03, FOXF2, FST, HSD1 1B2, HTRA3, ICAM5, IGF2, IL1R1, TMEM1 19, MGP, MSX1, PRG4, PTN, PTPRN, S100A4, SERPINA3, SFRP2, SOD3, SOX1 1, WISP2 and ZIC1 and is negative for the markers: AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, BMP4, C20orfl03, CD24, CDH3, CDH6, CLDN1 1, CNTNAP2, COMP, COP1, CRLF1, DKK2, EGR2, EMID1, FGFR3, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, ID4, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MMPl, MSX2, MX1, MYBPH, MYHl l , IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PROM1, RARRES1, RGS1, SMOC2, SYT12, TFPI2, RSP03, THY1, TNNT2, TRH, TSLP, TUBB4 and ZIC2. The group of cell lines SKlOBiol and SK10Bio2 are positive for the markers: BEXl, COL21A1, FST, ICAM5, IL1R1, TMEM1 19, SERPINA3 and ZIC2 and are negative for the markers: ACTC, AGC1 , ALDH1A1, AQP1, CFB, BMP4, C3, C6, C20orfl03, CDH3, CLDN1 1, CNTNAP2, DKK2, DPT, EMID1, TMEM100, FM03, GABRB1, GAP43, GSC, HOXA5, HSPA6, ID4, IFI27, KIAA0644, KRT14, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MX1, MYBPH, MYH3, MYHl l , NLGN4X, NPPB, OLR1 , PAX2, PAX9, PDE1A, PENK, PROM1, RARRES1, RASD1, RELN, RGS 1, SLITRK6, SMOC1, SMOC2, STMN2, SYT12, TAC1, RSP03, THY1, TNNT2 and TUBB4. The group of cell lines SKI 1, SK44, SK50 and SK52 are positive for the markers: BEXl, COL21Al, FST, ICAM5, IL1R1, TMEM1 19, PTPRN, SERPINA3, SFRP2 and ZIC1 and are negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, ATP8B4, C6, C20orfl03, CCDC3, CDH3, CLDN1 1, CNTNAP2, DI02, DKK2, EMID1, GABRB1, GSC, HOXA5, HSPA6, IFI27, INA, KRT14, KRT34, IGFL3, LOC92196, MEOXl, MEOX2, MMPl, MX1, MYH3, MYHl l , IL32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PROM1, PTN, RARRES1, RASD1, RELN, RGS1, SMOC1, SMOC2, STMN2, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH and TUBB4. The group of cell lines SK14, SK53, SK60 and SK61 are positive for the markers: C7, COL21Al, CRYAB, HTRA3, IL1R1, MGP, PTPRN, RGMA, SERPINA3 and SFRP2 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, BMP4, CCDC3, CDH3, CNTNAP2, COP1, CXADR, DKK2, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD17B2, IFI27, IFIT3, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MXl, MYBPH, MYH3, MYHl l , IL32, NLGN4X, NPPB, OLRl, PAX2, PAX9, PENK, PROMl, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, STMN2, TACl, RSP03, TNNT2, TRH, TUBB4, UGT2B7, ZIC1 and ZIC2. The cell line SK17 is positive for the markers: ACTC, APCDD1, BEXl, COL21A1, METTL7A, DLK1, FST, HOXA5, HSPB3, HTRA3, IGF2, IL1R1, KIAA0644, MASP1, MGP, MYBPH, MYH3, NLGN4X, PDEIA, PTN, RGMA, SRCRB4D, STMN2, RSP03 and TNNT2 and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, CFB, C6, C20orfl03, CCDC3, CDH3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COMP, COP1, CRLF1, DKK2, DPT, TMEM100, FMOl, FM03, FOXF2, GABRBI, GDF10, GSC, HSD17B2, HSPA6, ID4, IFI27, INA, KCNMB1, KRT14, KRT34, LAMC2, TMEM1 19, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MXl, MYHl l , IL32, NPAS1, NPPB, OLRl, PAX2, PAX9, PENK, PITX2, PRELP, RASDl, RELN, RGSl, S100A4, SLITRK6, SMOCl, SMOC2, TACl, THYl, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2. The cell line SK18 is positive for the markers: APCDD1, COL21A1, METTL7A, FMOl, FOXF1, FST, HTRA3, IGF2, IL1R1, TMEM1 19, OGN, PITX2, PRRX1, RGMA, SERPINA3, SFRP2, SOD3 and TSLP and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CNTNAP2, COP1, CXADR, DI02, DKK2, DLK1, DPT, EMID1, TMEM100, GABRB1, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KIAA0644, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MSX1, MXl, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OLRl, OSR2, PAX2, PAX9, PDEIA, PENK, PRELP, PROMl, RARRES1, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, STMN2, TACl, TFPI2, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZIC1 and ZIC2. The cell line SK26 is positive for the markers: APCDD1, BEXl, COL21A1, CRYAB, FMOl, FOXF2, FST, HTRA3, ICAM5, IL1R1, TMEM1 19, PRRX1, PTPRN, SERPINA3 and SFRP2 and is negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COP1, CXADR, DKK2, DLK1, DPT, EGR2, EMID1, FGFR3, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, IFI27, IFIT3, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MXl, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OLRl, OSR2, PAX2, PAX9, PDEIA, PENK, PITX2, POSTN, PROMl, PTN, RARRES1, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, TACl, TFPI2, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZIC1 . The group of cell lines SK27 and T7 are positive for the markers: BEXl, PRSS35, CCDC3, CDH6, COL21A1, CRIPl, CRYAB, GAP43, IGF2, KRT19, LAMC2, POSTN, S100A4, SFRP2, SOX1 1 and ZIC2 and are negative for the markers: AGC1, ALDH1 Al, APCDD1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN1 1, CNTNAP2, COP1, CXADR, DLK1, DPT, EGR2, EMID1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KRT14, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MYBPH, MYH3, MYL4, NLGN4X, NPPB, OLRl, PAX2, PAX9, PDEIA, PENK, PRG4, PROMl, RARRES1, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, TACl, TFPI2, RSP03, TNNT2, TRH, TUBB4 and ZIC1 . The group of cell lines SK28 and SK57 are positive for the markers: BEXl, COL21A1, CRYAB, HTRA3, ICAM5, IGF2, IL1R1, PTPRN and SERPINA3 and are negative for the markers: AGC1, ALDH1 Al, AQP1, ATP8B4, CFB, BMP4, C20orfl03, CCDC3, CDH3, CDH6, CLDN1 1, CNTNAP2, COP1, CXADR, DI02, DKK2, EMID1, GABRB1, GAP43, GDF10, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MSX2, MXl, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OLRl, OSR2, PAX2, PAX9, PENK, PROMl, PTN, RARRES1, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, STMN2, TACl, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7. The group of cell lines SK30 and W4 are positive for the markers:BEXl, FST, HTRA3, IGF2, TMEM1 19, POSTN, SOX1 1, SRCRB4D, ZIC1 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CDH3, CLDN1 1, CRYAB, DI02, METTL7A, EGR2, EMID1, FM03, FOXF2, GABRB1, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ID4, IFI27, INA, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MXl, MYH3, MYHl l , NPPB, OLRl, OSR2, PAX2, PAX9, PDEIA, PENK, PRELP, PROMl, RARRES1, RASDl, RELN, SMOC2, STMN2, SYT12, TACl, RSP03, TNFSF7, TNNT2 and TUBB4. The group of cell lines SK31 and SK54 are positive for the markers: BEX1, COL21A1, CRIPl, CRYAB, TMEM100, FMOl, FM03, FOXF1, FOXF2, IGF2, IGFBP5, IL1R1, KRT19, LAMC2, TMEM1 19, NPAS1, PDE1A, PRRX2, S100A4, SERPINA3, SNAP25, SOX1 1, SRCRB4D and WISP2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, COP1, CXADR, DKK2, DLK1, DPT, EMIDl, FGFR3, GABRBl, GAP43, GDF10, GSC, HSD17B2, HSPA6, HTRA3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, PRRX1, RELN, RGSl, SLITRK6, SMOCl, SMOC2, SOD3, STMN2, SYT12, TACl, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, ZICl and ZIC2. The cell line SK32 is positive for the markers: AKR1C1, BEX1, C6, C7, C20orfl03, COL21A1, CRYAB, METTL7A, DPT, GDF5, HTRA3, ICAM5, IL1R1, TMEM1 19, MGP, OGN, POSTN, PTPRN, RGMA, SERPINA3, SFRP2, SOD3, WISP2 and ZICl and is negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, CCDC3, CD24, CDH3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COMP, COP1, CXADR, DI02, DKK2, EGR2, EMIDl, FGFR3, FM03, FOXF1, FOXF2, GABRBl, GAP43, GDF10, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, INA, KIAA0644, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, PTGS2, RASD1, RELN, RGSl, SLITRK6, SMOCl, SMOC2, STMN2, SYT12, TFPI2, RSP03, THYl, TNFSF7, TNNT2, TRH, TSLP, TUBB4 and ZIC2. The group of cell lines SK40 and SK40Bio2 are positive for the markers: BEX1, COL21A1, CRYAB, FMOl, FST, ICAM5, IGFBP5, TMEM1 19, MSX1, MYL4, PTPRN, SERPINA3, SOD3, ZICl and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, AQP1, ATP8B4, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COP1, DI02, DKK2, DPT, TMEM100, FM03, GABRBl, GAP43, GSC, HOXA5, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MX1, MYBPH, MYH1 1, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PROM1, RARRES1, RASD1, RELN, RGSl, SMOC2, SNAP25, SYT12, TACl, TFPI2, RSP03, THYl, TNFSF7, TRH, TSLP and TUBB4 The cell line SK46 is positive for the markers: APCDD1, COL21A1, DI02, METTL7A, FMOl, FM03, FOXF1, FOXF2, FST, HTRA3, IGF2, IL1R1, TMEM1 19, OGN, PRRX1, PRRX2, SERPINA3, SFRP2, SLITRK6, TSLP and ZIC2 and is negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COP1, CRIPl, CXADR, DKK2, DPT, EMIDl, FGFR3, GABRBl, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, IFI27, INA, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PROM1, RARRES1, RASD1, RELN, RGSl, SMOCl, SMOC2, STMN2, TFPI2, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZICl . The cell line SK47 is positive for the markers: BEX1, COL21A1, METTL7A, FMOl, FOXF1, FOXF2, FST, HTRA3, ICAM5, IGF2, IL1R1, KRT19, TMEM1 19, MSX1, PRRX2, PTPRN, SERPINA3, SOD3 and ZICl and is negative for the markers: AGC1, ALDH1A1, AQP1, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COL15A1, COP1, CRLFl, DKK2, DPT, EGR2, EMIDl, FGFR3, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYH1 1, IL32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PROM1, RARRES1, RASD1, RELN, RGSl, SLITRK6, SMOCl, SMOC2, STMN2, SYT12, TACl, TFPI2, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4 and ZD52F10. The group of cell lines SK5.Biol, SK5.Bio2, SK5Bio3 and SK5BioUT are positive for the markers: ACTC, C7, CRLFl, CRYAB, FST, HTRA3, IL1R1, TMEM1 19, MGP, PTPRN, SERPINA3, SFRP2 and ZICl and are negative for the markers: ALDH1A1, ANXA8, CFB, BMP4, C3, C20orfl03, CDH3, CLDN1 1, CNTNAP2, COP1, DKK2, EMIDl, FM03, GABRBl, GDF10, GSC, HSD17B2, HSPB3, IFI27, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MYH1 1, IL32, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PRELP, PROM1, RARRES1, RELN, RGSl, SLITRK6, SMOCl, SMOC2, STMN2, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and ZIC2. The cell line SK8 is positive for the markers: APCDD1, BEX1, COL21 Al, CRLFl, FMOl, FM03, FOXF2, FST, HTRA3, ICAM5, IGF2, IL1R1, TMEM1 19, MASPl, PTPRN, SERPINA3 and SFRP2 and is negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, BMP4, C7, PRSS35, C20orfl03, CD24, CDH3, CDH6, CLDNl l , CNTNAP2, COPl, DKK2, EMIDl, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, INA, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PROM1, PTN, RARRES1, RASD1, RELN, RGS1, SMOC1, SMOC2, STMN2, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, ZIC1 and ZIC2. The cell line SM17 is positive for the markers: BEX1, CD24, CRYAB, EGR2, FOXFl, FST, GDF5, HTRA3, IGFBP5, KRT19, MMP1, MSX1, MSX2, IL32, PODN, POSTN, PRELP, PRRX2, SRCRB4D, TFPI2, TSLP and ZIC1 and is negative for the markers: AGC1, AKR1C1, ALDH1 Al, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C6, C7, C20orfl03, CCDC3, CDH3, CLDNl l , CNTNAP2, COL15A1, DI02, METTL7A, DKK2, DLKl, DPT, FGFR3, TMEM100, FMOl, FM03, GABRBl, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, IFI27, IGF2, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, RARRES1, RASD1, RELN, RGS1, SMOC1, SMOC2, SNAP25, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2 and ZIC2. The cell line SM19 is positive for the markers: BEX1, CNTNAP2, CRYAB, FST, GDF5, MMP1, POSTN, PRRX2, SERPINA3 and SFRP2 and is negative for the markers: ACTC, AGC1, AKR1C1 , ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CDH3, CDH6, CLDNl l , COL21A1, COMP, COPl, CRLFl, DI02, METTL7A, DKK2, DLKl, DPT, EMIDl, FGFR3, TMEM100, FMOl, FM03, FOXF2, GABRBl, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, IGFBP5, IL1R1, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, RARRES1, RASD1, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TAC1, TFPI2, RSP03, THY1, TNFSF7, TNNT2, TRH, UGT2B7, WISP2, ZIC1 and ZIC2. The cell line SM2 is positive for the markers: CDH6, CNTNAP2, COL15A1, COL21A1, FST, GDF5, TMEM1 19, MMP1, MSX1, POSTN, PRRX1, SOD3, ZIC1 and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEX1, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDNl l , COMP, CRIPl, CRYAB, DI02, DPT, EMIDl, FGFR3, TMEM100, FM03, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PROM1, RARRES1, RASD1, RELN, RGS 1, SFRP2, SLITRK6, SMOC1, SMOC2, STMN2, SYT12, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7. The cell line SM22 is positive for the markers: CDH6, CRLFl, DLKl, FOXFl, FST, GDF5, HTRA3, IGFBP5, IL1R1, MGP, MMP1, MSX1, MSX2, OGN, POSTN, PRRX2, PTN, RGMA, SOD3, SRCRB4D, STMN2, TSLP, ZD52F10 and ZIC1 and is negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, BMP4, C3, C6, C7, C20orfl03, CCDC3, CDH3, CLDNl l , CNTNAP2, COL15A1 , CRIPl, CXADR, DI02, DKK2, DPT, TMEM100, FMOl, FOXF2, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, INA, KRT14, KRT17, KRT34, LAMC2, TMEM1 19, IGFL3, LOC92196, MFAP5, MASPl, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRG4, PROM1, PTPRN, RARRES1, RASD1, RELN, RGS1, SFRP2, SMOC1, SMOC2, SNAP25, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZIC2. The group of cell lines SM25 and Z8 are positive for the markers: FOXFl, FST, GDF5, HTRA3, MSX1, MSX2, PRRX2 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1 , ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, BMP4, C6, C7, C20orfl03, CD24, CDH3, CLDNl l , CNTNAP2, METTL7A, DKK2, EMIDl, TMEM100, FMOl, GABRBl, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PROM1, RARRES1, RASD1, RGS1, RPS4Y2, SFRP2, SLITRK6, SMOC1, SMOC2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7. The cell line SM28 is positive for the markers: COMP, CRLFl, DI02, EGR2, FOXF1, FOXF2, FST, HSPB3, INA, TMEM1 19, MGP, MMP1, MSX2, POSTN, PRELP, PRRX2, PTN and SYT12 and is negative for the markers: ACTC, AGCl, AKRICI, ALDHlAl, ANXA8, APCDDl, AQPl, AREG, ATP8B4, BEXl, CFB, C3, C6, C7, C20orfl03, CD24, CDH6, CLDN1 1, CNTNAP2, COL21A1, CXADR, METTL7A, DKK2, DLK1, FGFR3, TMEM100, FMOl, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, IL32, NLGN4X, TAGLN3, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, PTGS2, PTPRN, RARRESl, RASDl, RGSl, RPS4Y2, SERPINA3, SFRP2, SMOCl, SMOC2, SNAP25, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line SM29 is positive for the markers: FOXF1, FOXF2, FST, HTRA3, IGF2, IGFBP5, IL1R1, MASP1, MGP, MMP1, MSX2, OGN, PODN, POSTN, PRELP, PRRX2, PTN, SRCRB4D and TSLP and is negative for the markers: ACTC, AKRICI, ALDHlAl, ANXA8, APCDDl, AQPl, CFB, C6, C7, CCDC3, CDH3, CLDN1 1, CNTNAP2, COL15A1, COL21A1, CRIPl, CRLFl, CRYAB, DKK2, DPT, FGFR3, TMEM100, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX9, PDE1A, PENK, PITX2, PROM1, RARRESl, RASDl, RELN, RGSl, S100A4, SMOCl, SMOC2, SNAP25, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2. The cell line SM30 is positive for the markers: COL15A1, CRYAB, DYSF, FST, GDF5, HTRA3, TMEM1 19, MMP1, MSX1, MSX2, MYL4, POSTN, SERPINA3, SRCRB4D and ZIC2 and is negative for the markers: ACTC, AGCl, AKRICI, ALDHlAl, ANXA8, APCDDl, AQPl, ATP8B4, CFB, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, DI02, METTL7A, DKK2, DLK1, DPT, FGFR3, TMEM100, FMOl, FM03, FOXF2, GABRBl, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, ID4, IFI27, IL1R1, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, PRRX1, PTN, RARRESl, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and WISP2. The cell line SM33 is positive for the markers: BEXl, CDH6, CRLFl, EGR2, FOXF1, FST, IGFBP5, MSX1, MSX2, PRELP, SERPINA3, SRCRB4D, SYT12, TSLP and ZIC2 and is negative for the markers: ACTC, AGCl, AKRICI, ALDHlAl, ANXA8, APCDDl, AQPl, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COL21A1 , CRIPl, DI02, METTL7A, DLK1, DPT, EMID1, FGFR3, TMEM100, FMOl, GABRBl, GAP43, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ID4, IFI27, IL1R1, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, PTGS2, RARRESl, RASDl, RELN, RGSl, RPS4Y2, SFRP2, SMOCl, SMOC2, SNAP25, STMN2, TAC1, RSP03, THY1, TNFSF7, TRH, TUBB4, UGT2B7, WISP2 and ZIC1 . The cell line SM4 is positive for the markers: BEXl, CCDC3, CDH6, CRLFl, EGR2, FST, GABRBl, GAP43, GDF5, HSPB3, HTRA3, MMP1, MSX1, MSX2, PRELP, PRRX1, PRRX2 and SRCRB4D and is negative for the markers: AGCl, ALDHlAl, ANXA8, APCDDl, AQPl, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, PRSS35, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COL15A1, COL21A1, COP1, CXADR, METTL7A, DKK2, DLK1, DPT, EMID1, FGFR3, TMEM100, FMOl, FM03, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ICAM5, ID4, IFI27, IGF2, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, RARRESl, RASDl, RELN, RGSl, SFRP2, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC1 . The cell line SM40 is positive for the markers: BEXl, CD24, CRYAB, FST, HSPB3, IGFBP5, KRT19, MMP1, MYL4, POSTN, PRELP, SRCRB4D and ZD52F10 and is negative for the markers: AGCl, AKRICI, ALDHlAl, ANXA8, APCDDl, AQPl, AREG, CFB, C6, C7, CDH3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COL21 Al, COMP, CRLFl, DI02, METTL7A, DKK2, DLK1, DPT, EMID1, FGFR3, TMEM100, FMOl, FM03, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PROM1, PRRX1, RARRESl, RASDl, RELN, RGMA, RGSl, RPS4Y2, SFRP2, SLITRK6, SMOCl, SMOC2, SOXl l , STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2. The cell line SM42 is positive for the markers: COL15A1, EGR2, FST, GDF5, TMEM1 19, MMPl, MSX1, MSX2, PRELP, PRRX1, PRRX2, SFRP2, SRCRB4D, ZIC1 and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDNl l , CNTNAP2, CRIPl, CRYAB, DI02, METTL7A, DKK2, DLKl, DPT, EMIDl, FGFR3, TMEMIOO, FOXF2, GABRB1, GAP43, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, ID4, IFI27, KIAA0644, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMl, RARRESl, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7. The cell line SM44 is positive for the markers: CDH6, COMP, CRLF1, CRYAB, EGR2, FOXF1, FST, GDF5, HTRA3, MGP, MMPl, MSX2, POSTN, PRELP, PRRX2, SYT12 and TSLP and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDNl l , CNTNAP2, COL15A1, COL21A1, COP1, CXADR, METTL7A, DKK2, DLKl, DPT, EMIDl, FGFR3, TMEMIOO, FMOl, FM03, FOXF2, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGF2, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMl, PTN, PTPRN, RARRESl, RASDl, RELN, RGSl, SFRP2, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line SM49 is positive for the markers: FOXF1, FOXF2, FST, GAP43, GDF5, HSPB3, HTRA3, IGFBP5, MGP, MMPl, MSX2, POSTN, PRELP, PRRX2, PTN, RGMA, SOD3, SRCRB4D and SYT12 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, BMP4, C6, C7, C20orfl03, CD24, CDH3, CLDNl l , CNTNAP2, COL15A1, COL21A1, DI02, METTL7A, DPT, EMIDl, FGFR3, TMEMIOO, FMOl, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, KIAA0644, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMl, RARRESl, RELN, RGSl, SMOCl, SMOC2, SNAP25, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2 The cell line SM8 is positive for the markers: BEX1, CDH6, FOXF1, FST, GDF5, GDF10, IGF2, IGFBP5, MMPl, MSX1, TFPI2, TSLP and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CDH3, CLDNl l , COL21A1, COMP, CRYAB, DI02, METTL7A, DKK2, DLKl, DPT, EMIDl, FGFR3, TMEMIOO, FMOl, FM03, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, TMEM1 19, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PRG4, PROMl, PRRX1, PTGS2, RGMA, RGSl, S100A4, SFRP2, SLITRK6, SMOC2, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2 and ZD52F10. The cell line T14 is positive for the markers: BEX1, PRSS35, CCDC3, COL15A1, CRIPl, CRYAB, FST, HTRA3, IGF2, KCNMB1, KRT17, KRT19, LAMC2, PITX2, POSTN, S100A4, SOX1 1, THY1 and TNNT2 and is negative for the markers: AGC1, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CDH3, CLDNl l , CNTNAP2, COP1, CXADR, METTL7A, DLKl, DPT, EGR2, EMIDl, TMEMIOO, FMOl, FM03, FOXF1, FOXF2, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IGFBP5, KIAA0644, KRT14, IGFL3, LOC92196, MASP1, MEOX1, MEOX2, MGP, MX1, MYH3, IL32, NLGN4X, TAGLN3, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMl, PTGS2, PTPRN, RARRESl, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, SOD3, STMN2, TAC1, TFPI2, RSP03, TNFSF7, TRH, TUBB4, WISP2, ZD52F10, ZIC1 and ZIC2. The group of cell lines T4 and T23 are positive for the markers: BEX1, CCDC3, DKK2, KRT19 and LAMC2 and are negative for the markers: ALDH1A1, APCDD1, AQP1, CFB, C3, C6, C20orfl03, CDH3, CLDNl l , CNTNAP2, COL15A1, COMP, CRLF1, METTL7A, DPT, EMIDl, TMEMIOO, FM03, FOXF2, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, IFI27, IL1R1, KRT14, IGFL3, LOC92196, MASP1, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, MYH1 1, NLGN4X, NPAS1, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PROMl, PRRX2, PTPRN, RARRESl, RASDl, RGMA, RGSl, RPS4Y2, SFRP2, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNFSF7, TRH, WISP2, ZD52F10 and ZIC1 . The group of cell lines T36 and T42 are positive for the markers: BEX1, CCDC3, CDH6, CRIPl, FST, HTRA3, KRT17, PTN, S100A4, SRCRB4D, THYl and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, C3, C6, C7, PRSS35, C20orfl03, CDH3, CLDN1 1, CNTNAP2, CRLF1, METTL7A, DLK1, DPT, EMID1, FMOl, FM03, FOXF2, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, KRT14, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MGP, MMP1, MYBPH, MYH3, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX9, PDE1A, PENK, PRG4, PROMl, PTPRN, RARRESl, RASDl, RELN, RGSl, SLITRK6, SMOC2, SNAP25, STMN2, TACl, RSP03, TRH, TUBB4 and WISP2. The group of cell lines T43 and T44 are positive for the markers: BEX1, PRSS35, CCDC3, CDH6, COL21A1, CRIPl, CRYAB, ICAM5, KRT17, LAMC2, POSTN, S100A4, SFRP2 and THYl and are negative for the markers: AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COP1, METTL7A, DLK1, DPT, EMID1, FMOl, FM03, FOXF1, FOXF2, GABRBl, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, IFI27, IGFBP5, IGFL3, LOC92196, MEOX1, MEOX2, MGP, NLGN4X, TAGLN3, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PRG4, PROMl, RARRESl, RASDl, RELN, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, TACl, TRH, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC2. The cell line U18 is positive for the markers: ANXA8, BEX1, PRSS35, CCDC3, CDH6, CRYAB, DKK2, KRT19, MYH1 1, NPPB, TNNT2 and ZIC2 and is negative for the markers: ACTC, AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COL15A1, COP1, CRLF1, DI02, METTL7A, DPT, EGR2, EMID1, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRBl, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IGF2, IGFBP5, KIAA0644, KRT14, TMEM1 19, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, NLGN4X, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PROMl, PTPRN, RARRESl, RASDl, RELN, RGSl, SFRP2, SLITRK6, SMOCl, SMOC2, SNAP25, SOD3, STMN2, TACl, TFPI2, RSP03, THYl, TNFSF7, TRH, TUBB4, WISP2 and ZIC1 . The group of cell lines U30, U30 and U31 are positive for the markers: BEX1, CDH6, CRYAB, KCNMB1, KRT17, MYH1 1, ZIC1 and ZIC2 and are negative for the markers: ALDH1A1, ATP8B4, C3, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COP1, CRLF1, METTL7A, DPT, FMOl, FM03, FOXF1, FOXF2, GABRBl, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, IFI27, KIAA0644, KRT14, MEOX2, MGP, MYH3, OGN, OLR1, PAX2, PAX9, PDE1A, PROMl, PTPRN, RASDl, RGSl, SFRP2, SMOCl, SNAP25, TACl, TNNT2, TRH, TUBB4 and WISP2. The cell line Wl l is positive for the markers: COL15A1, COL21A1, DI02, DLK1, FMOl, FOXF1, FOXF2, FST, HTRA3, IGF2, IL1R1, TMEM1 19, OGN, PRRX2, PTN, SERPINA3, SLITRK6, SOD3, TFPI2 and WISP2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, CRIPl, CRYAB, CXADR, DKK2, EMID1, FGFR3, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PRG4, PROMl, RASDl, RELN, RGSl, SMOCl, SMOC2, STMN2, TACl, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line W2 is positive for the markers: BEX1, CD24, COL21A1, FST, HTRA3, ICAM5, IGF2, IGFBP5, IL1R1, KRT19, LAMC2, TMEM1 19, MSX1, MSX2, PTN, SERPINA3, SFRP2, SOD3, SOX1 1, SRCRB4D and ZIC2 and is negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, ATP8B4, BMP4, C6, C7, C20orfl03, CCDC3, CDH3, CLDN1 1, CNTNAP2, COL15A1, COMP, COP1, CRLF1, DKK2, DLK1, DPT, EGR2, EMID1, TMEM100, FM03, FOXF2, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSPA6, ID4, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMl, PTGS2, RARRESl, RASDl, RELN, RGMA, RGS l , SLITRK6, SMOCl, SMOC2, STMN2, SYT12, TACl, TNFSF7, TNNT2, TRH, TSLP, TUBB4 and ZIC1 . The cell line W3 is positive for the markers: BEX1, CRIPl, FOXFl, FST, GDF5, HSPA6, HTRA3, IGF2, IGFBP5, KRT19, LAMC2, MMP1, MSX1, POSTN, PTPRN and TFPI2 and is negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, BMP4, C6, C7, PRSS35, C20orfl03, CCDC3, CDH3, CLDN1 1, CNTNAP2, COL15A1, COL21A1, COMP, DI02, METTL7A, DKK2, DLKl, DPT, EGR2, EMIDl, FGFR3, FMOl, FM03, FOXF2, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, IFI27, IFIT3, INA, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROM1, PRRXl, RARRESl, RELN, RGMA, RGSl, SLITRK6, SMOCl, SMOC2, SOX1 1, SYT12, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZIC1 and ZIC2. The cell line W8 is positive for the markers: AQP1, CDH6, DI02, DLKl, EMIDl, FOXFl, FOXF2, FST, HTRA3, IL1R1, MSX1, MSX2, PRRX2, PTN, SLITRK6, SRCRB4D, TSLP and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, BMP4, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, CRLFl, CRYAB, CXADR, DKK2, DPT, EGR2, FGFR3, TMEMIOO, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PROM1, PRRXl, RARRESl, RASD1, RGMA, RGSl, SMOCl, SMOC2, STMN2, SYT12, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC1 . The cell line X4 is positive for the markers: ACTC, AQP1, BEX1, BMP4, CD24, CDH6, CLDN1 1 CRYAB, CXADR, HTRA3, INA, KRT17, KRT19, LAMC2, MMP1, IL32, NLGN4X, TAGLN3, NPPB, PAX2, PROM1, RASD1, RELN and UGT2B7 and is negative for the markers: AGC1, ALDH1A1, APCDD1, ATP8B4, CFB, C3, C6, C7, C20orfl03, CCDC3, CDH3, CNTNAP2, COL15A1, COL21A1, COMP, COP1, CRLFl, DI02, METTL7A, DKK2, DLKl, DPT, EGR2, EMIDl, TMEMIOO, FMOl, FM03, FOXFl, FOXF2, FST, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGF2, IL1R1, KCNMB1, KIAA0644, TMEM1 19, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, MYL4, OGN, OSR2, PAX9, PDE1A, PENK, PITX2, PRELP, PRRXl, PRRX2, PTGS2, PTN, RARRESl, RGMA, RGSl, SERPINA3, SLITRK6, SMOCl, SMOC2, SOD3, TAC1, RSP03, TNNT2, TRH, TUBB4, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line X5.4 is positive for the markers: ACTC, CD24, CLDN1 1, CRIPl, CRYAB, HTRA3, KRT19, KRT34, LAMC2, MMP1, IL32, NLGN4X, TAGLN3, NPPB, PAX2, POSTN, RELN, S100A4, SFRP2, SRCRB4D, THY1 and UGT2B7 and is negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CNTNAP2, COL21A1, COMP, COP1, CRLFl, DI02, METTL7A, DKK2, DLKl, DPT, EMIDl, TMEMIOO, FMOl, FM03, FOXFl, FOXF2, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGF2, KIAA0644, TMEM1 19, IGFL3, MASP1, MEOX2, MSX1, MX1, MYBPH, MYH3, MYL4, NPAS1, OGN, OSR2, PAX9, PDE1A, PENK, PRELP, PRRXl, PRRX2, PTPRN, RARRESl, RGMA, RGSl, SLITRK6, SMOCl, SMOC2, SNAP25, SOD3, TAC1, RSP03, TNNT2, TRH, TUBB4, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line X5 is positive for the markers: ACTC, AKR1C1, BEX1, CLDN1 1, COMP, CRIPl, CRYAB, GDF5, HTRA3, KIAA0644, KRT14, KRT19, KRT34, LAMC2, MFAP5, MEOX2, MGP, MMP1, PENK, PITX2, POSTN, PTGS2, S100A4 and THY1 and is negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, C6, C7, C20orfl03, CCDC3, CDH6, CNTNAP2, COL15A1, COL21A1, COP1, CXADR, DI02, DKK2, DLKl, DPT, EMIDl, FGFR3, TMEMIOO, FMOl, FM03, FOXFl, FOXF2, GAP43, GDF10, HSD1 1B2, HSD17B2, HSPA6, IFI27, IFIT3, IGF2, IGFL3, LOC92196, MEOX1, MSX1, MSX2, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PROM1, PTPRN, RASD1, RELN, RGSl, SERPINA3, SFRP2, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The group of cell lines X7PEND12 and X7PEND24 are positive for the markers: AQP1, BEX1, CDH3, DI02, DLKl, FOXFl, FST, GABRBl, IGF2, IGFBP5, IL1R1, KIAA0644, MSX1, PODN, PRRX2, SERPINA3, SOX1 1, SRCRB4D and TFPI2 and are negative for the markers: ACTC, AGC1, AKR1C1 , ALDH1A1, ANXA8, APCDD1, AREG, CFB, C3, C6, C7, PRSS35, CCDC3, CD24, CLDN1 1, COMP, COP1, CXADR, DKK2, EMIDl, FGFR3, FMOl, FM03, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PRG4, PRRXl, RARRESl, RELN, RGMA, SFRP2, SMOCl, SMOC2, SOD3, SYT12, TAC1, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The group of cell lines X7PEND9 and X7PEND16 are positive for the markers: BEXl, CDH6, DLK1, TMEM100, FOXF1, FOXF2, IGF2, IGFBP5, IL1R1, KIAA0644, TMEM1 19, MGP, MSX1, MSX2, PDE1A, PODN, PRRX2, PTN, S100A4, SERPINA3, SNAP25, SOX1 1 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AREG, ATP8B4, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, CNTNAP2, COPl, CRYAB, CXADR, METTL7A, DKK2, EMIDl, FGFR3, FMOl, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PRG4, PROM1, PTPRN, RASD1, RELN, RGS1, SFRP2, SMOC1, SMOC2, SOD3, SYT12, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line X7PEND30 is positive for the markers: BEXl, PRSS35, CDH6, COL15A1, DI02, DLK1, DPT, TMEM100, FMOl, FM03, FOXF1, FOXF2, FST, HSPB3, IGF2, IGFBP5, IL1R1, KIAA0644, KRT19, LAMC2, TMEM1 19, MGP, MSX1, PDE1A, PODN, PRRX2, S100A4, SERPINA3, SOX1 1 and SRCRB4D and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, C3, C7, C20orfl03, CCDC3, CD24, CDH3, CLDNl l , CNTNAP2, COPl, CXADR, DKK2, EMIDl, FGFR3, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PRRX1, PTGS2, PTPRN, RELN, RGS1, SFRP2, SMOC1, SMOC2, SOD3, STMN2, SYT12, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line X7SKEL2 is positive for the markers: APCDD1, BEXl, C6, C7, PRSS35, COL21A1, CRIPl, CRLF1, CRYAB, DLK1, TMEM100, FMOl, FOXF2, GDF5, HSD1 1B2, IGF2, IGFBP5, KRT19, LAMC2, TMEM1 19, MGP, NPAS1, PRRX2, PTPRN, RGMA, S100A4, SERPINA3, SNAP25 and SOX1 1 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, CDH6, CLDNl l , CNTNAP2, COMP, COPl, CXADR, DI02, METTL7A, DKK2, DPT, EGR2, EMIDl, FGFR3, FOXF1, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HTRA3, ID4, IFI27, IFIT3, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MSX2, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PROM1, PRRX1, PTGS2, PTN, RARRES1, RELN, RGS1, SLITRK6, SMOC1, SMOC2, SOD3, STMN2, SYT12, TAC1, TFPI2, RSP03, THY1, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZIC1 and ZIC2. The cell line X7SKEL22 is positive for the markers: ACTC, BEXl, C7, PRSS35, COL21A1, CRIPl, CRYAB, DI02, DPT, EGR2, FM03, FOXF1, FOXF2, FST, GJB2, HSPB3, IGF2, IGFBP5, IL1R1, KRT19, LAMC2, TMEM1 19, MGP, NPAS1, PODN, PRRX2, SERPINA3, SOX1 1 and SRCRB4D and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, CDH6, CLDNl l , CNTNAP2, COL15A1, COMP, COPl, CXADR, METTL7A, DKK2, DLK1, EMIDl, FGFR3, TMEM100, GABRB1, GAP43, GDF5, GDF10, GSC, HOXA5, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, IFIT3, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MSX1, MSX2, MX1, MYBPH, MYH3, MYH1 1, IL32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PRG4, PROM1, PRRX1, PTN, RARRES1, RASD1, RELN, RGS1, SFRP2, SLITRK6, SMOC1, SMOC2, SOD3, STMN2, SYT12, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The group of cell lines X7SKEL4, X7SKEL6 and X7SKEL7 are positive for the markers: BEXl, COL21A1, CRLF1, DLK1, FMOl, FM03, FOXF1, FOXF2, HSD1 1B2, IGF2, IGFBP5, IL1R1, TMEM1 19, PRRX2, RGMA, SERPINA3, SNAP25, SOX1 1 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, CLDNl l , CNTNAP2, COL15A1, COMP, COPl, CXADR, DKK2, EMIDl, FGFR3, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HTRA3, ID4, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMP1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PENK, PITX2, POSTN, PRELP, PROM1, RELN, RGS1, SFRP2, SLITRK6, SMOC1, SMOC2, SOD3, STMN2, SYT12, TAC1, TFPI2, RSP03, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4 and ZIC1 . The cell line X7SM0012 is positive for the markers: BEX1, CDH6, COL21A1, CRIPl, DI02, DLK1, EGR2, FOXF1, FOXF2, FST, IGF2, IGFBP5, TMEM1 19, MSX1, MSX2, MX1, PODN, POSTN, PRRX2, PTN, S100A4, SERPINA3, SOX1 1, TFPI2, WISP2 and ZIC2 and is negative for the markers: ACTC, AGCl, AKRICI, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, C3, C6, C7, C20orfl03, CCDC3, CD24, CLDNl l , CNTNAP2, COMP, COPl, CRYAB, CXADR, METTL7A, DKK2, EMIDl, FGFR3, TMEM100, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, IL1R1, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMP1, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PTGS2, RARRES1, RGS1, SFRP2, SMOCl, SMOC2, SOD3, SYT12, TACl, RSP03, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZD52F10 and ZIC1 . The cell line X7SM0019 is positive for the markers: BEX1, CDH6, COL15A1, COL21 Al, COMP, CRIPl, DLK1, EGR2, FMOl, FM03, FOXF1, FOXF2, FST, HSPA6, IGF2, IGFBP5, KIAA0644, KRT19, LAMC2, TMEM1 19, MSX1, MSX2, OGN, PODN, PRRX2, RGMA, S100A4, SERPINA3, SNAP25, SOX1 1, SRCRB4D, TNNT2 and ZIC2 and is negative for the markers: ACTC, AGCl, AKRICI, ALDHl Al, ANXA8, APCDD1, AREG, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CD24, CLDNl l , COPl, CXADR, DI02, METTL7A, DKK2, DPT, EMIDl, TMEM100, GABRB1, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HTRA3, ICAM5, ID4, IFI27, IL1R1, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MMP1, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRG4, PROM1, PTPRN, RARRES1, RELN, RGS1, SFRP2, SLITRK6, SMOCl, SMOC2, SOD3, STMN2, SYT12, TACl, RSP03, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZICl . The cell line X7SM0025 is positive for the markers: AQP1, ATP8B4, BEX1, CDH3, COL21A1, CRIPl, DLK1, FOXF1, FOXF2, FST, GABRB1, HSPB3, IGF2, IGFBP5, IL1R1, KRT19, LAMC2, TMEM1 19, MSX1, MSX2, PODN, POSTN, PRRX2, PTN, RGMA, S100A4, SERPINA3, SLITRK6, SOX1 1, SRCRB4D, TFPI2, RSP03 and THY1 and is negative for the markers: ACTC, AGCl, AKRICI, ANXA8, APCDD1, AREG, CFB, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CLDNl l , COL15A1, COPl, CXADR, METTL7A, DKK2, EGR2, EMIDl, FGFR3, TMEM100, FMOl, FM03, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MASPl, MEOXl, MEOX2, MGP, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROM1, PRRX1, PTPRN, RASD1, RELN, RGS1, SFRP2, SMOCl, SMOC2, SOD3, SYT12, TACl, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line X7SM0026 is positive for the markers: BEX1, CCDC3, CDH6, COL15A1, COL21A1, COMP, CRIPl, CRLF1, CRYAB, DI02, EGR2, FOXF1, FOXF2, FST, GDF10, HSPB3, IGF2, IGFBP5, KRT19, LAMC2, TMEM1 19, MSX1, MSX2, NPAS1, PODN, POSTN, PRRX2, S100A4, SERPINA3, SOX1 1, SRCRB4D, TNNT2 and ZIC2 and is negative for the markers: ACTC, AGCl, AKRICI, ALDHl Al, ANXA8, APCDD1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDNl l , COPl, METTL7A, DLK1, DPT, EMIDl, FGFR3, TMEM100, FMOl, FM03, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, IL1R1, KCNMB1, KIAA0644, KRT14, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, IL32, NLGN4X, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROM1, PTGS2, PTN, PTPRN, RARRES1, RASD1, RELN, RGS1, SFRP2, SLITRK6, SMOCl, SMOC2, SNAP25, SOD3, STMN2, SYT12, TACl, TFPI2, RSP03, THY1, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC1 . The group of cell lines X7SM009 and X7SM0029 are positive for the markers: BEX1, COL21A1, CRIPl, CRLF1, DI02, DLK1, FOXF1, FOXF2, FST, IGF2, IGFBP5, KIAA0644, TMEM1 19, MSX1, PODN, POSTN, PRRX2, RGMA, S100A4, SERPINA3, SNAP25, SOX1 1 and SRCRB4D and are negative for the markers: ACTC, AGCl, AKRICI, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDNl l , COPl, CXADR, METTL7A, DKK2, EMIDl, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, IL1R1, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, PTPRN, RASD1, RELN, RGS1, SMOCl, SMOC2, SYT12, TACl, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZD52F10 and ZICl . The cell line X7SM0032 is positive for the markers: ACTC, BEXl, CDH6, COL21A1, CRIPl, CRLF1, DI02, DLK1, EGR2, FGFR3, FOXF1, FOXF2, FST, GABRB1, IGFBP5, KIAA0644, KRT19, LAMC2, TMEM1 19, MGP, MMP1, MSX1, MSX2, PODN, POSTN, PRG4, PRRX2, PTN, RGMA, S100A4, SERPINA3, SOXl l and SRCRB4D and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, ATP8B4, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CLDN1 1, CNTNAP2, COL15A1, COP1, CXADR, METTL7A, DKK2, DPT, EMID1, TMEM100, FMOl, FM03, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, IL1R1, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PITX2, PRELP, PROM1, PTPRN, RASDl, RGS1, SFRP2, SMOC1, SMOC2, SOD3, STMN2, SYT12, TACl, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line X7SM006 is positive for the markers: ACTC, BEXl, CNTNAP2, COL15A1 , COL21 Al, CRIPl, CRLF1, CRYAB, DLK1, EGR2, FMOl, FM03, FOXF1, FOXF2, FST, HSPB3, IGF2, IGFBP5, KRT19, LAMC2, TMEM1 19, MGP, MSX1, MSX2, NPAS1, OGN, PODN, POSTN, PRRX2, RGMA, S100A4, SERPINA3, SNAP25, SOXl l , SRCRB4D, STMN2 and TNNT2 and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CD24, CLDN1 1, COP1, CXADR, DI02, METTL7A, DKK2, EMID1, TMEM100, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, IL1R1, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, TAGLN3, NPPB, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PRRX1, PTGS2, PTPRN, RASDl, RELN, RGS1, SFRP2, SMOC1, SMOC2, SYT12, TACl, RSP03, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The cell line X7SM007 is positive for the markers: ACTC, BEXl, CDH6, CRIPl, CRLF1, CRYAB, DLK1, EGR2, FOXF1, FOXF2, FST, HSPA6, IGF2, IGFBP5, INA, LAMC2, MMP1, MSX1, MSX2, TAGLN3, POSTN, PRRX2, PTGS2, PTPRN, RASDl, RELN, S100A4, SNAP25, SOXl l , SRCRB4D, TACl, TFPI2 and RSP03 and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CDH3, CLDN1 1, CNTNAP2, COL15A1, COL21A1, COP1, CXADR, METTL7A, DKK2, DPT, EMID1, FM03, GAP43, GDF5, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPB3, HTRA3, ID4, IFI27, IFIT3, KCNMB1, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MGP, MYBPH, MYH3, MYHl l , MYL4, IL32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROM1, PRRX1, PTN, RGMA, RGS1, SFRP2, SLITRK6, SMOC2, SOD3, STMN2, SYT12, TNNT2, TRH, TSLP, TUBB4, WISP2 and ZIC1 . The group of cell lines Zl, Z6 and Z7 are positive for the markers: FST, GDF5, MMP1, MSX1, SRCRB4D, ZIC1 and ZIC2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CDH3, CLDN1 1, CNTNAP2, CRLF1, DI02, METTL7A, DKK2, DLK1, DPT, EMID1, FGFR3, TMEM100, FMOl, FM03, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ID4, IFI27, IGF2, KCNMB1, KIAA0644, KRT14, IGFL3, LOC92196, MFAP5, MASPl, MEOXl, MEOX2, MGP, MYBPH, MYH3, MYHl l , NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, RARRES1, RASDl, RELN, RGS1, SFRP2, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TACl, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and WISP2. The cell line Zl l (also known as Zl lRepl and Zl lRep2 and ACTC194) is positive for the markers: ATP8B4, CD24, DLK1, FOXF1, FST, HTRA3, IGF2, IGFBP5, IL1R1, MSX1, NLGN4X, OSR2, PODN, PROM1, PRRX2, PTN, SOD3, SOXl l , SRCRB4D, STMN2 and TFPI2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, CFB, C6, C7, PRSS35, CCDC3, CDH3, CLDN1 1, CNTNAP2, COMP, CRIPl, CRLF1, DI02, DKK2, DPT, EMID1, FMOl, FM03, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MX1, MYBPH, MYH3, MYHl l , MYL4, IL32, NPPB, OLR1, PAX2, PITX2, RARRES1, RASDl, RGS1, SMOC1, SMOC2, SNAP25, TACl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2. The cell line Z2 is positive for the markers: BEXl, CCDC3, EGR2, FOXF1, FOXF2, FST, GDF5, HSPB3, IGFBP5, INA, TMEM1 19, MASPl, MMP1, MSX2, POSTN, PRELP, PRRX2, PTN, SRCRB4D, TFPI2 and TSLP and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, BMP4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COL21A1, DI02, DKK2, DLK1, DPT, FGFR3, TMEM100, FMOl, FM03, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MYBPH, MYH3, MYHl l , NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, RARRES1, RASDl, RGS1, SMOC1, SMOC2, SNAP25, STMN2, TACl, RSP03, TNFSF7, TNNT2, TRH, TUBB4, WISP2, ZIC1 and ZIC2. The cell line MEL2 is positive for the markers: AKR1C1, AQP1, COL21A1, CRYAB, CXADR, DI02, METTL7A, DKK2, DLK1, HSD17B2, HSPB3, MGP, MMP1, MSX2, PENK, PRRX1, PRRX2, S100A4, SERPINA3, SFRP2, SNAP25, SOX1 1, TFPI2 and THY1 and is negative for the markers: ACTC, ALDHlAl, AREG, CFB, C3, C20orfl03, CD24, CDH3, CDH6, CNTNAP2, COL15A1, COMP, COP1, CRLFl, FGFR3, FMOl, FM03, FOXF2, FST, GABRB1, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, ICAM5, KCNMB1, KRT14, KRT17, KRT19, KRT34, MASPl, MEOXl, MEOX2, MYBPH, MYH3, MYHl l , TAGLN3, NPASl, NPPB, OLRl, PAX2, PDE1A, PITX2, PRG4, PTN, PTPRN, RASD1, RELN, RGSl, SMOCl, STMN2, TACl, TNFSF7, TRH, TUBB4, WISP2, ZIC1 and ZIC2. The cell line C4ELSR10 is positive for the markers: AKR1C1, ALDHlAl, ANXA8, AREG, CDH6, COP1, DI02, METTL7A, EGR2, FOXFl, HSD17B2, IGFBP5, KIAA0644, KRT19, KRT34, OLRl, PITX2, S100A4, STMN2 and TFPI2 and is negative for the markers: ACTC, AQP1, C7, C20orfl03, CD24, CDH3, CLDNl l , CNTNAP2, COMP, CRIPl, CRLFl, DKK2, DLK1, DPT, FGFR3, FMOl, GABRB1, GAP43, GDF10, GJB2, GSC, HSD1 1B2, HSPA6, HSPB3, ICAM5, ID4, KRT14, KRT17, LAMC2, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMP1, MSX1, MYBPH, MYH3, MYHl l , TAGLN3, NPASl, NPPB, OGN, PAX2, PAX9, PENK, PRELP, PRG4, PRRX1, PRRX2, PTN, RELN, RGS l , SERPINA3, SFRP2, SMOCl, SNAP25, SOX1 1, TACl, TNNT2, TUBB4, WISP2, ZIC1 and ZIC2. The cell line Z3 is positive for the markers: BEX1, CDH6, COL21 Al, CXADR, EGR2, FOXFl, FST, HSD17B2, LAMC2, MMP1, MSX1, MSX2, SERPINA3, ZIC1 and ZIC2 and is negative for the markers: ACTC, ALDHlAl, AQP1, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDNl l , CNTNAP2, COMP, CRIPl, CRLFl, DI02, METTL7A, DKK2, DLK1, DPT, FGFR3, FMOl, FM03, GABRB1, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMB1, KIAA0644, KRT14, KRT17, MFAP5, MASPl, MEOXl, MEOX2, MGP, MXl, MYBPH, MYH3, MYHl l , NPASl, OGN, OLRl, PAX2, PAX9, PDE1A, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRES l , RASD1, RGSl, S100A4, SFRP2, SMOCl, SNAP25, STMN2, TACl, TNFSF7, TUBB4 and WISP2. The cell line SK15 is positive for the markers: AREG, BEX1, FOXFl, KRT19, LAMC2, MSX1, PITX2, S100A4, SERPINA3 and THY1 and is negative for the markers: AGC1, ALDHlAl, AQP1, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CDH6, CLDNl l , CNTNAP2, COL15A1, COMP, CRIPl, CRLFl, DLK1, DPT, FMOl, FM03, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IGF2, IGFBP5, KCNMB1, KIAA0644, KRT14, KRT17, MFAP5, MASPl, MEOXl, MEOX2, MGP, MSX2, MXl, MYBPH, MYH3, MYHl l , OGN, OLRl, PAX2, PAX9, PDE1A, PRG4, PROM1, PRRX2, PTN, RARRESl, RGSl, SFRP2, SMOCl, SNAP25, STMN2, TACl, TNNT2, TRH, TUBB4, WISP2, ZIC1 and ZIC2. The cell line W8Rep2a is positive for the markers: AQP1, AREG, BEX1, CDH6, COL21A1, COP1, DI02, METTL7A, DLK1, FMOl, FM03, FOXFl, FOXF2, MMP1, MSX1, MSX2, PDE1A, PRRX2, SERPINA3, SNAP25, SOX1 1, TFPI2 and ZIC2 and is negative for the markers: ALDHlAl, ATP8B4, C3, C7, C20orfl03, CD24, CLDNl l , CNTNAP2, COMP, CRIPl, CRLFl, CXADR, DKK2, DPT, EGR2, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MGP, MXl, MYBPH, MYH3, MYHl l , NPASl, NPPB, OLRl, PAX2, PAX9, PITX2, PRG4, PROM1, PRRX1, PTGS2, PTN, PTPRN, RGSl, SFRP2, STMN2, TACl, THY1, TNNT2, TRH, TUBB4 and ZIC1 . The cell line E55 is positive for the markers: AKR1C1, BEX1, CDH6, COL21 Al, DI02, DKK2, EGR2, GAP43, KRT19, MSX2, PRRX1, S100A4, SOX1 1, THY1, TNNT2 and ZIC2 and is negative for the markers: ALDHlAl, AQP1, AREG, ATP8B4, C3, C7, C20orfl03, CLDNl l , CNTNAP2, COMP, CRLFl, CXADR, DLK1, DPT, FMOl, FM03, FOXF2, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IGF2, KRT14, KRT34, LAMC2, MFAP5, MASPl, MEOXl, MEOX2, MGP, MYBPH, MYH3, NPASl, NPPB, OGN, OLRl, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRESl, RGSl, SFRP2, SMOCl, SNAP25, STMN2, TACl, TRH, TUBB4, WISP2 and ZICl . The cell line T20 is positive for the markers: ACTC, AKR1C1, BEX1, CDH6, COL21 Al, CRYAB, DKK2, EGR2, GAP43, LAMC2, MMP1, MSX2, PITX2, SOX1 1, THY1 and ZIC2 and is negative for the markers: ALDHlAl, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CLDNl l , CNTNAP2, COMP, CRLFl, METTL7A, DPT, FMOl, FM03, FOXF2, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, KIAA0644, KRT14, MASPl, MEOX2, MGP, MXl, MYBPH, MYH3, TAGLN3, NPASl, NPPB, OGN, OLRl, PAX2, PDE1A, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRESl, RASD1, RGSl, SFRP2, SMOCl, SNAP25, STMN2, TACl, TFPI2, TNFSF7, TRH, TUBB4, WISP2 and, ZIC1 . The cell line X4D20.8 is positive for the markers: BEXl, CDH6, CNTNAP2, COL21 Al, CRIPl, CRYAB, DI02, DKK2, GAP43, ID4, LAMC2, MMP1, MSX2, S100A4, SOX1 1 and THY1 and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN1 1, COP1, CRLF1, DLK1, DPT, FMOl, FM03, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, KRT14, KRT17, KRT34, MASPl, MEOX2, MSXl, MXl, MYBPH, MYH3, MYHl l , TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PDE1A, PRG4, PROM1, PTN, PTPRN, RARRESl, RGSl, SNAP25, STMN2, TACl, TNNT2, TRH, TUBB4, WISP2, ZIC1 and ZIC2. The cell line X4D20.3 is positive for the markers: ACTC, AKRICI, AQP1, BEXl, CDH6, COL21 Al, CRYAB, DKK2, DLK1, GJB2, HSD17B2, KRT17, LAMC2, MYL4, PITX2, S100A4, SOX1 1, THY1, TNNT2, ZIC1 and ZIC2 and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN1 1, CNTNAP2, COMP, COP1, CRLF1, METTL7A, DPT, FGFR3, FMOl, FM03, FOXF1, GABRB1, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, IGFBP5, KIAA0644, KRT14, KRT34, MASPl, MEOX2, MGP, MSX2, MXl, MYBPH, MYH3, MYHl l , NPAS1, OGN, OLR1, PAX9, PDE1A, PENK, PRG4, PROM1, PRRX2, PTN, RARRESl, RGSl, SFRP2, SNAP25, STMN2, TACl, TRH, TUBB4 and WISP2. The cell line E132 is positive for the markers: ACTC, AKRICI, AQP1, CD24, CDH6, COL21A1, CRYAB, DKK2, KRT19, TAGLN3, RELN, S100A4, SFRP2, SOX1 1, THY1 and ZIC2 and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CLDN1 1, CNTNAP2, COL15A1, COMP, COP1, CRLF1, DI02, METTL7A, DLK1, DPT, FMOl, FM03, FOXF1, FOXF2, FST, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IGF2, KCNMB1, KRT14, MFAP5, MASPl, MEOX2, MGP, MYBPH, MYH3, MYHl l , NPAS1, NPPB, OGN, OLR1, PDE1A, PRG4, PROM1, PRRX2, PTGS2, PTN, PTPRN, RARRESl, RASDl, RGSl , SERPINA3, SMOCl, SNAP25, STMN2, TACl, TRH, TUBB4, WISP2 and ZIC1 . The cell line M13 is positive for the markers: ACTC, ANXA8, BEXl, CDH6, COL15A1, EGR2, GDF10, GJB2, KRT19, LAMC2, MYL4, TAGLN3, S100A4, SFRP2, SOX1 1, THY1, ZIC1 and ZIC2 and is negative for the markers: ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN1 1, CNTNAP2, COMP, COP1, CRLF1, DI02, DLK1, DPT, FGFR3, FMOl , FM03, FOXF1, GABRBI, GAP43, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KIAA0644, KRT14, MFAP5, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, NPAS1, OGN, OLR1, PDE1A, PRELP, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRESl, RASDl, RELN, RGSl, SMOCl, SNAP25, STMN2, TACl, TRH, TUBB4 and WISP2. The cell line M10 is positive for the markers: ACTC, BEXl, CDH6, COL21A1, DI02, DKK2, EGR2, IGFBP5, PRRX1, S100A4, SFRP2, THY1 and ZIC2 and is negative for the markers: AKRICI, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, COP1, CRLF1, CXADR, METTL7A, DPT, FMOl, FM03, FOXF1, GABRB1, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, KIAA0644, KRT14, MEOX1, MEOX2, MGP, MYBPH, MYH3, MYHl l , TAGLN3, NPAS1, OGN, OLR1, PAX2, PAX9, PDE1A, PITX2, PRG4, PROM1, PRRX2, PTN, PTPRN, RELN, RGSl, SERPINA3, SMOCl, SNAP25, STMN2, TACl, TNFSF7, TNNT2, TRH, TUBB4, WISP2 and ZIC1 . The cell line E109 is positive for the markers: ACTC, AKRICI, BEXl, CDH6, COL15A1, COL21A1, CRIPl, CRYAB, DI02, DKK2, GAP43, GDF5, ID4, KRT14, KRT19, KRT34, MFAP5, MEOX2, MGP, MMP1, MYHl l , S100A4, TFPI2, THY1 and ZIC1 and is negative for the markers: ALDH1A1, AQP1, AREG, ATP8B4, C3, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, CRLF1, CXADR, METTL7A, DLK1, DPT, FMOl, FM03, FOXF1, FOXF2, GDF10, GJB2, GSC, HSD1 1B2, HSD17B2, HSPA6, ICAM5, IGF2, KIAA0644, MASPl, MEOX1, MYBPH, MYH3, TAGLN3, NPAS1, NPPB, OGN, PAX2, PAX9, PDE1A, PITX2, PRG4, PROM1, PRRX2, PTN, RARRESl, RASDl, RGSl, SFRP2, SMOCl, SNAP25, STMN2, TACl, TRH, TUBB4 and WISP2. The cell line E34 is positive for the markers: ACTC, AGC1, AQP1, CDH6, COL15A1, COL21A1, CRYAB, DKK2, GAP43, KRT14, KRT17, KRT19, KRT34, MFAP5, MEOX1, MEOX2, MGP, MYHl l , TAGLN3, S100A4, THY1, TNNT2, ZIC1 and ZIC2 and is negative for the markers: ALDH1A1, AREG, ATP8B4, C3, C7, C20orfl03, CDH3, CLDN1 1, CNTNAP2, COMP, COP1, CRLF1, CXADR, DI02, METTL7A, DPT, FMOl, FM03, FOXF1, FOXF2, FST, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSPA6, IFI27, IGF2, KIAA0644, LAMC2, MASPl, MSX2, MXl, MYBPH, MYH3, NPAS1, OLR1, PAX9, PDE1A, PRG4, PROM1, PRRX2, PTN, RARRESl, RASDl, RGSl, SERPINA3, SFRP2, SMOCl, SNAP25, STMN2, TACl, TFPI2, TRH, TUBB4 and WISP2. The cell line E122 is positive for the markers: ACTC, AGC1, AKR1C1, BEXl, CDH6, COL21A1, CRIPl, CRYAB, DI02, DKK2, GAP43, ID4, KRT19, MFAP5, MYH1 1, MYL4, OGN, PRRX1, PTGS2, S100A4, SOX1 1 and THY1 and is negative for the markers: ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COL15A1, COP1, CRLF1, METTL7A, DLK1, DPT, FMOl, FM03, FOXF2, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, KIAA0644, KRT14, KRT17, KRT34, LAMC2, MASP1, MEOXl, MEOX2, MYBPH, NPASl, NPPB, OLRl, PAX2, PAX9, PDEIA, PRG4, PROMl, RARRES1, RASD1, RGS1, SERPINA3, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TUBB4, WISP2 and ZIC2. The cell line E65 is positive for the markers: ACTC, AKR1C1, AQP1, BEXl, CD24, CDH6, COL21A1, CRYAB, DKK2, GAP43, KRT17, KRT19, KRT34, TAGLN3, RELN, S100A4, SFRP2, SOX1 1, THY1 and ZIC2 and is negative for the markers: AGC1, ALDH1 Al, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN1 1, CNTNAP2, COMP, COP1, CRIPl, CRLF1, CXADR, METTL7A, DLK1, DPT, FMOl, FM03, FOXF2, FST, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, KIAA0644, KRT14, MFAP5, MASP1, MEOX2, MGP, MYBPH, MYH3, NPASl, OGN, OLRl, PAX9, PDEIA, PITX2, PRG4, PROMl, PRRX2, PTGS2, PTN, RARRES1, RASD1, RGS1, SMOC1, SNAP25, STMN2, TAC1, TRH, TUBB4, WISP2 and ZIC1 . The cell line E76 is positive for the markers: ACTC, BEXl, COL21A1, CRIPl, CRYAB, DI02, DKK2, EGR2, GAP43, KRT17, KRT19, MMP1, MSX2, PTGS2, S100A4 and THY1 and is negative for the markers: ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN1 1, CNTNAP2, COP1, CRLF1, METTL7A, DPT, FMOl, FM03, FOXF1, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ICAM5, IFI27, IGF2, KRT14, MEOX2, MGP, MYBPH, MYH3, NPASl, NPPB, OGN, OLRl, PAX2, PAX9, PDEIA, PENK, PITX2, PRG4, PROMl, PRRX2, PTN, PTPRN, RARRES 1, RGS1, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TFPI2, TNNT2, TRH, TUBB4, WISP2 and ZIC1 . The cell line E108 is positive for the markers: ACTC, BEXl, CDH6, COL21A1, CRIPl, CRYAB, DI02, DKK2, IGFBP5, KRT17, KRT19, MYH1 1, S100A4, SOX1 1, THY1 and ZIC2 and is negative for the markers: ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, COP1, CRLF1, CXADR, METTL7A, DLK1, DPT, FMOl, FM03, FOXF1, FOXF2, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ICAM5, IFI27, IGF2, KRT14, KRT34, MASP1, MEOXl, MEOX2, MGP, MYBPH, MYH3, NPASl, NPPB, OGN, OLRl, PAX2, PAX9, PDEIA, PRG4, PROMl, PTN, PTPRN, RARRES1, RASD1, RGS1, SERPINA3, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TFPI2, TNNT2, TRH, TUBB4 and WISP2. The cell line E85 is positive for the markers: ACTC, BEXl, CDH6, COL21 Al, CRYAB, DI02, DKK2, EGR2, FGFR3, ID4, KRT17, KRT19, MFAP5, MGP, MMP1, MYH1 1, PRELP, S100A4, SOX1 1, THY1, TNNT2, ZIC1 and ZIC2 and is negative for the markers: ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CNTNAP2, COMP, COP1, CRLF1, METTL7A, DPT, FMOl, FM03, GABRBI, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ICAM5, IFI27, IGF2, KRT14, MASP1, MEOXl, MEOX2, MYBPH, MYH3, NPASl, OGN, OLRl , PAX9, PDEIA, PITX2, PRG4, PROMl, PRRX2, PTN, RARRES1, RASD1, RGS1, SFRP2, SMOC1, STMN2, TAC1, TFPI2, TRH, TUBB4 and WISP2. The cell line Mi l is positive for the markers: BEXl, CDH6, COL21A1, CRYAB, DKK2, GAP43, ID4, MMP1, MYH1 1, SOX1 1, THY1 and ZIC1 and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, C3, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, COP1, CRLF1, CXADR, METTL7A, DLK1, DPT, FMOl, FM03, FOXF2, FST, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ICAM5, IGF2, IGFBP5, KCNMB1, KIAA0644, KRT14, MASP1, MEOXl, MEOX2, MSX2, MX1, MYBPH, MYH3, TAGLN3, NPASl, OLRl, PAX2, PAX9, PDEIA, PENK, PITX2, PRG4, PROMl, PRRX2, PTN, PTPRN, RARRES1, RELN, RGS1, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TFPI2, TNFSF7, TNNT2, TRH, TUBB4, WISP2 and ZIC2. The cell line E8 is positive for the markers: ACTC, BEXl, CDH6, COL21 Al, CRIPl, CRYAB, DI02, DKK2, ID4, KCNMB1, KRT14, KRT17, KRT19, KRT34, MFAP5, MGP, MYH1 1, PTGS2, S100A4, SOX1 1 and THY1 and is negative for the markers: ALDH1 Al, AREG, ATP8B4, C3, C7, C20orfl03, CDH3, CNTNAP2, COMP, COP1, CXADR, METTL7A, DPT, FMOl, FM03, FOXF1, FOXF2, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, IGFBP5, KIAA0644, LAMC2, MASP1, MEOXl, MSX2, MX1, MYBPH, TAGLN3, NPASl, NPPB, OLRl, PAX2, PAX9, PDEIA, PRELP, PRG4, PROMl, PRRX2, PTN, PTPRN, RARRES1, RASD1, RGS1, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TFPI2, TNFSF7, TRH, WISP2, ZIC1 and ZIC2. The cell line E80 is positive for the markers: ACTC, BEXl, CDH6, COL21 Al, CRYAB, DKK2, ID4, KRT19, MMP1, MYH1 1, TAGLN3, SOXl l and THY1 and is negative for the markers: ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN1 1, CNTNAP2, COMP, CRIPl, CRLF1, METTL7A, DLKl, DPT, FMOl, FM03, FOXFl, FOXF2, GABRB1, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ICAM5, IFI27, IGF2, KIAA0644, KRT14, KRT34, MASP1, MEOX2, MGP, MYBPH, MYH3, NPAS1, OGN, OLR1, PAX9, PDEIA, PRELP, PRG4, PROMl, PRRX2, PTN, RARRES1, RASD1, RGSl, SERPINA3, SMOC1, SNAP25, STMN2, TAC1, TNNT2, TRH, WISP2, ZIC1 and ZIC2. The cell line RA.D20.24 is positive for the markers: ACTC, BEXl, CRYAB, CXADR, DKK2, FOXFl, GAP43, HOXA5, IGFBP5, KRT19, LAMC2, MFAP5, MMP1, MSX1, MYL4, PITX2, PTGS2, RELN, THY1 and TNNT2 and is negative for the markers: AGC1, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C7, C20orfl03, CDH3, CNTNAP2, COL15A1, COMP, COP1, CRLF1, DLKl, DPT, FGFR3, FMOl, FM03, FOXF2, GDF10, GJB2, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMBl, KRT14, MASP1, MEOX1, MEOX2, MGP, MSX2, MX1, MYBPH, MYH3, MYH1 1, NPAS1, OGN, PAX2, PAX9, PDEIA, PRG4, PROMl, PRRX2, PTN, PTPRN, RARRES1, RGSl, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TUBB4, WISP2, ZIC1 and ZIC2. The cell line RA.D20.6 is positive for the markers: ACTC, CRYAB, CXADR, DKK2, FOXFl, GAP43, HOXA5, IGFBP5, KRT19, LAMC2, MFAP5, MMP1, MSX1, PITX2, PTGS2, SOXl l and THY1 and is negative for the markers: ALDH1A1, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CNTNAP2, COL15A1, COMP, COP1, CRLF1, DI02, DLKl, DPT, FMOl, FM03, FOXF2, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IGF2, KRT14, MASP1, MEOX1, MEOX2, MGP, MSX2, MX1, MYBPH, MYH3, MYH1 1, NPAS1, OGN, PAX2, PAX9, PDEIA, PRG4, PROMl, PRRX2, PTN, PTPRN, RARRES1, RGSl, SERPINA3, SFRP2, SMOC1, STMN2, TAC1, TRH, TUBB4, WISP2, ZIC1 and ZIC2. The cell line RA.SMO10 is positive for the markers: ALDH1A1, BEXl, C3, CDH3, COL21A1, CXADR, METTL7A, EGR2, FM03, FOXFl, HOXA5, KIAA0644, MGP, RARRES1, SOXl l and STMN2 and is negative for the markers: ACTC, AGC1, ANXA8, AQP1, CFB, C7, C20orfl03, CD24, CDH6, CNTNAP2, COL15A1, COMP, COP1, CRIPl, CRLF1, DPT, FOXF2, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KRT14, KRT17, KRT34, MASP1, MEOX1, MEOX2, MMP1, MSX2, MYBPH, MYH3, MYH1 1, TAGLN3, NPAS1, NPPB, OGN, PAX2, PAX9, PDEIA, PITX2, PRELP, PRG4, PROMl, PRRX2, PTN, PTPRN, RGSl, S100A4, SERPINA3, SFRP2, SMOC1, TAC1, TFPI2, THY1, TNFSF7, TRH, TUBB4, WISP2, ZIC1 and ZIC2. The cell line RA.SM014 is positive for the markers: ACTC, BEXl, CD24, CXADR, FOXFl, GDF5, GJB2, HOXA5, IGFBP5, KRT19, LAMC2, MFAP5, MMP1, RELN, SOXl l and STMN2 and is negative for the markers: AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C3, C7, CDH6, CLDN1 1, CNTNAP2, COL15A1, COL21A1, COMP, COP1, CRIPl, CRLF1, DI02, DLKl, DPT, FGFR3, FMOl, FM03, FOXF2, GABRB1, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMBl, KRT14, KRT17, KRT34, MASP1, MEOX1, MEOX2, MGP, MSX2, MYBPH, MYH3, MYH1 1, NPAS1, NPPB, OGN, PAX2, PAX9, PDEIA, PITX2, PRELP, PRG4, PROMl, PRRXl, PRRX2, PTN, PTPRN, RGSl, SERPINA3, SFRP2, SMOC1, TAC1, TNFSF7, TUBB4, WISP2, ZIC1 and ZIC2. The cell line RA.PEND18 is positive for the markers: C3, CDH3, COL21 Al, METTL7A, DLKl, EGR2, FOXFl, GABRB1, HOXA5, IGF2, KIAA0644, KRT19, MSX1, PITX2, PROMl, PTGS2, SNAP25 and SOXl l and is negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, BEXl, CFB, C20orfl03, CDH6, CNTNAP2, COL15A1, COMP, CRIPl, CRLF1, CXADR, DPT, FMOl, FOXF2, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KCNMBl, KRT14, KRT34, MFAP5, MASP1, MEOX1, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, MYH1 1, TAGLN3, NPAS1, NPPB, PAX2, PAX9, PENK, PRELP, PRG4, PRRX2, PTN, PTPRN, RARRES1, RELN, RGSl, SFRP2, SMOC1, STMN2, TAC1, TNFSF7, TRH, TUBB4, WISP2, ZIC1 and ZIC2. The cell line RA.PEND10 is positive for the markers: AREG, C3, CDH3, CDH6, COL21A1, METTL7A, DLKl, EGR2, FOXFl, FST, GDF5, HOXA5, IGF2, IGFBP5, KRT19, PDEIA, PITX2, RELN and SOXl l and is negative for the markers: ACTC, AGC1, ALDH1A1, ATP8B4, CFB, C7, C20orfl03, CLDN1 1, CNTNAP2, COL15A1, COMP, CRIPl, CRLF1, CRYAB, DPT, FOXF2, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KCNMBl, KRT14, KRT17, KRT34, MASP1, MEOX1, MEOX2, MMP1, MSX2, MYBPH, MYH3, MYH1 1, TAGLN3, NPAS1, NPPB, OGN, PAX2, PAX9, PRELP, PRG4, PROMl, PRRXl, PRRX2, PTN, PTPRN, RGSl, S100A4, SERPINA3, SFRP2, SMOC1, STMN2, TAC1, THY1, TNFSF7, TRH, TUBB4, WISP2, ZIC1 and ZIC2. The cell line RA.SKEL21 is positive for the markers: AREG, BEX1, C3, CD24, COL21A1, COPl, METTL7A, FOXF1, KRT19, MSXl, PITX2, SERPINA3, SOX1 1 and THY1 and is negative for the markers: ACTC, AGC1, ALDHl Al, AQP1, ATP8B4, CFB, C7, C20orfl03, CDH6, CLDN1 1, CNTNAP2, COL15A1, COMP, CRIPl, CRLF1, DKK2, DPT, FGFR3, FMOl, FM03, FOXF2, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT34, MASPl, MEOXl, MEOX2, MGP, MMPl, MSX2, MXl, MYBPH, MYH3, TAGLN3, NPASl, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PRRX2, PTGS2, PTN, PTPRN, RARRES1, RASD1, RELN, RGS1, SFRP2, SMOC1, STMN2, TAC1, TNFSF7, TRH, TUBB4 and ZIC2. The cell line RA.SKEL18Rep2a is positive for the markers: AREG, C3, CD24, CDH3, COL21A1, METTL7A, DPT, GJB2, SERPINA3, SNAP25 and SOX1 1 and is negative for the markers: ALDHl Al, ATP8B4, CFB, C7, C20orfl03, CDH6, CLDN1 1, CNTNAP2, COMP, COPl, CRIPl, DI02, DKK2, DLKl, FGFR3, FMOl, FM03, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMB1, KRT14, KRT17, KRT19, KRT34, MASPl, MEOXl, MEOX2, MGP, MMPl, MSX2, MYBPH, MYH3, MYHl l , TAGLN3, NPASl, NPPB, OGN, OLR1, PAX2, PAX9, PRELP, PRG4, PROM1, PRRX1, PRRX2, PTGS2, PTN, PTPRN, RARRES1, RELN, RGS1, SFRP2, SMOC1, STMN2, TAC1, THY1, TNFSF7, TNNT2, TRH, WISP2, ZIC1 and ZIC2. The cell line C4.4 is positive for the markers: AKR1C1, BEX1, CDH6, COPl, DI02, METTL7A, DKK2, DPT, EGR2, FOXF1, FST, KIAA0644, MMPl, MSXl, RELN, S100A4, TAC1 and THY1 and is negative for the markers: AGC1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COL21A1, COMP, CRIPl, CRLF1, CXADR, FGFR3, FMOl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, MFAP5, MASPl, MEOXl, MEOX2, MGP, MYBPH, MYH3, MYHl l , TAGLN3, NPASl, NPPB, OGN, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, PTGS2, PTN, PTPRN, RARRES1, RASD1, RGS1, SERPINA3, SFRP2, SMOC1, SNAP25, STMN2, TNFSF7, TNNT2, TRH, TUBB4, ZIC1 and ZIC2. The cell line W7 is positive for the markers: AREG, C3, COL15A1, COL21A1, COPl, CXADR, DI02, DLKl, EGR2, FMOl, FOXF1, GDF5, HOXA5, KIAA0644, METTL7A, PITX2, PROM1, S100A4, SERPINA3 and SOX1 1 and is negative for the markers: AGC1, ALDHl Al, AQP1, ATP8B4, C20orfl03, C7, CD24, CDH3, CDH6, CFB, CLDN1 1, CNTNAP2, COMP, CRIPl, DKK2, DPT, FM03, GABRB1, GAP43, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, ICAM5, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT19, KRT34, MASPl, MEOXl, MEOX2, MGP, MMPl, MYBPH, MYHl l , MYH3, NPASl, NPPB, OGN, PAX2, PAX9, PRG4, PRRX2, PTN, PTPRN, RARRES1, RASD1, RELN, RGS1, SFRP2, SMOC1, STMN2, TAC1, TNFSF7, TRH, TUBB4, ZIC1 and ZIC2. The cell line X4SKEL20 is positive for the markers: AREG, BEX1, C3, C7, COPl, CXADR, FOXF1, FST, KRT19, METTL7A, MGP, MSXl, PITX2, SERPINA3 and TFPI2 and is negative for the markers: ALDHl Al, AQP1, ATP8B4, C20orfl03, CD24, CDH3, CDH6, CFB, CLDN1 1, CNTNAP2, COL15A1, COMP, DKK2, DLKl, DPT, EGR2, FGFR3, FMOl, FOXF2, GABRB1, GAP43, GDF10, GDF5, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, IGFBP5, KCNMB1, KRT14, KRT34, MASPl, MEOXl, MEOX2, MFAP5, MMPl, MSX2, MXl, MYBPH, MYHl l , MYH3, NPASl, NPPB, OGN, OLR1, PAX2, PENK, PRG4, PROM1, PRRX1, PRRX2, PTN, PTPRN, RARRES1, RELN, RGS1, SFRP2, SMOC1, SOX1 1, STMN2, TAC1, TAGLN3, THY1, TNFSF7, TNNT2, TRH, WISP2, ZIC1 and ZIC2. The cell line C4ELSR6 is positive for the markers: ACTC, BEX1, C7, CDH6, COL21 Al, DI02, METTL7A, DKK2, FOXF1, FOXF2, LAMC2, PITX2, PRRX1, S100A4, SFRP2, SNAP25, SOX1 1, TAC1 and TFPI2 and is negative for the markers: AGC1, ALDHl Al, AREG, ATP8B4, CFB, C3, C20orfl03, CD24, CLDN1 1, CNTNAP2, COMP, CRIPl, CRLF1, CRYAB, DLKl, DPT, FGFR3, FM03, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMB1, KRT14, KRT17, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMPl, MYBPH, MYH3, MYHl l , NPASl, NPPB, PAX2, PAX9, PENK, PRG4, PTN, PTPRN, RARRES1, RASD1, RGS1, SMOC1, STMN2, TNFSF7, TRH, TUBB4, WISP2 and ZIC1 . The cell line J2 is positive for the markers: ACTC, AKR1C1 , BEX1, CDH6, COL15A1, COL21A1, DI02, METTL7A, DKK2, DLKl, FOXF1, KIAA0644, MGP, PDE1A, PRRX1, SFRP2, SNAP25, TNNT2 and ZIC2 and is negative for the markers: AGC1, ALDHl Al, ATP8B4, CFB, C3, C20orfl03, CD24, CNTNAP2, COMP, CRIPl, CRLF1, DPT, FGFR3, GABRB1, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ICAM5, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, MFAP5, MASPl, MEOXl, MMPl, MSXl, MYBPH, MYH3, MYHl l , NPASl, NPPB, OGN, OLR1, PAX2, PAX9, PENK, PROM1, PRRX2, PTN, PTPRN, RARRES1, RGS1, SMOC1, STMN2, TAC1, TNFSF7, TRH and TUBB4. The cell line F15 is positive for the markers: BEX1, CDH6, COL15A1, COL21 Al, DKK2, DLKl, FOXFl, FST, GDF5, KRT19, MGP, MMP1, PRRX1, SERPINA3, SNAP25, SOX1 1, ZIC1 and ZIC2 and is negative for the markers: ACTC, AGCl, ALDHlAl, AQPl, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CNTNAP2, COMP, CRLFl, DI02, DPT, FGFR3, FMOl, FM03, FOXF2, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMBl, KIAA0644, KRT14, KRT17, MASPl, MEOXl, MEOX2, MYBPH, MYH3, MYH1 1, NPAS1, NPPB, OGN, OLR1, PAX2, PDE1A, PENK, PITX2, PRG4, PROM1, PRRX2, PTN, PTPRN, RGS1, SFRP2, SMOC1, STMN2, TFPI2, TNNT2, TRH and TUBB4. The cell line X4SKEL4 is positive for the markers: ANXA8, AREG, BEX1, C3, COL21A1, COPl, CXADR, METTL7A, EGR2, FOXFl, FST, KRT19, LAMC2, MYL4, PITX2 and SERPINA3 and is negative for the markers: ALDHlAl, AQPl, ATP8B4, CFB, C7, C20orfl03, CD24, CDH3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COMP, CRLFl, DKK2, DLKl, DPT, FGFR3, FM03, FOXF2, GABRBI, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, IGFBP5, KIAA0644, KRT14, KRT17, KRT34, MASPl, MEOXl, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRES1, RASD1, RGS1, SFRP2, SMOC1, SOX1 1, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2 and ZICl . The cell line X4SKEL19 is positive for the markers: AREG, COL21A1, COPl, DI02, METTL7A, EGR2, FOXFl, FST, KIAA0644, KRT19, MGP, PDE1A, PITX2, SERPINA3 and TFPI2 and is negative for the markers: ACTC, AGCl, ALDHlAl, AQPl, ATP8B4, CFB, C20orfl03, CD24, CDH3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COMP, CRIPl, CRLFl, CXADR, DKK2, DLKl, DPT, FGFR3, FMOl, FOXF2, GABRB1, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMBl, KRT14, KRT17, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MMP1, MSX2, MX1, MYBPH, MYH3, MYH1 1, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PRELP, PRG4, PRRX2, PTN, PTPRN, RELN, SFRP2, SMOC1, SOX1 1, STMN2, TAC1, THY1, TRH, WISP2, ZIC1 and ZIC2. The cell line X4SKEL8 is positive for the markers: AREG, BEX1, COL21A1, DI02, METTL7A, DKK2, EGR2, FM03, FOXFl, FST, MYL4, PITX2, PTGS2, S100A4 and SERPINA3 and is negative for the markers: ALDHlAl, AQPl, ATP8B4, CFB, C3, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, CRIPl, CRLFl, DLKl, DPT, FGFR3, FOXF2, GABRB1, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KRT14, KRT17, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, MYH1 1, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PRG4, PRRX1, PRRX2, PTN, PTPRN, RARRES1, RASD1, RELN, RGS1, SFRP2, SMOC1, STMN2, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4, ZIC1 and ZIC2. The cell line RA.PEND17Bio2a is positive for the markers: AREG, BEX1, CDH6, COL15A1, COL21A1, COPl, METTL7A, DPT, EGR2, FOXFl, FST, GJB2, LAMC2, MSX2, PTGS2, SERPINA3 and SFRP2 and is negative for the markers: ACTC, ALDHlAl, AQPl, ATP8B4, CFB, C20orfl03, CD24, CDH3, CNTNAP2, COMP, CRIPl, CXADR, FGFR3, FMOl, GABRB1, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IGF2, KCNMBl, KRT14, KRT17, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYH1 1, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PRELP, PRG4, PROM1, PRRX2, PTN, PTPRN, RELN, RGS1, SMOC1, STMN2, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4, ZIC1 and ZIC2. The cell line W9 is positive for the markers: AKR1C1, C7, CDH6, COL21A1, METTL7A, DLKl, EGR2, FOXFl, GDF5, GJB2, HOXA5, IGFBP5, KIAA0644, KRT19, MGP, OGN, PITX2, SERPINA3, SOX1 1, TFPI2 and ZIC2 and is negative for the markers: AGCl, ALDHlAl, AQPl, CFB, C3, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COL15A1, COMP, CRIPl, CRLFl, CRYAB, DKK2, FGFR3, FMOl, FM03, FOXF2, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMBl, KRT14, KRT17, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MSX2, MX1, MYBPH, MYH3, MYH1 1, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRES1, RASD1, RGS1, SFRP2, SNAP25, STMN2, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4 and ZIC1 . The cell line MW4 is positive for the markers: AKR1C1, AREG, BEX1, C7, COL15A1, COL21A1, DI02, METTL7A, DKK2, EGR2, FM03, FOXFl, FOXF2, PITX2, PRELP, SERPINA3, SFRP2 and TFPI2 and is negative for the markers: ALDHlAl, AQPl, ATP8B4, CFB, C3, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, CRIPl, CXADR, DLKl, GABRB1, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMBl, KRT14, KRT17, KRT19, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMP1, MSX1, MX1, MYBPH, MYH3, MYH1 1, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, PRRX1, PTN, PTPRN, RARRES1, RELN, RGS 1, SMOC1, STMN2, TAC1, TNNT2, TUBB4, ZIC1 and ZIC2, . The cell line SK58 is positive for the markers: AKR1C1, AREG, BEX1, C7, COL15A1, COL21A1, METTL7A, EGR2, FMOl, FOXFl, PTGS2, SERPINA3, SFRP2, TAC1 and TFPI2 and is negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C3, C20orfl03, CD24, CDH3, CDH6, CLDNl l , CNTNAP2, COP1, CRIPl, DI02, DLKl, DPT, GABRB1, GDF5, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPB3, ID4, IFI27, IGF2, KCNMB1, KRT14, KRT17, KRT19, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MMPl, MSX2, MX1, MYBPH, MYH3, MYHl l , NPASl, NPPB, OLRl, PAX2, PAX9, PDEIA, PRG4, PROMl, PRRX2, PTN, PTPRN, RARRESl, RELN, RGSl, SMOCl, STMN2, TNNT2, TRH, TUBB4, ZIC1 and ZIC2, . The cell line SK25 is positive for the markers: BEX1, COL21A1, METTL7A, FMOl, FOXFl, LAMC2, SERPINA3, SFRP2 and WISP2 and is negative for the markers: ACTC, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, C3, C20orfl03, CD24, CDH3, CLDNl l , CNTNAP2, COMP, CRIPl, CRLFl, CXADR, DI02, DKK2, DPT, EGR2, FGFR3, GABRBI, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMPl, MSX2, MYBPH, MYH3, MYHl l , NPASl, NPPB, OGN, OLRl, PAX2, PAX9, PDEIA, PITX2, PRELP, PRG4, PROMl, PTN, RARRESl, RASD1, RGSl, SMOCl, STMN2, TAC1, TFPI2, TNFSF7, TNNT2, TRH, ZIC1 and ZIC2. The cell line SK16 is positive for the markers: AREG, BEX1, COL15A1, COL21A1, METTL7A, EGR2, FMOl, FOXFl, LAMC2, MSXl, PITX2, SERPINA3, ZIC1 and ZIC2 and is negative for the markers: AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C3, C20orfl03, CD24, CDH3, CLDNl l , CNTNAP2, COMP, CRIPl, CXADR, DI02, DKK2, DPT, FGFR3, GABRB1, GDF10, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IGF2, KIAA0644, KRT14, KRT17, KRT19, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMPl, MSX2, MX1, MYBPH, MYH3, MYHl l , TAGLN3, NPASl, NPPB, OLRl, PAX2, PAX9, PENK, PRELP, PRG4, PROMl, PRRX2, PTN, RARRESl, RELN, RGSl, STMN2, TAC1, TFPI2, THY1, TNFSF7, TNNT2, TRH and TUBB4, . The cell line EN20 is positive for the markers: BEX1, COL21A1, METTL7A, DLKl, FMOl, FOXFl, FST, GDF5, LAMC2, MGP, PRRXl, S100A4, SERPINA3, SOX1 1, TFPI2 and WISP2 and is negative for the markers: ALDH1A1, AQP1, ATP8B4, C3, C7, C20orfl03, CD24, CDH3, CNTNAP2, COL15A1, COMP, CRIPl, CXADR, DI02, DKK2, FGFR3, GABRB1, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MMPl, MX1, MYBPH, MYH3, MYHl l , NPASl, NPPB, OLRl, PAX2, PDEIA, PITX2, PRELP, PRG4, PROMl, PTN, PTPRN, RASD1, RGSl, SFRP2, SMOCl, SNAP25, STMN2, TAC1, TNFSF7, TNNT2, TRH, TUBB4, ZIC1 and ZIC2, . The cell line EN43 is positive for the markers: AKR1C1, BEX1, C7, CDH6, COL21A1, DI02, METTL7A, DLKl, FMOl, FM03, FOXFl, FOXF2, FST, GDF5, MMPl, MSXl, OGN, PRRXl, S100A4, SERPINA3 and SOX1 1 and is negative for the markers: ALDH1A1, ANXA8, AQP1, ATP8B4, C3, C20orfl03, CD24, CDH3, CLDNl l , CNTNAP2, COMP, CRIPl, CRLFl, DKK2, DPT, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, KCNMB1, KRT14, KRT17, KRT19, KRT34, MFAP5, MASPl, MEOXl, MEOX2, MGP, MYBPH, MYH3, MYHl l , NPASl, NPPB, OLRl, PAX2, PAX9, PDEIA, PITX2, PRG4, PROMl, PTN, PTPRN, RASD1, RGSl, SFRP2, SMOCl, STMN2, THY1, TNNT2, TRH, TUBB4, ZIC1 and ZIC2.

Table II Culture Conditions 1. Subconfluent Monolayer Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in a subconcluent state.

2 . Confluent Monolayer Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in a confluent monolayer state.

3. Micromass Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I- IV herein while said cells are in a highly dense micromass state as described herein. 4 . Subconfluent Mixed Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in a subconfluent state and juxtasposed (co-cultured) potentially in physical contact with cells of another differentiated state or another distinguishable cell line of the present invention.

5. Subconfluent Transwell Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in transwell vessels or tissue cultureware of similar design that allows the physical separation of diverse cell types but allowing a sharing of their media. Such subconfluent transwell culture is where the cell lines of the present invention are subconfluent and share culture media with a cell type of a different differentiated state wherein the cells of a different differentiated state may be themselves in a subconfluent or confluent state.

6. Confluent Mixed Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in a confluent state and juxtasposed (co-cultured) potentially in physical contact with cells of another differentiated state or another distinguishable cell line of the present invention. 7. Confluent Transwell Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in transwell vessels or tissue cultureware of similar design that allows the physical separation of diverse cell types but allowing a sharing of their media. Such subconfluent transwell culture is where the cell lines of the present invention are confluent and share culture media with a cell type of a different differentiated state wherein the cells of a different differentiated state may be themselves in a subconfluent or confluent state. 8. Micromass Mixed Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in a highly dense micromass state as described herein and juxtasposed (co-cultured) potentially in physical contact with cells of another differentiated state or another distinguishable cell line of the present invention.

9. Micromass Transwell Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in transwell vessels or tissue cultureware of similar design that allows the physical separation of diverse cell types but allowing a sharing of their media while said cells are in a highly dense micromass state as described herein. Such subconfluent transwell culture is where the cell lines of the present invention are confluent and share culture media with a cell type of a different differentiated state wherein the cells of a different differentiated state may be themselves in a subconfluent or confluent state.

Culture Exposed to Cell Extracts of Cells of a Different Differentiated State: Target cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in a subconfluent state and wherein the media for said cells contains extracts of cells of a differing differentiated state and wherein said target cells are exposed to conditions that facilitate the intracellular trafficking of molecules such as described in U.S. patent application Ser. No. 10/910,156 filed on August 2, 2004 and titled "Methods for Altering Cell Fate", and U.S. patent application Ser. No. 10/015,824 filed on December 10, 2001 and titled "Methods for Altering Cell Fate", both incorporated herein by reference in their entirety. Table III Culture Media and Related Culture Variables Culture Media 1) DMEM (Dulbecco's Modified Eagle's Medium). HyClone Cat. No. SH30285.03 2) Airway Epithelial Growth Medium (PromoCell Cat. No. C-21260 with supplement Cat No. C-39160) 3) Epi-Life (LSGS) Medium (Cascade Cat. No. M-EPIcf/PRF-500 with supplement Cat. No. S-003-10) 4) Neural Basal Medium B-27 (Gibco Cat. No. 12348-017 with B-27 supplement Cat. No. 12587-010) 5) Neural Basal Medium N-2 (Gibco Cat. No. 12348-017 with N-2 supplement Cat. No. 17502-048) 6) HepatoZyme-SFM (Gibco Cat. No. 17705-021) 7) Epi-Life (HKGS) Medium (Cascade Cat. No. M EPIcf/PRF-500 with supplement Cat. No. S-001-5) 8) Endothelial Cell Growth Medium (PromoCell Cat. No. C-22221 with supplement Cat No. C-39221) 9) Endothelial Cell SFM (Gibco Cat. No. 11111-044 with basic fibroblast growth factor Cat. No. 13256- 029, epidermal growth factor Cat. No. 13247-051 and fibronectin Cat. No. 33016-015) 10) Skeletal Muscle Medium (PromoCell Cat. No. C-23260 with supplement Cat. No. C-39360) 11) Smooth Muscle Basal Medium (PromoCell Cat. No. C-22262 with supplement Cat. No. C-39262) 12) MesenCult Medium (Stem Cell Technologies Cat. No. 05041 with supplement Cat. No. 05402) 13) Melanocyte Growth Medium (PromoCell Cat. No. C 24010 with supplement Cat. No. C-39410) 14) Ham's F-10 Medium 15) Ham' s F-12 Medium 16) DMEM/Ham's F-12 50/50 mix 17) Iscove's Modified Dulbecco's Medium (IMDM) 18) Leibovitz's L-15 Medium 19) McCoy's 5A Medium Modified 20) RPMI 1640 Medium 21) Glasgow's MEM (GMEM) 22) Eagle's Medium 23) Medium 199 24) MEM Eagle-Earle's

Antibiotics 25) Penicillin 26) Streptomycin 27) Gentamycin 28) Neomycin 29) G418

Other Factors 30) Human plasma 31) Chick embryo extract 32) Human plasmanate Table IV Supplemented Factors EGF Ligands I) Amphiregulin 2) Betacellulin 3) EGF 4) Epigen 5) Epiregulin 6) HB-EGF 7) Neuregulin-3 8) NRG1 isoform GGF2 9) NRG1 Isoform SMDF 10) NRG -alpha/HRGl -alpha I I) TGF-alpha 12) TMEFFl/Tomoregulin- l 13) TMEFF2 14) EGF Ligands pooled (1-13 above)

EGF R/ErbB Receptor Family

15) EGF Receptor 16) ErbB2 17) ErbB3 18) ErbB4 19) EGF/ErbB Receptors pooled (15-18 above)

FGF Ligands

20) FGF acidic 21) FGF basic 22) FGF-3 23) FGF-4 24) FGF-5 25) FGF-6 26) KGF/FGF-7 27) FGF-8 28) FGF-9 29) FGF- 10 30) FGF-1 1 31) FGF-12 32) FGF-13 33) FGF-14 4) FGF-15 5) FGF-16 6) FGF-17 7) FGF-18 8) FGF-19 9) FGF-20 0) FGF-21 1) FGF-22 2) FGF-23 3) FGF Ligands pooled (20-38 above)

GF Receptors

40) FGF 1 41) FGF 2 42) FGF R3 43) FGF R4 44) FGF R5 45) FGF Receptors pooled (40-44 above)

FGF Regulators

46) FGF-BP

Hedgehogs

47) Desert Hedgehog 48) Sonic Hedgehog 49) Indian Hedgehog 50) Hedgehogs pooled (47-49 above)

Hedgehog Regulators

51) Gasl 52) Hip 53) Hedgehog Regulators pooled (51-52 above)

IGF Ligands

54) IGF-I 55) IGF-II 56) IGF Ligands pooled (54-55 above)

IGF-I Receptor (CD221) 57) IGF-I R

GF Binding Protein (IGFBP) Family

58) ALS 59 IGFBP-4 60) CTGF/CCN2 61) IGFBP-5 62) Endocan 63) IGFBP-6 64) IGFBP-1 65) IGFBP-rpl/IGFBP-7 66) IGFBP-2 67) NOV/CCN3 68) IGFBP-3 69) GF Binding Protein Family pooled (58-68 above)

Receptor Tyrosine Kinases

70) Axl 71) Clq Rl/CD93 72) DDR1 73) Flt-3 74) DDR2 75) HGF R 76) Dtk 77) IGF-II R 78) Eph 79) Insulin R/CD220 80) EphAl 81) M-CSF R 82) EphA2 83) Mer 84) EphA3 85) MSP R Ron 86) EphA4 87) MuSK 88) EphA5 89) PDGF R alpha 90) EphA6 91) PDGF R beta 92) EphA7 94) EphA8 95) ROR1 96) EphBl 97) ROR2 98) EphB2 99) SCF R/c-kit 100) EphB3 101) Tie-1 102) EphB4 103) Tie-2 104) EphB6 105) TrkA 106) TrkB 107) TrkC 108) VEGF Rl/Flt-1 109) VEGF R2/Flk-1 110) VEGF R3/Flt-4 111) Receptor Tyrosine Kinases pooled (70-1 10 above)

Proteoglycans

112) Aggrecan 113) Lumican 114) Biglycan 115) Mimecan 116) Decorin 117) NG2/MCSP 118) Endocan 119) Osteoadherin 120) Endorepellin 121) Syndecan-1/CD138 122) Glypican 2 123) Syndecan-3 124) Glypican 3 125) Testican l/SPOCKl 126) Glypican 5 127) Testican 2/SPOCK2 128) Glypican 6 129) Testican 3/SPOCK3 130) Heparan sulfate proteoglycan 131) Heparin 132) Chondroitin sulfate proteoglycan 133) Hyaluronic acid 134) Dermatan sulfate proteoglycan

Proteoglycan Regulators

135) Arylsulfatase A/ARSA 136) HAPLN1 137) Exostosin-like 2 138) HS6ST2 139) Exostosin-like 3 140) IDS 141) Proteoglycan Regulators pooled (135-140 above)

SCF, Flt-3 Ligand & M-CSF

142) Flt-3 143) M-CSF R 144) Flt-3 Ligand 145) SCF 146) M-CSF 147) SCF R/c-kit 148) Pooled factors (142-147 above)

Activins

149) Activin A 150) Activin B 151) Activin AB 152) Activin C 153) Pooled Activins (149-152 above)

BMPs (Bone Morphogenetic Proteins)

154) BMP-2 155) BMP-3 156) BMP-3b/GDF-10 157) BMP-4 158) BMP-5 159) BMP-6 160) BMP-7 161) BMP-8 162) Decapentaplegic 163) Pooled BMPs (154-162 above)

GDFs (Growth Differentiation Factors)

164) GDF-1 165) GDF-2 166) GDF-3 167) GDF-4 168) GDF-5 169) GDF-6 170) GDF-7 171) GDF-8 172) GDF-9 173) GDF-10 174) GDF-1 1 175) GDF-12 176) GDF-13 177) GDF-14 178) GDF-15 179) GDFs pooled (164- 178 above)

GDNF Family Ligands

180) Artemin

18 1) Neurturin 182) GDNF 183) Persephin 184) GDNF Ligands pooled (180-183 above)

TGF-beta

185) TGF-beta 186) TGF-beta 1 187) TGF-beta 1.2 188) TGF-beta 2 189) TGF-beta 3 190) TGF-beta 4 191) TGF-beta 5 192) LAP (TGF-beta 1) 193) Latent TGF-beta 1 194) TGF-beta pooled (185-193 above)

Other TGF-beta Superfamily Ligands

195) Lefty 196) Nodal 197) MLS/AMH 198) Other TGF-beta Ligands pooled (195-197 above)

TGF-beta Superfamily Receptors

199) Activin RIA/ALK-2 200) GFR alpha-1 201) Activin RIB/ALK-4 202) GFR alpha-2 203) Activin RIIA 204) GFR alpha-3 205) Activin RUB 206) GFR alpha-4 207) ALK-1 208) MIS RII 209) ALK-7 210) Ret 2 11) BMPR-IA/ALK-3 212) TGF-beta RI/ALK-5 213) BMPR-IB/ALK-6 214) TGF-beta RII 215) BMPR-II 216) TGF-beta Rllb 217) Endoglin/CD105 2 8) TGF-beta RIII 219) TGF-beta family receptors pooled (199-21 8 above)

TGF-beta Superfamily Modulators

220) Amnionless 221) GASP-2/WFIKKN 222) BAMBI/NMA 223) Gremlin 224) Caronte 225) NCAM-1/CD56 226) Cerberus 1 227) Noggin 228) Chordin 229) PRDC 230) Chordin-Like 1 231) Chordin-Like 2 232) Smadl 233) Smad4 234) Smad5 235) Smad7 236) Smad8 237) CRIM1 238) Cripto 239) Crossveinless-2 240) Cryptic 241) SOST 242) DAN 243) Latent TGF-beta bpl 244) TMEFFl/Tomoregulin-1 245) FLRG 246) TMEFF2 247) Follistatin 248) TSG 249) Follistatin-like 1 250) Vasorin 251) GASP-l/WFIKKNRP 252) TGF Modulators pooled (220-251 above)

VEGF/PDGF Family

253) Neuropilin-1 254) P1GF 255) P1GF-2 256) Neuropilin-2 257) PDGF 258) VEGF Rl/Flt-1 259) PDGF R alpha 260) VEGF R2/Flk-1 261) PDGF R beta 262) VEGF R3/Flt-4 263) PDGF-A 264) VEGF 265) PDGF-B 266) VEGF-B 267) PDGF-C 268) VEGF-C 269) PDGF-D 270) VEGF-D 271) PDGF-AB 272) VEGF/PDGF Family pooled (253-271 above)

Dickkopf Proteins & Wnt Inhibitors

273) Dkk-1 274) Dkk-2 275) Dkk-3 276) Dkk-4 277) Soggy- 1 278) WIF-1 279) Pooled factors (273-278 above)

Frizzled & Related Proteins

280) Frizzled- 1

28 ) Frizzled-2 282) Frizzled-3 283) Frizzled-4 284) Frizzled-5 285) Frizzled-6 286) Frizzled-7 287) Frizzled-8 288) Frizzled-9 289) sFRP-1 290) sFRP-2

29 ) sFRP-3 292) sFRP-4 293) MFRP 294) Factors pooled (280-293 above)

Wnt Ligands

295) Wnt-1 296) Wnt-2 297) Wnt-3 298) Wnt-3a 299) Wnt-4 300) Wnt-5 301) Wnt-5a 302) Wnt-6 303) Wnt-7 304) Wnt-8 305) Wnt-8a 306) Wnt-9 307) Wnt-lOa 308) Wnt-lOb 309) Wnt-1 1 310 Wnt Ligands pooled (295-309 above)

Other Wnt-related Molecules

3 11) beta-Catenin 312) LRP-6 313) GSK-3 314) ROR1 315) Kremen-1 316) ROR2 317) Kremen-2 318) WISP-1/CCN4 319) LRP-1 320) Pooled factors (31 1-319 above)

Other Growth Factors

321) CTGF/CCN2 322) NOV/CCN3 323) EG-VEGF/PK1 324) Osteocrin 325) Hepassocin 326) PD-ECGF 327) HGF 328) Progranulin 329) beta-NGF 330) Thrombopoietin 331) Pooled factors (321-330 above) Steroid Hormones

332) 17beta-Estradiol 333) Testosterone 334) Cortisone 335) Dexamethasone

Extracellular/Membrane Proteins

336) Plasma Fibronectin 337) Tissue Fibronectin 338) Fibronectin fragments 339) Collagen Type I (gelatin) 340) Collagen Type II 341) Collagen Type III 342) Tenascin 343) Matrix Metalloproteinase 1 344) Matrix Metalloproteinase 2 345) Matrix Metalloproteinase 3 346) Matrix Metalloproteinase 4 347) Matrix Metalloproteinase 5 348) Matrix Metalloproteinase 6 349) Matrix Metalloproteinase 7 350) Matrix Metalloproteinase 8 351) Matrix Metalloproteinase 9 352) Matrix Metalloproteinase 10 353) Matrix Metalloproteinase 11 354) Matrix Metalloproteinase 12 355) Matrix Metalloproteinase 13 356) ADAM-1 357) ADAM-2 358) ADAM-3 359) ADAM-4 360) ADAM-5

36 ) ADAM-6 362) ADAM-7 363) ADAM-8 364) ADAM-9 365) ADAM-10 366) ADAM-1 1 367) ADAM- 2 368) ADAM-13 369) ADAM-14 370) ADAM-15 371) ADAM-16 372) ADAM-17 373) ADAM-18 374) ADAM-19 375) ADAM-20 376) ADAM-21 377) ADAM-22 378) ADAM-23 379) ADAM-24 380) ADAM-25 381) ADAM-26 382) ADAM-27 383) ADAM-28 384) ADAM-29 385) ADAM-30 386) ADAM-31 387) ADAM-32 388) ADAM-33 389) ADAMTS-1 390) ADAMTS-2 391) ADAMTS-3 392) ADAMTS-4 393) ADAMTS-5 394) ADAMTS-6 395) ADAMTS-7 396) ADAMTS-8 397) ADAMTS-9 398) ADAMTS-10 399) ADAMTS-11 400) ADAMTS-12 401) ADAMTS-13 402) ADAMTS-14 403) ADAMTS-15 404) ADAMTS-16 405) ADAMTS-17 406) ADAMTS-18 407) ADAMTS-19 408) ADAMTS-20 409) Arg-Gly-Asp 410) Arg-Gly-Asp-Ser 4 11) Arg-Gly-Asp-Ser-Pro-Ala-Ser-Ser-Lys-Pro 412) Arg-Gly-Glu-Ser 413) Arg-Phe-Asp-Ser 414) SPARC 415) Cys-Asp-Pro-Gly-Tyr-Ile-Gly-Ser-Arg 416) Cys-Ser-Arg-Ala-Arg-Lys-Gln-Ala-Ala-Ser-Ile-Lys-Val-Ser-Ala-Asp-Arg 417) Elastin 4 18) Tropelastin 419) Gly-Arg-Gly-Asp-Ser-Pro-Lys 420) Gly-Arg-Gly-Asp-Thr-Pro 421) Laminin 422) Leu-Gly-Thr-Ile-Pro-Gly 423) Ser-Asp-Gly-Arg-Gly 424) Vitronectin 425) Superfibronectin 426) Thrombospondin 427) TIMP-1 428) TIMP-2 429) TIMP-3 430) TIMP-4 431) Fibromodulin 432) Flavoridin 433) Collagen IV 434) Collagen V 435) Collagen VI 436) Collagen VII 437) Collagen VIII 438) Collagen IX 439) Collagen X 440) Collagen XI 441) Collagen XII 442) Entactin 443) Fibrillin 444) Syndecan-1 445) Keratan sulfate proteoglycan

Ambient Oxygen

446) 0.1-0.5% Oxygen 447) 0.5-1% Oxygen 448) 1-2% Oxygen 449) 2-5% Oxygen 450) 5-10% Oxygen 45 1) 10-20% Oxygen

Animal Serum

452) 0.1% Bovine Seram 453) 0.5% Bovine Seram 454) 1.0% Bovine Seram 455) 5.0% Bovine Seram 456) 10% Bovine Seram 457) 20% Bovine Seram 458) 10% Horse Seram

Interleukins

459) IL-1 460) IL-2

46 1) IL-3 462) IL-4 463) IL-5 464) IL-6 465) IL-7 466) IL-8 467) IL-9 468) IL-10 469) IL-1 1 470) IL-12 471) IL-13 472) IL-14 473) IL-15 474) IL-16 475) IL-17 476) IL-18

Proteases

477) MMP-1 478) MMP-2 479) MMP-3 480) MMP-4 481) MMP-5 482) MMP-6 483) MMP-7 484) MMP-8 485) MMP-9 486) MMP-10 487) MMP-1 488) MMP-12 489) MMP-13 490) MMP-14 491) MMP-15 492) MMP-16 493) MMP-17 494) MMP-18 495) MMP-19 496) MMP-20 497) MMP-21 498) MMP-22 499) MMP-23 500) MMP-24 501) Cathepsin B 501) Cathepsin C 503) Cathepsin D 504) Cathepsin G 505) Cathepsin H 506) Cathepsin L 507) Trypsin 508) Pepsin 509) Elastase 510) Carboxypeptidase A

511) Carboxypeptidase B 512) Carboxypeptidase G 513) Carboxypeptidase P 514) Carboxypeptidase W 515) Carboxypeptidase Y 516) Chymotrypsin 5 17) Plasminogen 518) Plasmin 519) u-type Plasminogen activator 520) t-type Plasminogen activator 521) Plasminogen activator inhibitor- 1 522) Carboxypeptidase Z

Amino Acids

522) Alanine 523) Arginine 524) Asparagine 525) Aspartic acid 526) Cysteine 527) Glutamine 528) Glutamic acid 529) Glycine 530) Histidine 531) Isoleucine 532) Leucine 533) Lysine 534) Methionine 535) Phenylalanine 536) Proline 537) Serine 538) Threonine 539) Tryptophan 540) Tyrosine 541) Valine

Prostaglandins

542) Prostaglandin Al 543) Prostaglandin A2 544) Prostaglandin Bl 545) Prostaglandin B2 546) Prostaglandin D2 547) Prostaglandin El 548) Prostaglandin E2 549) Prostaglandin Fl alpha 550) Prostaglandin F2alpha 551) Prostaglandin H

552) Prostaglandin 12 553) Prostaglandin J2 554) 6-Keto-Prostaglandin Fla 555) 16,16-Dimethyl-Prostaglandin E2 556) 15d-Prostaglandin J2 557) Prostaglandins pooled (542-556 above)

Retinoid receptor agonists/Antagonists

558) Methoprene Acid 559) All trans retinoic acid 560) 9-Cis Retinoic Acid 561) 13-Cis Retinoic Acid 562) Retinoid agonists pooled (558-561 above) 563) Retinoid antagonists 564) Retinoic acid receptor isotype RARalpha 565) Retinoic acid receptor isotype RARbeta 566) Retinoic acid receptor isotype RARgamma 567) Retinoic X receptor isotype RXRalpha 568) Retinoic X receptor isotype RXRbeta 569) Retinoic X receptor isotype RARgamma

Miscellaneous Inducers

570) Plant lectins 571) Bacterial lectins 572) forskolin 573) Phorbol myristate acetate 574) Poly-D-lysine 575) 1,25-dihydroxyvitamin D 576) Inhibin 577) Heregulin 578) Glycogen 579) Progesterone 580) IL-1 581) Serotonin 582) Fibronectin - 45kDa Fragment 583) Fibronectin - 70kDa Fragment 584) glucose 585) beta mercaptoethanol 586) heparinase 587) pituitary extract 588) chorionic gonadotropin 589) adrenocorticotropic hormone 590) thyroxin 591) Bombesin 592) Neuromedin B 593) Gastrin-Releasing Peptide 594) Epinephrine 595) Isoproterenol 596) Ethanol 597) DHEA 598) Nicotinic Acid 599) NADH 600) Oxytocin 601) Vasopressin 602) Vasotocin 603) Angiotensin I 604) Angiotensin II 605) Angiotensin I Converting Enzyme 606) Angiotensin I Converting Enzyme Inhibitor 607) Chondroitinase AB 608) Chondroitinase C 609) Brain natriuretic peptide 610) Calcitonin 6 11) Calcium ionophore I 12) Calcium ionophore II 613) Calcium ionophore III 614) Calcium ionophore IV 615) Bradykinin 616) Albumin 617) Plasmonate 6 18) LIF 619) PARP inhibitors 620) Lysophosphatidic acid 621) (R)-METHANANDAMIDE 622) 1,25-DIHYDROXYVITAMIN D3 623) 1,2-DIDECANOYL-GLYCEROL (10:0) 624) 1,2-DIOCTANOYL-SN-GLYCEROL

625) 1,2-DIOLEOYL-GLYCEROL (18: 1) 626) 10-hydroxycamptothecin 627) 11,12-EPOXYEICOSATRIENOIC ACID 628) 12(R)-HETE 629) 12(S)-HETE 630) 12(S)-HPETE 631) 12-METHOXYDODECANOIC ACID 632) 13(S)-HODE 633 13(S)-HPODE 634 13.14-DIHYDRO-PGEl 635 13-KETOOCTADECADIENOIC ACID 636 14.15-EPOXYEICOSATRIENOIC ACID 637 1400W 638 15(S)-HETE 639 15(S)-HPETE 640 15-KETOEICOSATETRAENOIC ACID 641 17-Allylamino-geldanamycin 642 17-OCTADECYNOIC ACID 643 17-PHENYL-TRINOR-PGE2 644 1-ACYL-PAF 645 1-HEXADECYL-2-ARACHIDONOYL-522) 646) GLYCEROL 647 1-HEXADECYL-2-METHYLGLYCERO-3 PC 648 1-HEXADECYL-2-0- ACETYL-GLYCEROL 649 1-HEXADECYL-2-O-METHYL-GLYCEROL 650 1-OCTADECYL-2-METHYLGLYCERO-3 PC 651 1-OLEOYL-2-ACETYL-GLYCEROL 652 1-STEAROYL- 2-LINOLEOYL-GLYCEROL 653 1-STEAROYL-2-ARACHIDONOYL-GLYCEROL 654 2.5-ditertbutylhydroquinone 655 24(S)-hydroxycholesterol 656 24,25-DIHYDROXYVITAMIN D3 657 25-HYDROXYVITAMIN D3 658 2-ARACHIDONOYLGLYCEROL 659 2-FLUOROPALMITIC ACID 660 2-HYDROXYMYRISTIC ACID 661 2-methoxyantimycin A3 662 3,4-dichloroisocoumarin 663 granzyme B inhibitor 664 4-AMINOPYRIDINE 665 4-HYDROXYPHENYLRETIN AMIDE 666 4-OXATETRADECANOIC ACID 667 5(S)-HETE 668 5(S)-HPETE 669 5.6-EPOXYEICOSATRIENOIC ACID 670 5,8,1 1,14-EICOSATETRAYNOIC ACID 671 5,8,1 1-EICOSATRIYNOIC ACID 672 5-HYDROXYDECANOATE 673 5-iodotubercidin 674 5-KETOEICOSATETRAENOIC ACID 675 5' -N-Ethylcarboxamidoadenosine (NECA) 676 6,7-ADTN HBr 677 6-FORMYLINDOLO [3,2-B] CARBAZOLE 678 7,7-DIMETHYLEICOSADIENOIC ACID 679 8.9-EPOXYEICOSATRIENOIC ACID 680 8-methoxymethyl-IBMX 68 9(S)-HODE 682 9(S)-HPODE 683 9.10-OCTADECENO AMIDE 684; A-3 685 AA-861 686 acetyl (N)-s-farnesyl-l-cysteine 687 ACETYL-FARNESYL-CYSTEINE 688 Ac-Leu-Leu-Nle-CHO 689 ACONITINE 690 actinomycin D 69 1 ADRENIC ACID (22:4, n-6) 692 ImM 693 AG-1296 694 AG1478 695 AG213 (Tyrphostin 47) 696 AG-370 697 AG-490 698 AG-879 699 AGC 700 AGGC 701 Ala-Ala-Phe-CMK 702 alamethicin 703 Alrestatin 704; AM 92016 704 AM-251 706 AM-580 707 AMANTIDINE 708 AMILORIDE 709 Amino-l,8-naphthalimide [4-Amino-l,8-522] naphthalimide] 710 Aminobenzamide (3-ABA) [3-522] aminobenzamide (3-ABA)] 7 11 AMIODARONE 712 ANAND AMIDE (18:2,n-6)

7 13 ANAND AMIDE (20:3,n-6) 7 14 ANANDAMIDE (20:4, n-6)

7 15 ANAND AMIDE (22:4,n-6) 716) anisomycin 717) aphidicolin 718) ARACHIDONAMIDE 719) ARACHIDONIC ACID (20:4, n-6) 720) ARACHIDONOYL-PAF 721) aristolochic acid 722) Arvanil 723) ascomycin (FK-520) 724) B581 725) BADGE 726) bafilomycin Al 727) BAPTA-AM 728) BAY 11-7082 729) BAY K-8644 730) BENZAMIL 731) BEPRIDIL 732) Bestatin 733) beta-lapachone 734) Betulinic acid 735) bezafibrate 736) Blebbistatin 737) BML-190 738) Boc-GVV-CHO 739) bongkrekic acid 740) brefeldin A 741) Bromo-7-nitroindazole [3-Bromo-7-nitroindazole] 742) Bromo-cAMP [8-Bromo-cAMP] 743) Bromo-cGMP [8-Bromo-cGMP] 744) bumetanide 745) BW-B 70C 746) CI6 CE AMIDE 747) C2 CERAMIDE 748) C2 DIHYDROCERAMIDE 749) C8 CERAMIDE 750) C8 CERAMINE 750) C8 DIHYDROCERAMIDE 751) CA-074-Me 753) calpeptin 754) calphostin C 755) calyculin A 756) camptothecin 757) cantharidin 758) CAPE 759) capsacin(E) 760) capsazepine 761) CARBACYCLIN 762) castanospermine 763) CDC 764) Cerulenin 765) CGP-37157 766) chelerythrine 767) CIGLITAZONE 768) CIMATEROL 769) CiniiGEL 2Me 770) CIRAZOLINE 771) CITCO 772) CLOFIBRATE 773) clonidine 774) CLOPROSTENOL Na 775) clozapine 776) C-PAF 777) Curcumin 778) Cyclo [Arg-Gly-Asp-D-Phe-Val] 779) cycloheximide 780) protein synthesis inhibitor 781) cycloheximide-N-ethylethanoate 782) cyclopamine 783) CYCLOPIAZONIC ACID 784) cyclosporin A 785) cypermethrin 786) cytochalasin B 787) cytochalasin D

788) D12-PROSTAGLANDIN 32 789) D609 790) damnacanthal 791) DANTROLENE 792) decoyinine 793) Decylubiquinone 794) deoxymannojirimycin(l) 795) deoxynorjrimycin(l) 796) Deprenyl 797) DIAZOXIDE 798) dibutyrylcyclic AMP 799) dibutyrylcyclic GMP 800) DICHLOROBENZAMIL 801) DIHOMO-GAMMA-LINOLENIC ACID 802) DIHYDROSPHINGOSINE 803) DIINDOLYLMETHANE 804) DILTIAZEM 805) diphenyleneiodonium CI 806) dipyridamole 807) DL-DIHYDROSPHINGOSINE 808) DL-PDMP 809) DL-PPMP 810) DOCOSAHEXAENOIC ACID (22:6 n-3) 8 11) DOCOSAPENTAENOIC ACID 8 12) DOCOSATRIENOIC ACID (22:3 n-3) 8 13) doxorubicin 8 14) DRB 815) E-4031 816) E6 berbamine 817) E-64-d 818) Ebselen 819) EHNA HC1 820) EICOSA-5,8-DIENOIC ACID (20:2 n-12)

82 1) EICOSADIENOIC ACID (20:2 n-6) 822) EICOSAPENTAENOIC ACID (20:5 n-3) 823) EICOSATRIENOIC ACID (20:3 n-3) 824) ENANTIO-PAF C16 825) epibatidine (+/-) 826) etoposide 827) FARNESYLTHIO ACETIC ACID 828) FCCP 829) FIPRONIL 830) FK-506 831) FLECAINIDE 832) FLUFENAMIC ACID 833) FLUNARIZINE 834) FLUPROSTENOL 835) FLUSPIRILINE 836) FPL-64176 837) Fumonisin Bl 838) Furoxan 839) GAMMA-LINOLENIC ACID (18:3 n-6) 840) geldanamycin 841) genistein 842) GF-109203X 843) GINGEROL 844) Gliotoxin 845) GLIPIZIDE 846) GLYBURIDE 847) GM6001 848) Go6976 849) GRAYANOTOXIN III 850) GW-5074 851) GW-9662 852) H7] 853) H-89 854) H9 855) HA-1004 856) HA1077 857) HA14-1 858) HBDDE 859) Helenalin 860) Hinokitiol 861) HISTAMINE 862) HNMPA-(AM)3 863) Hoechst 33342 (cell permeable) (BisBenzimide) 864) Huperzine A [(-)-Huperzine A] 865) IAA-94 866) IB-MECA 867) IBMX 868) ICRF-193 869) Ikarugamyin 870) Indirubin 871) Indirubin-3'-monoxime 872) indomethacin 873) juglone 874) K252A 875) Kavain (+/-) 876) KN-62 877) KT-5720 878) L-744,832 879) LatTunculin B 880) Lavendustin A 881) L-cis-DILTIAZEM 882) LEUKOTOXIN A (9,10-EODE) 883) LEUKOTOXIN B (12,13-EODE) 884) LEUKOTRIENE B4 885) LEUKOTRIENE C4 886) LEUKOTRIENE D4 887) LEUKOTRIENE E4 888) Leupeptin 889) LFM-A13 890) LIDOCAINE 891) LINOLEAMIDE 892) LINOLEIC ACID 893) LINOLENIC ACID (18:3 n-3) 894) LIPOXIN A4 895) L-NAME 896) L-NASPA 897) LOPERAMIDE 898) LY-17 1883 899) LY-294002 900) LY-83583 901) Lycorine 902) LYSO-PAF C 6 903) Manoalide 904) manumycin A 905) MAPP, D-erythro 906) MAPP, L-erythro 907) mastoparan 908) MBCQ 909) MCI-186 910) MDL-28 170 9 11) MEAD ACID (20:3 n-9) 912) MEAD ETHANOLAMIDE 913) methotrexate 914) METHOXY VERAPAMIL 915) Mevinolin (lovastatin) 916) MG-132 917) Milrinone 918) MINOXIDIL 919) MINOXIDIL SULFATE 920) MISOPROSTOL, FREE ACID 921) mitomycin C 922) ML7 923) ML9 924) MnTBAP 925) Monastrol 926) monensin 927) MY-5445 928) Mycophenolic acid 929) N,N-DIMETHYLSPHINGOSINE 930) N9-Isopropylolomoucine 931) N-ACETYL-LEUKOTRIENE E4 932) NapSul-Ile-Trp-CHO 933) N-ARACHIDONOYLGLYCINE 934) NICARDIPINE 935) NIFEDIPINE 936) NIFLUMIC ACID 937) Nigericin 938) NIGULDIPINE 939) Nimesulide 940) NIMODIPINE 941) NITRENDIPINE 942) N-LINOLEOYLGLYCINE 943) nocodazole 944) N-PHENYLANTHRANILIC (CL) 945) NPPB 946) NS-1619 947) NS-398 948) NSC-95397 949) OBAA 950) okadaic acid 95 1) oligomycin A 952) olomoucine 953) ouabain 954) PAF C16 955) PAF CI 8 956) PAF C18: 1 957) PALMITYLETHANOLAMIDE 958) Parthenolide 959) PAXILLINE 960) PCA 4248 961) PCO-400 962) PD 98059 963) PENITREM A 964) pepstatin 965) PHENAMIL 966) Phenanthridinone [6(5H)-Phenanthridinone] 967) Phenoxybenzamine 968) PHENTOLAMINE 969) PHENYTOIN 970) PHOSPHATIDIC ACID, DIPALMITOYL

9 ) Piceatannol 972) pifithrin 973) PIMOZIDE 974) PINACIDIL 975) piroxicam 976) PP1 977) PP2 978) prazocin 979) Pregnenolone 16alpha carbonitrile 980) PRIMA- 981) PROCAINAMIDE 982) PROPAFENONE 983) propidium iodide 984) propranolol (S-) 985) puromycin 986) quercetin 987) QUINIDINE 988) QUININE 989) QX-314 990) rapamycin 991) resveratrol 992) RETINOIC ACID, ALL TRANS 993) REV-5901 994) RG-14620 995) RHC-80267 996) RK-682 997) Ro 20-1724 998) Ro 31-8220 999) Rolipram 1000) roscovitine 1001) Rottlerin 1002) RWJ-60475-(AM)3 1003) RYANODINE 1004) SB 202190 1005) SB 203580 1006) SB-415286 1007) SB-43 1542 1008) SDZ-201 106 1009) S-FARNESYL-L-CYSTEINE ME 1010) Shikonin

101 1) siguazodan 1012) SKF-96365 1013) SP-600125 1014) SPHINGOSINE 1015) Splitomycin 1016) SQ22536 1017) SQ-29548 101 8) staiuOsporine 1019) SU-43 12 1020) Suramin 1021) swainsonine 1022) tamoxifen 1023) Tanshinone IIA 1024) taxol = paclitaxel 1025) TETRAHYDROCANNABINOL-7-OIC ACID 1026) TETRANDRINE 1027) thalidomide 1028) THAPSIGARGIN 1029) Thiociti-ulline [L-Thiocitralline HCl] 1030) Thiorphan 1031) TMB-8 1032) TOLAZAMIDE 1033) TOLBUTAMIDE 1034) Tosyl-Phe-CMK (TPCK) 1035) TPEN 1036) Trequinsin 1037) trichostatin-A 1038) trifluoperazine 1039) TRIM 1040) Triptolide 1041) TTNPB 1042) Tunicamycin 1043) tyrphostin 1 1044) tyrphostin 9 1045) tyrphostin AG- 126 1046) tyrphostin AG-370 1047) tyrphostin AG-825 1048) Tyrphostin-8 1049) U-0126 1050) U-37883A 1051 ) -466 19 1052) U-50488 1053) 73122 1054) U-74389G 1055) U-75302 1056) valinomycin 1057) Valproic acid 1058) VERAPAMIL 1059) VERATRIDINE 1060) vinblastine 1061) vinpocetine 1062) W7 1063) WIN 55,212-2 1064) Wiskostatin 1065) Wortmannin 1066) WY-14643 1067) Xestospongin C 1068) Y-27632 1069) YC-1 1070) Yohimbine 1071) Zaprinast 1072) Zardaverine 1073) ZL3VS 1074) ZM226600 1075) ZM336372 1076) Z-prolyl-prolinal 1077) zVAD-FMK 1078) Ascorbate 1079) 5-azacytidine 1080) 5-azadeoxycytidine 1081) Hexamethylene bisacetamide (HMBA) 1082) Sodium butyrate 1083) Dimethyl sulfoxide. 1084) Goosecoid 1085) Glycogen synthase kinase-3 1086) Galectin-1 1087) Galectin-3

Cell Adhesion Molecules

1086) Cadherin 1 (E-Cadherin) 1087) Cadherin 2 (N-Cadherin) 1088) Cadherin 3 (P-Cadherin) 1089) Cadherin 4 (R-Cadherin) 1090) Cadherin 5 (VE-Cadherin) 1091) Cadherin 6 (K-Cadherin) 1092) Cadherin 7 1093) Cadherin 8 1094) Cadherin 9 1095) Cadherin 10 1096) Cadherin 11 (OB-Cadherin) 1097) Cadherin 12 (BR-Cadherin)

1098) Cadherin 13 (H-Cadherin) 1099) Cadherin 14 (same as Cadherin 18) 1100) Cadherin 15 (M-Cadherin) 1101) Cadherin 16 (KSP-Cadherin) 1102) LI Cadherin

Table V A set of gene expression markers useful screening for terminal differentiation in human embryonic progenitor cell lines Gene Accession No. Cell Type Present(+)/Absent(- COL2A1 NM_001 844.3 Chondrocytes - COL24A1 NM_152890.4 Osteoblasts low GFAP NM_002055.2 Astrocytes - OLIG2 NM_005806.1 Oligodendrocytes - PLP1 NM_000533.3 Oligodendrocytes & Schwann cells low PRPH NM_006262.2 Peripheral Neurons low ACTA1 NM_001 100.3 Skeletal Myocytes - MYF5 NM_005593.1 Skeletal Myocytes - DES NM_001927.3 Skeletal Muscle low-med MYH1 1 NM_002474.2 Smooth Muscle low-med GCM2 NM_004752.2 Parathyroid - VWF NM_000552.2 Endothelial low PECAMI NM_000442.2 Endothelial low LY75 NM_002349.1 Thymus TNMD NM_022144.1 Tendon/Ligament low SCXA NM 001008271 Tendon med

TABLE V I

Parental hES ACTC No. Cell Line Cell Line Microarray NMF Group NMF Order Cell Lines Synonyms Group Number (WA09 or MA03)

MA03 50 B-26 B26 lllumina 1 4 71

MA03 5 1 B-2 B2 lllumina 1 9 69 MA03 52 B-29 B-29 lllumina 1 13 52 MA03 53 B-7 B7 lllumina 1 9 68 MA03 54 B-17 B17 lllumina 1 8 54 MA03 55 B-3 B3 lllumina 1 4 74 MA03 56 B-6 B6 lllumina 1 15 55 MA03 57 B-25 B25 lllumina 1 4 73

MA03 58 B-1 1 B11 lllumina 1 4 72 MA03 59 B-16 B16 lllumina 1 7 65 MA03 60 B-28 B28 lllumina 1 12 84

MA03 6 1 B-30 B30 lllumina 1 14 25 MA03 62 2-2 2-2 (Rep1), 2-2 lllumina 1 1 89 (Rep1), 90 (Rep2), 2.2 (Rep2) MA03 63 2-1 2.1 lllumina 1 1 88

MA03 64 6-1 6.1 lllumina 1 9 70 MA03 65 B-12 B12 lllumina 1 12 82 MA03 66 B-4 B4 lllumina 1 5 83 MA03 67 B-14 B14 lllumina 1 NA NA MA03 68 5-4 5.4 lllumina 1 122 32

MA03 69 4-2 4.2 lllumina 1 11 37 MA03 70 2-3 2.3 lllumina 1 23 94

MA03 7 1 B-15 B15 lllumina 1 6 22 MA03 72 CM50-4 CM50.4 lllumina 1 NA NA MA03 73 CMO-3 CM0.3 lllumina 1 22 85 MA03 74 CMO-5 CM0.5 lllumina 1 22 86 MA03 75 CM50-5 CM50.5 lllumina 1 22 87 MA03 76 CM50-2 CM50.2 lllumina 1 NA NA

MA03 77 CMO-2 CM0.2 lllumina 1 21 49 MA03 78 CM30-2 CM30.2 lllumina 1 10 42 MA03 79 CM20-4 CM20.4 lllumina 1 23 93 MA03 80 E26 E26 lllumina 1 NA NA

MA03 8 1 E71 E71 lllumina 1 NA NA WA09 82 4-D20-9 4-D20-9 lllumina 1 NA NA WA09 83 4-SKEL-19 4-SKEL-19 Affymetrix NA NA WA09 84 4-D20-8 4-D20-8 Affymetrix NA NA MA03 85 E34 E34 Affymetrix NA NA MA03 86 E51 E51 lllumina 1 36 24 WA09 87 C4.4 C4.4 Affymetrix NA NA MA03 88 E3 E3 lllumina 1 30 75 MA03 89 E73 E73 lllumina 1 30 80 MA03 90 E93 E93 lllumina 1 NA NA

MA03 9 1 E57 E57 lllumina 1 30 79 WA09 92 C4 ELSR #14 C4 ELSR #14 lllumina 1 NA NA MA03 93 E76 E76 Affymetrix NA NA MA03 94 E17 E17 lllumina 1 NA NA MA03 95 E40 E40 lllumina 1 32 28 MA03 96 E8 E8 Affymetrix NA NA MA03 97 E67 E67 lllumina 1 30 76 MA03 98 E15 E15 lllumina 1 26 26 MA03 99 E45 E45 lllumina 1 34 47 MA03 00 E72 E72 lllumina 1 7 66 MA03 101 E69 E69 lllumina 1 28 16 MA03 102 E75 E75 lllumina 1 7 67 MA03 103 M10 M10 Affymetrix NA NA MA03 104 M13 M13 Affymetrix NA NA MA03 105 E19 E19 lllumina 1 29 27 WA09 106 T44 T44 lllumina 1 114 18

MA03 107 E61 E61 lllumina 1 NA NA

WA09 108 C4 ELSR #18 C4 ELSR #18 lllumina 1 41 97 WA09 109 RA-SKEL-8 RA-SKEL-8 lllumina 1 78 147 WA09 110 4-SKEL-8 4-SKEL-8 Affymetrix NA NA

WA09 111 RA-PEND-15 RA-PEND-15 lllumina 1 NA NA MA03 112 E108 E108 Affymetrix NA NA MA03 113 E35 E35 lllumina 1 NA NA

MA03 114 E33 E33 lllumina 1 31 46 MA03 115 E80 E80 Affymetrix NA NA MA03 116 E84 E84 lllumina 1 30 78 MA03 117 E109 E109 Affymetrix NA NA WA09 118 C4 ELS5 #6 C4 ELS5 #6 lllumina 1 38 9 MA03 119 J8 J8 lllumina 1 65 96 WA09 120 T43 T43 lllumina 1 114 17

MA03 121 E10 E10 lllumina 1 NA NA WA09 122 RA-PEND-6 RA-PEND-6 lllumina 1 NA NA WA09 123 RA-PEND-10 RA-PEND-10 Affymetrix NA NA WA09 124 RA-SKEL-3 RA-SKEL-3 lllumina 1 NA NA WA09 125 RA-SKEL-21 RA-SKEL-21 Affymetrix NA NA WA09 126 4-SKEL-4 4-SKEL-4 Affymetrix NA NA WA09 127 4-SKEL-20 4-SKEL-20 Affymetrix NA NA WA09 128 RA-PEND-4 RA-PEND-4 lllumina 1 NA NA WA09 129 RA-PEND-18 RA-PEND-18 Affymetrix NA NA

WA09 130 C4 ELS5 # 1 C4 ELS5 # 1 lllumina 1 16 98

WA09 131 C4 ELSR #12 C4 ELSR #12 lllumina 1 18 99 MA03 132 E163 E163 lllumina 1 NA NA WA09 133 C4 Mesen. #3 C4 Mesen. #3 lllumina 1 20 45 MA03 134 G6 G6 lllumina 1 NA NA WA09 135 C4 ELS5 #5 C4 ELS5 #5 lllumina 1 17 100 MA03 136 J16 J16 lllumina 1 64 95 WA09 137 SK46 SK46 lllumina 1 92 186 WA09 138 SK47 SK47 lllumina 1 93 184 WA09 139 EN2 EN2 lllumina 1 47 167 WA09 140 EN26 EN26 lllumina 1 49 160 WA09 141 EN31 EN31 lllumina 1 52 172 WA09 142 SM2 SM2 lllumina 1 98 115 WA09 143 SM4 SM4 lllumina 1 105 109 WA09 144 EN4 EN4 lllumina 1 54 163 WA09 145 EN5 EN5 lllumina 1 57 162

WA09 146 SK52 SK52 lllumina 1 81 203

WA09 147 SK43 SK43 lllumina 1 81 202 WA09 148 SK30 SK30 lllumina 1 88 176 WA09 149 SM42 SM42 lllumina 1 107 116

WA09 150 SM28 SM28 lllumina 1 101 112 WA09 151 SM49 SM49 lllumina 1 109 114 WA09 152 C4 ELSR #10 C4 ELSR #10 Affymetrix NA NA WA09 153 RA-SKEL-1 1 RA-SKEL-1 1 lllumina 1 NA NA WA09 154 RA-SMO-12 RA-SMO-12 lllumina 1 NA NA WA09 155 RA-D20-16 RA-D20-16 lllumina 1 72 58 WA09 156 SM22 SM22 lllumina 1 99 110 WA09 157 SK5 SK5 lllumina 1 94 148 WA09 158 SK18 SK18 lllumina 1 84 185

WA09 159 SK50 SK50 lllumina 1 81 199 WA09 160 SK54 SK54 lllumina 2 89 135

MA03 161 J4 J4 lllumina 1 NA NA WA09 162 SK17 SK17 lllumina 1 83 3 WA09 163 SK26 SK26 lllumina 1 85 198 WA09 164 SK31 SK31 lllumina 2 89 134 WA09 165 SK32 SK32 lllumina 1 90 189 WA09 166 SM25 SM25 lllumina 1 100 107 WA09 167 C4 ELSR #2 C4 ELSR #2 lllumina 1 19 102 (Bio 1) (Bio 1) WA09 167 C4 ELSR #2 C4 ELSR #2 lllumina 1 19 103 (Bio 2) (Bio 2)

WA09 167 C4 ELSR #2 C4 ELSR #2 lllumina 1 19 101 (Bio 3) (Bio 3) WA09 168 SK3 SK3 lllumina 1 NA NA WA09 169 SK53 SK53 lllumina 1 82 193 MA03 170 E44 E44 lllumina 1 33 12

MA03 171 E65 E65 Affymetrix NA NA MA03 172 J13 J13 lllumina 1 63 5

WA09 173 EN1 EN1 lllumina 1 45 154 WA09 174 EN13 EN13 lllumina 1 43 149 WA09 175 EN42 EN42 lllumina 1 55 164 WA09 176 EN47 EN47 lllumina 1 56 152 WA09 177 SM27 SM27 lllumina 1 NA NA MA03 178 E50 E50 lllumina 1 35 56 MA03 179 E30 (Biol) E30 (Biol) Affymetrix NA NA MA03 179 E30 (Bio2) E30 (Bio2) lllumina 1 30 77 MA03 180 E122 E122 Affymetrix NA NA

WA09 181 SK61 SK61 lllumina 1 82 190 WA09 182 SM17 SM17 lllumina 1 96 122 WA09 183 SM33 SM33 lllumina 1 104 125 WA09 184 EN7 EN7 lllumina 1 43 150

WA09 185 EN55 EN55 lllumina 1 61 161 WA09 186 T7 T7 lllumina 2 86 14 WA09 187 EN22 EN22 lllumina 1 NA NA WA09 188 SK58 SK58 Affymetrix NA NA WA09 189 MW2 MW2 lllumina 1 67 187 WA09 190 SK8 SK8 lllumina 1 95 195 WA09 191 SK20 SK20 lllumina 1 NA NA

WA09 192 SK60 SK60 lllumina 1 82 191 WA09 193 MW6 MW6 lllumina 1 68 188

WA09 194 Z 11 (Rep 1) Z 11 (Rep 1) lllumina 1 139 104

WA09 194 Z 11 (Rep 2) Z 11 (Rep 2) lllumina 1 139 105

WA09 195 Z6 Z6 lllumina 1 138 120 WA09 196 W10 W10 lllumina 1 42 166 WA09 197 W 11 W 11 lllumina 1 117 157 WA09 198 T36 T36 lllumina 1 113 20 WA09 199 EN27 EN27 lllumina 1 50 159 WA09 200 Z7 Z7 lllumina 1 138 118 WA09 201 SM44 SM44 lllumina 1 108 113

WA09 202 EN38 EN38 lllumina 1 53 171 WA09 203 SK1 SK1 lllumina 1 79 182

WA09 204 SK44 SK44 lllumina 1 81 201 WA09 205 SK57 SK57 lllumina 1 87 197 MA03 206 J2 J2 Affymetrix NA NA

MA03 207 E68 E68 lllumina 1 37 11 MA03 208 E169 E169 lllumina 1 28 15 MA03 209 E164 E164 lllumina 1 27 53

WA09 210 T42 T42 lllumina 1 113 21

WA09 211 T14 T14 lllumina 1 11 1 19 WA09 212 RA-D20-6 RA-D20-6 Affymetrix NA NA WA09 213 Z8 Z8 lllumina 1 100 108

WA09 214 SK40 SK40 lllumina 1 91 183

WA09 215 EN1 1 EN1 1 lllumina 1 42 165 WA09 216 EN18 EN18 lllumina 1 45 153 WA09 217 EN23 EN23 lllumina 1 NA NA WA09 218 SK14 SK14 lllumina 1 82 192 WA09 219 SK10 SK10 lllumina 1 80 181 WA09 220 EN51 EN51 lllumina 1 59 173 WA09 221 EN16 EN16 lllumina 1 44 158 MA03 222 E53 E53 lllumina 1 NA NA MA03 223 E11 1 E11 1 lllumina 1 24 48 WA09 224 SK49 SK49 lllumina 1 NA NA WA09 225 SM8 SM8 lllumina 1 110 106 WA09 226 RA-D20-5 RA-D20-5 lllumina 1 74 57 WA09 227 RA-D20-24 RA-D20-24 Affymetrix NA NA WA09 228 W7 W7 Affymetrix NA NA WA09 229 4-D20-14 4-D20-14 lllumina 1 NA NA WA09 230 RA-D20-19 RA-D20-19 lllumina 1 73 59 WA09 231 T20 T20 Affymetrix NA NA WA09 232 RA-SMO-19 RA-SMO-19 lllumina 1 NA NA

MA03 233 M 11 M 11 Affymetrix NA NA WA09 234 EN9 EN9 lllumina 1 NA NA

WA09 235 Q7 Q7 lllumina 1 71 194

WA09 236 U31 U31 lllumina 1 116 64 WA09 237 EN19 EN19 lllumina 1 46 175 WA09 238 C4 ELS5 #8 C4 ELS5 #8 lllumina 1 39 8 WA09 239 Q8 Q8 lllumina 1 NA NA WA09 240 SK25 SK25 Affymetrix NA NA WA09 241 EN20 EN20 Affymetrix NA NA WA09 242 MW1 MW1 lllumina 2 66 4 WA09 243 C4 ELSR #13 C4 ELSR #13 lllumina 1 40 10 WA09 244 Z3 Z3 Affymetrix NA NA WA09 245 W8 (Rep 1) W8 (Rep 1) lllumina 1 120 151 WA09 245 W8 (Rep 2) W8 (Rep 2) Affymetrix NA NA

WA09 246 SK28 SK28 lllumina 1 87 196 MA03 247 E120 E120 lllumina 1 25 44 WA09 248 SM51 SM51 lllumina 1 NA NA WA09 249 EN8 EN8 lllumina 1 NA NA

WA09 250 SK1 1 SK1 1 lllumina 1 81 200 WA09 251 EN43 EN43 Affymetrix WA09 252 4-D20-3 4-D20-3 Affymetrix NA NA WA09 253 EN44 EN44 lllumina 1 NA NA WA09 254 EN50 EN50 lllumina 1 58 178 WA09 255 Z2 Z2 lllumina 1 140 117 WA09 256 SM30 SM30 lllumina 1 103 124 WA09 257 EN53 EN53 lllumina 1 60 179 WA09 258 SK27 SK27 lllumina 1 86 13 WA09 259 U18 U18 lllumina 1 115 62 WA09 260 SM35 SM35 lllumina 1 NA NA WA09 261 EN25 EN25 lllumina 1 48 174 WA09 262 C4 ELSR 6 C4 ELSR 6 Affymetrix NA NA

WA09 263 Z 1 Z 1 lllumina 1 138 119 MA03 264 F15 F15 Affymetrix NA NA WA09 265 RA-SKEL-9 RA-SKEL-9 lllumina 1 NA NA MA03 266 E85 E85 Affymetrix NA NA WA09 267 W4 W4 lllumina 1 88 177 WA09 268 MEL-2 MEL-2 Affymetrix NA NA WA09 269 LS2 LS2 lllumina 1 NA NA WA09 270 7-SKEL-4 7-SKEL-4 lllumina 2 129 130 WA09 271 7-SKEL-7 7-SKEL-7 lllumina 2 129 132 WA09 272 7-PEND-9 7-PEND-9 lllumina 2 125 128

WA09 273 7-PEND-16 7-PEND-16 lllumina 2 125 127

WA09 274 7-SKEL-6 7-SKEL-6 lllumina 2 129 131 WA09 275 LS3 LS3 lllumina 1

WA09 276 7-SMOO-19 7-SMOO-19 lllumina 2 131 140

WA09 277 7-SMOO-29 7-SMOO-29 lllumina 2 134 141 WA09 278 7-SMOO-32 7-SMOO-32 lllumina 2 135 136 WA09 279 7-SMOO-33 7-SMOO-33 lllumina 1 NA NA WA09 280 7-SMOO-4 7-SMOO-4 lllumina 1 NA NA WA09 281 7-SMOO-9 7-SMOO-9 lllumina 2 134 142 WA09 282 7-SMOO-17 7-SMOO-17 lllumina 1 NA NA WA09 283 7-PEND-24 7-PEND-24 lllumina 2 124 156 WA09 284 7-SKEL-32 7-SKEL-32 lllumina 1 NA NA WA09 285 7-SMOO-13 7-SMOO-13 lllumina 1 NA NA WA09 286 7-SMOO-25 7-SMOO-25 lllumina 2 132 168 WA09 287 7-SMOO-12 7-SMOO-12 lllumina 2 130 138 WA09 288 7-PEND-30 7-PEND-30 lllumina 2 126 126 WA09 289 7-SKEL-25 7-SKEL-25 lllumina 1 WA09 290 7-SMOO-6 7-SMOO-6 lllumina 2 136 139 WA09 291 7-SMOO-26 7-SMOO-26 lllumina 2 133 137 WA09 292 7-SMOO-22 7-SMOO-22 lllumina 1 NA NA WA09 293 7-SMOO-8 7-SMOO-8 lllumina 1 NA NA WA09 294 7-SKEL-14 7-SKEL-14 lllumina 1 NA NA WA09 295 7-SKEL-1 1 7-SKEL-1 1 lllumina 1 NA NA WA09 296 7-SKEL-2 7-SKEL-2 lllumina 2 127 129 WA09 297 7-SKEL-22 7-SKEL-22 lllumina 2 128 133 WA09 298 7-SMOO-7 7-SMOO-7 lllumina 2 137 1 WA09 299 7-PEND-12 7-PEND-12 lllumina 2 124 155 WA09 300 7-SMOO-27 7-SMOO-27 NA NA NA WA09 301 7-PEND-13 7-PEND-13 NA NA NA WA09 302 7-PEND-11 7-PEND-11 NA NA NA WA09 303 7-PEND-15 7-PEND-15 NA NA NA WA09 304 7-PEND-32 7-PEND-32 NA NA NA WA09 305 7-PEND-26 7-PEND-26 NA NA NA WA09 306 7-SKEL-24 7-SKEL-24 NA NA NA WA09 307 7-PEND-10 7-PEND-10 NA NA NA WA09 308 7-PEND-23 7-PEND-23 NA NA NA 309 10-RPE-9 10-RPE-9 NA NA NA 310 10-RPE-8 10-RPE-8 NA NA NA WA09 311 RA-PEND-19 RA-PEND-19 NA NA NA MA03 NA X4.1 X4.1 lllumina 1 3 29

MA03 NA X4.3 X4.3 lllumina 1 3 31 MA03 NA B-10 B-10 lllumina 1 3 30 MA03 NA B-1 B-1 lllumina 1 2 39 MA03 NA X4 X4 lllumina 1 121 40

MA03 NA X5 X5 lllumina 1 123 81 MA03 NA B-20 B-20 lllumina 1 6 23

MA03 NA B-22 B-22 lllumina 1 10 41 MA03 NA X6 X6 lllumina 1 10 43

MA03 NA CM10.1 CM10.1 lllumina 1 11 33

MA03 NA X2 X2 lllumina 1 11 34

MA03 NA B-27 B-27 lllumina 1 11 35

MA03 NA B-9 B-9 lllumina 1 11 36

MA03 NA X4.4 X4.4 lllumina 1 11 38

MA03 NA E31 E31 lllumina 1 21 51

MA03 NA CM10-4 CM10-4 lllumina 1 23 91 MA03 NA CM30-5 CM30-5 lllumina 1 23 92

MA03 NA EN28 EN28 lllumina 1 51 170 WA09 NA Q4 Q4 lllumina 1 69 143 WA09 NA Q6 Q6 lllumina 1 70 180 WA09 NA RA-PEND-17 RA-PEND-17 lllumina 1 75 146 (Bio 1) (Bio 1) WA09 NA RA-PEND-17 RA-PEND-17 Affymetrix (Bio 2) (Bio 2) WA09 NA RA-SKEL-18 RA-SKEL-18 lllumina 1 76 144 (Rep 1) (Rep 1) WA09 NA RA-SKEL-18 RA-SKEL-18 Affymetrix NA NA (Rep 2) (Rep 2) WA09 NA RA-SKEL-6 RA-SKEL-6 lllumina 1 77 145 WA09 NA SM19 SM-19 lllumina 1 97 121

WA09 NA SM29 SM-29 lllumina 1 102 11 1 WA09 NA SM40 SM-40 lllumina 1 106 123 WA09 NA T23 T-23 lllumina 1 112 60

WA09 NA T4 T-4 lllumina 1 112 61 WA09 NA U30 U-30 Affymetrix 116 63 WA09 NA W2 W-2 lllumina 1 118 169 WA09 NA W3 W-3 lllumina 1 119 2

MA03 NA E1 1 E-11 lllumina 1 21 50 WA09 NA SK15 SK15 Affymetrix NA NA MA03 NA E55 E55 Affymetrix NA NA MA03 NA E132 E132 Affymetrix NA NA WA09 NA RA-SMO-10 RASMO10 Affymetrix NA NA WA09 NA RA-SMO-14 RASM014 Affymetrix NA NA WA09 NA W9 W9 Affymetrix NA NA WA09 NA MW4 MW4 Affymetrix NA NA WA09 NA SK16 SK16 Affymetrix NA NA Table VII A comparison of gene expression markers in human adipocyte stem cells (ACSs), human bone marrow mesenchymal stem cells (MSCs), human adult dental pulp stem cells (DPSCs), cultured human foreskin fibroblasts (Fibro), a clonal hEP line not capable of COL2A1 induction 7SM007, and the human embryonic progenitors SM30, E15, 4D20.8, 7SM0032, MEL2 and SKI 1 each capable of induced COL2A1 Expression. Numbers in parenthesis are RFU values. Negative expression indicated by shaded boxes. (ND means No Data)

Table VIII Exemplary Differentiation Protocols Preparation of solutions 1. 10% Calf Serum/DMEM: 60 mL Calf Serum; 6 mL 100 mM MEM Sodium Pyruvate; 6 mL lOOx P/S/G; 500 mL DMEM.

2 . 10% FBS/DMEM: 60 mL Fetal Bovine Serum (Filter Sterilized); 6 mL 100 mM MEM Sodium Pyruvate; 6 mL lOOx P/S/G; 500 mL DMEM.

3. IBMX Solution (make fresh): Dissolve IBMX in a solution made of 0.5N KOH to a final concentration of 0.0115 g/mL; filter sterilize through a 0.22 mm syringe filter.

4 . Insulin Stock Solution: 167 µΜ ( 1 mg/mL) in 0.02 M HC1; Filter sterilized through 0.22 mm filter; Can store at -20°C for long term, 4°C short term.

5. Dexamethasone Stock Solutions: Freezer Stock 10 mM of Dex in 100% ethanol (store at -20°C); Working Stock: Dilute Freezer stock to lmM in PBS; Filter sterilize and store at 4°C.

6. MDI Induction Media (10 mL/ 10cm plate; 5 mL/ 6 cm plate); To required volume of 10% FBS/DMEM add: 1:100 IBMX; 1:1000 Insulin; 1:1000 Dexamethasone working stock.

7 . Insulin Media (10 mL/ 10 cm plate; 5 mL /6 cm plate); To required volume of 10% FBS/DMEM add: 1:100 Insulin (final concentration 10.0 ug/mL).

8. Oil red 0 stock solution (0.5 g/ 100 ml isopropanol); Just before staining: mix 60 ml of stock with 40 ml of H20, let it sit for 1 hr at RT; filter through whatman paper 3MM. Procedures

Clonal embryonic Cells are plated in their standard growth media (West et al., 2008, preadipocyte maintenance Regenerative Medicine vol. 3(3) pp. 287-308; see Supplementary and passage Table I) and incubated 37°C in 10% C0 2 and preferable in 5% ambient oxygen. Cells are frequently observed to prevent them from becoming too confluent (>70%), until differentiation is induced.

Adipocyte Differentiation 1. Grow embryonic preadipocytes to confluency in their standard Protocol growth media (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308).

2 . After two days of post confluency (which is counted as day 0), stimulate the cells with MDI induction media.

3. After two days of MDI an induction medium (which is called as day 2) replace the MDI induction media with Insulin Media and feed every two days. Staining procedure 1. Aspirate media, add formaldehyde slowly and let sit for 30 min. 2. Aspirate formaldehyde and add oil red 0 solution to cover the well, leave 1 hr at RT.

3. Remove the stain and wash with distilled water twice. Photograph. Adipogenesis Protocol 2

Cells are grown to confluence in their standard growth medium (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308), medium is removed and replaced by serum-free differentiation medium (DMEM/ F12 containing 1 µ bovine insulin, 100 n hydrocortisone, 10 µg of transferrin/mL, 1 nM thyronine, 1 µΜ rosiglitazone, 33 ο η,and 17 µΜ pantothenic acid) to induce adipocyte differentiation for 3 d. After 3 d of culture, the medium is changed to differentiation medium without rosiglitazone for another 5 d. The mRNA from cultured cells was extracted at 0, 2, 5, 7 and 14 d of incubation for transcript analysis as described herein.

Differentiation Factor Protocol 1

Cells are seeded in a 12 well plate precoated with fibronectin (Gibco) at a high density (1.5 x 106 cells/well). Cells are fed three times per week for 14 days with a basal media of knock out DMEM with penicillin/streptomycin and 16% knock out serum replacement. Individual differentiation factors added to this basal medium chosen from Table III.

Control five day quiescent cells are plated at 3.0 x 105 cells/well and at confluence fed media with serum or other growth supplements reduced to 10% of normal values. The cells are refed two days prior to harvest.

Angiogenesis Protocols Endothelial Formation The tube formation assay is carried out on 24-well plates previously Protocol (Tube Formation) coated with 250µ1of matrigel per well (BD Biosciences, cat. # 356237). The plates are pre-incubated for 30 minutes at 37°C before seeding the cells. Subsequently, the cells to be differentiated are seeded at a density of 5xl0 4 cells/well in 1 ml of EGM2 media (LONZA cat. # CC-3162). The tube formation assays were analyzed at 24 and 96 hours. Cells are photographed for scoring of the quantity and quality of tube formation as is well-known in the art. RNA is harvested for Q-PCR and microarray analysis of gene expression and markers of endothelial cell differentiation such as the up-regulation of VWF, CDH5 (VE-Cadherin), CD31, KDR, is assayed. Mural Cell Integration into Endothelial tubes are generated as described in Endothelial Endothelial Tube Protocol Formation Protocol (Tube Formation)Above. To measure tube stability and cell integration, 5xl0 4 HUVEC or cells of the present invention including but not limited to the cell line W10 or cells with markers thereof, are mixed with lxlO 4 cells that are to be assayed. HUVEC or similar cells capable of tube formation are labeled with the red dye PKH26 (Sigma, cat. # MINI26); all other cell lines to be tested for mural cell capacity in this assay are labeled with the green dye PKH2 (Sigma, cat. # PKH2GL-1KT). The cell labeling was performed according to the manufacture's protocol. ). The tube formation and mural integration assays are analyzed at 24 and 96 hours. Fluorescence and transmitted light images were taken at a magnification of 4x using a Nikon Eclipse TE 2000-U microscope equipped with an EXFO X-Cite 120 illumination system. Osteogenic Protocol 1 Tissue culture plates are exposed to 12ug/mL of Type I collagen (gelatin) and 12 ug/mL of vitronectin for 24 hours. This gelatin/vitronectin solution is then aspirated and the cell lines of the present invention are added at confluent density. Osteogenic media comprising: DMEM (low glucose) with L-Glutamine, 10% fetal bovine serum, 0.1 uM dexamethasone, 0.2 mM ascorbic acid 2-phosphate, 10 mM glycerol 2-phosphate, and 100 nM BMP7 is added for 15-21 days. The degree of steogenesis is scored by relative staining with Alizarin red S performed as follows: Alizarin red S

(Sigma) (40mM) is prepared in dH20 and the pH is adjusted to 4.1 using 10% (v/v) ammonium hydroxide. Monolayers in 6-well plates (10 cm2/well) are washed with PBS and fixed in 10% (v/v) formaldehyde (Sigma- Aldrich) at room temperature for 15min. The monolayers are then washed twice with excess dH20 prior to addition of 1 mL of 40 mM Alizarin red S (pH 4.1) per well. The plates are incubated at room temperature for 20 min with gentle shaking. After aspiration of the unincorporated dye, the wells are washed four times with 4 mL dH20 while shaking for 5 min. The plates are then left at an angle for 2min to facilitate removal of excess water, reaspirated, and then stored at -20°C prior to dye extraction. Stained monolayers are visual-ized by phase microscopy using an inverted microscope (Nikon). For quantification of staining, 800 uL 10% (v/v) acetic acid is added to each well, and the plate is incubated at room temperature for 30 min with shaking. The monolayer (loosely attached to the plate) is scraped from the plate with a cell scraper (Fisher Lifesciences) and transferred with 10% (v/v) acetic acid to a 1.5-mL microcentrifuge tube with a wide-mouth pipette. After vortexing for 30 s, the slurry is overlaid with 500uL mineral oil (Sigma-Aldrich), heated to exactly 85°C for 10 min, and transferred to ice for 5 min. Care should be taken at this point to avoid opening of the tubes until fully cooled. The slurry is then centrifuged at 20,000g for 15 min and 500 uL of the supernatant is removed to a new 1.5-mL microcentrifuge tube. 200 uL of 10% (v/v) ammonium hydroxide is added to neutralize the acid. The pH can be measured at this point to ensure that it is between 4.1 and 4.5. Aliquots (150 uL) of the supernatant are read in triplicate at 405nm in 96-well format using opaque- walled, transparent-bottomed plates (Fisher Lifesciences) as described (Gregory, CA et al, An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction, Analytical Biochemistry 329 (2004) 77-84).

In vitro conditions to induce chondrogenenesis - Pellet Culture.

Functional differentiation assays utilizing the cells of the present invention can employ micromass and pellet protocols that are well known in the art as capable of causing bone marrow, adipose, and tooth-derived mesenchymal stem cells to differentiate into chondrogenic lineages. To demonstrate that individual cell lines are capable of differentiating into chondrogenic lineages we assayed by qPCR transcript levels for COL2A1, ACAN, CRTL1, CILP, BGN, and CRTAC1 (CEP-68). In the case of the Chondrogenic Pellet Protocol:

1. Cells are cultured in gelatin (0.1%) coated Corning tissue culture treated cultureware and detached with 0.25% trypsin/EDTA (Invitrogen, Carlsbad, CA, Gibco) diluted 1:3 with PBS (Ca,Mg free). After detachment and addition of growth medium cells are counted using a Coulter counter and appropriate number of cells needed for experiment (e.g. 10x106 or more) are transferred into a sterile polyproylene tube and spun at 150g for 5 min at room temperature. 2. The supernatant is aspirated and discarded. The cells are washed with the addition of Incomplete Chondrogenic Medium consisting of hMSC Chondro BulletKit (PT-3925) to which is added supplements (Lonza, Basel, Switzerland, Poietics Single-Quots, Cat. # PT-4121). Supplements added to prepare Incomplete Chondrogenic Medium are: Dexamethasone (PT-4130G), Ascorbate (PT-4131G), ITS + supplements (4113G), Pyruvate (4114G), Proline (4115G), Gentamicin (4505G), Glutamine (PT-4140G). 3. Cells are spun at 150g at room temperature, the supernatant is aspirated and cell the pellet is resuspended (once more) with 1.0 ml Incomplete Chondrogenic Medium per 7.5 x 10e5 cells, and spun at 150 x g for 5 minutes. The supernatant is aspirated and discarded. The Chondrogenesis culture protocol as described by Lonza is followed with some modifications (as written below). 4. Cell pellets are resuspended in Complete Chondrogenic medium to a concentration of 5.0 x 10e5 cells per ml. Complete Chondrogenic Medium consists of Lonza Incomplete Medium plus TGFD3 (Lonza, PT-4124). Sterile lyophilized TGFP3 is reconstituted with the addition of sterile 4mM HC1 containing lmg/ml BSA to a concentration of 20ug/ml and is stored after aliquoting at - 80°C. Complete Chondrogenic medium is prepared just before use by the addition of lul of TGF 3 for each 2 ml of Incomplete Chondrogenic medium (final TGF 3 concentration is lOng/ml).

5. An aliquot of 0.5 ml (2.5 x 105 cells) of the cell suspension is placed into sterile 15 ml polypropylene culture tubes. Cells are spun at 150 x g for 5 minutes at room temperature. 6. Following centrifugation the caps of the tubes are loosened one half turn to allow gas exchange. The tubes are placed in an incubator at 37°C, in a humidified atmosphere of 10% C0 2 and

5%0 2. Pellets are not disturbed for 24 hours. 7. Cell pellets are fed every 2-3 days by completely replacing the medium in each tube by aspirating the old medium with sterile 1-200 ul pipette tip and adding 0.5 ml of freshly prepared Complete Chondrogenic Medium to each tube.

8. After replacing the medium and ensuring that the pellet is free-floating, caps are loosened and tubes returned to the incubator. 9. Pellets are harvested after varying time points in chondrogenic medium and prepared for histology by fixation with Neutral Buffered Formalin and/or the pellets are combined and prepared for RNA extraction using Rneasy mini Kits (Qiagen, Germantown, MD, Cat. No. 74104). The protocol for RNA extraction is followed as described by the Qiagen Handbook. RNA yield is maximized by using Qiagen' s QiaShredder (Cat. # 79654) to homogenize samples following lysis of cell pellets with RLT buffer (provided in Rneasy mini kits) prior to RNA extraction.

In vitro conditions to induce chondrogenenesis - Micromass Culture.

1. Cells are cultured in gelatin (0. 1%) coated Corning tissue culture treated cultureware and detached with 0.25% trypsin/EDTA (Gibco) diluted 1:3 with PBS (Gibco Ca,Mg free). After detachment and addition of growth medium cells are counted using a Coulter counter and appropriate number of cells needed for experiment (e.g. 10 xlO 6 cells or more) are resuspended at a cell density of 20x1 06 cells/ml in growth medium. 2. lOul aliquots are seeded onto Corning Tissue Culture Treated Polystyrene plates or dishes. Twenty five or more micromass aliqouts (200,000 cells/lOul aliquot) are seeded.

3. The seeded micromasses are placed in a humidified incubator at 37°C with 5% 0 2 and

10% C0 2 for 90 minutes to 2 hours for attachment. 4. Growth medium is added and the following morning is replaced, after aspiration and washing with PBS (Ca, Mg free), with Complete Chondrogenic Medium (prepared as described above for the pellet micromasses). For example 6 ml Complete Chondrogenic medium/ 10cm dish is added. Cells are maintainied in a humidified incubator at 37°C with 5% 0 2, 10% C0 2 and chondrogenic medium replaced with freshly prepared medium every 2-3 days. 5. After varying periods of time in chondrogenic medium RNA is extracted using Qiagen Rneasy kits (Qiagen Cat. No. 74104) as described in the Qiagen Handbook. RNA yield is maximized by using Qiagen' s QiaShredder (Cat. # 79654 to homogenize samples following lysis of micromasses with RLT buffer, (which is provided with the Rneasy mini kits) prior to RNA extraction. An alternative to Lonza Chondrogenic medium is CellGro (Cat. No. 15-013-CV) from Media Tech. To each 500ml, the following supplements are added: 5.0 ml Pen/Strep (Gibco Cat. No. 15140), 5.0ml Glutamax (Gibco Cat. No. 35050), Dexamethasone (Sigma, St. Louis, MO, Cat. No.D1756-100) - 500ul of O.lmM for a final concentration of 0.1 uM; L-Proline (Sigma Cat. No. D49752) -500ul 0.35M for a final concentration of 0.35mM; Ascorbic Acid-2 -phosphate (Sigma, Cat. No. 49792, Fluka) -500ul 0.17M for a final concentration 0.17mM; ITS Premix (BD, Franklin

Lakes, NJ, sterile Cat. No. 47743-628) -500ul of lOOOx concentrate for a final concentration of 6.25ug/ml insulin, 6.25ug/ml transferrin, 6.25ng/ml selenious acid, serum albumin 1.25mg/ml, 5.35 ug/ml linoleic acid. Following addition of constituents above the media is filtered through a 500 ml Corning 0.2 micron filter unit. As an alternative to Lonza TGF 3 descibed above we use TGFP3 (R&D Systems, Minneapolis MN, Cat. No. 243-B3-010). It is prepared, aliquoted and stored and used similarly to that purchased from Lonza. Differentiation in gels containing crosslinked hyaluronic acid and gelatin The cell lines of the present invention may also be differentiated within hydrogels, including crosslinked gels containing hyaluronic acid and gelatin with or without added factors listed in Table III. Cells are trypsinized and suspended at 1-30 x 10e6 cells/ml HyStem-CSS (Glycosan Hydrogel Kit GS319) according to manufacturers directions.

1. Preparation of HyStem-CSS: HyStem (thiol-modified hyaluranan) is dissolved in 1 ml degassed deionized water (taking about 20 minutes). Gelin-S (thiol modified gelatin) is dissolved in 1 ml degassed deionized water and PEGSSDA (disulfide-containing PEG diacrylate) is dissolved in 0.5 ml degassed deionized water (designated herein as "PEGSSDA solution"). Then HyStem (1ml) is mixed with Gelin-S (1ml) without creating air bubbles, immediately before use (designated herein as "HyStem: Gelin-S mix").

2. Retinoic acid and EGF-Containing HyStem-CSS: In the case of differentiation in HyStem hydrogel containing RA and EGF, 17 million cells are pelleted and resuspended in 1.4 ml Hystem:Gelin-S mix. Then 0.35ml of PEGSSDA solution is added, pipetted up and down, without creating air bubbles, and lOOul aliquots are quickly placed onto multiple 24 well inserts (Corning Cat #3413). After gelation, in 20 minutes, encapsulated cells are fed 2ml growth media with trans-RA (luM) (Sigma, Cat # 2625) or 2ml growth media with EGF lOOng/ml (R&D systems Cat# 236-EG). Cells are fed three times weekly. After 28 days, cells are lysed and RNA harvested using RNeasy micro kits (Qiagen Cat # 74004) for qPCR or microarray analysis as described herein.

3. Differentiation in Hydrogels Containing Crosslinked Hyaluronic Acid and Gelatin to Induce Chondrogenesis: Cells are suspended at a density of 20 x 10e6 cells/ml in 1.4 ml Hystem:Gelin-S mix. Then 0.35ml of PEGSSDA solution is added, pipetted up and down, without creating air bubbles, and lOOul aliquots are quickly placed onto multiple 24 well inserts (Corning Cat #3413). After gelation, in 20 minutes, encapsulated cells are fed 2ml Complete Chondrogenic Medium which consists of Lonza Incomplete Medium plus TGFP3 (Lonza, PT-4124). Incomplete Chondrogenic Medium consisting of hMSC Chondro BulletKit (PT-3925) to which is added supplements (Lonza, Basel, Switzerland, Poietics Single-Quots, Cat. # PT-4121). Supplements added to prepare Incomplete Chondrogenic Medium are: Dexamethasone (PT-4130G), Ascorbate (PT-4131G), ITS + supplements (4113G), Pyruvate (4114G), Proline (4115G), Gentamicin (4505G), Glutamine (PT-4140G). Sterile lyophilized TGF 3 is reconstituted with the addition of sterile 4mM HC1 containing lmg/ml BSA to a concentration of 20ug/ml and is stored after aliquoting at -80°C. Complete Chondrogenic medium is prepared just before use by the addition of lul of TGFP3 for each 2 ml of Incomplete Chondrogenic medium (final

TGF 3 concentration is lOng/ml). Cells are refed three times a week and cultured for a total of 14 days. Cells are then lysed and RNA harvested using RNeasy micro kits (Qiagen Cat # 74004). Differentiation of confluent cultures in the presence of EGF Cell of the present invention are grown to confluence in a 10 cm cell culture dish which may take 0.5-2 weeks depending upon the initial seeding density and the rate of growth of the cell line. Cells are fed growth media plus lOOng/ml EGF when they reach confluence and are fed three times a week. After 28 days, cells are lysed and RNA prepared using RNeasy mini kits (Qiagen Cat #71404).

Table IX Homo sapiens serpin peptidase 6290707 NM_002639.3 SERPINB5 inhibitor, clade B (ovalbumin), 9337.881 1 97.442505 member 5 (SERPINB5), mRNA. Homo sapiens interleukin 1 receptor 7510386 NM_173843.1 IL1RN antagonist (IL1RN), transcript variant 8983.3292 95.20599 4, mRNA. Homo sapiens ladinin 1 (LAD1), 1170349 NM_005558.3 LAD1 14006.772 78.260091 mRNA. Homo sapiens ribonuclease, RNase A 1190131 NM_032572.2 RNASE7 4305.8224 71.751095 family, 7 (RNASE7), mRNA. Homo sapiens protease, serine, 3 5080139 NM_002771.2 PRSS3 5908.2373 63.615992 (mesotrypsin) (PRSS3), mRNA. Homo sapiens kallikrein-related 6620427 NM_012427.4 KLK5 peptidase 5 (KLK5), transcript variant 3863.586 61.158976 1, mRNA. Homo sapiens corneodesmosin 2140131 NM_001264.3 CDSN 4052.9354 59.87187 (CDSN), mRNA. Homo sapiens serpin peptidase 6350209 NM_002575.1 SERPINB2 inhibitor, clade B (ovalbumin), 7188.0348 59.432694 member 2 (SERPINB2), mRNA. Homo sapiens WAP four-disulfide 6940598 NM_145652.2 WFDC5 3367.8413 58.521206 core domain 5 (WFDC5), mRNA. PREDICTED: Homo sapiens cystatin 4010491 XM_001129442.1 CST6 5190.7212 56.762909 EM (CST6), mRNA. Homo sapiens kallikrein-related 3840010 NM_007196.2 KLK8 peptidase 8 (KLK8), transcript variant 3624.6171 54.699877 1, mRNA. Homo sapiens kallikrein-related 5960192 NM_002776.4 KLK10 peptidase 10 (KLK10), transcript 3802.9105 51.608777 variant 1, mRNA. Homo sapiens cystatin E M (CST6), 1070333 NM_001323.2 CST6 4175.0556 47.073488 mRNA. Homo sapiens collagen, type XVII, 990372 NM_000494.3 COL17A1 4509.0335 43.308003 alpha 1 (COL17A1), mRNA. Homo sapiens laminin, alpha 3 6480592 NM_198129.1 LAMA3 4031.9264 41.333333 (LAMA3), transcript variant 1, mRNA. Homo sapiens crumbs homolog 3 7400524 NM_139161.2 CRB3 (Drosophila) (CRB3), transcript 4001.037 38.696075 variant 2, mRNA. Homo sapiens mesofhelin (MSLN), 1230228 NM_013404.3 MSLN 4084.0186 37.970319 transcript variant 2, mRNA. Homo sapiens interleukin 1 family, 1240528 NM_173170.1 IL1F5 member 5 (delta) (IL1F5), transcript 2208.6037 37.242107 variant 2, mRNA. Homo sapiens chloride intracellular 5870136 NM_004669.2 CLIC3 9848.3735 32.907079 channel 3 (CLIC3), mRNA. Homo sapiens folate receptor 3 4010181 NM_000804.2 FOLR3 2257.6414 28.518472 (gamma) (FOLR3), mRNA. Homo sapiens Ly6/neurotoxin 1 1850541 NM_177458.1 LYNX1 (LYNX1), transcript variant SLURP2, 1801.1529 26.887828 mRNA. Homo sapiens collagen, type XVII, 2120270 NM_000494.3 COL17A1 1788.1525 25.425555 alpha 1 (COL17A1), mRNA. Homo sapiens crumbs homolog 3 4670402 NM_174881.2 CRB3 (Drosophila) (CRB3), transcript 2293.9631 24.958006 variant 3, mRNA. Homo sapiens serine peptidase 6380707 NM_006846.2 SPINK5 inhibitor, Kazal type 5 (SPINK5), 1972.9324 24.836288 mRNA. Homo sapiens proline-rich protein 4010224 NM_199353.1 PRB1 BstNI subfamily 1 (PRB1), transcript 1602.4678 23.346259 variant 2, mRNA. Homo sapiens laminin, alpha 3 2650612 NM_198129.1 LAMA3 1631.0776 21.589169 (LAMA3), transcript variant 1, mRNA. Homo sapiens cathepsin L2 (CTSL2), 1430477 NM_001333.2 CTSL2 4608.6774 21.247247 mRNA. Homo sapiens protease, serine, 8 7210139 NM_002773.3 PRSS8 2764.6522 20.363669 (PRSS8), mRNA. Homo sapiens abhydrolase domain 2710070 NM_024794.1 ABHD9 2162.0329 19.77041 1 containing 9 (ABHD9), mRNA. Homo sapiens laminin, beta 3 730040 NM_000228.2 LAMB 3 5875.8047 18.916112 (LAMB3), transcript variant 1, mRNA. Homo sapiens transforming growth 6660435 NM_003236.1 TGFA 2152.4698 18.323993 factor, alpha (TGFA), mRNA. Homo sapiens desmoglein 1 (DSG1), 4250259 NM_001942.2 DSG1 1048.5971 16.008546 mRNA. Homo sapiens alpha-2-glycoprotein 1, 7200324 NM_001185.2 AZGP1 1297.5647 15.382046 zinc-binding (AZGP1), mRNA. Homo sapiens WAP four-disulfide 580324 NM_080869.1 WFDC12 780.23083 15.156245 core domain 12 (WFDC12), mRNA. Homo sapiens 4010392 NM_174932.1 BPIL2 bactericidal/permeability-increasing 799.18584 14.42805 protein-like 2 (BPIL2), mRNA. Homo sapiens ephrin-Al (EFNA1), 3710397 NM_004428.2 EFNA1 4294.1202 14.364293 transcript variant 1, mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 2529.0429 13.796543 variant 1, mRNA. Homo sapiens 1070400 NM_153282.1 HYAL1 hyaluronoglucosaminidase 1 1425.6857 13.47488 (HYAL1), transcript variant 2, mRNA. Homo sapiens integrin, beta 4 3940132 NM_001005619.1 ITGB4 2193.146 12.971441 (ITGB4), transcript variant 2, mRNA. Homo sapiens ephrin-Al (EFNA1), 3390187 NM_004428.2 EFNA1 1184.2015 12.859628 transcript variant 1, mRNA. Homo sapiens hypothetical protein 3190121 NM_177964.3 LOC130576 1476.9865 12.512142 LOC130576 (LOC130576), mRNA. Homo sapiens secretoglobin, family 6840154 NM_002407.1 SCGB2A1 665.3208 12.368277 2A, member 1 (SCGB2A1), mRNA. Homo sapiens kallikrein-related 1430603 NM_144505.1 KLK8 peptidase 8 (KLK8), transcript variant 726.70029 12.24871 2, mRNA. Homo sapiens proline-rich protein 1660358 NM_199354.1 PRB1 BstNI subfamily 1 (PRB1), transcript 762.35634 11.975599 variant 3, mRNA. Homo sapiens dehydrogenase/reductase (SDR family) 630315 NM_005771.3 DHRS9 1390.9754 11.737302 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens FXYD domain 5390240 NM_021910.1 FXYD3 containing ion transport regulator 3 631.69543 11.304237 (FXYD3), transcript variant 2, mRNA. Homo sapiens Cas-Br-M (murine) 3870471 NM_0121 16.2 CBLC ecotropic retroviral transforming 745.09897 10.534748 sequence c (CBLC), mRNA. Homo sapiens serine peptidase 5860767 NM_003710.3 SPINT1 inhibitor, Kunitz type 1 (SPFNT1), 946.79631 10.212331 transcript variant 2, mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 1014.0296 9.7860641 mRNA. Homo sapiens kallikrein-related 940327 NM_015596.1 KLK13 492.47743 9.6861549 peptidase 13 (KLK13), mRNA. Homo sapiens retinol dehydrogenase 1300187 NM_138412.2 RDH13 1757.0146 9.5424634 13 (all-trans/9-cis) (RDH13), mRNA. Homo sapiens deoxyribonuclease I- 5910528 NM_001374.2 DNASE1L2 668.81844 9.4568415 like 2 (DNASE1L2), mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 3220.0619 9.2529103 (plasma) (GPX3), mRNA. Homo sapiens mucin 15, cell surface 3850451 NM_145650.2 MUC15 548.46991 9.212607 associated (MUC15), mRNA. Homo sapiens integrin, beta 4 1570598 NM_001005731.1 ITGB4 1108.6476 8.9029207 (ITGB4), transcript variant 3, mRNA. Homo sapiens FXYD domain 2060687 NM_005971.2 FXYD3 containing ion transport regulator 3 506.43046 8.8231949 (FXYD3), transcript variant 1, mRNA. Homo sapiens pregnancy specific beta- 4290397 NM_03 1246.1 PSG2 479.43555 8.7505164 1-glycoprotein 2 (PSG2), mRNA. Homo sapiens pregnancy specific beta- 4120243 NM_002784.2 PSG9 775.82183 8.4022808 1-glycoprotein 9 (PSG9), mRNA. Homo sapiens pregnancy specific beta- 1690095 NM_002782.3 PSG6 1-glycoprotein 6 (PSG6), transcript 564.29535 8.1573247 variant 1, mRNA. Homo sapiens kallikrein-related 4230221 NM_005046.2 KLK7 peptidase 7 (KLK7), transcript variant 492.31 18 8.0260751 1, mRNA. Homo sapiens pregnancy specific beta- 5960392 NM_001031850.2 PSG6 1-glycoprotein 6 (PSG6), transcript 614.23894 7.9743613 variant 2, mRNA. Homo sapiens SI00 calcium binding 6550500 NM_002963.3 S100A7 401.84779 7.9518312 protein A7 (S100A7), mRNA. Homo sapiens F l l receptor (FUR), 3850561 NM_144504.1 F R 868.04351 7.735802 transcript variant 5, mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 6596.8294 7.7330167 variant 1, mRNA. Homo sapiens endofhelin 2 (EDN2), 6400598 NM_001956.2 EDN2 475.54233 "7.6745046 mRNA. Homo sapiens lipase, endothelial 7210681 NM_006033.2 LIPG 1527.1653 7.5692932 (LIPG), mRNA. Homo sapiens proline-rich protein 2640307 NM_006249.4 PRB3 460.39757 7.2568842 BstNI subfamily 3 (PRB3), mRNA. Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 4560288 NM_001982.2 ERBB3 704.98584 7.1608589 (avian) (ERBB3), transcript variant 1, mRNA. Homo sapiens interleukin 1 family, 5890689 NM_019618.2 IL1F9 396.16062 7.0293322 member 9 (IL1F9), mRNA. Homo sapiens dehydrogenase/reductase (SDR family) 7160468 NM_005771.3 DHRS9 473.19521 6.83716 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens 5'-nucleotidase, 3940520 NM_001002010.1 NT5C3 cytosolic III (NT5C3), transcript 7749.8165 6.8368492 variant 1, mRNA. Homo sapiens lymphocyte antigen 6 1690685 NM_025261.1 LY6G6C complex, locus G6C (LY6G6C), 494.74499 6.8048958 mRNA. Homo sapiens FXYD domain 6760440 NM_005971.2 FXYD3 containing ion transport regulator 3 363.5073 6.6373909 (FXYD3), transcript variant 1, mRNA. Homo sapiens prostaglandin- endoperoxide synthase 2 1820632 NM_000963.1 PTGS2 4874.8898 6.4245455 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA. Homo sapiens poliovirus receptor- 1430332 NM_030916.1 PVRL4 373.17198 6.4136268 related 4 (PVRL4), mRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 IL1RL1 like 1 (ILIRLI), transcript variant 2, 615.42168 6.3531476 mRNA. Homo sapiens tuftelin 1 (TUFT1), 5220035 NM_020127.1 TUFT1 4515.7484 6.319479 mRNA. Homo sapiens pregnancy specific beta- 4480292 NM_002781.2 PSG5 342.71991 6.2678036 1-glycoprotein 5 (PSG5), mRNA. Homo sapiens wingless-type MMTV 3870131 NM_004625.3 WNT7A integration site family, member 7A 376.31785 6.2310202 (WNT7A), mRNA. Homo sapiens protease, serine, 2 2690452 NM_002770.2 PRSS2 (trypsin 2) (PRSS2), transcript variant 430.51372 6.1914702 1, mRNA. Homo sapiens pregnancy specific beta- 3400474 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 842.09041 6.1522266 variant 1, mRNA. Homo sapiens heparanase (HPSE), 630619 NM_006665.3 HPSE 397.3691 6.0446929 mRNA. Homo sapiens 1980300 NM_153283.1 HYAL1 hyaluronoglucosaminidase 1 354.27094 5.7228221 (HYAL1), transcript variant 3, mRNA. Homo sapiens syndecan 1 (SDC1), 6590592 NM_001006946.1 SDC1 5016.3389 5.6975523 transcript variant 1, mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 801.17065 5.6618673 (HOXA9), mRNA. Homo sapiens carboxypeptidase M 2510152 NM_001005502.1 CPM 409.40487 5.6290324 (CPM), transcript variant 3, mRNA. Homo sapiens coxsackie virus and 870161 NM_001338.3 CXADR adenovirus receptor (CXADR), 1820.0662 5.6028145 mRNA. Homo sapiens interleukin 1 family, 6350593 NM_173161.1 ILIFIO member 10 (theta) (ILIFIO), transcript 302.65428 5.5769102 variant 2, mRNA. Homo sapiens psoriasis susceptibility 1 4640133 NM_014069.1 PSORS1C2 317.78658 5.2369797 candidate 2 (PSORS1C2), mRNA. Homo sapiens serine peptidase 1710468 NM_003710.3 SPINT1 inhibitor, Kunitz type 1 (SPFNT1), 339.47227 5.0491224 transcript variant 2, mRNA. Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral 1050671 NM_005228.3 EGFR 1858.5518 5.0279033 (v-erb-b) oncogene homolog, avian) (EGFR), transcript variant 1, mRNA. Homo sapiens leucine-rich repeat LGI 5390128 NM_018176.2 LGI2 402.46372 5.0008655 family, member 2 (LGI2), mRNA. Homo sapiens growth differentiation 5090671 NM_004864.1 GDF15 3936.2158 4.7575265 factor 15 (GDF15), mRNA. Homo sapiens phospholipase A2, group VII (platelet-activating factor 3390438 NM_005084.2 PLA2G7 267.32869 4.6208078 acetylhydrolase, plasma) (PLA2G7), mRNA.

Homo sapiens Notch homolog 1, 5080167 NM_017617.3 NOTCH 1 translocation-associated (Drosophila) 1370.5479 3.5347199 (NOTCH 1), mRNA. Homo sapiens CUB domain containing 60215 NM_178181.1 CDCP1 protein 1 (CDCP1), transcript variant 1075.0832 3.5264342 2, mRNA. Homo sapiens tweety homolog 1 50719 NM_020659.2 TTYH1 (Drosophila) (TTYH1), transcript 315.92581 3.521 1346 variant 1, mRNA. Homo sapiens chromosome 10 open 4850762 NM_153714.1 C10orf67 323.14594 3.4799814 reading frame 67 (C10orf67), mRNA. Homo sapiens F-box protein 2 4540215 NM_012168.4 FBX02 583.28097 3.4631581 (FBX02), mRNA. Homo sapiens placental growth factor 1940438 NM_002632.4 PGF 449.79513 3.4264269 (PGF), mRNA. Homo sapiens engulfment and cell 4920121 NM_024712.3 ELM03 275.83451 3.4077981 motility 3 (ELM03), mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 5690167 NM_004186.2 SEMA3F 471.75723 3.3938822 basic domain, secreted, (semaphorin) 3F (SEMA3F), mRNA. Homo sapiens ADAM metallopeptidase domain 15 3440452 NM_207 195.1 ADAM 15 8679.3746 3.3868082 (ADAM15), transcript variant 4, mRNA. Homo sapiens pregnancy specific beta- 6550563 NM_002782.3 PSG6 1-glycoprotein 6 (PSG6), transcript 175.48407 3.3554821 variant 1, mRNA. Homo sapiens neuromedin U (NMU), 7050220 NM_006681.1 NMU 407.96062 3.26015 mRNA. Homo sapiens tweety homolog 1 3170047 NM_001005367.1 TTYH1 (Drosophila) (TTYH1), transcript 210.40088 3.2447942 variant 2, mRNA. Homo sapiens bone morphogenetic 4280577 NM_001200.2 BMP2 729.95236 3.2353662 protein 2 (BMP2), mRNA. Homo sapiens Rho guanine nucleotide 3850333 NM_015320.2 ARHGEF4 exchange factor (GEF) 4 (ARHGEF4), 355.34558 3.2107065 transcript variant 1, mRNA. Homo sapiens ADAM metallopeptidase domain 15 1980553 NM_003815.3 ADAM 15 840.11549 3.1858186 (ADAM15), transcript variant 2, mRNA. Homo sapiens carboxypeptidase A4 520682 NM_016352.2 CPA4 4628.5878 3.1759943 (CPA4), mRNA. Homo sapiens biliverdin reductase B 6620521 NM_000713.1 BLVRB (flavin reductase (NADPH)) 790.616 3.1588873 (BLVRB), mRNA. Homo sapiens carboxyl ester lipase 6650593 NM_001807.3 CEL (bile salt-stimulated lipase) (CEL), 373.00619 3.121 1058 mRNA. Homo sapiens betacellulin (BTC), 4280131 NM_001729.1 BTC 189.31534 3.1120787 mRNA. Homo sapiens immunoglobulin 7650767 NM_020789.2 IGSF9 superfamily, member 9 (IGSF9), 202.2823 3.1003966 mRNA. Homo sapiens parathyroid hormone 6900414 NM_198965.1 PTHLH like hormone (PTHLH), transcript 942.50546 3.0657657 variant 1, mRNA. Homo sapiens cytochrome P450, 4860307 NM_000772.1 CYP2C18 family 2, subfamily C, polypeptide 18 176.96593 3.0527722 (CYP2C18), mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 435.27006 3.0349374 variant 1, mRNA. Homo sapiens defensin, beta 123 5670162 NM_153324.2 DEFB123 206.6056 2.9983718 (DEFB123), mRNA. Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 3120608 NM_001005915.1 ERBB3 250.07257 2.9969139 (avian) (ERBB3), transcript variant s, mRNA. Homo sapiens kallikrein 1 (KLK1), 650561 NM_002257.2 KLK1 248.40885 2.9878114 mRNA. Homo sapiens glucosidase, beta; acid 4780133 NM_001005742.1 GBA (includes glucosylceramidase) (GBA), 3486.8534 2.9846767 transcript variant 3, mRNA. Homo sapiens Fl l receptor (FUR), 50307 NM_016946.3 F R 207.25634 2.9839633 transcript variant 1, mRNA. 3440630 NM_03 1475.1 ESPN Homo sapiens espin (ESPN), mRNA. 2 11.08673 2.9583995 Homo sapiens UDP-N-acetyl-alpha-D- galactosamine:polypeptide N- 4490164 NM_007210.3 GALNT6 384.36667 2.8941383 acetylgalactosaminyltransferase 6 (GalNAc-T6) (GALNT6), mRNA. Homo sapiens defensin, beta 4 2120091 NM_004942.2 DEFB4 159.8674 2.8626171 (DEFB4), mRNA. Homo sapiens regulator of G-protein 4070215 NM_002926.3 RGS12 signaling 12 (RGS12), transcript 1167.2288 2.85851 variant 2, mRNA. Homo sapiens endoplasmic reticulum 3290008 NM_152461.2 ERN1 to nucleus signalling 1 (ERN1), 543.32979 2.8553203 transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1767.2189 2.8522127 3) (LTBR), mRNA. Homo sapiens interleukin 20 receptor, 6450482 NM_014432.2 IL20RA 218.07345 2.8459077 alpha (IL20RA), mRNA. Homo sapiens lipoprotein, Lp(a) 610291 NM_005577.2 LPA 170.23024 2.8406176 (LPA), mRNA. Homo sapiens protocadherin 1 5570053 NM_002587.3 PCDH1 179.30553 2.8107571 (PCDH1), transcript variant 1, mRNA. Homo sapiens extracellular matrix 3450521 NM_022664.1 ECMl protein 1 (ECMl), transcript variant 2, 1510.2886 2.8080108 mRNA. Homo sapiens ladinin 1 (LAD1), 3130082 NM_005558.3 LAD1 146.85383 2.779581 mRNA. Homo sapiens parathyroid hormone 1980593 NM_198964.1 PTHLH like hormone (PTHLH), transcript 510.18584 2.7723514 variant 3, mRNA. Homo sapiens kallikrein-related 2690647 NM_144947.1 KLK1 1 peptidase 11 (KLK1 1), transcript 188.84189 2.7562149 variant 2, mRNA. Homo sapiens transmembrane 5960091 NM_019894.2 TMPRSS4 protease, serine 4 (TMPRSS4), 220.58953 2.7496886 transcript variant 1, mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 1570435 NM_139057.2 ADAMTS17 191.56401 2.710937 type 1 motif, 17 (ADAMTS17), mRNA. transcript variant 1, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short 5080280 NM_198925.1 SEMA4B 1298.8016 2.3271338 cytoplasmic domain, (semaphorin) 4B (SEMA4B), transcript variant 2, mRNA. Homo sapiens laminin, gamma 2 2230594 NM_005562.1 LAMC2 845.37758 2.279901 (LAMC2), transcript variant 1, mRNA. Homo sapiens EROl-like (S. 4780671 NM_014584.1 EROIL 1742.771 1 2.219169 cerevisiae) (EROIL), mRNA. Homo sapiens Rho GTPase activating 6760482 NM_001017526.1 ARHGAP8 protein 8 (ARHGAP8), transcript 133.3205 2.1977826 variant 1, mRNA. Homo sapiens serpin peptidase 3310201 NM_006919.1 SERPINB3 inhibitor, clade B (ovalbumin), 119.73525 2.1943393 member 3 (SERPINB3), mRNA. Homo sapiens integrin, alpha 6 7570608 NM_000210.2 ITGA6 129.3205 2.1896498 (ITGA6), transcript variant 2, mRNA. Homo sapiens apolipoprotein A-I 1570725 NM_144772.1 APOA1BP 3378.2842 2.1818843 binding protein (APOA1BP), mRNA. Homo sapiens similar to CG12314 1980474 NM_178836.2 LOC201 164 137.58842 2.1773234 gene product (LOC201 164), mRNA. Homo sapiens poliovirus receptor 780524 NM_006505.2 PVR 503.12876 2.151 191 1 (PVR), mRNA. Homo sapiens interleukin 16 5080615 NM_172217.2 IL16 (lymphocyte chemoattractant factor) 184.95619 2.1385315 (IL16), transcript variant 2, mRNA. Homo sapiens ubiquitin specific 4830010 NM_032663.2 USP30 247.31401 2.1 120353 peptidase 30 (USP30), mRNA. Homo sapiens hypothetical protein 2490170 NM_017910.2 FLJ20628 470.7177 2.1103134 FLJ20628 (FLJ20628), mRNA. Homo sapiens palmitoyl-protein 1660575 NM_138717.1 PPT2 fhioesterase 2 (PPT2), transcript 269.19248 2.0992385 variant 2, mRNA. Homo sapiens DnaJ (Hsp40) homolog, 6560445 NM_005147.3 DNAJA3 subfamily A, member 3 (DNAJA3), 2825.2081 2.0858595 mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 441.06755 2.0832069 (CYP51A1), mRNA. Homo sapiens CD59 molecule, 1410201 NM_00061 1.4 CD59 complement regulatory protein 1343.6472 2.081539 (CD59), transcript variant 2, mRNA. Homo sapiens SRY (sex determining 1300445 NM_178424.1 SOX30 region Y)-box 30 (SOX30), transcript 137.40642 2.0755213 variant 1, mRNA. Homo sapiens ephrin-Bl (EFNB1), 4730019 NM_004429.3 EFNB1 438.1441 2.0714489 mRNA. Homo sapiens proprotein convertase 4070619 NM_174936.2 PCSK9 subtilisin/kexin type 9 (PCSK9), 196.39351 2.0590305 mRNA. Homo sapiens chemokine (C-C motif) 1340626 NM_002989.2 CCL21 128.46932 2.053963 ligand 2 1 (CCL21), mRNA. Homo sapiens core 1 synthase, glycoprotein-N-acetylgalactosamine 3- 580066 NM_020156.1 C1GALT1 322.35737 2.042385 beta-galactosyltransferase, 1 (C1GALT1), mRNA. Homo sapiens protein tyrosine 5870553 NM_1 30440.1 PTPRF phosphatase, receptor type, F (PTPRF), 1568.1714 2.0298879 transcript variant 2, mRNA. Homo sapiens interleukin 6 receptor 1780603 NM_000565.2 IL6R 115.19189 2.013546 (IL6R), transcript variant 1, mRNA.

CASM P5 Coronary artery smooth muscle Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave. Homo sapiens natriuretic peptide 4290040 NM_002521.2 NPPB 7171.9072 66.838889 precursor B (NPPB), mRNA. Homo sapiens CD14 molecule (CD14), 6370369 NM_001040021.1 CD14 4047.7358 37.535825 transcript variant 2, mRNA. Homo sapiens CD14 molecule (CD14), 7000369 NM_000591.2 CD14 1269.9537 20.016624 transcript variant 1, mRNA. Homo sapiens interleukin 6 (interferon, 4040576 NM_000600.1 IL6 10988.747 13.128694 beta 2) (IL6), mRNA. Homo sapiens sclerosteosis (SOST), 6370017 NM_025237.2 SOST 672.22434 12.124005 mRNA. Homo sapiens chemokine (C-X-C motif) ligand 6 (granulocyte 60192 NM_002993.2 CXCL6 7236.6257 12.061634 chemotactic protein 2) (CXCL6), mRNA. Homo sapiens serum amyloid Al 1690563 NM_199161.1 SAA1 1627.414 11.690382 (SAA1), transcript variant 2, mRNA. Homo sapiens osteoclast-associated 1820450 NM_133169.2 OSCAR receptor (OSCAR), transcript variant 984.05671 9.3842671 4, mRNA. Homo sapiens transmembrane 6 240653 NM_023003.2 TM6SF1 superfamily member 1 (TM6SF1), 1296.8947 8.0591586 mRNA. Homo sapiens bone morphogenetic 6980064 NM_001718.4 BMP6 827.93569 7.8599384 protein 6 (BMP6), mRNA. Homo sapiens protocadherin 10 5910093 NM_032961.1 PCDH10 (PCDH10), transcript variant 1, 1520.6078 7.6643879 mRNA. Homo sapiens chemokine (C-C motif) 6620121 NM_005623.2 CCL8 589.73289 7.6413288 ligand 8 (CCL8), mRNA. Homo sapiens serum amyloid Al 2600424 NM_000331.3 SAA1 506.69233 6.8864166 (SAA1), transcript variant 1, mRNA. Homo sapiens chemokine (C-C motif) 1030333 NM_002982.3 CCL2 16553.6 6.7384504 ligand 2 (CCL2), mRNA. Homo sapiens neurotrophin 3 (NTF3), 2940441 NM_002527.3 NTF3 1323.291 6.5009977 mRNA. Homo sapiens protocadherin 10 1580753 NM_020815.1 PCDH10 (PCDH10), transcript variant 2, 904.20575 6.3474139 mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1755.4426 6.1674067 (LY96), mRNA. Homo sapiens osteoclast associated, 150762 NM_1 3077 1.3 OSCAR immunoglobulin-like receptor 528.47773 6.0612187 (OSCAR), transcript variant 3, mRNA. Homo sapiens Clq and tumor necrosis 5090079 NM_198594.1 C1QTNF1 factor related protein 1 (C1QTNF1), 5173.7581 6.0603968 mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 4792.7671 5.3887829 mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 5129.8789 5.258241 cyclooxygenase) (PTGS1), transcript variant 2, mRNA. Homo sapiens platelet factor 4 variant 1410278 NM_002620.2 PF4V1 414.56165 5.1132604 1 (PF4V1), mRNA. Homo sapiens chemokine (C-C motif) 870603 NM_002986.2 CCL1 1 260.53466 4.7094757 ligand 11 (CCL1 1), mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 851.06298 4.6545708 cyclooxygenase) (PTGS1), transcript variant 1, mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 423.13525 4.6164035 (NAALADL1), mRNA. Homo sapiens tissue factor pathway 5080543 NM_006528.2 TFPI2 1583.3354 4.3554027 inhibitor 2 (TFPI2), mRNA. Homo sapiens complement component 4860494 NM_000064.1 C3 322.91608 4.3444371 3 (C3), mRNA. Homo sapiens slit homolog 2 4560592 NM_004787.1 SLIT2 1529.623 4.2177148 (Drosophila) (SLIT2), mRNA. Homo sapiens chemokine (C-C motif) 4610364 NM_006273.2 CCL7 241.14137 4.1008237 ligand 7 (CCL7), mRNA. Homo sapiens protease, serine, 3 5080139 NM_002771.2 PRSS3 376.31785 4.0519417 (mesotrypsin) (PRSS3), mRNA. Homo sapiens scrapie responsive 1110048 NM_007281.1 SCRG1 5268.8103 3.9821835 protein 1 (SCRG1), mRNA. Homo sapiens follistatin (FST), 6020286 NM_0 13409.1 FST 10564.173 3.9463366 transcript variant FST344, mRNA. Homo sapiens bone marrow stromal 6270681 NM_004334.1 BST1 481.6823 3.901307 cell antigen 1 (BST1), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 4042.2758 3.8441608 variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 770408 NM_000602.1 SERPINE1 18155.869 3.796504 activator inhibitor type 1), member 1 (SERPINE1), mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 1260040 NM_004105.3 EFEMP1 4859.9181 3.7883149 (EFEMP1), transcript variant 1, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 830.06947 3.7868062 c, mRNA. Homo sapiens chemokine (C-X-C motif) ligand 1 (melanoma growth 3400292 NM_00151 1.1 CXCL1 754.78776 3.786732 stimulating activity, alpha) (CXCL1), mRNA. PREDICTED: Homo sapiens 1510382 XM_938935.2 NXPH4 728.59779 3.7805663 neurexophilin 4 (NXPH4), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 393.72566 3.7520284 complexing protein 2) (DPP4), mRNA. Homo sapiens interleukin 8 (IL8), 1340743 NM_000584.2 IL8 11954.262 3.6881556 mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6250563 NM_004105.3 EFEMP1 2834.91 14 3.5692958 (EFEMP1), transcript variant 1, mRNA. Homo sapiens Clq and tumor necrosis 6180719 NM_198593.1 C1QTNF1 factor related protein 1 (C1QTNF1), 277.04056 3.5089605 transcript variant 2, mRNA. Homo sapiens chemokine (C-X-C 540377 NM_002994.3 CXCL5 332.25841 3.4298634 motif) ligand 5 (CXCL5), mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 243.18201 3.3542592 chromosome Y. Homo sapiens endofhelin 1 (EDN1), 7040386 NM_001955.2 EDN1 1750.8726 3.3043691 mRNA. Homo sapiens chemokine (C-X3-C 630521 NM_002996.3 CX3CL1 379.59336 3.2628767 motif) ligand 1 (CX3CL1), mRNA. Homo sapiens collagen, type XV, 5090026 NM_001855.3 COL15A1 2151.7122 3.1968777 alpha 1 (COL15A1), mRNA. Homo sapiens procollagen C- 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1757.9959 3.1531 174 (PCOLCE2), mRNA. Homo sapiens apolipoprotein A-I 4570364 NM_000039.1 APOA1 235.86932 3.1344836 (APOA1), mRNA. Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 839.94292 3.1191764 (Drosophila) (SLIT3), mRNA. Homo sapiens KIAA1 199 110181 NM_0 18689.1 KIAA1 199 6307.2208 3.1002318 (KIAA1 199), mRNA. Homo sapiens matrix Gla protein 1430487 NM_000900.2 MGP 11189.599 3.0892282 (MGP), mRNA. Homo sapiens collagen, type IV, alpha 6380066 NM_03 1365.2 COL4A3 3 (Goodpasture antigen) (COL4A3), 2 11.14189 3.0622325 transcript variant 5, mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 1128.9621 3.0125347 mRNA. Homo sapiens chemokine (C-X-C 4670390 NM_002089.3 CXCL2 264.18392 3.0039371 motif) ligand 2 (CXCL2), mRNA. Homo sapiens protein tyrosine 5870553 NM_1 30440.1 PTPRF phosphatase, receptor type, F (PTPRF), 2317.8257 3.0002627 transcript variant 2, mRNA. Homo sapiens fibrinogen-like 2 1430170 NM_006682.1 FGL2 723.01357 2.9725884 (FGL2), mRNA. Homo sapiens phospholipid 4120019 NM_020353.1 PLSCR4 1755.4426 2.9190657 scramblase 4 (PLSCR4), mRNA. Homo sapiens tumor necrosis factor receptor superfamily, member l i b 2370132 NM_002546.3 TNFRSF1 1B 2369.7824 2.9162255 (osteoprotegerin) (TNFRSF11B), mRNA. Homo sapiens prostaglandin- endoperoxide synthase 2 1820632 NM_000963.1 PTGS2 2190.0962 2.8862955 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 9483.5714 2.8089647 mRNA. Homo sapiens growth differentiation 5090671 NM_004864.1 GDF15 2303.9519 2.7846828 factor 15 (GDF15), mRNA. Homo sapiens cholesteryl ester transfer 7510079 NM_000078.1 CETP 322.59617 2.776744 protein, plasma (CETP), mRNA. Homo sapiens secreted frizzled-related 7330035 NM_003014.2 SFRP4 156.50133 2.7761552 protein 4 (SFRP4), mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6900408 NM_001039348.1 EFEMP1 12522.001 2.7400003 (EFEMP1), transcript variant 2, mRNA. Homo sapiens oxidized low density 7510132 NM_002543.3 OLR1 lipoprotein (lectin-like) receptor 1 443.44779 2.6774002 (OLR1), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1658.4625 2.6766848 3) (LTBR), mRNA. Homo sapiens peptidase inhibitor 16 6980129 NM_153370.2 PI16 539.25553 2.6593803 (PI16), mRNA. Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 540.45206 2.6428336 b, mRNA. Homo sapiens superoxide dismutase 3, 3890095 NM_003102.2 SOD3 290.19749 2.61239 extracellular (SOD3), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARID ID interactive domain ID (JARID1D), 172.60155 2.5680662 mRNA. Homo sapiens chloride intracellular 5870136 NM_004669.2 CLIC3 "767.44602 2.5643226 channel 3 (CLIC3), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 13933.806 2.5487765 mRNA. Homo sapiens CUG triplet repeat, 5390575 NM_006561.2 CUGBP2 RNA binding protein 2 (CUGBP2), 170.90627 2.5032647 transcript variant 2, mRNA. Homo sapiens cathepsin F (CTSF), 3930020 NM_003793.2 CTSF 410.66327 2.4706681 mRNA. Homo sapiens cadherin 13, H-cadherin 5820563 NM_001257.3 CDH13 1633.3558 2.469738 (heart) (CDH13), mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-1 beta (PTX3), 390.4528 2.459789 mRNA. Homo sapiens CD58 molecule (CD58), 5900594 NM_001779.1 CD58 1275.4841 2.4408937 mRNA. Homo sapiens chemokine (C-C motif) 7100646 NM_006274.2 CCL19 164.13968 2.4227724 ligand 19 (CCL19), mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 5080192 NM_006216.2 SERPINE2 28908.1 2.416744 activator inhibitor type 1), member 2 (SERPINE2), mRNA. Homo sapiens poliovirus receptor 780524 NM_006505.2 PVR 557.64395 2.3842777 (PVR), mRNA. Homo sapiens transferrin receptor 2940435 NM_003234.1 TFRC 4535.774 2.3773135 (p90, CD71) (TFRC), mRNA. Homo sapiens chemokine (C-C motif) 4220246 NM_004591.1 CCL20 496.38451 2.364148 ligand 20 (CCL20), mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 455.83997 2.3582423 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1385.4235 2.350567 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens immediate early 1190367 NM_003897.3 IER3 9694.0142 2.3504632 response 3 (IER3), mRNA. Homo sapiens neurexophilin 4 4540458 NM_007224.1 NXPH4 225.17552 2.3489836 (NXPH4), mRNA. Homo sapiens endoplasmic reticulum 3290008 NM_152461.2 ERN1 to nucleus signalling 1 (ERN1), 445.53938 2.3414097 transcript variant 2, mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 998.93658 2.3350266 mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 8218.4366 2.2860013 mRNA. Homo sapiens nucleobindin 2 60427 NM_005013.2 NUCB2 2400.2919 2.2420287 (NUCB2), mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 1907.9462 2.2365562 variant 1, mRNA. Homo sapiens arylsulfatase B (ARSB), 6900309 NM_000046.2 ARSB 272.84897 2.2303231 transcript variant 1, mRNA. Homo sapiens TIMP metallopeptidase inhibitor 3 (Sorsby fundus dystrophy, 2030577 NM_000362.4 TPMP3 9818.0367 2.1498827 pseudoinflammatory) (TEVIP3), mRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 1079.3475 2.1093104 transcript variant 2, mRNA. Homo sapiens frizzled homolog 4 620255 NM_012193.2 FZD4 1040.4938 2.1010062 (Drosophila) (FZD4), mRNA. Homo sapiens vitronectin (VTN), 1090008 NM_000638.3 VTN 125.18717 2.0974243 mRNA. Homo sapiens protein tyrosine 16071 1 NM_002837.2 PTPRB phosphatase, receptor type, B 253.35 2.0933499 (PTPRB), mRNA. Homo sapiens opioid receptor, sigma 1 510136 NM_147157.1 OPRS1 364.4694 2.0795481 (OPRS1), transcript variant 2, mRNA. Homo sapiens carbonic anhydrase XII 3830075 NM_001218.3 CA12 655.4205 2.067209 (CA12), transcript variant 1, mRNA. Homo sapiens pregnancy-associated 730754 NM_002581.3 PAPPA plasma protein A, pappalysin 1 5678.9069 2.0578772 (PAPPA), mRNA. Homo sapiens lipocalin 1 (tear 2600215 NM_002297.2 LCN1 138.31704 2.0440487 prealbumin) (LCN1), mRNA. Homo sapiens brain-derived 7330241 NM_001709.3 BDNF neurotrophic factor (BDNF), transcript 1118.7529 2.0177256 variant 4, mRNA. Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, 2000646 NM_003778.3 B4GALT4 1340.3479 2.016149 polypeptide 4 (B4GALT4), transcript variant 2, mRNA. Homo sapiens chemokine (C-C motif) 4280301 NM_006072.4 CCL26 228.5323 2.0138542 ligand 26 (CCL26), mRNA.

NHEM P5 Neonatal normal human epidermal melanocytes Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave. Homo sapiens silver homolog (mouse) 2320373 NM_006928.3 SILV 30909.262 150.42945 (SILV), mRNA. Homo sapiens brevican (BCAN), 2100446 NM_021948.3 BCAN 6319.9429 88.835615 transcript variant 1, mRNA.

Homo sapiens guanine nucleotide 1300139 NM_052847.2 GNG7 binding protein (G protein), gamma 7 946.02758 7.0752501 (GNG7), mRNA. Homo sapiens immunoglobulin 4230608 NM_001542.2 IGSF3 superfamily, member 3 (IGSF3), 683.24971 6.2657874 transcript variant 1, mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 4762.4075 6.0440149 (APOD), mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 524.93038 5.7269879 (NAALADL1), mRNA. Homo sapiens surfactant, pulmonary- 510561 NM_003018.2 SFTPC 322.49993 5.705271 1 associated protein C (SFTPC), mRNA. Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, 6290356 NM_002615.4 SERPINF1 3985.9645 5.3450073 pigment epithelium derived factor), member 1 (SERPFNF1), mRNA. Homo sapiens plexin Bl (PLXNB1), 6330438 NM_002673.3 PLXNB1 1364.4086 5.247092 mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARID1D), 348.94499 5.1918064 mRNA. Homo sapiens apolipoprotein E 730414 NM_000041.2 APOE 12862.586 5.1810702 (APOE), mRNA. Homo sapiens delta-like 3 4210382 NM_0 16941.2 DLL3 (Drosophila) (DLL3), transcript variant 1055.9224 5.1619079 1, mRNA. Homo sapiens spectrin repeat 160121 NM_015180.4 SYNE2 containing, nuclear envelope 2 469.45133 4.9545167 (SYNE2), transcript variant 1, mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1380.69 4.8507863 (LY96), mRNA. Homo sapiens olfactomedin 1 2680072 NM_014279.4 OLFMl 696.6056 4.4546941 (OLFMl), transcript variant 1, mRNA. Homo sapiens glycogenin 2 (GYG2), 4070241 NM_003918.2 GYG2 2366.3355 4.3869918 transcript variant 2, mRNA. Homo sapiens phospholipase Al 3400307 NM_015900.1 PLA1A 295.42788 4.2126015 member A (PLA1A), mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 920.10059 4.1975314 c, mRNA. Homo sapiens neurotrophin 3 (NTF3), 2940441 NM_002527.3 NTF3 846.04351 4.1564001 mRNA. Homo sapiens CUG triplet repeat, 2320162 NM_001025076.2 CUGBP2 RNA binding protein 2 (CUGBP2), 284.99779 4.1462103 transcript variant 1, mRNA. Homo sapiens trefoil factor 3 7570484 NM_003226.2 TFF3 504.98643 4.0401524 (intestinal) (TFF3), mRNA. Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 4260482 NM_001005915.1 ERBB3 235.1823 3.9782157 (avian) (ERBB3), transcript variant s, mRNA. Homo sapiens similar to hypothetical 770156 NM_203422.1 LOC221091 292.46873 3.8925174 protein (LOC221091), mRNA. Homo sapiens interleukin 16 5080615 NM_172217.2 IL16 (lymphocyte chemoattractant factor) 325.37153 3.7620653 (IL16), transcript variant 2, mRNA.

Homo sapiens alpha-2-HS- 2320377 NM_001622.1 AHSG 231.33282 2.661872 glycoprotein (AHSG), mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1157.0389 2.655526 mRNA. Homo sapiens glycogenin 2 (GYG2), 4830451 NM_003918.1 GYG2 3 11.13304 2.640645 mRNA. Homo sapiens CD44 molecule (Indian 360719 NM_000610.3 CD44 blood group) (CD44), transcript variant 204.51527 2.6222939 1, mRNA. Homo sapiens golgi associated, gamma 2190121 NM_015044.3 GGA2 adaptin ear containing, ARF binding 1019.0553 2.6140341 protein 2 (GGA2), mRNA. Homo sapiens neurturin (NRTN), 5310468 NM_004558.2 NRTN 169.68186 2.5557544 mRNA. Homo sapiens FK506 binding protein 4150753 NM_017946.2 FKBP14 2487.3723 2.5307646 14, 22 kDa (FKBP14), mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 FLU) interacting protein 1 (LRRFIPl), 3093.5619 2.4633343 mRNA. Homo sapiens cysteine sulfinic acid 2810255 NM_015989.3 CSAD 830.39808 2.460291 decarboxylase (CSAD), mRNA. Homo sapiens CUG triplet repeat, 7400133 NM_001025077.2 CUGBP2 RNA binding protein 2 (CUGBP2), 158.5559 2.4542622 transcript variant 3, mRNA. Homo sapiens biotinidase (BTD), 1410091 NM_000060.2 BTD 709.80885 2.4514681 mRNA. Homo sapiens Sin3A-associated 1780673 NM_003864.3 SAP30 1432.9788 2.4478544 protein, 30kDa (SAP30), mRNA. Homo sapiens CD44 molecule (Indian 4560193 NM_001001392.1 CD44 blood group) (CD44), transcript variant 3170.1951 2.4334635 5, mRNA. Homo sapiens ATP-binding cassette, 4890609 NM_000033.2 ABCD1 sub-family D (ALD), member 1 422.92965 2.4137489 (ABCD1), mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1177.0888 2.3899655 9, mRNA. Homo sapiens spectrin repeat 10634 NM_015180.4 SYNE2 containing, nuclear envelope 2 159.94351 2.3885935 (SYNE2), transcript variant 1, mRNA. Homo sapiens cartilage associated 6770168 NM_006371.3 CRTAP 870.78068 2.3866975 protein (CRTAP), mRNA. Homo sapiens dipeptidyl-peptidase 7 670608 NM_013379.2 DPP7 815.57035 2.3850756 (DPP7), mRNA. Homo sapiens AU RNA binding protein/enoyl-Coenzyme A hydratase 7330180 NM_001698.1 AUH 630.57788 2.3818598 (AUH), nuclear gene encoding mitochondrial protein, mRNA. Homo sapiens TBC1 domain family, 7160707 NM_020773.1 TBC1D14 1876.8382 2.3649594 member 14 (TBC1D14), mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 170.41 187 2.3505258 chromosome Y. Homo sapiens syntaxin binding protein 7550022 NM_1 39244.2 STXBP5 873.16386 2.3344232 5 (tomosyn) (STXBP5), mRNA. Homo sapiens cartilage acidic protein 1660075 NM_018058.4 CRTAC1 321.2017 2.3307691 1 (CRTAC1), mRNA.

Homo sapiens cathepsin H (CTSH), 1980288 NM_004390.2 CTSH 804.9292 2.0662116 transcript variant 1, mRNA. Homo sapiens CD59 molecule, 1430240 NM_203331.1 CD59 complement regulatory protein 234.99218 2.0657562 (CD59), transcript variant 4, mRNA. Homo sapiens leptin (obesity homolog, 840309 NM_000230.1 LEP 379.031 12 2.0643368 mouse) (LEP), mRNA. Homo sapiens chromosome 6 open 2070543 NM_025258.2 C6orf27 133.65546 2.0453351 reading frame 27 (C6orf27), mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 1872.2652 2.0292354 (ANG), transcript variant 2, mRNA. Homo sapiens CD44 molecule (Indian 5860152 NM_001001391.1 CD44 blood group) (CD44), transcript variant 15513.492 2.0056941 4, mRNA.

NHBE Normal human bronchial epithelial cells Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens lipocalin 2 (LCN2), 4390398 NM_005564.3 LCN2 26475.669 182.96636 mRNA. Homo sapiens lectin, galactoside- 4220463 NM_002307.1 LGALS7 binding, soluble, 7 (galectin 7) 17105.808 156.69745 (LGALS7), mRNA. Homo sapiens secretory leukocyte 2140707 NM_003064.2 SLPI 21045.352 143.97952 peptidase inhibitor (SLPI), mRNA. 3710040 NM_006142.3 SFN Homo sapiens stratifin (SFN), mRNA. 14006.772 133.42831 Homo sapiens kallikrein-related 5900008 NM_144947.1 KLK1 1 peptidase 11 (KLK1 1), transcript 11766.594 127.27679 variant 2, mRNA. Homo sapiens peptidase inhibitor 3, 1050168 NM_002638.2 PI3 13663.985 119.78412 skin-derived (SKALP) (PI3), mRNA. Homo sapiens serpin peptidase 6290707 NM_002639.3 SERPINB5 inhibitor, clade B (ovalbumin), 11067.226 115.48853 member 5 (SERPINB5), mRNA. Homo sapiens Ly6/neurotoxin 1 1850541 NM_177458.1 LYNX1 (LYNX1), transcript variant SLURP2, 5428.6664 81.039785 mRNA. Homo sapiens collagen, type XVII, 990372 NM_000494.3 COL17A1 7866.0223 75.55094 alpha 1 (COL17A1), mRNA. Homo sapiens ladinin 1 (LAD1), 1170349 NM_005558.3 LAD1 12210.763 68.225242 mRNA. Homo sapiens interleukin 1 receptor 7510386 NM_173843.1 IL1RN antagonist (IL1RN), transcript variant 5811.9761 61.595754 4, mRNA. Homo sapiens kallikrein-related 6020139 NM_005046.2 KLK7 peptidase 7 (KLK7), transcript variant 7601.3891 59.187353 1, mRNA. Homo sapiens kallikrein-related 4050398 NM_019598.2 KLK12 peptidase 12 (KLK12), transcript 4136.5906 59.161367 variant 1, mRNA. Homo sapiens mesofhelin (MSLN), 1230228 NM_013404.3 MSLN 5728.7796 53.262145 transcript variant 2, mRNA. Homo sapiens kallikrein-related 3170687 NM_012427.4 KLK5 peptidase 5 (KLK5), transcript variant 4608.6774 43.764268 1, mRNA. Homo sapiens laminin, alpha 3 6480592 NM_198129.1 LAMA3 3945.9257 40.451696 (LAMA3), transcript variant 1, mRNA. Homo sapiens collagen, type XVII, 2120270 NM_000494.3 COL17A1 2563.1639 36.44536 alpha 1 (COL17A1), mRNA. Homo sapiens protease, serine, 3 5080139 NM_002771.2 PRSS3 3229.3389 34.771386 (mesotrypsin) (PRSS3), mRNA. Homo sapiens kallikrein-related 3840010 NM_007196.2 KLK8 peptidase 8 (KLK8), transcript variant 1932.1664 29.158738 1, mRNA. Homo sapiens kallikrein-related 5960192 NM_002776.4 KLK10 peptidase 10 (KLK10), transcript 2131.2603 28.923042 variant 1, mRNA. Homo sapiens family with sequence 6100537 NM_138805.2 FAM3D similarity 3, member D (FAM3D), 1667.773 27.278098 mRNA. Homo sapiens transcobalamin I 1770603 NM_001062.3 TCN1 (vitamin B12 binding protein, R binder 4991.946 27.19211 1 family) (TCN1), mRNA. Homo sapiens chloride intracellular 5870136 NM_004669.2 CLIC3 7712.591 25.770635 channel 3 (CLIC3), mRNA. Homo sapiens ribonuclease, RNase A 1190131 NM_032572.2 RNASE7 1532.7547 25.541422 family, 7 (RNASE7), mRNA. Homo sapiens cytochrome P450, 4860307 NM_000772.1 CYP2C18 family 2, subfamily C, polypeptide 18 1413.946 24.391447 (CYP2C18), mRNA. Homo sapiens kallikrein-related 6660274 NM_001077491.1 KLK5 peptidase 5 (KLK5), transcript variant 2170.667 23.125312 2, mRNA. Homo sapiens protease, serine, 8 7210139 NM_002773.3 PRSS8 3029.3926 22.313674 (PRSS8), mRNA. Homo sapiens laminin, beta 3 730040 NM_000228.2 LAMB3 6691.4562 21.541957 (LAMB3), transcript variant 1, mRNA. Homo sapiens parathyroid hormone 6900414 NM_198965.1 PTHLH like hormone (PTHLH), transcript 6282.8029 20.436594 variant 1, mRNA. Homo sapiens serine peptidase 6380707 NM_006846.2 SPINK5 inhibitor, Kazal type 5 (SPINK5), 1604.7544 20.201474 mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 6940.3176 19.943137 (plasma) (GPX3), mRNA. Homo sapiens laminin, alpha 3 2650612 NM_198129.1 LAMA3 1435.9038 19.005823 (LAMA3), transcript variant 1, mRNA. Homo sapiens crumbs homolog 3 7400524 NM_139161.2 CRB3 (Drosophila) (CRB3), transcript 1933.3575 18.698489 variant 2, mRNA. Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 5700753 NM_001024912.1 CEACAM1 1162.8928 18.228723 1 (biliary glycoprotein) (CEACAM1), transcript variant 2, mRNA. Homo sapiens parathyroid hormone 1980593 NM_198964.1 PTHLH like hormone (PTHLH), transcript 3271.4245 17.77693 variant 3, mRNA. Homo sapiens folate receptor 3 4010181 NM_000804.2 FOLR3 1346.1904 17.005044 (gamma) (FOLR3), mRNA. Homo sapiens kallikrein-related 7050047 NM_019598.2 KLK12 peptidase 12 (KLK12), transcript 896.58274 16.498271 variant 1, mRNA. Homo sapiens FXYD domain 5390240 NM_021910.1 FXYD3 containing ion transport regulator 3 919.36047 16.452024 (FXYD3), transcript variant 2, mRNA. Homo sapiens ephrin-Al (EFNA1), 3710397 NM_004428.2 EFNA1 4792.7671 16.032321 transcript variant 1, mRNA. Homo sapiens serine peptidase 5860767 NM_003710.3 SPINT1 inhibitor, Kunitz type 1 (SPFNT1), 1430.4366 15.42897 transcript variant 2, mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 IL1RL1 like 1 (ILIRLI), transcript variant 2, 1540.5871 14.867696 mRNA. Homo sapiens cafhelicidin 5860075 NM_004345.3 CAMP antimicrobial peptide (CAMP), 806.75243 13.430157 mRNA. Homo sapiens transforming growth 6660435 NM_003236.1 TGFA 1548.21 12 13.179935 factor, alpha (TGFA), mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 11148.021 13.06807 variant 1, mRNA. Homo sapiens wingless-type MMTV 3870131 NM_004625.3 WNT7A integration site family, member 7A 768.44609 12.723827 (WNT7A), mRNA. Homo sapiens serpin peptidase 6350209 NM_002575.1 SERPINB2 inhibitor, clade B (ovalbumin), 1526.7754 12.623808 member 2 (SERPFNB2), mRNA. Homo sapiens transmembrane 5960091 NM_019894.2 TMPRSS4 protease, serine 4 (TMPRSS4), 1010.7487 12.599166 transcript variant 1, mRNA. Homo sapiens integrin, beta 4 3940132 NM_001005619.1 ITGB4 2032.2955 12.020085 (ITGB4), transcript variant 2, mRNA. Homo sapiens fibroblast growth factor receptor 3 (achondroplasia, 6520139 NM_022965.1 FGFR3 4509.0335 11.895289 thanatophoric dwarfism) (FGFR3), transcript variant 2, mRNA. Homo sapiens integrin, beta 4 1570598 NM_001005731.1 ITGB4 1480.5074 11.889115 (ITGB4), transcript variant 3, mRNA. Homo sapiens WAP four-disulfide 6940598 NM_145652.2 WFDC5 662.66615 11.514801 core domain 5 (WFDC5), mRNA. Homo sapiens ephrin-Al (EFNA1), 3390187 NM_004428.2 EFNA1 1026.799 11.150343 transcript variant 1, mRNA. Homo sapiens cafhepsin L2 (CTSL2), 1430477 NM_001333.2 CTSL2 2402.232 11.074938 mRNA. Homo sapiens F l l receptor (FUR), 3850561 NM_144504.1 F R 1233.7055 10.994496 transcript variant 5, mRNA. Homo sapiens mucin 20, cell surface 3400097 NM_001098516.1 MUC20 associated (MUC20), transcript variant 767.15472 10.900319 S, mRNA. Homo sapiens syndecan 1 (SDC1), 6590592 NM_001006946.1 SDC1 9143.5302 10.385212 transcript variant 1, mRNA. Homo sapiens crumbs homolog 3 4670402 NM_174881.2 CRB3 (Drosophila) (CRB3), transcript 947.59425 10.309696 variant 3, mRNA. Homo sapiens defensin, beta 1 4920040 NM_005218.3 DEFB1 871.13717 9.8758036 (DEFB1), mRNA. Homo sapiens Rho guanine nucleotide 3850333 NM_015320.2 ARHGEF4 exchange factor (GEF) 4 (ARHGEF4), 1082.178 9.7779634 transcript variant 1, mRNA. Homo sapiens neuromedin U (NMU), 7050220 NM_006681.1 NMU 1191.4291 9.521 1089 mRNA. Homo sapiens fetuin B (FETUB), 1440377 NM_014375.2 FETUB 660.79204 9.3939386 mRNA. Homo sapiens prolactin-induced 4010519 NM_002652.2 PIP 805.55317 8.9686593 protein (PIP), mRNA. Homo sapiens regulator of G-protein 4070215 NM_002926.3 RGS12 signaling 12 (RGS12), transcript 3603.6146 8.8251495 variant 2, mRNA. Homo sapiens Cas-Br-M (murine) 3870471 NM_0121 16.2 CBLC ecotropic retroviral transforming 620.28496 8.7700374 sequence c (CBLC), mRNA. Homo sapiens laminin, gamma 2 4390100 NM_005562.1 LAMC2 9064.792 8.5225361 (LAMC2), transcript variant 1, mRNA. Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 4560288 NM_001982.2 ERBB3 836.81445 8.4999016 (avian) (ERBB3), transcript variant 1, mRNA. Homo sapiens cystatin E/M (CST6), 1070333 NM_001323.2 CST6 735.59639 8.2938028 mRNA. Homo sapiens dehydrogenase/reductase (SDR family) 630315 NM_005771.3 DHRS9 922.00929 7.7800814 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens immunoglobulin 7650767 NM_020789.2 IGSF9 superfamily, member 9 (IGSF9), 486.33142 7.4540396 mRNA. Homo sapiens kallikrein-related 1430603 NM_144505.1 KLK8 peptidase 8 (KLK8), transcript variant 437.67714 7.3771544 2, mRNA. Homo sapiens cathepsin H (CTSH), 1980288 NM_004390.2 CTSH 2865.1271 7.354633 transcript variant 1, mRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 IL1RL1 like 1 (ILIRLI), transcript variant 2, 693.99889 7.1643193 mRNA. PREDICTED: Homo sapiens cystatin 4010491 XM_001129442.1 CST6 654.39322 7.1560889 E M (CST6), mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 1022.2979 7.1280121 variant 1, mRNA. Homo sapiens kallikrein-related 6620427 NM_012427.4 KLK5 peptidase 5 (KLK5), transcript variant 449.79513 7.1200718 1, mRNA. Homo sapiens growth differentiation 5090671 NM_004864.1 GDF15 5769.5931 6.973447 factor 15 (GDF15), mRNA. Homo sapiens integrin, alpha 6 2140678 NM_000210.2 ITGA6 840.11549 6.8935233 (ITGA6), transcript variant 2, mRNA. Homo sapiens endofhelin 2 (EDN2), 6400598 NM_001956.2 EDN2 413.72788 6.6769166 mRNA. Homo sapiens mucin 1, cell surface 7650026 NM_001044391.1 MUC1 associated (MUC1), transcript variant 4852.0339 6.6129665 6, mRNA. Homo sapiens heparanase (HPSE), 630619 NM_006665.3 HPSE 427.81637 6.5078502 mRNA. 3440630 NM_03 1475.1 ESPN Homo sapiens espin (ESPN), mRNA. 454.19041 6.3655196 Homo sapiens sema domain, immunoglobulin domain (Ig), short 5690167 NM_004186.2 SEMA3F 878.6823 6.3213536 basic domain, secreted, (semaphorin) 3F (SEMA3F), mRNA.

Homo sapiens mucin 1, cell surface 7200601 NM_001044390.1 MUC1 associated (MUC1), transcript variant 1993.9407 6.1415164 5, mRNA. Homo sapiens F-box protein 2 4540215 NM_012168.4 FBX02 1028.0779 6.1040847 (FBX02), mRNA. Homo sapiens abhydrolase domain 2710070 NM_024794.1 ABHD9 658.51 143 6.0216668 containing 9 (ABHD9), mRNA. Homo sapiens carboxyl ester lipase 6650593 NM_001807.3 CEL (bile salt-stimulated lipase) (CEL), 706.34469 5.9102946 mRNA. Homo sapiens wingless-type MMTV 6840202 NM_030761.3 WNT4 integration site family, member 4 334.0042 5.8727631 (WNT4), mRNA. Homo sapiens laminin, gamma 2 2230594 NM_005562.1 LAMC2 2121.2653 5.7208461 (LAMC2), transcript variant 1, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short 5080280 NM_198925.1 SEMA4B 3141.171 5.6282076 cytoplasmic domain, (semaphorin) 4B (SEMA4B), transcript variant 2, mRNA. Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 2970286 NM_001024912.1 CEACAM1 772.18097 5.6125613 1 (biliary glycoprotein) (CEACAM1), transcript variant 2, mRNA. Homo sapiens biliverdin reductase B 6620521 NM_000713.1 BLVRB (flavin reductase (NADPH)) 1378.2183 5.5066382 (BLVRB), mRNA. Homo sapiens poliovirus receptor- 1430332 NM_030916.1 PVRL4 318.89358 5.4807557 related 4 (PVRL4), mRNA. Homo sapiens serine peptidase 1710468 NM_003710.3 SPINT1 inhibitor, Kunitz type 1 (SPINT1), 364.68577 5.4241339 transcript variant 2, mRNA. Homo sapiens placental growth factor 1940438 NM_002632.4 PGF 680.15295 5.1812351 (PGF), mRNA. Homo sapiens wingless-type MMTV 1500500 NM_058238.1 WNT7B integration site family, member 7B 380.79314 5.0519515 (WNT7B), mRNA. Homo sapiens serpin peptidase 6860424 NM_002974.2 SERPINB4 inhibitor, clade B (ovalbumin), 252.81549 5.0127363 member 4 (SERPINB4), mRNA.

Homo sapiens Notch homolog 1, 5080167 NM_017617.3 NOTCH 1 translocation-associated (Drosophila) 1939.6904 5.0025702 (NOTCH 1), mRNA. Homo sapiens hypothetical protein 3190121 NM_177964.3 LOC130576 579.1413 4.9061371 LOC130576 (LOC130576), mRNA. Homo sapiens mucin 15, cell surface 3850451 NM_145650.2 MUC15 286.43466 4.81 1221 associated (MUC15), mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 868.04351 4.735388 variant 1, mRNA. Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral 1050671 NM_005228.3 EGFR 1735.7001 4.6955552 (v-erb-b) oncogene homolog, avian) (EGFR), transcript variant 1, mRNA. Homo sapiens ADAM metallopeptidase domain 15 3440452 NM_207 195.1 ADAM 15 11906.849 4.6462117 (ADAM15), transcript variant 4, mRNA. Homo sapiens dehydrogenase/reductase (SDR family) 7160468 NM_005771.3 DHRS9 320.33835 4.6285434 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens extracellular matrix 3450521 NM_022664.1 ECM1 protein 1 (ECM1), transcript variant 2, 2471.569 4.5952756 mRNA. Homo sapiens FXYD domain 2060687 NM_005971.2 FXYD3 containing ion transport regulator 3 261.91431 4.5631556 (FXYD3), transcript variant 1, mRNA. Homo sapiens engulfment and cell 4920121 NM_024712.3 ELM03 365.121 17 4.5108903 motility 3 (ELM03), mRNA. Homo sapiens poliovirus receptor- related 1 (herpesvirus entry mediator 1740592 NM_203286.1 PVRL1 366.3205 4.4889293 C) (PVRLl), transcript variant 3, mRNA. Homo sapiens immunoglobulin 2900674 NM_001542.2 IGSF3 superfamily, member 3 (IGSF3), 1926.0969 4.4661966 transcript variant 1, mRNA. Homo sapiens 1070400 NM_153282.1 HYAL1 hyaluronoglucosaminidase 1 470.08156 4.4429797 (HYAL1), transcript variant 2, mRNA. Homo sapiens serpin peptidase 3310201 NM_006919.1 SERPINB3 inhibitor, clade B (ovalbumin), 239.49889 4.389199 member 3 (SERPFNB3), mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1222.628 4.2954661 (LY96), mRNA. Homo sapiens retinol dehydrogenase 1300187 NM_138412.2 RDH13 789.74639 4.2891653 13 (all-trans/9-cis) (RDH13), mRNA. Homo sapiens phospholipase A2, 2600170 NM_003561.1 PLA2G10 284.14086 4.2835877 group X (PLA2G10), mRNA. Homo sapiens ADAM metallopeptidase domain 15 1980553 NM_003815.3 ADAM 15 1106.6904 4.1967026 (ADAM15), transcript variant 2, mRNA. Homo sapiens GM2 ganglioside 4280273 NM_000405.3 GM2A 782.23171 4.1891468 activator (GM2A), mRNA. Homo sapiens matrix metallopeptidase 7100338 NM_001032278.1 MMP28 28 (MMP28), transcript variant 3, 649.84513 4.109251 mRNA. Homo sapiens serine peptidase 2260326 NM_003122.2 SPINK1 inhibitor, Kazal type 1 (SPINK1), 334.0042 4.0439376 mRNA. Homo sapiens sterol regulatory element binding transcription factor 1 3390343 NM_001005291.1 SREBF1 1090.0174 3.8756978 (SREBFl), transcript variant 1, mRNA. Homo sapiens sulfide quinone 6770707 NM_02 1199.2 SQRDL reductase-like (yeast) (SQRDL), 1104.6907 3.870897 mRNA. Homo sapiens protein tyrosine 5870553 NM_1 30440.1 PTPRF phosphatase, receptor type, F (PTPRF), 2962.891 3.8352546 transcript variant 2, mRNA. Homo sapiens CD14 molecule (CD14), 6370369 NM_001040021.1 CD14 405.43186 3.7596869 transcript variant 2, mRNA. Homo sapiens hypothetical protein 4730242 NM_175885.3 MGC33846 217.29742 3.6866528 MGC33846 (MGC33846), mRNA. Homo sapiens defensin, beta 123 5670162 NM_153324.2 DEFB123 245.27869 3.5596164 (DEFB123), mRNA. Homo sapiens coxsackie virus and 870161 NM_001338.3 CXADR adenovirus receptor (CXADR), 1144.927 3.5244946 mRNA. Homo sapiens carboxypeptidase M 2510152 NM_001005502.1 CPM 255.74749 3.5163503 (CPM), transcript variant 3, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 760.63805 3.4700577 c, mRNA. Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 3120608 NM_001005915.1 ERBB3 288.79919 3.4610206 (avian) (ERBB3), transcript variant s, mRNA. Homo sapiens transmembrane 7320753 NM_183247.1 TMPRSS4 protease, serine 4 (TMPRSS4), 205.75177 3.450961 1 transcript variant 2, mRNA. Homo sapiens interleukin 6 receptor 5870685 NM_000565.2 IL6R 190.38142 3.4354518 (IL6R), transcript variant 1, mRNA. Homo sapiens carbonic anhydrase XII 150474 NM_001218.3 CA12 4329.1768 3.406555 (CA12), transcript variant 1, mRNA. Homo sapiens interleukin 1 family, 1240528 NM_173170.1 IL1F5 member 5 (delta) (IL1F5), transcript 200.87109 3.3871458 variant 2, mRNA. Homo sapiens acid phosphatase 5, 7050082 NM_00161 1.2 ACP5 332.06077 3.3533212 tartrate resistant (ACP5), mRNA. Homo sapiens protease, serine, 2 2690452 NM_002770.2 PRSS2 (trypsin 2) (PRSS2), transcript variant 232.92065 3.3497684 1, mRNA. Homo sapiens 24-dehydrocholesterol 4480341 NM_014762.3 DHCR24 1309.6802 3.3345305 reductase (DHCR24), mRNA. Homo sapiens microseminoprotein, 5900368 NM_002443.2 MSMB beta- (MSMB), transcript variant 172.45634 3.3170342 PSP94, mRNA. Homo sapiens gelsolin (amyloidosis, 3940204 NM_000177.3 GSN Finnish type) (GSN), transcript variant 313.71232 3.2572461 1, mRNA. Homo sapiens D site of albumin 7050458 NM_001352.2 DBP promoter (albumin D-box) binding 412.89292 3.2551438 protein (DBP), mRNA. Homo sapiens kallikrein-related 2970154 NM_001012964.1 KLK6 peptidase 6 (KLK6), transcript variant 227.67743 3.2517256 B, mRNA. Homo sapiens hydroxysteroid (17- 1450397 NM_014234.3 HSD17B8 beta) dehydrogenase 8 (HSD17B8), 703.41047 3.2157958 mRNA. Homo sapiens interleukin 28 receptor, 3520398 NM_170743.2 IL28RA alpha (interferon, lambda receptor) 230.63717 3.1856145 (IL28RA), transcript variant 1, mRNA. Homo sapiens immunoglobulin 4230608 NM_001542.2 IGSF3 superfamily, member 3 (IGSF3), 343.22714 3.1475876 transcript variant 1, mRNA. Homo sapiens protein tyrosine 3060398 NM_002840.3 PTPRF phosphatase, receptor type, F (PTPRF), 5598.9233 3.142478 transcript variant 1, mRNA. Homo sapiens transmembrane 130324 NM_005656.2 TMPRSS2 protease, serine 2 (TMPRSS2), 207.65324 3.1137628 mRNA. Homo sapiens interleukin 6 receptor 1780603 NM_000565.2 IL6R 177.97522 3.1109942 (IL6R), transcript variant 1, mRNA. Homo sapiens wingless-type MMTV 2710343 NM_025216.2 WNT10A integration site family, member 10A 201.64358 3.1089036 (WNT10A), mRNA. Homo sapiens lipase, endothelial 7210681 NM_006033.2 LIPG 626.3761 1 3.1045914 (LIPG), mRNA. Homo sapiens CD44 molecule (Indian 360719 NM_000610.3 CD44 blood group) (CD44), transcript variant 238.459 3.0575203 1, mRNA. Homo sapiens T-box 1 (TBX1), 460575 NM_080647.1 TBX1 263.86335 3.0454555 transcript variant C, mRNA. Homo sapiens glypican 5 (GPC5), 5910491 NM_004466.3 GPC5 234.99218 3.0242297 mRNA. Homo sapiens integrin, alpha 6 7570608 NM_000210.2 ITGA6 177.97522 3.0134697 (ITGA6), transcript variant 2, mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 217.52824 3.00041 16 chromosome Y. Homo sapiens mucin 1, cell surface 520128 NM_002456.4 MUC1 associated (MUC1), transcript variant 234.15715 2.9594641 1, mRNA. Homo sapiens nudix (nucleoside 110092 NM_177533.2 NUDT14 diphosphate linked moiety X)-type 2006.7158 2.9399264 motif 14 (NUDT14), mRNA. Homo sapiens acid phosphatase, 2680725 NM_001099.2 ACPP 210.5171 1 2.9313669 prostate (ACPP), mRNA. Homo sapiens pregnancy specific beta- 4900561 NM_006905.2 PSG1 222.1236 2.91 10926 1-glycoprotein 1 (PSG1), mRNA. Homo sapiens serum amyloid A4, 3710022 NM_006512.1 SAA4 180.40177 2.8710248 constitutive (SAA4), mRNA. Homo sapiens EROl-like (S. 4780671 NM_014584.1 EROIL 2254.5395 2.8708328 cerevisiae) (EROIL), mRNA. Homo sapiens surfactant, pulmonary- 6510270 NM_003019.4 SFTPD 231.95664 2.8684039 associated protein D (SFTPD), mRNA. Homo sapiens cafhepsin H (CTSH), 4670162 NM_004390.3 CTSH 232.66445 2.8446854 transcript variant 1, mRNA. Homo sapiens calcium/calmodulin- 940747 NM_020439.2 CAMK1G dependent protein kinase IG 283.93909 2.8270591 (CAMK1G), mRNA. Homo sapiens pregnancy specific beta- 4210500 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 739.46873 2.7741 191 variant 1, mRNA. Homo sapiens carbonic anhydrase XII 3830075 NM_001218.3 CA12 878.3208 2.7702408 (CA12), transcript variant 1, mRNA. Homo sapiens secretoglobin, family 6840154 NM_002407.1 SCGB2A1 148.89506 2.7679509 2A, member 1 (SCGB2A1), mRNA. Homo sapiens Notch homolog 3 2340692 NM_000435.1 NOTCH3 1597.322 2.7182867 (Drosophila) (NOTCH3), mRNA. Homo sapiens dickkopf homolog 4 7040100 NM_014420.2 DKK4 150.53901 2.686976 (Xenopus laevis) (DKK4), mRNA. Homo sapiens spectrin repeat 160121 NM_015180.4 SYNE2 containing, nuclear envelope 2 254.49204 2.6858696 (SYNE2), transcript variant 1, mRNA. Homo sapiens Fl l receptor (FUR), 50307 NM_016946.3 F R 182.75361 2.631 1864 transcript variant 1, mRNA. Homo sapiens laminin, gamma 2 4150725 NM_0 1889 1.1 LAMC2 236.3733 2.6278956 (LAMC2), transcript variant 2, mRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 1341.6586 2.6219307 transcript variant 2, mRNA.

Homo sapiens protein phosphatase 1, 1230068 NM_006242.3 PPP1R3D regulatory (inhibitor) subunit 3D 408.21608 2.5704246 (PPP1R3D), mRNA. Homo sapiens matrix metallopeptidase 150180 NM_002425.1 MMP10 595.2028 2.5680915 10 (stromelysin 2) (MMP10), mRNA. Homo sapiens sterol regulatory element binding transcription factor 1 6840044 NM_004176.3 SREBF1 337.45649 2.5586771 (SREBFl), transcript variant 2, mRNA. Homo sapiens secretoglobin, family 2000292 NM_052863.2 SCGB3A1 154.27456 2.5540489 3A, member 1 (SCGB3A1), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARID ID interactive domain ID (JARID1D), 170.08982 2.5306953 mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1567.2895 2.5295356 3) (LTBR), mRNA. Homo sapiens endoplasmic reticulum 3290008 NM_152461.2 ERN1 to nucleus signalling 1 (ERN1), 478.42906 2.5142523 transcript variant 2, mRNA. Homo sapiens tumor necrosis factor receptor superfamily, member 25 3990224 NM_148973.1 TNFRSF25 1037.6814 2.5077172 (TNFRSF25), transcript variant 10, mRNA. Homo sapiens collagen, type XXV, 3180035 NM_032518.2 COL25A1 alpha 1 (COL25A1), transcript variant 134.88658 2.5027769 2, mRNA. Homo sapiens ephrin-Bl (EFNB1), 4730019 NM_004429.3 EFNB1 526.71991 2.4902158 mRNA. Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 506.17021 2.4751939 b, mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1155.933 2.4687599 mRNA. Homo sapiens palmitoyl-protein 1660575 NM_138717.1 PPT2 fhioesterase 2 (PPT2), transcript 315.47979 2.4602 variant 2, mRNA. Homo sapiens laminin, beta 3 6350243 NM_000228.2 LAMB3 139.59808 2.453857 (LAMB3), transcript variant 1, mRNA. Homo sapiens laminin, alpha 5 4040176 NM_005560.3 LAMA5 7219.8583 2.4510366 (LAMA5), mRNA. Homo sapiens cysteine-rich secretory 4280487 NM_003296.1 CRISP2 168.93599 2.4460628 protein 2 (CRISP2), mRNA. Homo sapiens granulin (GRN), 6840184 NM_002087.2 GRN 4120.6518 2.4418368 mRNA. Homo sapiens ficolin (collagen/fibrinogen domain 1170274 NM_003665.2 FCN3 151.5559 2.4264796 containing) 3 (Hakata antigen) (FCN3), transcript variant 1, mRNA. Homo sapiens granulin (GRN), 1940021 NM_002087.2 GRN 5512.9174 2.4177893 mRNA. Homo sapiens CUB domain containing 5260367 NM_022842.3 CDCP1 protein 1 (CDCP1), transcript variant 930.27419 2.4175267 1, mRNA. Homo sapiens ADAM metallopeptidase domain 15 6480131 NM_207 195.1 ADAM 15 586.26239 2.4131 13 (ADAM15), transcript variant 4, mRNA. Homo sapiens Rho guanine nucleotide 6250370 NM_032995.1 ARHGEF4 exchange factor (GEF) 4 (ARHGEF4), 155.01003 2.404487 transcript variant 2, mRNA. Homo sapiens kallikrein-related 2690647 NM_144947.1 KLK1 1 peptidase 11 (KLK1 1), transcript 164.67109 2.4034335 variant 2, mRNA. Homo sapiens interleukin 16 5080615 NM_172217.2 IL16 (lymphocyte chemoattractant factor) 207.52463 2.3994761 (IL16), transcript variant 2, mRNA. Homo sapiens intercellular adhesion molecule 4, Landsteiner-Wiener blood 730554 NM_001544.2 ICAM4 160.64528 2.3948233 group (ICAM4), transcript variant 1, mRNA. Homo sapiens iduronate 2-sulfatase 2600138 NM_006123.2 IDS (Hunter syndrome) (IDS), transcript 275.57603 2.3871655 variant 2, mRNA. Homo sapiens plexin Bl (PLXNB1), 6330438 NM_002673.3 PLXNB1 617.03555 2.3729273 mRNA. Homo sapiens Rho GTPase activating 6760482 NM_001017526.1 ARHGAP8 protein 8 (ARHGAP8), transcript 143.1233 2.3593814 variant 1, mRNA. Homo sapiens pregnancy specific beta- 5690681 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 201.99808 2.3556352 variant 1, mRNA. Homo sapiens chromosome 7 open reading frame 20 (C7orf20), mRNA. 2900504 NM_015949.2 C7orf20 914.8587 2.3298429 XM_946081 XM_946082 XM_946083 Homo sapiens coiled-coil domain 780341 NM_03 1455.2 CCDC3 397.2472 2.3289683 containing 3 (CCDC3), mRNA. Homo sapiens T-box 1 (TBX1), 4880730 NM_005992.1 TBX1 224.51755 2.3209074 transcript variant B, mRNA. Homo sapiens protocadherin 1 5570053 NM_002587.3 PCDH1 145.52227 2.281 1776 (PCDH1), transcript variant 1, mRNA. Homo sapiens mitogen-activated 1440440 NM_004635.3 MAPKAPK3 protein kinase-activated protein kinase 2444.995 2.2757096 3 (MAPKAPK3), mRNA. Homo sapiens matrix metallopeptidase 4810477 NM_024302.3 MMP28 28 (MMP28), transcript variant 1, 153.45627 2.2704749 mRNA. Homo sapiens interleukin 20 receptor, 6450482 NM_014432.2 IL20RA 173.97367 2.2703956 alpha (IL20RA), mRNA. Homo sapiens CUB domain containing 60215 NM_178181.1 CDCP1 protein 1 (CDCP1), transcript variant 680.15295 2.2310038 2, mRNA. Homo sapiens heparan sulfate 6-0- 830491 NM_001077188.1 HS6ST2 sulfotransferase 2 (HS6ST2), transcript 183.07035 2.2194489 variant L, mRNA. Homo sapiens protease, serine, 16 430768 NM_005865.2 PRSS16 151.91047 2.2172063 (thymus) (PRSS16), mRNA. Homo sapiens chromosome 7 open reading frame 20 (C7orf20), mRNA. 6560608 NM_015949.2 C7orf20 351.15973 2.2124788 XM_946081 XM_946082 XM_946083 Homo sapiens apolipoprotein A-I 1570725 NM_144772.1 APOA1BP 3413.7013 2.2047586 binding protein (APOA1BP), mRNA. Homo sapiens EPH receptor A2 6510332 NM_004431.2 EPHA2 684.48171 2.2033049 (EPHA2), mRNA. Homo sapiens chromosome 6 open 2070543 NM_025258.2 C6orf27 143.31785 2.193199 reading frame 27 (C6orf27), mRNA. Homo sapiens reticulon 4 receptor 3180195 NM_023004.5 RTN4R 185.99749 2.1846125 (RTN4R), mRNA. Homo sapiens chemokine (C-C motif) 1340626 NM_002989.2 CCL21 136.5076 2.1824786 ligand 2 1 (CCL21), mRNA. Homo sapiens kallikrein-related 3840240 NM_012315.1 KLK9 109.68798 2.1817473 peptidase 9 (KLK9), mRNA.

Homo sapiens chitinase 3-like 2 610598 NM_004000.2 CHI3L2 11489.875 62.89519 (CHI3L2), transcript variant 1, mRNA. Homo sapiens WNT1 inducible 3310333 NM_003880.2 WISP3 signaling pathway protein 3 (WISP3), 3566.9065 56.609756 transcript variant 1, mRNA. Homo sapiens collagen, type IX, alpha 69401 14 NM_001851.3 COL9A1 1 (COL9A1), transcript variant 1, 8047.6049 54.287425 mRNA. Homo sapiens melanoma inhibitory 6980767 NM_006533.2 MIA 3449.8634 36.632168 activity (MIA), mRNA. Homo sapiens collagen, type II, alpha 1 (primary osteoarthritis, 4010136 NM_001844.3 COL2A1 spondyloepiphyseal dysplasia, 19047.355 33.21 1937 congenital) (COL2A1), transcript variant 1, mRNA. Homo sapiens alpha-2-macroglobulin 2370438 NM_000014.4 A2M 3092.1437 30.776036 (A2M), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 6380484 NM_001002235.1 SERPINA1 antiproteinase, antitrypsin), member 1 3695.9956 30.468528 (SERPINA1), transcript variant 3, mRNA. Homo sapiens scrapie responsive 1110048 NM_007281.1 SCRG1 37477.52 28.325628 protein 1 (SCRG1), mRNA. Homo sapiens matrix metallopeptidase "7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 5549.446 26.001629 (MMP3), mRNA. Homo sapiens procollagen C- 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 14298.298 25.645233 (PCOLCE2), mRNA. Homo sapiens leukocyte cell derived 4560626 NM_007015.2 LECT1 chemotaxin 1 (LECT1), transcript 6418.5507 24.925612 variant 1, mRNA. Homo sapiens angiopoietin-like 5 2360066 NM_178127.2 ANGPTL5 1800.5978 24.861459 (ANGPTL5), mRNA. Homo sapiens SPARC related modular 2630437 NM_022138.1 SMOC2 2359.2687 23.476162 calcium binding 2 (SMOC2), mRNA. Homo sapiens growth differentiation 5690095 NM_004962.2 GDF10 3388.6546 21.60137 factor 10 (GDF10), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 730047 NM_001002236.1 SERPINA1 antiproteinase, antitrypsin), member 1 4016.6404 20.407282 (SERPINA1), transcript variant 2, mRNA. Homo sapiens collagen, type XI, alpha 1450392 NM_080681.2 COL1 1A2 2 (COL1 1A2), transcript variant 2, 2293.9631 19.024155 mRNA. Homo sapiens superoxide dismutase 3, 3890095 NM_003102.2 SOD3 2057.2196 18.519319 extracellular (SOD3), mRNA. Homo sapiens SPARC related modular 840008 NM_001034852.1 SMOCl calcium binding 1 (SMOCl), transcript 2036.9855 17.6638 variant 1, mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 4152.8251 17.324867 mRNA. Homo sapiens proenkephalin (PENK), 6220019 NM_00621 1.2 PENK 17105.808 16.751489 mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 6280168 NM_001085.4 SERPINA3 23635.518 16.04099 antiproteinase, antitrypsin), member 3 (SERPIN A3), mRNA. Homo sapiens WNT1 inducible 520717 NM_198239.1 WISP3 signaling pathway protein 3 (WISP3), 865.64985 15.797566 transcript variant 3, mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 5321.2028 15.290579 (plasma) (GPX3), mRNA. Homo sapiens matrilin 3 (MATN3), 2320767 NM_002381.4 MATN3 6733.5934 15.155547 mRNA. Homo sapiens proprotein convertase 520176 NM_000439.3 PCSK1 subtilisin/kexin type 1 (PCSK1), 991.76991 14.504901 mRNA. Homo sapiens frizzled-related protein 33701 13 NM_001463.2 FRZB 11107.818 14.180284 (FRZB), mRNA. Homo sapiens collagen, type IX, alpha 6380040 NM_001852.3 COL9A2 8605.1021 14.048448 2 (COL9A2), mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 6307.2208 13.824817 mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 2490152 NM_001040092.1 ENPP2 3157.8524 13.819855 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens 1070400 NM_153282.1 HYALl hyaluronoglucosaminidase 1 1445.3923 13.661 137 (HYALl), transcript variant 2, mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 840678 NM_001040092.1 ENPP2 4084.0186 13.477384 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens matrilin 4 (MATN4), 270470 NM_030592.1 MATN4 1651.9142 13.414078 transcript variant 3, mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 1433.6951 12.91 175 transcript variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 6770333 NM_000295.3 SERPINA1 antiproteinase, antitrypsin), member 1 805.70796 12.402276 (SERPINA1), transcript variant 1, mRNA. Homo sapiens chitinase 3-like 1 1780014 NM_001276.1 CHI3L1 (cartilage glycoprotein-39) (CHI3L1), 668.69543 12.143267 mRNA. Homo sapiens matrilin 4 (MATN4), 7380246 NM_030592.1 MATN4 1316.7864 11.875961 transcript variant 3, mRNA. Homo sapiens F-box protein 2 4540215 NM_012168.4 FBX02 1979.8718 11.755242 (FBX02), mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 1049.9822 11.4553 (NAALADL1), mRNA. Homo sapiens hyaluronan and 1850397 NM_001884.2 HAPLN1 proteoglycan link protein 1 3403.187 10.890613 (HAPLN1), mRNA. Homo sapiens zinc finger protein 533 5290333 NM_152520.3 ZNF533 949.57493 10.805817 (ZNF533), mRNA. Homo sapiens osteoglycin (OGN), 4480152 NM_014057.3 OGN 2791.0782 10.516614 transcript variant 3, mRNA. Homo sapiens retinol binding protein 4610424 NM_006744.3 RBP4 700.271 17 10.152378 4, plasma (RBP4), mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6250563 NM_004105.3 EFEMP1 "7944.7305 10.002815 (EFEMP1), transcript variant 1, mRNA. Homo sapiens cafhepsin F (CTSF), 3930020 NM_003793.2 CTSF 1626.0508 9.7827882 mRNA. Homo sapiens cystatin E/M (CST6), 1070333 NM_001323.2 CST6 856.8146 9.6605305 mRNA. Homo sapiens tumor necrosis factor 6840020 NM_006573.3 TNFSF13B (ligand) superfamily, member 13b 902.01062 9.6224695 (TNFSF13B), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 835.18702 9.0987967 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens collagen, type IX, alpha 3520634 NM_001853.3 COL9A3 943.4604 9.0596246 3 (COL9A3), mRNA. Homo sapiens fibroblast growth factor receptor 3 (achondroplasia, 6520139 NM_022965.1 FGFR3 3378.2842 8.9122574 thanatophoric dwarfism) (FGFR3), transcript variant 2, mRNA. Homo sapiens fibroblast growth factor 4480220 NM_021923.3 FGFRL1 receptor-like 1 (FGFRLl), transcript 7637.206 8.0829194 variant 3, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 2316.061 1 8.0783431 specific (ECM2), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 3850500 NM_005031.3 FXYDl 753.68186 8.0200986 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens glypican 6 (GPC6), 2370593 NM_005708.2 GPC6 3674.3805 7.944592 mRNA. Homo sapiens RAS, dexamethasone- 2710735 NM_016084.3 RASD1 2264.1571 7.8967225 induced 1 (RASD1), mRNA. Homo sapiens secretory leukocyte 2140707 NM_003064.2 SLPI 1133.559 7.7551223 peptidase inhibitor (SLPI), mRNA. Homo sapiens matrilin 2 (MATN2), 5810746 NM_002380.3 MATN2 5908.2373 7.4627802 transcript variant 1, mRNA. PREDICTED: Homo sapiens cystatin 4010491 XM_001129442.1 CST6 679.40236 7.4295754 E M (CST6), mRNA. Homo sapiens 1980300 NM_153283.1 HYAL1 hyaluronoglucosaminidase 1 456.0581 1 7.3670716 (HYAL1), transcript variant 3, mRNA. Homo sapiens surfactant, pulmonary- 6510270 NM_003019.4 SFTPD 593.17906 7.3353242 associated protein D (SFTPD), mRNA. Homo sapiens matrilin 4 (MATN4), 6900170 NM_003833.2 MATN4 569.7292 7.2945742 transcript variant 1, mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 9253.463 7.2718427 transcript variant A2, mRNA. Homo sapiens vitamin K epoxide reductase complex, subunit 1 6450546 NM_024006.4 VKORC1 9604.3245 7.2169837 (VKORC1), transcript variant 1, mRNA. Homo sapiens osteoglycin (OGN), 2940280 NM_014057.3 OGN 3583.3531 7.1712864 transcript variant 3, mRNA. Homo sapiens fibroblast growth factor 58601 12 NM_001004358.1 FGFRL1 receptor-like 1 (FGFRLl), transcript 1619.3007 7.0615987 variant 2, mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 840.94565 7.0592353 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens matrilin 2 (MATN2), 670215 NM_002380.3 MATN2 670.20723 7.0358357 transcript variant 1, mRNA. Homo sapiens serpin peptidase 520240 NM_005025.2 SERPINI1 inhibitor, clade I (neuroserpin), 425.76128 6.9151931 member 1 (SERPFNI1), mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 928.70708 6.5631663 (HOXA9), mRNA. Homo sapiens Clq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 602.7671 1 6.4782214 transcript variant 2, mRNA. Homo sapiens CD14 molecule (CD14), 6370369 NM_001040021.1 CD14 689.38186 6.3928374 transcript variant 2, mRNA. 7200427 NM_017413.3 APLN Homo sapiens apelin (APLN), mRNA. 615.64174 6.1866017 Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 3290630 NM_000624.3 SERPINA5 1067.5804 6.1073543 antiproteinase, antitrypsin), member 5 (SERPIN A5), mRNA. Homo sapiens transferrin (TF), 6590538 NM_001063.2 TF 485.39794 6.0782396 mRNA. Homo sapiens cartilage acidic protein 1660075 NM_018058.4 CRTAC1 834.70177 6.0569329 1 (CRTAC1), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 6258.5251 5.9517899 variant 1, mRNA. Homo sapiens TIMP metallopeptidase 1090326 NM_003256.2 TIMP4 2260.9788 5.8941899 inhibitor 4 (TFMP4), mRNA. Homo sapiens Boc homolog (mouse) 75101 13 NM_033254.2 BOC 510.18584 5.8693384 (BOC), mRNA. Homo sapiens proline/arginine-rich "7000446 NM_20 1348.1 PRELP end leucine-rich repeat protein 604.05192 5.6477861 (PRELP), transcript variant 2, mRNA. Homo sapiens mesofhelin (MSLN), 1230228 NM_013404.3 MSLN 574.87655 5.3447959 transcript variant 2, mRNA. Homo sapiens G protein-coupled receptor, family C, group 5, member C 7510634 NM_018653.3 GPRC5C 1342.9789 5.3175636 (GPRC5C), transcript variant 2, mRNA. Homo sapiens Thy-l cell surface 6480204 NM_006288.2 THY1 12522.001 5.256422 antigen (THY1), mRNA. Homo sapiens matrix Gla protein 1430487 NM_000900.2 MGP 18783.155 5.1856597 (MGP), mRNA. Homo sapiens angiopoietin 2 3450066 NM_001147.1 ANGPT2 454.61814 5.141 1334 (ANGPT2), mRNA. Homo sapiens Sin3A-associated 1780673 NM_003864.3 SAP30 2968.1676 5.0703069 protein, 30kDa (SAP30), mRNA. Homo sapiens olfactomedin 1 3800204 NM_006334.3 OLFM1 459.58599 5.01445 (OLFM1), transcript variant 2, mRNA. Homo sapiens angiotensinogen (serpin 2850301 NM_000029.2 A T peptidase inhibitor, clade A, member 468.13606 4.9875887 8) (AGT), mRNA. Homo sapiens nucleobindin 2 60427 NM_005013.2 NUCB2 5311.9878 4.961742 (NUCB2), mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 3902.136 4.9522364 (APOD), mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 1260040 NM_004105.3 EFEMP1 6332.4214 4.9361338 (EFEMP1), transcript variant 1, mRNA. Homo sapiens G protein-coupled receptor, family C, group 5, member C 1170477 NM_022036.2 GPRC5C 557.64395 4.9097257 (GPRC5C), transcript variant 1, mRNA. Homo sapiens SPARC related modular 4260097 NM_001034852.1 SMOCl calcium binding 1 (SMOCl), transcript 325.23628 4.781 1294 variant 1, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 7787.6016 4.7624431 3, mRNA. Homo sapiens chemokine (C-C motif) 6620121 NM_005623.2 CCL8 365.43503 4.7350407 ligand 8 (CCL8), mRNA. Homo sapiens peptidylprolyl 70001 14 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 8068.5353 4.698989 mRNA. Homo sapiens olfactomedin 1 2680072 NM_014279.4 OLFM1 732.82006 4.6862804 (OLFM1), transcript variant 1, mRNA. Homo sapiens Norrie disease 2320598 NM_000266.1 NDP 951.73636 4.5901015 (pseudoglioma) (NDP), mRNA. Homo sapiens carboxypeptidase Z 4390193 NM_001014447.1 CPZ 1460.4976 4.5743623 (CPZ), transcript variant 1, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 2690.5128 4.5648358 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens carboxypeptidase Z 5340064 NM_001014447.1 CPZ 656.79764 4.5007851 (CPZ), transcript variant 1, mRNA. Homo sapiens cytochrome P450, 3290048 NM_178033.1 CYP4X1 family 4, subfamily X, polypeptide 1 315.7944 4.41 15026 (CYP4X1), mRNA. Homo sapiens lipocalin 2 (LCN2), 4390398 NM_005564.3 LCN2 635.03997 4.3885936 mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6900408 NM_001039348.1 EFEMP1 20016.516 4.3799117 (EFEMP1), transcript variant 2, mRNA. Homo sapiens nidogen 2 1580709 NM_007361.3 NID2 650.39926 4.3438832 (osteonidogen) (NID2), mRNA. Homo sapiens cysteine-rich with EGF- 3400619 NM_00103 1717.2 CRELD1 like domains 1 (CRELDl), transcript 4477.0171 4.307634 variant 1, mRNA. PREDICTED: Homo sapiens 1510382 XM_938935.2 NXPH4 810.2528 4.2042598 neurexophilin 4 (NXPH4), mRNA. Homo sapiens deleted in lymphocytic 5490053 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 1713.1847 4.1908968 13. Homo sapiens carboxypeptidase E 5390687 NM_001873.1 CPE 3739.6668 4.1785551 (CPE), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 891.76445 3.9638057 mRNA. Homo sapiens bone morphogenetic 6980064 NM_001718.4 BMP6 412.30944 3.9142253 protein 6 (BMP6), mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1612.176 3.8705513 1, mRNA. Homo sapiens elastase 2, neutrophil 7650497 NM_001972.2 ELA2 260.53466 3.8609629 (ELA2), mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1098.7479 3.8602375 (LY96), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 283.009 3.8526774 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 2769.2712 3.8480607 1, mRNA. Homo sapiens core 1 synthase, glycoprotein-N-acetylgalactosamine 3- 580066 NM_020156.1 C1GALT1 599.67832 3.7994292 beta-galactosyltransferase, 1 (C1GALT1), mRNA. Homo sapiens cathepsin O (CTSO), 1820300 NM_001334.2 CTSO 1545.0075 3.7547142 mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 3406.7434 3.6923637 (ANG), transcript variant 2, mRNA. Homo sapiens CD14 molecule (CD14), 7000369 NM_000591.2 CD14 233.78156 3.684794 transcript variant 1, mRNA. Homo sapiens sphingomyelin 1500193 NM_001007593.1 SMPD1 phosphodiesterase 1, acid lysosomal 877.27434 3.6212878 (SMPD1), transcript variant 2, mRNA. Homo sapiens collagen, type IX, alpha 1340671 NM_001851.3 COL9A1 1 (COL9A1), transcript variant 1, 232.44145 3.5423557 mRNA. Homo sapiens dipeptidyl-peptidase 7 670608 NM_013379.2 DPP7 1194.2086 3.4923752 (DPP7), mRNA. Homo sapiens low density lipoprotein 2650521 NM_002337.1 LRPAP1 receptor-related protein associated 2312.5721 3.4855679 protein 1 (LRPAP1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 4490563 NM_172244.2 SGCD 250.47699 3.4815292 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens ectonucleotide 3420553 NM_006208.1 ENPP1 pyrophosphatase/phosphodiesterase 1 649.95221 3.4699321 (ENPP1), mRNA. Homo sapiens lysyl oxidase-like 3 7200706 NM_032603.2 LOXL3 2450.7037 3.4541647 (LOXL3), mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 2867.8385 3.4502058 1, r subcomponent (C1R), mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 69001 14 NM_006080.2 SEMA3A 1823.2389 3.2885058 basic domain, secreted, (semaphorin) 3A (SEMA3A), mRNA. Homo sapiens deleted in lymphocytic 1260612 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 328.53097 3.2876487 13. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 1398.6718 3.2694126 mRNA. Homo sapiens antigen p97 (melanoma associated) identified by monoclonal 1240435 NM_033316.2 MFI2 246.85538 3.2126801 antibodies 133.2 and 96.5 (MFI2), transcript variant 2, mRNA.

Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 444.41814 3.1895833 matrix protein (SPON1), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 544.9736 3.1684019 variant 2, mRNA.

Homo sapiens clusterin-like 1 (retinal) 1660538 NM_199167.1 CLUL1 140.13171 2.6863524 (CLUL1), transcript variant 2, mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 3839.536 2.6855869 mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 280.41 165 2.6721969 complexing protein 2) (DPP4), mRNA. Homo sapiens collagen, type IX, alpha 5340402 NM_001851.3 COL9A1 1 (COL9A1), transcript variant 1, 2 11.50133 2.6627693 mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARID ID interactive domain ID (JARID1D), 177.77375 2.6450212 mRNA. Homo sapiens golgi phosphoprotein 4 5870221 NM_014498.2 GOLPH4 3226.2173 2.6328773 (GOLPH4), mRNA. Homo sapiens fibronectin 1 (FN1), 5670228 NM_054034.2 FN1 339.76999 2.6173101 transcript variant 7, mRNA. Homo sapiens hematopoietic cell 1580088 NM_001007469.1 HCST signal transducer (HCST), transcript 544.431 12 2.6024053 variant 2, mRNA. Homo sapiens biotinidase (BTD), 1410091 NM_000060.2 BTD 752.00472 2.5972001 mRNA. Homo sapiens synaptonemal complex 6760673 NM_006455.2 SC65 5512.9174 2.5632849 protein SC65 (SC65), mRNA. Homo sapiens asparagine-linked glycosylation 5 homolog (S. 63701 13 NM_013338.3 ALG5 2407.6805 2.5383803 cerevisiae, dolichyl-phosphate beta- glucosyltransferase) (ALG5), mRNA. Homo sapiens 5'-nucleotidase, ecto 5960398 NM_002526.1 NT5E 2105.91 15 2.5351517 (CD73) (NT5E), mRNA. Homo sapiens transmembrane protein 1510564 NM_014255.3 TMEM4 3678.6683 2.531 1218 4 (TMEM4), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM 14A similarity 14, member A (FAM14A), 1956.2917 2.5210431 mRNA. Homo sapiens interleukin 17D 6510519 NM_138284.1 IL17D 1365.081 1 2.508231 (IL17D), mRNA. Homo sapiens chitobiase, di-N-acetyl- 2850184 NM_004388.1 CTBS 1871.1417 2.4913472 (CTBS), mRNA. Homo sapiens signal sequence 7570243 NM_006280.1 SSR4 receptor, delta (translocon-associated 18527.698 2.4839159 protein delta) (SSR4), mRNA. Homo sapiens tumor necrosis factor 1090747 NM_003809.2 TNFSF12 (ligand) superfamily, member 12 879.03761 2.475475 (TNFSF12), mRNA. Homo sapiens calcitonin-related 6 110242 NM_001033953.1 CALCA polypeptide alpha (CALCA), transcript 165.5326 2.4688061 variant 3, mRNA. Homo sapiens laminin, beta 2 (laminin 7650189 NM_002292.3 LAMB2 2460.2854 2.468241 S) (LAMB2), mRNA. Homo sapiens reticulocalbin 3, EF- 2100431 NM_020650.2 RCN3 hand calcium binding domain (RCN3), 3931.4018 2.4639072 mRNA. Homo sapiens fibrinogen-like 2 1430170 NM_006682.1 FGL2 599.27965 2.4638704 (FGL2), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 13462.134 2.4624981 mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2605.3624 2.452121 1, mRNA. Homo sapiens SIL1 homolog, endoplasmic reticulum chaperone (S. 6560603 NM_001037633.1 SIL1 4968.3212 2.4378064 cerevisiae) (SIL1), transcript variant 1, mRNA. Homo sapiens deleted in bladder 4850450 NM_014618.2 DBC1 377.44248 2.4301379 cancer 1 (DBC1), mRNA. Homo sapiens heparan sulfate 1500139 NM_006042.1 HS3ST3A1 (glucosamine) 3-O-sulfotransferase 3888.0326 2.4176597 3A1 (HS3ST3A1), mRNA. Homo sapiens ephrin-Al (EFNA1), 3390187 NM_004428.2 EFNA1 222.61239 2.4174201 transcript variant 1, mRNA. Homo sapiens glucosidase, alpha; acid (Pompe disease, glycogen storage 1190634 NM_001079804.1 GAA 856.15973 2.4045426 disease type II) (GAA), transcript variant 3, mRNA. Homo sapiens transforming growth 6660435 NM_003236.1 TGFA 281.57161 2.3970214 factor, alpha (TGFA), mRNA. Homo sapiens neurexophilin 4 4540458 NM_007224.1 NXPH4 227.20251 2.3701287 (NXPH4), mRNA. Homo sapiens Rho guanine nucleotide 3850333 NM_015320.2 ARHGEF4 exchange factor (GEF) 4 (ARHGEF4), 262.26519 2.3696835 transcript variant 1, mRNA. Homo sapiens clusterin (CLU), 2120670 NM_203339.1 CLU 145.3795 2.3688643 transcript variant 2, mRNA. Homo sapiens aspartylglucosaminidase 130064 NM_000027.2 AGA 1127.3873 2.347397 (AGA), mRNA. Homo sapiens vitamin K epoxide reductase complex, subunit 1 1770703 NM_024006.4 VKORC1 30293.717 2.34388 (VKORC1), transcript variant 1, mRNA. Homo sapiens osteomodulin (OMD), 4610246 NM_005014.1 OMD 963.53127 2.3380731 mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 168.78304 2.328059 chromosome Y. Homo sapiens complement component 2000128 NM_000715.3 C4BPA 4 binding protein, alpha (C4BPA), 129.39617 2.3250417 mRNA. Homo sapiens chromosome 6 open 1190082 NM_001040437.1 C6orf48 reading frame 48 (C6orf48), transcript 251.94417 2.3131782 variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 5080192 NM_006216.2 SERPINE2 27548.738 2.3031002 activator inhibitor type 1), member 2 (SERPINE2), mRNA. Homo sapiens tumor necrosis factor receptor superfamily, member l i b 2370132 NM_002546.3 TNFRSF1 1B 1859.6239 2.2884306 (osteoprotegerin) (TNFRSF11B), mRNA. Homo sapiens cysteine-rich with EGF- 2940561 NM_001031717.1 CRELD1 like domains 1 (CRELDl), transcript 195.01209 2.284091 1 variant 1, mRNA. Homo sapiens palmitoyl-protein 7200041 NM_000310.2 PPT1 fhioesterase 1 (ceroid-lipofuscinosis, 3858.9091 2.2828625 neuronal 1, infantile) (PPT1), mRNA. Homo sapiens aspartate beta- 5890619 NM_004318.2 ASPH 386.46077 2.2659785 hydroxylase (ASPH), transcript variant 1, mRNA.

Homo sapiens SLIT and NTRK-like 7330477 NM_173078.2 SLITRK4 281.96121 2.2654655 family, member 4 (SLITRK4), mRNA. Homo sapiens B9 protein (EPPB9), 6040465 NM_0 1568 1.2 EPPB9 301.43687 2.2314581 mRNA. Homo sapiens SIL1 homolog, endoplasmic reticulum chaperone (S. 3130228 NM_001037633.1 SIL1 2148.8673 2.2221763 cerevisiae) (SIL1), transcript variant 1, mRNA. Homo sapiens sulfatase modifying 6 110253 NM_001042470.1 SUMF2 factor 2 (SUMF2), transcript variant 4, 12159.015 2.2026098 mRNA. Homo sapiens hexosaminidase A 6650240 NM_000520.3 HEXA 512.78569 2.1966375 (alpha polypeptide) (HEXA), mRNA. 1430521 NM_053276.2 VIT Homo sapiens vitrin (VIT), mRNA. 209.20782 2.1925009 Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 27991.695 2.1923075 transcript variant C, mRNA. Homo sapiens procollagen-lysine, 2- 160630 NM_001084.4 PLOD3 oxoglutarate 5-dioxygenase 3 7219.8583 2.1422168 (PLOD3), mRNA. Homo sapiens tumor necrosis factor 650328 NM_003327.2 TNFRSF4 receptor superfamily, member 4 124.76423 2.1380512 (TNFRSF4), mRNA. Homo sapiens complement component 670594 NM_000063.3 C2 170.26932 2.1366336 2 (C2), mRNA. Homo sapiens interleukin 18 binding 2190717 NM_173042.2 IL18BP protein (IL18BP), transcript variant A, 374.7267 2.1291724 mRNA. Homo sapiens myeloproliferative 5050086 NM_005373.1 MPL leukemia virus oncogene (MPL), 196.54631 2.1197222 mRNA. Homo sapiens endothelial cell-specific 3420605 NM_007036.3 ESM1 294.84912 2.1131431 molecule 1 (ESM1), mRNA. Homo sapiens chromosome 6 open 2570068 NM_145267.2 C6orf57 534.8295 2.1047099 reading frame 57 (C6orf57), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 947.59425 2.0922123 (SERPING1), transcript variant 2, mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLF1 1185.0564 2.0854573 factor 1 (CRLF1), mRNA. Homo sapiens v-maf musculoaponeurotic fibrosarcoma 3610440 NM_005360.3 MAF 758.93142 2.0815555 oncogene homolog (avian) (MAF), transcript variant 1, mRNA. Homo sapiens chromosome 19 open 1030458 NM_019107.3 C19orfl0 4581.7084 2.0758843 reading frame 10 (C19orfl0), mRNA. Homo sapiens clusterin (CLU), 1070471 NM_203339.1 CLU 133.36386 2.0658142 transcript variant 2, mRNA. Homo sapiens dipeptidyl-peptidase 7 2480364 NM_013379.2 DPP7 1095.8869 2.0627304 (DPP7), mRNA. Homo sapiens collagen, type XXVII, 2120181 NM_032888.2 COL27A1 322.87139 2.0626708 alpha 1 (COL27A1), mRNA. Homo sapiens collagen, type VI, alpha 7570598 NM_001848.2 COL6A1 13153.34 2.0600884 1 (COL6A1), mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 4220433 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 2 11.66401 2.059615 3B (SEMA3B), transcript variant 2, mRNA. Homo sapiens chondroadherin 4890167 NM_001267.2 CHAD 164.47212 2.0518242 (CHAD), mRNA. Homo sapiens leprecan-like 2 6760632 NM_014262.2 LEPREL2 1829.5866 2.0471642 (LEPREL2), mRNA. Homo sapiens chemokine (C-C motif) 4610364 NM_006273.2 CCL7 119.44631 2.0312909 ligand 7 (CCL7), mRNA. Homo sapiens chemokine (C-X3-C 630521 NM_002996.3 CX3CL1 235.99602 2.0285547 motif) ligand 1 (CX3CL1), mRNA. Homo sapiens wingless-type MMTV 4730176 NM_004626.2 WNT1 1 integration site family, member 11 179.41519 2.0281034 (WNT1 1), mRNA. Homo sapiens tenascin C 6940102 NM_002160.1 TNC 2052.4955 2.0271 147 (hexabrachion) (TNC), mRNA. Homo sapiens cathepsin K (CTSK), 1430278 NM_000396.2 CTSK 1772.4016 2.0268121 mRNA. Homo sapiens multiple inositol 6370639 NM_004897.2 MINPP1 polyphosphate histidine phosphatase, 1 507.01401 2.026353 (MFNPP1), mRNA. Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, 6220672 NM_003778.3 B4GALT4 396.75715 2.0261 184 polypeptide 4 (B4GALT4), transcript variant 2, mRNA. Homo sapiens protein kinase C 630280 NM_001001329.1 PRKCSH substrate 80K-H (PRKCSH), transcript 2951.7027 2.0240619 variant 2, mRNA. Homo sapiens collagen, type II, alpha 6501 13 NM_001844.4 COL2A1 1 (COL2A1), transcript variant 1, 204.1469 2.0232304 mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 1000.4092 2.0194283 mRNA. Homo sapiens chondroitin sulfate 3060128 NM_014918.3 CHSY1 4359.3979 2.0098463 synthase 1 (CHSY1), mRNA.

NHAC P8 prep3 Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave. Homo sapiens phospholipase A2, 4860152 NM_000300.2 PLA2G2A group IIA (platelets, synovial fluid) 12976.429 132.66661 (PLA2G2A), mRNA. Homo sapiens proline/arginine-rich "7000446 NM_20 1348.1 PRELP end leucine-rich repeat protein 7203.8627 67.354931 (PRELP), transcript variant 2, mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 14914.677 62.221447 mRNA. Homo sapiens chitinase 3-like 2 610598 NM_004000.2 CHI3L2 9498.6695 51.995398 (CHI3L2), transcript variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 730047 NM_001002236.1 SERPINA1 antiproteinase, antitrypsin), member 1 9426.0345 47.890706 (SERPINA1), transcript variant 2, mRNA. Homo sapiens defensin, beta 1 4920040 NM_005218.3 DEFB1 3730.8357 42.295292 (DEFB1), mRNA. Homo sapiens cartilage acidic protein 1660075 NM_018058.4 CRTAC1 4615.4847 33.491819 1 (CRTAC1), mRNA. Homo sapiens proenkephalin (PENK), 6220019 NM_00621 1.2 PENK 33906.985 33.204658 mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 6380484 NM_001002235.1 SERPINA1 antiproteinase, antitrypsin), member 1 4006.333 33.026844 (SERPINA1), transcript variant 3, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 3290630 NM_000624.3 SERPINA5 5063.6932 28.968093 antiproteinase, antitrypsin), member 5 (SERPIN A5), mRNA. Homo sapiens interleukin 11 (IL1 1), 8401 14 NM_000641.2 IL1 1 7371.1814 24.891658 mRNA. Homo sapiens 1070400 NM_153282.1 HYAL1 hyaluronoglucosaminidase 1 2454.4735 23.198476 (HYAL1), transcript variant 2, mRNA. Homo sapiens SPARC related modular 840008 NM_001034852.1 SMOCl calcium binding 1 (SMOCl), transcript 2573.9904 22.320459 variant 1, mRNA. Homo sapiens angiopoietin-like 5 2360066 NM_178127.2 ANGPTL5 1462.741 20.196557 (ANGPTL5), mRNA. Homo sapiens procollagen C- 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 11067.226 19.850025 (PCOLCE2), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 6280168 NM_001085.4 SERPINA3 28908.1 19.619394 antiproteinase, antitrypsin), member 3 (SERPIN A3), mRNA. Homo sapiens scrapie responsive 1110048 NM_007281.1 SCRG1 22099.182 16.702632 protein 1 (SCRG1), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 6770333 NM_000295.3 SERPINA1 antiproteinase, antitrypsin), member 1 1016.008 15.639428 (SERPINA1), transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase "7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 3164.3146 14.826225 (MMP3), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 1741.7254 14.620742 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 5056.0653 14.528702 (plasma) (GPX3), mRNA. Homo sapiens collagen, type II, alpha 1 (primary osteoarthritis, 4010136 NM_001844.3 COL2A1 spondyloepiphyseal dysplasia, 7171.9072 12.505302 congenital) (COL2A1), transcript variant 1, mRNA. Homo sapiens collagen, type XV, 5090026 NM_001855.3 COL15A1 7924.8209 11.774197 alpha 1 (COL15A1), mRNA. Homo sapiens cartilage intermediate layer protein, nucleotide 6400427 NM_003613.2 CILP 4264.5345 11.741 143 pyrophosphohydrolase (CILP), mRNA. Homo sapiens SPARC related modular 2630437 NM_022138.1 SMOC2 1173.8012 11.680037 calcium binding 2 (SMOC2), mRNA. Homo sapiens chondroadherin 4890167 NM_001267.2 CHAD 934.36519 11.656401 (CHAD), mRNA. Homo sapiens WNT1 inducible 3310333 NM_003880.2 WISP3 signaling pathway protein 3 (WISP3), 733.07094 11.634442 transcript variant 1, mRNA. Homo sapiens cartilage oligomeric 2360148 NM_000095.2 COMP 31253.086 11.099088 matrix protein (COMP), mRNA. Homo sapiens SPARC related modular 4260097 NM_001034852.1 SMOCl calcium binding 1 (SMOCl), transcript 715.00177 10.510869 variant 1, mRNA. Homo sapiens fibroblast growth factor 58601 12 NM_001004358.1 FGFRLl receptor-like 1 (FGFRLl), transcript 2183.9094 9.5237974 variant 2, mRNA. Homo sapiens WNT1 inducible 520717 NM_198239.1 WISP3 signaling pathway protein 3 (WISP3), 497.9421 1 9.0871307 transcript variant 3, mRNA. Homo sapiens ectonucleotide 3420553 NM_006208.1 ENPP1 pyrophosphatase/phosphodiesterase 1 1673.3205 8.9334391 (ENPP1), mRNA. PREDICTED: Homo sapiens cystatin 4010491 XM_001129442.1 CST6 813.91283 8.9005089 EM (CST6), mRNA. Homo sapiens RPE-spondin (RPESP), 2600397 NM_153225.2 RPESP 742.93864 8.6204651 mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLF1 4769.535 8.3934074 factor 1 (CRLF1), mRNA. Homo sapiens lysyl oxidase-like 3 7200706 NM_032603.2 LOXL3 5908.2373 8.3274143 (LOXL3), mRNA. Homo sapiens placental growth factor 1940438 NM_002632.4 PGF 1079.3475 8.2221993 (PGF), mRNA. Homo sapiens cystatin E M (CST6), 1070333 NM_001323.2 CST6 695.59336 7.8427712 mRNA. Homo sapiens fibroblast growth factor 4480220 NM_021923.3 FGFRLl receptor-like 1 (FGFRLl), transcript 7236.6257 7.6589608 variant 3, mRNA. Homo sapiens 1980300 NM_153283.1 HYALl hyaluronoglucosaminidase 1 437.26615 7.06351 (HYALl), transcript variant 3, mRNA. Homo sapiens melanoma inhibitory 6980767 NM_006533.2 MIA 660.45531 7.0130051 activity (MIA), mRNA. Homo sapiens matrix Gla protein 1430487 NM_000900.2 MGP 24283.161 6.7041033 (MGP), mRNA. Homo sapiens fibroblast growth factor receptor 3 (achondroplasia, 6520139 NM_022965.1 FGFR3 2520.9232 6.6504517 thanatophoric dwarfism) (FGFR3), transcript variant 2, mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARID1D), 400.13732 5.9534757 mRNA. Homo sapiens tumor necrosis factor receptor superfamily, member l ib 2370132 NM_002546.3 TNFRSF1 1B 4515.7484 5.5570251 (osteoprotegerin) (TNFRSF11B), mRNA. Homo sapiens osteoglycin (OGN), 2940280 NM_014057.3 OGN 2485.4027 4.9739821 transcript variant 3, mRNA. Homo sapiens clusterin (CLU), 2120670 NM_203339.1 CLU 298.00398 4.855781 transcript variant 2, mRNA. Homo sapiens low density lipoprotein receptor-related protein 8, 478041 1 NM_017522.3 LRP8 1221.5493 4.7955148 apolipoprotein e receptor (LRP8), transcript variant 3, mRNA. (pseudoglioma) (NDP), mRNA. Homo sapiens latent transforming 1170239 NM_000627.2 LTBP1 growth factor beta binding protein 1 783.98348 3.4240182 (LTBP1), transcript variant 2, mRNA. Homo sapiens rabphilin 3A-like 5260408 NM_006987.2 RPH3AL (without C2 domains) (RPH3AL), 292.06431 3.4182427 mRNA. Homo sapiens Thy-l cell surface 6480204 NM_006288.2 THY1 8047.6049 3.3781827 antigen (THY1), mRNA. Homo sapiens nitric oxide synthase 3 2480195 NM_000603.3 NOS3 240.75664 3.3490786 (endothelial cell) (NOS3), mRNA. Homo sapiens CD14 molecule (CD14), 6370369 NM_001040021.1 CD14 358.87994 3.3279975 transcript variant 2, mRNA. Homo sapiens insulin-like growth 6840372 NM_001013398.1 IGFBP3 factor binding protein 3 (IGFBP3), 24958.137 3.3270497 transcript variant 1, mRNA. Homo sapiens family with sequence 1260767 NM_001040020.1 FAM3C similarity 3, member C (FAM3C), 1466.1754 3.2052616 transcript variant 2, mRNA. Homo sapiens matrilin 2 (MATN2), 5810746 NM_002380.3 MATN2 2522.9792 3.1868116 transcript variant 1, mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISP1 signaling pathway protein 1 (WISP1), 237.93746 3.1817192 transcript variant 2, mRNA. Homo sapiens poliovirus receptor 780524 NM_006505.2 PVR 740.6792 3.1668683 (PVR), mRNA. Homo sapiens bone morphogenetic 4280577 NM_001200.2 BMP2 713.48289 3.1623686 protein 2 (BMP2), mRNA. Homo sapiens antigen p97 (melanoma associated) identified by monoclonal 1240435 NM_033316.2 MFI2 242.61785 3.157531 antibodies 133.2 and 96.5 (MFI2), transcript variant 2, mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 2359.2687 3.1494182 mRNA. Homo sapiens family with sequence 780332 NM_001040020.1 FAM3C similarity 3, member C (FAM3C), 1329.8792 3.1459546 transcript variant 2, mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 3955.7942 3.1086647 transcript variant A2, mRNA. Homo sapiens angiopoietin-like 2 7650672 NM_012098.2 ANGPTL2 3197.4559 3.1018306 (ANGPTL2), mRNA. Homo sapiens olfactomedin 1 2680072 NM_014279.4 OLFMl 471.90383 3.0177581 (OLFMl), transcript variant 1, mRNA. Homo sapiens plasminogen activator, 360475 NM_001005376.1 PLAUR urokinase receptor (PLAUR), 1617.9619 3.0063615 transcript variant 2, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 16350.645 2.9908655 mRNA. Homo sapiens plasminogen activator, 730528 NM_002659.2 PLAUR urokinase receptor (PLAUR), 1471.9015 2.9479179 transcript variant 1, mRNA. Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic 3170068 NM_004900.3 APOBEC3B 386.6306 2.9420652 polypeptide-like 3B (APOBEC3B), mRNA. Homo sapiens tenascin C 6940102 NM_002160.1 TNC 2960.1 136 2.9235093 (hexabrachion) (TNC), mRNA.

Homo sapiens cathepsin F (CTSF), 3930020 NM_003793.2 CTSF 429.62478 2.5847459 mRNA. Homo sapiens thymopoietin (TMPO), 3400630 NM_003276.1 TMPO 637.01667 2.5585497 transcript variant 1, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1505.5186 2.5543253 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens ADAM metallopeptidase domain 12 (meltrin 6420692 NM_003474.3 ADAM 12 200.1382 2.5223117 alpha) (ADAM 12), transcript variant 1, mRNA. Homo sapiens cysteine-rich with EGF- 3400619 NM_00103 1717.2 CRELD1 like domains 1 (CRELDl), transcript 2620.4959 2.5213522 variant 1, mRNA. Homo sapiens retinol binding protein 4610424 NM_006744.3 RBP4 173.82684 2.5201036 4, plasma (RBP4), mRNA. Homo sapiens growth differentiation 5690095 NM_004962.2 GDF10 392.36652 2.501 1857 factor 10 (GDF10), mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 770408 NM_000602.1 SERPINE1 11954.262 2.4997098 activator inhibitor type 1), member 1 (SERPINE1), mRNA. Homo sapiens syntrophin, beta 1 (dystrophin-associated protein Al, 3420739 NM_021021.2 SNTB1 851.93488 2.4934409 59kDa, basic component 1) (SNTB1), mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 69001 14 NM_006080.2 SEMA3A 1380.3444 2.489674 basic domain, secreted, (semaphorin) 3A (SEMA3A), mRNA. Homo sapiens follistatin-like 3 2360356 NM_005860.2 FSTL3 (secreted glycoprotein) (FSTL3), 3945.9257 2.4010776 mRNA. Homo sapiens AE binding protein 1 658071 1 NM_001 129.3 AEBP1 6519.4003 2.3822849 (AEBP1), mRNA. Homo sapiens DnaJ (Hsp40) homolog, 7000630 NM_006260.2 DNAJC3 subfamily C, member 3 (DNAJC3), 338.69786 2.3727795 mRNA. Homo sapiens superoxide dismutase 3, 3890095 NM_003102.2 SOD3 263.28643 2.3701336 extracellular (SOD3), mRNA. Homo sapiens chordin (CHRD), 5570592 NM_003741.2 CHRD 182.04395 2.3646764 mRNA. Homo sapiens zinc finger protein 533 5290333 NM_152520.3 ZNF533 207.14794 2.3572682 (ZNF533), mRNA. Homo sapiens transforming growth 6660435 NM_003236.1 TGFA 276.40501 2.3530382 factor, alpha (TGFA), mRNA. Homo sapiens chemokine (C-C motif) 1030333 NM_002982.3 CCL2 5780.0239 2.3528662 ligand 2 (CCL2), mRNA. Homo sapiens chromosome 19 open 1030458 NM_019107.3 C19orfl0 5138.4521 2.3281342 reading frame 10 (C19orfl0), mRNA. Homo sapiens collagen, type XI, alpha 1450392 NM_080681.2 COL1 1A2 2 (COL1 1A2), transcript variant 2, 278.44403 2.309175 mRNA. Homo sapiens chorionic gonadotropin, 6860446 NM_000737.2 CGB 191.68142 2.3017555 beta polypeptide (CGB), mRNA. Homo sapiens p21(CDKNlA)- 4490632 NM_001014832.1 PAK4 activated kinase 4 (PAK4), transcript 737.60708 2.2744605 variant 3, mRNA. Homo sapiens interferon-related 4200152 NM_006764.3 IFRD2 667.07662 2.2715949 developmental regulator 2 (IFRD2), mRNA.

Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 166.781 19 2.2704371 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens amine oxidase, copper 580736 NM_009590.2 AOC2 containing 2 (retina-specific) (AOC2), 148.18968 2.2580318 transcript variant 2, mRNA. Homo sapiens paired immunoglobin- 1570039 NM_013440.3 PILRB like type 2 receptor beta (PILRB), 677.5413 2.2482521 transcript variant 1, mRNA. Homo sapiens connective tissue 2640292 NM_001901.2 CTGF 29174.567 2.2441358 growth factor (CTGF), mRNA. Homo sapiens G protein-coupled receptor, family C, group 5, member C 1170477 NM_022036.2 GPRC5C 253.59543 2.232758 (GPRC5C), transcript variant 1, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 4220433 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 229.20096 2.2302598 3B (SEMA3B), transcript variant 2, mRNA. Homo sapiens cyclin F (CCNF), 3130541 NM_001761.1 CCNF 918.97006 2.2283186 mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 28435.106 2.2270354 transcript variant C, mRNA. Homo sapiens fhrombospondin 3 1260039 NM_0071 12.3 THBS3 724.18016 2.2181205 (THBS3), mRNA. Homo sapiens ADAM metallopeptidase domain 15 3440452 NM_207 195.1 ADAM 15 5629.508 2.1967094 (ADAM15), transcript variant 4, mRNA. Homo sapiens golgi phosphoprotein 4 5870221 NM_014498.2 GOLPH4 2659.1804 2.1701253 (GOLPH4), mRNA. Homo sapiens leucine rich repeat 2640195 NM_1 30830.2 LRRC15 630.47212 2.1626272 containing 15 (LRRC15), mRNA. Homo sapiens angiopoietin-like 4 4610433 NM_1 393 14.1 ANGPTL4 (ANGPTL4), transcript variant 1, 3940.8705 2.1516309 mRNA. Homo sapiens transferrin receptor 2940435 NM_003234.1 TFRC 4099.71 11 2.1487619 (p90, CD71) (TFRC), mRNA. Homo sapiens luteinizing hormone 3710161 NM_000894.2 LHB 161.37588 2.1468809 beta polypeptide (LHB), mRNA. Homo sapiens cysteine-rich with EGF- 2940561 NM_001031717.1 CRELD1 like domains 1 (CRELDl), transcript 182.50147 2.1375597 variant 1, mRNA. Homo sapiens mannosidase, endo- 3060767 NM_024641.2 MANEA 235.27529 2.0728576 alpha (MANEA), mRNA. Homo sapiens latent transforming 3520093 NM_021070.2 LTBP3 growth factor beta binding protein 3 2650.5397 2.0549422 (LTBP3), mRNA. Homo sapiens endoglin (Osler-Rendu- 4610753 NM_0001 18.1 ENG 2191.6243 2.0547489 Weber syndrome 1) (ENG), mRNA. Homo sapiens fibroblast growth factor 5810528 NM_003862.1 FGF18 260.67412 2.0540926 18 (FGF18), mRNA. Homo sapiens arylsulfatase B (ARSB), 6900309 NM_000046.2 ARSB 251.22404 2.0535565 transcript variant 1, mRNA. Homo sapiens neuropilin 2 (NRP2), 2650021 NM_018534.3 NRP2 275.23776 2.051099 transcript variant 4, mRNA. Homo sapiens EROl-like beta (S. 56901 12 NM_0 1989 1.2 EROILB 140.00959 2.0504641 cerevisiae) (EROILB), mRNA. Homo sapiens WAP four-disulfide 1230615 NM_02 1197.2 WFDC1 231.98953 2.0432368 core domain 1 (WFDC1), mRNA. Homo sapiens collagen, type XXVII, 2120181 NM_032888.2 COL27A1 319.08333 2.0384707 alpha 1 (COL27A1), mRNA. Homo sapiens ADAM metallopeptidase domain 15 1980553 NM_003815.3 ADAM 15 535.80354 2.0318312 (ADAM15), transcript variant 2, mRNA. Homo sapiens interferon, alpha 8 630041 NM_002170.3 IFNA8 1264.3609 2.0257977 (IFNA8), mRNA. Homo sapiens leucyl/cystinyl 2690544 NM_175920.3 LNPEP aminopeptidase (LNPEP), transcript 401.97257 2.0234448 variant 2, mRNA. Homo sapiens fibronectin 1 (FN1), 6180528 NM_212474.1 FN1 1721.9358 2.0221719 transcript variant 6, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 576.24469 2.0099221 specific (ECM2), mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 2375.1634 2.0089707 mRNA.

RTPEC P3 Human renal proximal tubule cells Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave. Homo sapiens matrix metallopeptidase 3800088 NM_002423.3 MMP7 7 (matrilysin, uterine) (MMP7), 16159.754 89.53144 mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 6380484 NM_001002235.1 SERPINA1 antiproteinase, antitrypsin), member 1 8240.4817 67.931723 (SERPINA1), transcript variant 3, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 730047 NM_001002236.1 SERPINA1 antiproteinase, antitrypsin), member 1 10457.71 1 53.132329 (SERPINA1), transcript variant 2, mRNA. Homo sapiens secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, 3840154 NM_001040058.1 SPP1 28908.1 41.044692 early T-lymphocyte activation 1) (SPP1), transcript variant 1, mRNA. Homo sapiens phospholipase Al 3400307 NM_015900.1 PLA1A 2153.2273 30.703563 member A (PLA1A), mRNA. Homo sapiens hyaluronan binding 4060427 NM_004132.2 HABP2 1677.0404 28.889498 protein 2 (HABP2), mRNA. Homo sapiens defensin, beta 1 4920040 NM_005218.3 DEFB1 2532.7889 28.713419 (DEFB1), mRNA. Homo sapiens serum amyloid Al 1690563 NM_199161.1 SAA1 3985.9645 28.632816 (SAA1), transcript variant 2, mRNA. Homo sapiens ladinin 1 (LAD1), 1170349 NM_005558.3 LAD1 5048.6329 28.208247 mRNA. Homo sapiens secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, 3460070 NM_000582.2 SPP1 22701.323 26.251332 early T-lymphocyte activation 1) (SPP1), transcript variant 2, mRNA. Homo sapiens major histocompatibility 2570564 NM_0191 11.3 HLA-DRA complex, class II, DR alpha (HLA- 2520.9232 25.761009 DRA), mRNA. Homo sapiens RPE-spondin (RPESP), 2600397 NM_153225.2 RPESP 2010.6385 23.329839 mRNA. Homo sapiens 1070400 NM_153282.1 HYAL1 hyaluronoglucosaminidase 1 2413.1291 22.807709 (HYAL1), transcript variant 2, mRNA. Homo sapiens carboxypeptidase, 60136 NM_03131 1.3 CPVL vitellogenic-like (CPVL), transcript 3520.8968 21.599522 variant 1, mRNA. Homo sapiens hepatitis A virus cellular 5220093 NM_032782.3 HAVCR2 2375.1634 21.572775 receptor 2 (HAVCR2), mRNA. Homo sapiens interleukin 17 receptor 1070152 NM_018725.3 IL17RB 1483.5671 21.138316 B (IL17RB), mRNA. Homo sapiens carboxypeptidase, 1400703 NM_019029.2 CPVL vitellogenic-like (CPVL), transcript 1883.6353 16.384909 variant 2, mRNA. Homo sapiens secretory leukocyte 2140707 NM_003064.2 SLPI 2298.804 15.727021 peptidase inhibitor (SLPI), mRNA. Homo sapiens protocadherin 20 5900376 NM_022843.2 PCDH20 905.84882 14.776712 (PCDH20), mRNA. Homo sapiens lipopolysaccharide 1850564 NM_004139.2 LBP 1196.9959 14.71 1144 binding protein (LBP), mRNA. Homo sapiens cathepsin H (CTSH), 1980288 NM_004390.2 CTSH 5688.735 14.602688 transcript variant 1, mRNA. Homo sapiens G protein-coupled receptor, family C, group 5, member C 7510634 NM_018653.3 GPRC5C 3645.3774 14.433977 (GPRC5C), transcript variant 2, mRNA. Homo sapiens G protein-coupled receptor, family C, group 5, member C 1170477 NM_022036.2 GPRC5C 1620.2254 14.265128 (GPRC5C), transcript variant 1, mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 1455.8878 13.873955 complexing protein 2) (DPP4), mRNA. Homo sapiens lactotransferrin (LTF), 5550367 NM_002343.2 LTF 808.1354 13.152757 mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 1859.6239 13.141949 (HOXA9), mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 4323.2369 12.422905 (plasma) (GPX3), mRNA. Homo sapiens ephrin-Al (EFNA1), 3710397 NM_004428.2 EFNA1 3599.6814 12.041321 transcript variant 1, mRNA. Homo sapiens CD14 molecule (CD14), 6370369 NM_001040021.1 CD14 1203.7532 11.162752 transcript variant 2, mRNA. Homo sapiens 1980300 NM_153283.1 HYAL1 hyaluronoglucosaminidase 1 678.45693 10.959658 (HYAL1), transcript variant 3, mRNA. Homo sapiens transcobalamin II; 5670100 NM_000355.2 TCN2 2405.8639 10.830006 macrocytic anemia (TCN2), mRNA. Homo sapiens serum amyloid A2 4050291 NM_030754.2 SAA2 619.00664 10.180572 (SAA2), mRNA. Homo sapiens growth differentiation 5090671 NM_004864.1 GDF15 8218.4366 9.9332537 factor 15 (GDF15), mRNA. Homo sapiens ephrin-Al (EFNA1), 3390187 NM_004428.2 EFNA1 892.31032 9.6898869 transcript variant 1, mRNA. Homo sapiens crumbs homolog 3 7400524 NM_139161.2 CRB3 (Drosophila) (CRB3), transcript 986.70192 9.5428987 variant 2, mRNA.

Homo sapiens mucin 1, cell surface 7650026 NM_001044391.1 MUC1 associated (MUC1), transcript variant 6835.1305 9.3157818 6, mRNA.

Homo sapiens mucin 1, cell surface 7200601 NM_001044390.1 MUC1 associated (MUC1), transcript variant 3023.8209 9.31364 5, mRNA. Homo sapiens carboxypeptidase M 2510152 NM_001005502.1 CPM 587.10413 8.0722737 (CPM), transcript variant 3, mRNA. Homo sapiens kallikrein-related 2970154 NM_001012964.1 KLK6 peptidase 6 (KLK6), transcript variant 559.68909 7.9935692 B, mRNA. Homo sapiens lipocalin 2 (LCN2), 4390398 NM_005564.3 LCN2 1145.9794 7.9195608 mRNA. Homo sapiens UDP 1070088 NM_019075.2 UGT1A10 glucuronosyltransferase 1 family, 397.06726 7.7032079 polypeptide A10 (UGTl A10), mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 8803.474 7.4264518 (RARRES2), mRNA. Homo sapiens amiloride binding 5420440 NM_001091.2 ABP1 protein 1 (amine oxidase (copper- 442.74484 7.297426 containing)) (ABP1), mRNA. Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, 3710296 NM_000934.3 SERPINF2 450.75398 7.1669789 pigment epithelium derived factor), member 2 (SERPINF2), mRNA. Homo sapiens serum amyloid Al 2600424 NM_000331.3 SAA1 524.31453 7.1259185 (SAA1), transcript variant 1, mRNA. Homo sapiens somatostatin (SST), 15001 13 NM_001048.3 SST 318.93879 6.2743295 mRNA. Homo sapiens carbohydrate (N- 4760390 NM_03 1422.2 CHST9 acetylgalactosamine 4-0) 376.37087 6.0445355 sulfotransferase 9 (CHST9), mRNA. Homo sapiens protease, serine, 8 7210139 NM_002773.3 PRSS8 808.42448 5.9546328 (PRSS8), mRNA. Homo sapiens folate receptor 3 4010181 NM_000804.2 FOLR3 471.30324 5.953491 1 (gamma) (FOLR3), mRNA. Homo sapiens CD14 molecule (CD14), 7000369 NM_000591.2 CD14 368.96121 5.8154545 transcript variant 1, mRNA. Homo sapiens fucosidase, alpha-L- 1, 2060121 NM_000147.3 FUCA1 3620.2491 5.4305204 tissue (FUCA1), mRNA. Homo sapiens Fl l receptor (FUR), 3850561 NM_144504.1 F R 606.13997 5.4017786 transcript variant 5, mRNA. Homo sapiens cafhepsin H (CTSH), 4670162 NM_004390.3 CTSH 431.66962 5.2778335 transcript variant 1, mRNA. Homo sapiens crumbs homolog 3 4670402 NM_174881.2 CRB3 (Drosophila) (CRB3), transcript 477.61681 5.1964059 variant 3, mRNA. Homo sapiens acid phosphatase 5, 7050082 NM_00161 1.2 ACP5 500.48289 5.0541349 tartrate resistant (ACP5), mRNA. Homo sapiens serum amyloid A4, 3710022 NM_006512.1 SAA4 310.13038 4.9356058 constitutive (SAA4), mRNA. Homo sapiens coagulation factor XII 3610735 NM_000505.3 F12 1281.132 4.850063 (Hageman factor) (F12), mRNA. (IL4I1), transcript variant 2, mRNA. Homo sapiens nudix (nucleoside 110092 NM_177533.2 NUDT14 diphosphate linked moiety X)-type 2580.0512 3.7798878 motif 14 (NUDT14), mRNA. Homo sapiens carbonic anhydrase XI 5220482 NM_001217.3 CA1 1 883.19218 3.7650016 (CA1 1), mRNA. Homo sapiens cafhepsin C (CTSC), 3450138 NM_001814.2 CTSC 3312.0873 3.7407762 transcript variant 1, mRNA. Homo sapiens v-maf musculoaponeurotic fibrosarcoma 3610440 NM_005360.3 MAF 1337.6701 3.6688881 oncogene homolog (avian) (MAF), transcript variant 1, mRNA. Homo sapiens mucin 1, cell surface 520128 NM_002456.4 MUC1 associated (MUC1), transcript variant 287.9674 3.6395608 1, mRNA. Homo sapiens lipase, hepatic (LIPC), 2350044 NM_000236.1 LIPC 186.866 3.6371542 mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 654.04351 3.567966 variant 1, mRNA. Homo sapiens hypothetical protein 4830592 NM_173619.2 MGC34761 336.03097 3.5364005 MGC34761 (MGC34761), mRNA. Homo sapiens glucosaminyl (N-acetyl) transferase 2, 1-branching enzyme (I 6660369 NM_001491.2 GCNT2 391.1177 3.5251877 blood group) (GCNT2), transcript variant 2, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 6770333 NM_000295.3 SERPINA1 antiproteinase, antitrypsin), member 1 226.84366 3.4918082 (SERPINA1), transcript variant 1, mRNA. Homo sapiens sclerostin domain 4810273 NM_015464.2 SOSTDC1 349.92699 3.4893224 containing 1 (SOSTDC1), mRNA. Homo sapiens protein S (alpha) 6420008 NM_000313.1 PROS1 3015.2937 3.4457515 (PROS1), mRNA. Homo sapiens transmembrane 5960091 NM_019894.2 TMPRSS4 protease, serine 4 (TMPRSS4), 266.31091 3.319614 transcript variant 1, mRNA. Homo sapiens paraoxonase 2 (PON2), 3140390 NM_000305.2 PON2 8196.2295 3.2784906 transcript variant 1, mRNA. Homo sapiens collagen, type IV, alpha 6380066 NM_03 1365.2 COL4A3 3 (Goodpasture antigen) (COL4A3), 224.48717 3.2557817 transcript variant 5, mRNA. Homo sapiens mesofhelin (MSLN), 1230228 NM_013404.3 MSLN 341.25981 3.1727925 transcript variant 2, mRNA. Homo sapiens WNT1 inducible 3310333 NM_003880.2 WISP3 signaling pathway protein 3 (WISP3), 199.84056 3.171635 transcript variant 1, mRNA. Homo sapiens serum amyloid Al 130338 NM_000331.3 SAA1 229.93083 3.1645365 (SAA1), transcript variant 1, mRNA. Homo sapiens thromboxane A synthase 1 (platelet, cytochrome P450, 3940390 NM_001061.2 TBXAS1 369.67552 3.1360295 family 5, subfamily A) (TBXAS1), transcript variant TXS-I, mRNA. Homo sapiens phosphodiesterase 9A 830563 NM_001001567.1 PDE9A 454.25914 3.0974864 (PDE9A), transcript variant 2, mRNA. Homo sapiens coxsackie virus and 870161 NM_001338.3 CXADR adenovirus receptor (CXADR), 1003.5876 3.0894015 mRNA.

Homo sapiens lysophospholipase II 6480088 NM_007260.2 LYPLA2 833.21 15 2.6539349 (LYPLA2), mRNA. Homo sapiens solute carrier family 27 6250646 NM_012254.1 SLC27A5 (fatty acid transporter), member 5 431.66962 2.6149472 (SLC27A5), mRNA. PREDICTED: Homo sapiens major histocompatibility complex, class II, 780403 XM_936128.2 HLA-DQA1 130.81084 2.5988017 DQ alpha 1, transcript variant 10 (HLA-DQA1), mRNA. Homo sapiens plexin Bl (PLXNB1), 6330438 NM_002673.3 PLXNB1 666.96062 2.5649236 mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1583.3354 2.5554329 3) (LTBR), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARID1D), 171.24299 2.5478529 mRNA. Homo sapiens hydroxysteroid (17- 1450397 NM_014234.3 HSD17B8 beta) dehydrogenase 8 (HSD17B8), 556.59882 2.544614 mRNA. Homo sapiens glypican 4 (GPC4), 6330270 NM_001448.2 GPC4 1806.0094 2.5442574 mRNA. Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 4560288 NM_001982.2 ERBB3 248.16704 2.5207444 (avian) (ERBB3), transcript variant 1, mRNA. Homo sapiens UDP-N-acetyl-alpha-D- galactosamine:polypeptide N- 5310270 NM_024572.2 GALNT14 377.8331 1 2.5174213 acetylgalactosaminyltransferase 14 (GalNAc-T14) (GALNT14), mRNA. Homo sapiens histidine triad 1570370 NM_032593.2 HINT2 nucleotide binding protein 2 (HINT2), 2148.8673 2.5172379 mRNA. Homo sapiens haptoglobin (HP), 2640025 NM_005143.2 HP 151.64513 2.4910905 mRNA. Homo sapiens proteasome (prosome, macropain) subunit, beta type, 8 (large 3420632 NM_148919.3 PSMB8 514.70782 2.4514365 multifunctional peptidase 7) (PSMB8), transcript variant 2, mRNA. Homo sapiens secretoglobin, family 6840154 NM_002407.1 SCGB2A1 130.97478 2.4348138 2A, member 1 (SCGB2A1), mRNA. Homo sapiens phospholipase C, beta 4 6280097 NM_000933.2 PLCB4 333.30029 2.423837 (PLCB4), transcript variant 1, mRNA. Homo sapiens retinol dehydrogenase 1300187 NM_138412.2 RDH13 441.14049 2.3958634 13 (all-trans/9-cis) (RDH13), mRNA. Homo sapiens 24-dehydrocholesterol 4480341 NM_014762.3 DHCR24 940.33739 2.3941598 reductase (DHCR24), mRNA. Homo sapiens neuromedin B (NMB), 5670594 NM_021077.3 NMB 1157.5674 2.3821228 transcript variant 1, mRNA. Homo sapiens laminin, alpha 1 21901 13 NM_005559.2 LAMA1 329.1 2.3788761 (LAMA1), mRNA. Homo sapiens sulfide quinone 6770707 NM_02 1199.2 SQRDL reductase-like (yeast) (SQRDL), 675.4056 2.3666584 mRNA. Homo sapiens tumor necrosis factor receptor superfamily, member 6b, 6350184 NM_032945.2 TNFRSF6B 1083.6358 2.3574439 decoy (TNFRSF6B), transcript variant M68C, mRNA. Homo sapiens apolipoprotein M 3830022 NM_019101.2 APOM 334.58614 2.3493486 (APOM), mRNA. Homo sapiens heparan sulfate 6-0- 6100494 NM_147175.3 HS6ST2 sulfotransferase 2 (HS6ST2), transcript 176.75081 2.3488259 variant S, mRNA. Homo sapiens pyrophosphatase (inorganic) 2 (PPA2), nuclear gene 460630 NM_176866.2 PPA2 2575.9605 2.3357054 encoding mitochondrial protein, transcript variant 3, mRNA. Homo sapiens surfactant, pulmonary- 6510270 NM_003019.4 SFTPD 188.18201 2.3270815 associated protein D (SFTPD), mRNA. Homo sapiens syndecan 1 (SDC1), 6590592 NM_001006946.1 SDC1 2035.5823 2.3120122 transcript variant 1, mRNA. Homo sapiens poliovirus receptor 780524 NM_006505.2 PVR 538.80354 2.3037232 (PVR), mRNA. Homo sapiens crumbs homolog 3 3130561 NM_139161.2 CRB3 (Drosophila) (CRB3), transcript 123.6267 2.2792423 variant 2, mRNA. Homo sapiens chemokine (C-X3-C 630521 NM_002996.3 CX3CL1 264.61 195 2.2745291 motif) ligand 1 (CX3CL1), mRNA. Homo sapiens cafhepsin D (CTSD), 1110092 NM_001909.3 CTSD 4991.946 2.2716362 mRNA. Homo sapiens polymeric 50600 NM_002644.2 PIGR immunoglobulin receptor (PIGR), 131.57397 2.2663052 mRNA. Homo sapiens acyl-CoA synthetase 7040286 NM_016234.3 ACSL5 long-chain family member 5 (ACSL5), 214.49366 2.2652025 transcript variant 1, mRNA. Homo sapiens pantothenate kinase 1 6620133 NM_138316.2 PANK1 (PANK1), transcript variant gamma, 703.65796 2.2568443 mRNA. Homo sapiens B9 protein (EPPB9), 6040465 NM_0 1568 1.2 EPPB9 302.40841 2.2386501 mRNA. Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 3120608 NM_001005915.1 ERBB3 186.35767 2.2333433 (avian) (ERBB3), transcript variant s, mRNA. Homo sapiens RAS, dexamethasone- 2710735 NM_016084.3 RASD1 640.1292 2.2325848 induced 1 (RASD1), mRNA. Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 5700753 NM_001024912.1 CEACAM1 141.05206 2.21 1037 1 (biliary glycoprotein) (CEACAM1), transcript variant 2, mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 159.94351 2.2061336 chromosome Y. Homo sapiens cafhepsin O (CTSO), 1820300 NM_001334.2 CTSO 894.7826 2.1745221 mRNA. Homo sapiens retinol dehydrogenase 2340494 NM_016026.2 RDH1 1 11 (all-trans/9-cis/l l-cis) (RDH1 1), 1153.2917 2.1690928 mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM 14A similarity 14, member A (FAM14A), 1668.6619 2.150379 mRNA. Homo sapiens mitochondrial ribosomal protein L43 (MRPL43), nuclear gene 6940521 NM_0321 12.2 MRPL43 1141.281 2.1306801 encoding mitochondrial protein, transcript variant 1, mRNA. Homo sapiens hypothetical protein 2900139 NM_017842.1 FLJ20489 524.31453 2.1301484 FLJ20489 (FLJ20489), mRNA. Homo sapiens apolipoprotein A-I 1570725 NM_144772.1 APOA1BP 3295.0063 2.1280988 binding protein (APOA1BP), mRNA. Homo sapiens Fl l receptor (FUR), 50307 NM_016946.3 F R 147.22935 2.1197276 transcript variant 1, mRNA. Homo sapiens amylase, alpha 2B 7000754 NM_020978.3 AMY2B 124.40767 2.09341 (pancreatic) (AMY2B), mRNA. Homo sapiens engulfment and cell 4920121 NM_024712.3 ELM03 169.38496 2.0926668 motility 3 (ELM03), mRNA. Homo sapiens chromosome 6 open 2570068 NM_145267.2 C6orf57 531.23201 2.0905527 reading frame 57 (C6orf57), mRNA. Homo sapiens CD58 molecule (CD58), 5900594 NM_001779.1 CD58 1084.1274 2.0746945 mRNA. Homo sapiens heparanase (HPSE), 630619 NM_006665.3 HPSE 136.38591 2.0746731 mRNA. Homo sapiens proteasome (prosome, macropain) subunit, beta type, 8 (large 3180026 NM_148919.3 PSMB8 740.26445 2.0683234 multifunctional peptidase 7) (PSMB8), transcript variant 2, mRNA. Homo sapiens cafhepsin B (CTSB), 60121 NM_001908.3 CTSB 10828.476 2.0676763 transcript variant 1, mRNA. Homo sapiens carbonic anhydrase XII 3830075 NM_001218.3 CA12 654.39322 2.0639689 (CA12), transcript variant 1, mRNA. Homo sapiens proteasome (prosome, macropain) subunit, beta type, 8 (large 4210706 NM_004159.4 PSMB8 167.93289 2.0615701 multifunctional peptidase 7) (PSMB8), transcript variant 1, mRNA. Homo sapiens prohibitin (PHB), 4280204 NM_002634.2 PHB 2098.8739 2.0544072 mRNA. Homo sapiens NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa 1070538 NM_002496.1 NDUFS8 10528.006 2.0463324 (NADH-coenzyme Q reductase) (NDUFS8), mRNA. Homo sapiens homeobox A9 6420020 NM_152739.3 HOXA9 109.00767 2.0432491 (HOXA9), mRNA. Homo sapiens growth differentiation 2690168 NM_000557.2 GDF5 269.84395 2.0087329 factor 5 (GDF5), mRNA. Homo sapiens chromosome 20 open 5550204 NM_023935.1 C20orfll6 reading frame 116 (C20orfl l6), 2473.5302 2.0079934 mRNA. PREDICTED: Homo sapiens cystatin 4010491 XM_001129442.1 CST6 182.95737 2.0007225 EM (CST6), mRNA.

HA P3 Normal human astrocytes Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave. Homo sapiens scrapie responsive 1110048 NM_007281.1 SCRG1 15425.628 11.658739 protein 1 (SCRG1), mRNA. Homo sapiens angiopoietin 2 3450066 NM_001147.1 ANGPT2 643.93451 7.2820526 (ANGPT2), mRNA. Homo sapiens secreted frizzled-related 3060639 NM_003013.2 SFRP2 7077.169 7.086917 protein 2 (SFRP2), mRNA. Homo sapiens dehydrogenase/reductase (SDR family) 630315 NM_005771.3 DHRS9 774.95413 6.5392033 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens chemokine (C-C motif) 1030333 NM_002982.3 CCL2 14079.27 5.7312287 ligand 2 (CCL2), mRNA. Homo sapiens endofhelin 2 (EDN2), 6400598 NM_001956.2 EDN2 302.48746 4.8816715 mRNA. Homo sapiens Kallmann syndrome 1 6620008 NM_000216.2 KALI 2333.3537 4.8662503 sequence (KALI), mRNA. Homo sapiens bone morphogenetic 990075 NM_1 3085 1.1 BMP4 protein 4 (BMP4), transcript variant 3, 2 118.3938 4.71 11499 mRNA. Homo sapiens growth differentiation 5690095 NM_004962.2 GDF10 734.56077 4.6825425 factor 10 (GDF10), mRNA. Homo sapiens Norrie disease 2320598 NM_000266.1 NDP 970.10568 4.6786944 (pseudoglioma) (NDP), mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 1018.4325 4.6461251 c, mRNA. Homo sapiens glypican 4 (GPC4), 6330270 NM_001448.2 GPC4 3291.7606 4.6373436 mRNA. Homo sapiens neuregulin 1 (NRG1), 1940128 NM_013962.2 NRG1 654.27537 4.5946624 transcript variant GGF2, mRNA. Homo sapiens like-glycosyltransferase 10768 NM_004737.3 LARGE 2224.1767 4.4321434 (LARGE), transcript variant 1, mRNA. Homo sapiens leucine rich repeat 6510762 NM_020873.5 LRRN1 673.17397 4.2988461 neuronal 1 (LRRN1), mRNA. Homo sapiens myosin light chain 1300286 NM_053026.3 MYLK kinase (MYLK), transcript variant 2, 961.11637 4.288721 mRNA. Homo sapiens collagen, type IX, alpha 6380040 NM_001852.3 COL9A2 2592.795 4.2329242 2 (COL9A2), mRNA. Homo sapiens hypothetical protein 4830592 NM_173619.2 MGC34761 397.90678 4.1875834 MGC34761 (MGC34761), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 1733.7705 4.0527099 mRNA. Homo sapiens carboxypeptidase A4 520682 NM_016352.2 CPA4 5875.8047 4.0317962 (CPA4), mRNA. Homo sapiens growth differentiation 5090671 NM_004864.1 GDF15 3322.6796 4.0159731 factor 15 (GDF15), mRNA. Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CESl (monocyte/macrophage serine esterase 245.18496 3.9602813 1) (CESl), transcript variant 1, mRNA. Homo sapiens fhrombospondin 3 1260039 NM_0071 12.3 THBS3 1245.4686 3.8147958 (THBS3), mRNA. Homo sapiens urotensin 2 (UTS2), 2710315 NM_006786.2 UTS2 216.9295 3.720322 transcript variant 2, mRNA. Homo sapiens bone morphogenetic 6980064 NM_001718.4 BMP6 366.97965 3.4838907 protein 6 (BMP6), mRNA. Homo sapiens cystatin E M (CST6), 1070333 NM_001323.2 CST6 308.56504 3.4790514 mRNA. Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 704.15074 3.4433271 b, mRNA. Homo sapiens multiple EGF-like- 270201 NM_032446.1 MEGF10 612.23687 3.3443404 domains 10 (MEGF10), mRNA. Homo sapiens proprotein convertase 4210678 NM_0 1327 1.2 PCSK1N subtilisin/kexin type 1 inhibitor 934.77965 3.3223148 (PCSK1N), mRNA. Homo sapiens RGM domain family, 6020682 NM_02021 1.1 RGMA 945.64558 3.3042315 member A (RGMA), mRNA. Homo sapiens lipase, endothelial 7210681 NM_006033.2 LIPG 656.10295 3.2519305 (LIPG), mRNA. Homo sapiens midkine (neurite 4560717 NM_001012334.1 MDK growth-promoting factor 2) (MDK), 12690.348 3.2362673 transcript variant 1, mRNA.

Homo sapiens midkine (neurite 150458 NM_001012334.1 MDK growth-promoting factor 2) (MDK), 244.93348 2.3751858 transcript variant 1, mRNA. Homo sapiens EMI domain containing 6100487 NM_133455.2 EMID1 141.71091 2.3517902 1 (EMID1), mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6250563 NM_004105.3 EFEMP1 1864.7771 2.3478481 (EFEMP1), transcript variant 1, mRNA. Homo sapiens collagen, type XXII, 4250408 NM_152888.1 COL22A1 274.42596 2.3147391 alpha 1 (COL22A1), mRNA. Homo sapiens prickle homolog 1 1770224 NM_153026.1 PRICKLE 1 4944.818 2.3105679 (Drosophila) (PRICKLE 1), mRNA. Homo sapiens protocadherin 20 5900376 NM_022843.2 PCDH20 141.44882 2.3073921 (PCDH20), mRNA. Homo sapiens EPH receptor A3 4040544 NM_005233.3 EPHA3 145.23156 2.3052959 (EPHA3), transcript variant 1, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 5690167 NM_004186.2 SEMA3F 319.87537 2.3012246 basic domain, secreted, (semaphorin) 3F (SEMA3F), mRNA. Homo sapiens F-box protein 2 4540215 NM_012168.4 FBX02 386.57773 2.2952571 (FBX02), mRNA. Homo sapiens urotensin 2 (UTS2), 5290762 NM_006786.2 UTS2 137.97994 2.2679028 transcript variant 2, mRNA. Homo sapiens astrotactin 2 (ASTN2), 360025 NM_198186.2 ASTN2 343.48201 2.2595224 transcript variant 2, mRNA. Homo sapiens prepronociceptin 2350278 NM_006228.3 PNOC 117.69159 2.2549228 (PNOC), mRNA. Homo sapiens fibroblast growth factor 4480220 NM_021923.3 FGFRL1 receptor-like 1 (FGFRLl), transcript 2126.9951 2.251 1282 variant 3, mRNA. Homo sapiens mesofhelin (MSLN), 1230228 NM_013404.3 MSLN 241.14137 2.2419621 transcript variant 2, mRNA. Homo sapiens UDP-N-acetyl-alpha-D- galactosamine:polypeptide N- 3610202 NM_017540.3 GALNTIO acetylgalactosaminyltransferase 10 2032.9091 2.2322257 (GalNAc-TlO) (GALNTIO), transcript variant 2, mRNA.

Homo sapiens interleukin 17 receptor 3450091 NM_0 17563.1 IL17RD 140.82935 2.2048431 D (IL17RD), mRNA. Homo sapiens netrin Gl (NTNG1), 6940053 NM_014917.2 NTNG1 266.70885 2.2024641 transcript variant 3, mRNA. Homo sapiens glypican 6 (GPC6), 2370593 NM_005708.2 GPC6 1016.4631 2.1977541 mRNA. Homo sapiens kallikrein 1 (KLKl), 650561 NM_002257.2 KLK1 182.32035 2.1929123 mRNA. Homo sapiens hypothetical protein 2900139 NM_017842.1 FLJ20489 536.43289 2.1793821 FLJ20489 (FLJ20489), mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 2571.7521 2.1694836 (RARRES2), mRNA. Homo sapiens aspartylglucosaminidase 130064 NM_000027.2 AGA 1035.0035 2.1550395 (AGA), mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6900408 NM_001039348.1 EFEMP1 9787.0721 2.1415571 (EFEMP1), transcript variant 2, mRNA. Homo sapiens carboxypeptidase, 1400703 NM_019029.2 CPVL vitellogenic-like (CPVL), transcript 242.67876 2.110955 variant 2, mRNA. Homo sapiens Sin3A-associated 1780673 NM_003864.3 SAP30 1232.8431 2.1059772 protein, 30kDa (SAP30), mRNA. Homo sapiens fibrillin 2 (congenital 3440204 NM_001999.3 FBN2 contractural arachnodactyly) (FBN2), 3950.827 2.0921053 mRNA. Homo sapiens nudix (nucleoside 110092 NM_177533.2 NUDT14 diphosphate linked moiety X)-type 1422.4233 2.0839123 motif 14 (NUDT14), mRNA. Homo sapiens cysteine sulfinic acid 2810255 NM_015989.3 CSAD 702.78466 2.0821998 decarboxylase (CSAD), mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 381.46593 2.0809892 variant 1, mRNA. Homo sapiens dystrophin (muscular dystrophy, Duchenne and Becker 3870598 NM_004019.1 DMD 154.83215 2.079479 types) (DMD), transcript variant Dp40, mRNA. Homo sapiens fucosidase, alpha-L- 1, 2060121 NM_000147.3 FUCA1 1344.276 2.0164684 tissue (FUCA1), mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 283.55133 2.0050612 mRNA.

REM RPE Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave. Homo sapiens growth differentiation 5690095 NM_004962.2 GDF10 8152.2937 51.967738 factor 10 (GDF10), mRNA. Homo sapiens alpha-2-macroglobulin 2370438 NM_000014.4 A2M 3336.4183 33.207296 (A2M), mRNA. Homo sapiens cerebellin 1 precursor 21401 13 NM_004352.1 CBLN1 1141.7858 19.909772 (CBLN1), mRNA. Homo sapiens EPH receptor A3 4040544 NM_005233.3 EPHA3 809.96578 12.856784 (EPHA3), transcript variant 1, mRNA. Homo sapiens EGF-like-domain, 6330079 NM_015507.2 EGFL6 1924.9196 10.908357 multiple 6 (EGFL6), mRNA. Homo sapiens lymphocyte antigen 6 6180706 NM_002347.2 LY6H 662.1854 10.146478 complex, locus H (LY6H), mRNA. Homo sapiens leucine rich repeat 6510762 NM_020873.5 LPvRNl 1474.1922 9.4140974 neuronal 1 (LRRN1), mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 823.72699 7.4429921 complex, locus H (LY6H), mRNA. Homo sapiens major histocompatibility 2570564 NM_0191 11.3 HLA-DRA complex, class II, DR alpha (HLA- 666.73776 6.8133126 DRA), mRNA. Homo sapiens transforming growth 1030008 NM_003239.1 TGFB3 2437.3795 5.7899451 factor, beta 3 (TGFB3), mRNA. Homo sapiens glypican 4 (GPC4), 6330270 NM_001448.2 GPC4 4021.6108 5.6655368 mRNA. Homo sapiens proprotein convertase 4210678 NM_0 1327 1.2 PCSK1N subtilisin/kexin type 1 inhibitor 1414.6617 5.0278709 (PCSK1N), mRNA. Homo sapiens tweety homolog 1 50719 NM_020659.2 TTYH1 (Drosophila) (TTYH1), transcript 431.46106 4.8088267 variant 1, mRNA.

Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 8283.9748 2.4536529 mRNA. Homo sapiens Nedd4 family 60553 NM_030571.2 NDFIP1 interacting protein 1 (NDFIP1), 812.07035 2.4449195 mRNA. Homo sapiens plasticity-related gene 2 1580195 NM_024888.1 PRG2 227.11 165 2.438097 (PRG2), mRNA. Homo sapiens collectin sub-family 2100767 NM_130386.1 COLEC12 3726.6323 2.4329691 member 12 (COLEC12), mRNA. Homo sapiens carboxypeptidase E 5390687 NM_001873.1 CPE 2148.8673 2.4010589 (CPE), mRNA. Homo sapiens leucine rich repeat 2370041 NM_018334.3 LRRN3 193.11608 2.38516 neuronal 3 (LRRN3), mRNA. Homo sapiens heparan sulfate 6-0- 6100494 NM_147175.3 HS6ST2 sulfotransferase 2 (HS6ST2), transcript 179.10752 2.380144 variant S, mRNA. Homo sapiens immunoglobulin 2900674 NM_001542.2 IGSF3 superfamily, member 3 (IGSF3), 1025.8981 2.3788328 transcript variant 1, mRNA. Homo sapiens pleiotrophin (heparin binding growth factor 8, neurite 4920576 NM_002825.5 PTN 2287.2013 2.3700464 growth-promoting factor 1) (PTN), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 12690.348 2.3213228 mRNA. Homo sapiens retinoic acid receptor, 830736 NM_000965.2 RARB beta (RARB), transcript variant 1, 271.82463 2.319575 mRNA. Homo sapiens protein tyrosine 3940541 NM_030671.1 PTPRO phosphatase, receptor type, O 189.31534 2.31 12173 (PTPRO), transcript variant 5, mRNA. Homo sapiens protein tyrosine 1660386 NM_030667.1 PTPRO phosphatase, receptor type, O 162.7671 1 2.3055103 (PTPRO), transcript variant 1, mRNA. Homo sapiens protocadherin 20 5900376 NM_022843.2 PCDH20 141.0205 2.3004052 (PCDH20), mRNA. Homo sapiens chemokine (C-C motif) 1030333 NM_002982.3 CCL2 5609.1248 2.2832985 ligand 2 (CCL2), mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 1696.8497 2.2651465 mRNA. Homo sapiens acid phosphatase 6, 4670671 NM_016361.2 ACP6 380.90494 2.226162 lysophosphatidic (ACP6), mRNA. Homo sapiens leukemia inhibitory 430079 NM_002310.3 LIFR 218.24381 2.1967118 factor receptor alpha (LIFR), mRNA. Homo sapiens like-glycosyltransferase 10768 NM_004737.3 LARGE 1097.2763 2.1865555 (LARGE), transcript variant 1, mRNA. Homo sapiens prickle homolog 1 1770224 NM_153026.1 PRICKLE 1 4635.09 2.1658412 (Drosophila) (PRICKLE 1), mRNA. Homo sapiens glycogenin 2 (GYG2), 4830451 NM_003918.1 GYG2 253.45324 2.151 1057 mRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 1099.9468 2.1495664 transcript variant 2, mRNA. Homo sapiens glypican 6 (GPC6), 2370593 NM_005708.2 GPC6 993.46047 2.1480187 mRNA. Homo sapiens multimerin 1 1050008 NM_007351.2 MMRN1 139.82109 2.1469649 (MMRN1), mRNA. Homo sapiens glypican 2 (GPC2), 3390328 NM_152742.1 GPC2 297.49646 2.1424426 mRNA. Homo sapiens peptidase inhibitor 15 4490626 NM_015886.3 PI15 347.59735 2.138408 (PI15), mRNA. Homo sapiens trefoil factor 3 7570484 NM_003226.2 TFF3 266.45479 2.131776 (intestinal) (TFF3), mRNA. Homo sapiens calcium/calmodulin- dependent protein kinase ID 4210022 NM_153498.2 CAMK1D 523.19454 2.1195312 (CAMK1D), transcript variant 2, mRNA. Homo sapiens neuromedin B (NMB), 5670594 NM_021077.3 NMB 1019.702 2.0984137 transcript variant 1, mRNA. Homo sapiens integrin, beta 4 1570598 NM_001005731.1 ITGB4 259.97795 2.0877355 (ITGB4), transcript variant 3, mRNA. Homo sapiens frizzled-related protein 33701 13 NM_001463.2 FRZB 1595.4962 2.0368166 (FRZB), mRNA. Homo sapiens ciliary neurotrophic 6560487 NM_001842.3 CNTFR factor receptor (CNTFR), transcript 135.29041 2.0342232 variant 2, mRNA. Homo sapiens neuronal pentraxin II 6420050 NM_002523.1 NPTX2 365.54801 2.0282033 (NPTX2), mRNA. Homo sapiens G protein-coupled receptor, family C, group 5, member C 7510634 NM_018653.3 GPRC5C 507.92706 2.01 11518 (GPRC5C), transcript variant 2, mRNA.

HSMM P3 Human skeletal muscle myoblasts Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave. Homo sapiens calsequestrin 2 (cardiac 6620035 NM_001232.2 CASQ2 16447.124 209.70312 muscle) (CASQ2), mRNA. Homo sapiens histidine rich calcium 1580037 NM_002152.2 HRC 9787.0721 128.44443 binding protein (HRC), mRNA. Homo sapiens cytochrome c oxidase subunit Via polypeptide 2 (COX6A2), 1990437 NM_005205.2 COX6A2 3950.827 70.141859 nuclear gene encoding mitochondrial protein, mRNA. Homo sapiens coiled-coil domain 780341 NM_03 1455.2 CCDC3 5639.4535 33.062809 containing 3 (CCDC3), mRNA. 4760040 NM_004543.3 NEB Homo sapiens nebulin (NEB), mRNA. 2249.532 30.957561 Homo sapiens receptor-associated 4780370 NM_005055.3 RAPSN protein of the synapse (RAPSN), 4712.6193 28.339276 transcript variant 1, mRNA. Homo sapiens coagulation factor XIII, 2230241 NM_000129.3 F13A1 1531.1832 25.573257 Al polypeptide (F13A1), mRNA. Homo sapiens ladinin 1 (LAD1), 1170349 NM_005558.3 LAD1 4052.9354 22.644982 mRNA. Homo sapiens calcium/calmodulin- dependent protein kinase (CaM kinase) 5130593 NM_172080.1 CAMK2B 1943.1 158 21.721035 II beta (CAMK2B), transcript variant 4, mRNA. Homo sapiens neuronal pentraxin II 6420050 NM_002523.1 NPTX2 3775.3412 20.947069 (NPTX2), mRNA. Homo sapiens apolipoprotein C-I 3830465 NM_001645.3 APOC1 4264.5345 20.72523 (APOC1), mRNA. Homo sapiens Ras association 10639 NM_032023.3 RASSF4 (RalGDS/AF-6) domain family 3350.2642 19.105764 member 4 (RASSF4), mRNA. Homo sapiens myosin, heavy chain 1, 110768 NM_005963.3 MYH1 skeletal muscle, adult (MYH1), 891.25472 15.527401 mRNA. Homo sapiens receptor-associated 6370035 NM_005055.3 RAPSN protein of the synapse (RAPSN), 825.9309 12.545667 transcript variant 1, mRNA. Homo sapiens germ cell associated 1 2370022 NM_001080554.1 GSG1 571.26416 10.862769 (GSG1), transcript variant 3, mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 966.3233 10.235037 2, mRNA. Homo sapiens multiple EGF-like- 270201 NM_032446.1 MEGF10 1838.3919 10.042205 domains 10 (MEGF10), mRNA. Homo sapiens SLIT and NTRK-like 7330477 NM_173078.2 SLITRK4 1230.8966 9.8898491 family, member 4 (SLITRK4), mRNA. Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 4560288 NM_001982.2 ERBB3 841.11785 8.5436131 (avian) (ERBB3), transcript variant 1, mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 996.85029 8.3679615 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens cafhepsin H (CTSH), 1980288 NM_004390.2 CTSH 3080.2386 7.9068131 transcript variant 1, mRNA. Homo sapiens calcium/calmodulin- dependent protein kinase (CaM kinase) 1710131 NM_172078.1 CAMK2B 469.14056 7.821982 II beta (CAMK2B), transcript variant 2, mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 570.30059 7.7636549 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens fibroblast growth factor 6420746 NM_002010.1 FGF9 9 (glia-activating factor) (FGF9), 453.2368 7.6026629 mRNA. Homo sapiens integrin, alpha 6 2140678 NM_000210.2 ITGA6 9 11.89159 7.4824783 (ITGA6), transcript variant 2, mRNA. Homo sapiens KiSS-1 metastasis- 5820189 NM_002256.3 KISS1 1193.6432 7.1409067 suppressor (KISS1), mRNA. Homo sapiens G protein-coupled receptor, family C, group 5, member C 7510634 NM_018653.3 GPRC5C 1658.4625 6.5667301 (GPRC5C), transcript variant 2, mRNA. Homo sapiens nudix (nucleoside 110092 NM_177533.2 NUDT14 diphosphate linked moiety X)-type 4458.1727 6.5314179 motif 14 (NUDT14), mRNA. Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 3120608 NM_001005915.1 ERBB3 526.99543 6.3156066 (avian) (ERBB3), transcript variant s, mRNA. Homo sapiens arginyltransferase 1 4150626 NM_007041.2 ATE1 382.15236 6.1976782 (ATE1), transcript variant 2, mRNA. Homo sapiens Ras association 540564 NM_032023.3 RASSF4 (RalGDS/AF-6) domain family 509.75723 6.1681629 member 4 (RASSF4), mRNA. Homo sapiens integrin beta 1 binding 2810192 NM_170678.2 ITGB1BP3 943.65413 6.1463138 protein 3 (ITGB1BP3), mRNA. Homo sapiens calcium/calmodulin- dependent protein kinase (CaM kinase) 6220484 NM_172081.1 CAMK2B 387.13805 6.0672788 II beta (CAMK2B), transcript variant 5, mRNA. Homo sapiens G protein-coupled receptor, family C, group 5, member C 1170477 NM_022036.2 GPRC5C 657.60406 5.7898154 (GPRC5C), transcript variant 1, mRNA. Homo sapiens zinc finger protein 533 5290333 NM_152520.3 ZNF533 508.1674 5.7827603 (ZNF533), mRNA. Homo sapiens syntrophin, beta 1 (dystrophin-associated protein Al, 3420739 NM_021021.2 SNTB1 1973.5556 5.7761976 59kDa, basic component 1) (SNTB1), mRNA. Homo sapiens CUG triplet repeat, 5390575 NM_006561.2 CUGBP2 RNA binding protein 2 (CUGBP2), 391.89779 5.7401282 transcript variant 2, mRNA. Homo sapiens CUG triplet repeat, 7400133 NM_001025077.2 CUGBP2 RNA binding protein 2 (CUGBP2), 363.17861 5.6215856 transcript variant 3, mRNA. Homo sapiens T-box 1 (TBX1), 460575 NM_080647.1 TBX1 478.13186 5.5184978 transcript variant C, mRNA. Homo sapiens natriuretic peptide 6270739 NM_006172.2 NPPA 316.78407 5.4456892 precursor A (NPPA), mRNA. Homo sapiens heparan sulfate 6-0- 830491 NM_001077188.1 HS6ST2 sulfotransferase 2 (HS6ST2), transcript 439.52537 5.3285749 variant L, mRNA. Homo sapiens SPARC-like 1 (mast9, 6960148 NM_004684.2 SPARCL1 603.1854 5.1089633 hevin) (SPARCL1), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 6280168 NM_001085.4 SERPINA3 7509.4586 5.096531 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. Homo sapiens angiotensinogen (serpin 2850301 NM_000029.2 AGT peptidase inhibitor, clade A, member 466.87183 4.9741 194 8) (AGT), mRNA. Homo sapiens chordin (CHRD), 5570592 NM_003741.2 CHRD 377.88968 4.9086322 mRNA. Homo sapiens glypican 2 (GPC2), 3390328 NM_152742.1 GPC2 657.02493 4.7316133 mRNA. Homo sapiens inter-alpha (globulin) inhibitor H4 (plasma Kallikrein- 3710343 NM_002218.3 ITIH4 249.32861 4.5132118 sensitive glycoprotein) (ITIH4), mRNA. Homo sapiens ectonucleotide 3060471 NM_014936.3 ENPP4 pyrophosphatase/phosphodiesterase 4 341.66394 4.4758093 (putative function) (ENPP4), mRNA. Homo sapiens bladder cancer 2690524 NM_006698.2 BLCAP 3 115.8347 4.4514933 associated protein (BLCAP), mRNA. Homo sapiens POU class 4 homeobox 7400598 NM_006237.3 POU4F1 240.55929 4.4135184 1 (POU4F1), mRNA. Homo sapiens glycogen synthase 1 5570270 NM_002103.3 GYS1 1253.3695 4.3309008 (muscle) (GYS1), mRNA. Homo sapiens prostaglandin D2 1820379 NM_000954.5 PTGDS synthase 21kDa (brain) (PTGDS), 9282.15 4.3170627 mRNA. Homo sapiens T-box 1 (TBX1), 4880730 NM_005992.1 TBX1 406.58289 4.2029731 transcript variant B, mRNA. member 1 (SERPFNF1), mRNA.

Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 270.17471 2.9433703 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens neurotrophin 3 (NTF3), 2940441 NM_002527.3 NTF3 599.0581 1 2.9430227 mRNA. Homo sapiens poliovirus receptor 780524 NM_006505.2 PVR 674.80383 2.8852097 (PVR), mRNA. Homo sapiens acetylcholinesterase (Yt 1170594 NM_000665.3 ACHE blood group) (ACHE), transcript 175.69602 2.8740884 variant E4-E6, mRNA. Homo sapiens SRY (sex determining 1300445 NM_178424.1 SOX30 region Y)-box 30 (SOX30), transcript 189.76283 2.866364 variant 1, mRNA. Homo sapiens RGM domain family, 840553 NM_001012761.1 RGMB member B (RGMB), transcript variant 1219.7878 2.8650747 1, mRNA. Homo sapiens similar to CG12314 1980474 NM_178836.2 LOC201 164 180.99189 2.864179 gene product (LOC201 164), mRNA. Homo sapiens pre-B lymphocyte gene 4640768 NM_013378.1 VPREB3 196.36637 2.8526578 3 (VPREB3), mRNA. Homo sapiens UDP-Gal:betaGlcNAc 4590008 NM_003783.2 B3GALT2 beta 1,3-galactosyltransferase, 262.78149 2.8232733 polypeptide 2 (B3GALT2), mRNA. Homo sapiens collagen, type XXIII, 2350441 NM_173465.2 COL23A1 216.3081 1 2.7951 188 alpha 1 (COL23A1), mRNA. Homo sapiens collagen, type XXV, 3180035 NM_032518.2 COL25A1 alpha 1 (COL25A1), transcript variant 149.1 1357 2.7667541 2, mRNA. Homo sapiens sparc/osteonectin, cwcv 3840554 NM_014767.1 SPOCK2 and kazal-like domains proteoglycan 309.69985 2.7552065 (testican) 2 (SPOCK2), mRNA. Homo sapiens chromosome 10 open 1110201 NM_00103 1746.2 C10orf72 reading frame 72 (C10orf72), 324.61423 2.7486732 transcript variant 1, mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 4490563 NM_172244.2 SGCD 194.14572 2.6985473 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens FERM and PDZ domain 5870639 NM_014907.1 FRMPD1 223.77736 2.6639918 containing 1 (FRMPD1), mRNA. Homo sapiens serum amyloid A4, 3710022 NM_006512.1 SAA4 165.94572 2.6409623 constitutive (SAA4), mRNA. Homo sapiens phospholipase A2, 2600170 NM_003561.1 PLA2G10 172.39469 2.5989497 group X (PLA2G10), mRNA. Homo sapiens chromosome 6 open 2570068 NM_145267.2 C6orf57 656.10295 2.5819562 reading frame 57 (C6orf57), mRNA. Homo sapiens mitochondrial ribosomal protein L46 (MRPL46), nuclear gene 4210762 NM_022163.2 MRPL46 2345.1658 2.5481442 encoding mitochondrial protein, mRNA. Homo sapiens chromogranin B 6420356 NM_001819.1 CHGB 178.16822 2.5028726 (secretogranin 1) (CHGB), mRNA. Homo sapiens interleukin 20 receptor, 6450482 NM_014432.2 IL20RA 190.30752 2.4835561 alpha (IL20RA), mRNA. PREDICTED: Homo sapiens cystatin 4010491 XM_001129442.1 CST6 225.83923 2.4696552 EM (CST6), mRNA. Homo sapiens granulysin (GNLY), 5360064 NM_012483.1 ONLY 162.57286 2.4527946 transcript variant 519, mRNA. Homo sapiens chromosome 7 open reading frame 20 (C7orf20), mRNA. 2900504 NM_015949.2 C7orf20 957.5028 2.4384433 XM_946081 XM_946082 XM_946083 Homo sapiens non-metastatic cells 1, 7560673 NM_000269.2 NME1 protein (NM23A) expressed in 636.47094 2.4067983 (NME1), transcript variant 2, mRNA. Homo sapiens mitochondrial ribosomal protein S5 (MRPS5), nuclear gene 10343 NM_03 1902.3 MRPS5 1631.0776 2.3944407 encoding mitochondrial protein, mRNA. Homo sapiens ADP-ribosylhydrolase 5570446 NM_138430.3 ADPRHL1 like 1 (ADPRHL1), transcript variant 169.34366 2.3693007 1, mRNA. Homo sapiens mitogen-activated 1440440 NM_004635.3 MAPKAPK3 protein kinase-activated protein kinase 2543.8603 2.3677297 3 (MAPKAPK3), mRNA. Homo sapiens translocase of outer mitochondrial membrane 70 homolog 1400435 NM_014820.3 TOMM70A A (S. cerevisiae) (TOMM70A), 4104.5745 2.3670914 nuclear gene encoding mitochondrial protein, mRNA. Homo sapiens wingless-type MMTV 6840202 NM_030761.3 WNT4 integration site family, member 4 134.51866 2.3652283 (WNT4), mRNA. Homo sapiens chromosome 3 open 6220685 NM_016589.3 C3orfl 325.74676 2.3637212 reading frame 1 (C3orfl), mRNA. Homo sapiens engrailed homeobox 1 5820025 NM_001426.3 EN1 161.01342 2.3573674 (EN1), mRNA. Homo sapiens hypothetical protein 6580400 NM_018215.2 FLJ10781 604.91062 2.3501226 FLJ10781 (FLJ10781), mRNA. Homo sapiens germ cell associated 1 3930341 NM_001080554.1 GSG1 141.69558 2.341356 (GSG1), transcript variant 3, mRNA. Homo sapiens elastase 2, neutrophil 7650497 NM_001972.2 ELA2 156.07345 2.3129122 (ELA2), mRNA. Homo sapiens mitochondrial ribosomal protein L32 (MRPL32), nuclear gene 4480327 NM_03 1903.1 MRPL32 2505.0665 2.2701862 encoding mitochondrial protein, mRNA. Homo sapiens myeloperoxidase 3520601 NM_000250.1 MPO (MPO), nuclear gene encoding 120.59543 2.2570238 mitochondrial protein, mRNA. Homo sapiens protein tyrosine 1110561 NM_007079.2 PTP4A3 phosphatase type IVA, member 3 253.77028 2.2478194 (PTP4A3), transcript variant 2, mRNA. Homo sapiens glycine cleavage system 60196 NM_004483.3 GCSH protein H (aminomethyl carrier) 594.60221 2.2292727 (GCSH), mRNA. Homo sapiens leucine rich repeat 6510762 NM_020873.5 LRRN1 348.79853 2.2274052 neuronal 1 (LRRN1), mRNA. Homo sapiens protein tyrosine 5910594 NM_007079.2 PTP4A3 phosphatase type IVA, member 3 264.2528 2.2120379 (PTP4A3), transcript variant 2, mRNA. Homo sapiens mitochondrial ribosomal protein L43 (MRPL43), nuclear gene 6620181 NM_176792.1 MRPL43 190.07153 2.2038651 encoding mitochondrial protein, transcript variant 2, mRNA. Homo sapiens hydroxysteroid (17- 1450397 NM_014234.3 HSD17B8 beta) dehydrogenase 8 (HSD17B8), 477.39558 2.1825189 mRNA.

Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6900408 NM_001039348.1 EFEMP1 22849.356 4.9997794 (EFEMP1), transcript variant 2, mRNA. Homo sapiens POU class 4 homeobox 7400598 NM_006237.3 POU4F1 255.44078 4.6865477 1 (POU4F1), mRNA. Homo sapiens calcium/calmodulin- dependent protein kinase (CaM kinase) 5130593 NM_172080.1 CAMK2B 407.4559 4.554728 II beta (CAMK2B), transcript variant 4, mRNA. Homo sapiens chemokine (C-C motif) 1030333 NM_002982.3 CCL2 10948.097 4.4566264 ligand 2 (CCL2), mRNA. Homo sapiens ADAM metallopeptidase domain 15 1980553 NM_003815.3 ADAM 15 1159.632 4.3974635 (ADAM15), transcript variant 2, mRNA. Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 884.95074 4.3274468 b, mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-1 beta (PTX3), 613.29277 3.8636445 mRNA. Homo sapiens interleukin 18 binding 2190717 NM_173042.2 IL18BP protein (IL18BP), transcript variant A, 672.81814 3.8229084 mRNA. Homo sapiens heparanase (HPSE), 630619 NM_006665.3 HPSE 250.77596 3.8147497 mRNA. Homo sapiens alpha-fetoprotein 2030161 NM_001134.1 AFP 579.1413 3.7949647 (AFP), mRNA. Homo sapiens cubilin (intrinsic factor- 4890048 NM_001081.3 CUBN 276.40501 3.7750695 cobalamin receptor) (CUBN), mRNA. Homo sapiens ADAM metallopeptidase domain 15 6480131 NM_207 195.1 ADAM 15 915.4264 3.7679841 (ADAM15), transcript variant 4, mRNA. Homo sapiens hedgehog interacting 7510743 NM_022475.1 HHIP 198.34476 3.7246482 protein (HHIP), mRNA. Homo sapiens bone morphogenetic 4280577 NM_001200.2 BMP2 832.27552 3.6888929 protein 2 (BMP2), mRNA. Homo sapiens T-box 1 (TBX1), 460575 NM_080647.1 TBX1 316.69617 3.6552408 transcript variant C, mRNA. Homo sapiens ADAM metallopeptidase domain 15 3440452 NM_207 195.1 ADAM 15 9199.7754 3.5898755 (ADAM15), transcript variant 4, mRNA. Homo sapiens CD59 molecule, 1410201 NM_00061 1.4 CD59 complement regulatory protein 2288.9096 3.5459118 (CD59), transcript variant 2, mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 627.68805 3.4241906 variant 1, mRNA. Homo sapiens caspase-1 dominant- 2030170 NM_052889.2 COPl negative inhibitor pseudo-ICE (COPl), 268.56173 3.4145343 transcript variant 2, mRNA. Homo sapiens endoglin (Osler-Rendu- 4610753 NM_0001 18.1 ENG 3505.7251 3.2867789 Weber syndrome 1) (ENG), mRNA. Homo sapiens integrin, alpha 6 2140678 NM_000210.2 ITGA6 388.42847 3.1872293 (ITGA6), transcript variant 2, mRNA. Homo sapiens multimerin 2 7050291 NM_024756.1 MMRN2 209.82412 3.137681 (MMRN2), mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 770408 NM_000602.1 SERPINE1 14997.135 3.1359933 activator inhibitor type 1), member 1 (SERPINE1), mRNA. Homo sapiens bone morphogenetic 5490035 NM_1 3085 1.1 BMP4 protein 4 (BMP4), transcript variant 3, 175.69602 3.0579029 mRNA. Homo sapiens cytochrome P450, 3290048 NM_178033.1 CYP4X1 family 4, subfamily X, polypeptide 1 217.67242 3.0407837 (CYP4X1), mRNA. Homo sapiens prolylcarboxypeptidase 6 110386 NM_005040.2 PRCP (angiotensinase C) (PRCP), transcript 4120.6518 3.0386567 variant 1, mRNA. Homo sapiens poliovirus receptor 780524 NM_006505.2 PVR 707.62139 3.0255254 (PVR), mRNA. Homo sapiens c-mer proto-oncogene 7550066 NM_006343.2 MERTK 867.71563 3.0237252 tyrosine kinase (MERTK), mRNA. Homo sapiens chemokine (C-C motif) 6 110343 NM_145898.1 CCL23 ligand 23 (CCL23), transcript variant 346.6795 2.9478542 CKbeta8, mRNA. Homo sapiens thrombospondin, type I, 290091 NM_018676.2 THSD1 domain containing 1 (THSD1), 243.275 2.8984295 transcript variant 1, mRNA. Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 5700753 NM_001024912.1 CEACAM1 183.00501 2.8686632 1 (biliary glycoprotein) (CEACAM1), transcript variant 2, mRNA. Homo sapiens serpin peptidase 1440270 NM_000185.3 SERPIND1 inhibitor, clade D (heparin cofactor), 204.33319 2.8675743 member 1 (SERPIND1), mRNA. Homo sapiens heparan sulfate 5050706 NM_005529.5 HSPG2 274.50162 2.8455701 proteoglycan 2 (HSPG2), mRNA. Homo sapiens interleukin-1 receptor- 3930750 NM_001570.3 IRAK2 790.18053 2.8000038 associated kinase 2 (IRAK2), mRNA. Homo sapiens protocadherin 10 5910093 NM_032961.1 PCDH10 (PCDH10), transcript variant 1, 551.21018 2.7782894 mRNA. Homo sapiens CD59 molecule, 1430240 NM_203331.1 CD59 complement regulatory protein 312.85457 2.7502246 (CD59), transcript variant 4, mRNA. Homo sapiens nuclear factor 5820035 NM_004289.5 NFE2L3 (erythroid-derived 2)-like 3 (NFE2L3), 1912.8499 2.748456 mRNA. Homo sapiens membrane protein, 830452 NM_033066.1 MPP4 palmitoylated 4 (MAGUK p55 304.96622 2.7472807 subfamily member 4) (MPP4), mRNA. Homo sapiens RAS, dexamefhasone- 2710735 NM_016084.3 RASD1 779.32522 2.7180601 induced 1 (RASD1), mRNA. Homo sapiens phospholipid 4120019 NM_020353.1 PLSCR4 1625.5836 2.7031276 scramblase 4 (PLSCR4), mRNA. Homo sapiens T-box 1 (TBX1), 4880730 NM_005992.1 TBX1 259.13636 2.6787727 transcript variant B, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1631.0776 2.6324867 3) (LTBR), mRNA. Homo sapiens activating transcription 5420343 NM_007348.2 ATF6 2400.2919 2.567808 factor 6 (ATF6), mRNA.

Homo sapiens deleted in bladder 4850450 NM_014618.2 DBC1 1186.982 7.6423034 cancer 1 (DBC1), mRNA. Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 2047.8322 7.6047425 (Drosophila) (SLIT3), mRNA. Homo sapiens cystatin E/M (CST6), 1070333 NM_001323.2 CST6 628.51416 7.0864574 mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 840678 NM_001040092.1 ENPP2 2097.356 6.9213379 (autotaxin) (ENPP2), transcript variant 2, mRNA. PREDICTED: Homo sapiens cystatin 4010491 XM_001129442.1 CST6 627.68805 6.8640558 E M (CST6), mRNA. Homo sapiens CD14 molecule (CD14), 7000369 NM_000591.2 CD14 434.11718 6.8424232 transcript variant 1, mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 2491.3919 6.6480572 mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1792.8196 6.2532946 specific (ECM2), mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-1 beta (PTX3), 909.91829 5.7323369 mRNA. Homo sapiens thyrotropin-releasing 160382 NM_007 117.1 TRH 548.08319 5.6178669 hormone (TRH), mRNA. Homo sapiens WNT1 inducible 3310333 NM_003880.2 WISP3 signaling pathway protein 3 (WISP3), 337.79934 5.3611548 transcript variant 1, mRNA. Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 1496.7437 5.2665377 mRNA. Homo sapiens KIAA1 199 110181 NM_0 18689.1 KIAA1 199 10493.166 5.1577782 (KIAA1 199), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 532.08754 4.4665563 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 1260040 NM_004105.3 EFEMP1 5669.5187 4.4194 (EFEMP1), transcript variant 1, mRNA. Homo sapiens scrapie responsive 1110048 NM_007281.1 SCRG1 5811.9761 4.3927099 protein 1 (SCRG1), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 1976.0737 4.3630129 (SERPING1), transcript variant 2, mRNA. Homo sapiens follistatin (FST), 6020286 NM_0 13409.1 FST 11675.871 4.3616208 transcript variant FST344, mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 4483.3193 4.2635884 variant 1, mRNA. Homo sapiens hypothetical protein 3190121 NM_177964.3 LOC130576 482.47566 4.0872439 LOC130576 (LOC130576), mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6250563 NM_004105.3 EFEMP1 3179.1444 4.0027025 (EFEMP1), transcript variant 1, mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 554.01637 3.9152298 (HOXA9), mRNA. Homo sapiens cathepsin F (CTSF), 3930020 NM_003793.2 CTSF 617.35015 3.7141556 mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 3298.5431 3.708741 1 mRNA. Homo sapiens cathepsin K (CTSK), 1430278 NM_000396.2 CTSK 3213.7676 3.6750716 mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 13034.169 3.6255226 mRNA. Homo sapiens Notch homolog 3 2340692 NM_000435.1 NOTCH3 2126.9951 3.6196726 (Drosophila) (NOTCH3), mRNA. Homo sapiens protease, serine, 3 5080139 NM_002771.2 PRSS3 330.05192 3.5537808 (mesotrypsin) (PRSS3), mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 322.59617 3.5195226 (NAALADL1), mRNA. Homo sapiens family with sequence 2810373 NM_017565.2 FAM20A similarity 20, member A (FAM20A), 276.95914 3.3647017 mRNA. Homo sapiens bone marrow stromal 6270681 NM_004334.1 BST1 405.43186 3.283729 cell antigen 1 (BST1), mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 2720.0167 3.272366 1, r subcomponent (C1R), mRNA. Homo sapiens Thy-l cell surface 6480204 NM_006288.2 THY1 7712.591 3.2375523 antigen (THY1), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 338.54779 3.2262081 complexing protein 2) (DPP4), mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 4016.6404 3.1564807 transcript variant A2, mRNA. Homo sapiens growth differentiation 2690168 NM_000557.2 GDF5 422.99875 3.1488254 factor 5 (GDF5), mRNA. Homo sapiens insulin-like growth 7510414 NM_001552.2 IGFBP4 factor binding protein 4 (IGFBP4), 21483.882 3.0731243 mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 10206.614 3.0231246 mRNA. Homo sapiens sulfide quinone 6770707 NM_02 1199.2 SQRDL reductase-like (yeast) (SQRDL), 857.16504 3.0035534 mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6900408 NM_001039348.1 EFEMP1 13595.27 2.9748474 (EFEMP1), transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1841.6086 2.9722743 3) (LTBR), mRNA. Homo sapiens lysyl oxidase-like 4 4150477 NM_03221 1.6 LOXL4 3555.1 139 2.9319519 (LOXL4), mRNA. Homo sapiens collagen, type XXI, 3440747 NM_030820.2 COL21A1 250.13953 2.8822874 alpha 1 (COL21A1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 210.31593 2.8630872 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens protease, serine, 12 2480692 NM_003619.2 PRSS12 (neurotrypsin, motopsin) (PRSS12), 467.76077 2.8471737 mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1676.5737 2.8445445 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens similar to hypothetical 770156 NM_203422.1 LOC221091 209.20782 2.7843834 protein (LOC221091), mRNA. Homo sapiens prostaglandin E 1510181 NM_004878.3 PTGES 1717.0746 2.7466722 synthase (PTGES), mRNA. Homo sapiens collagen, type V, alpha 5560300 NM_015719.3 COL5A3 372.23791 2.7210905 3 (COL5A3), mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 1092.9658 2.6662222 (RECK), mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 3400600 NM_014244.2 ADAMTS2 288.75752 2.6560028 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 371.44882 2.626606 mRNA. Homo sapiens fms-related tyrosine 830324 NM_001459.2 FLT3LG 329.68142 2.6163785 kinase 3 ligand (FLT3LG), mRNA. Homo sapiens angiopoietin-like 5 2360066 NM_178127.2 ANGPTL5 187.87434 2.5940441 (ANGPTL5), mRNA. Homo sapiens follistatin (FST), 1260068 NM_006350.2 FST 581.69499 2.5918436 transcript variant FST317, mRNA. Homo sapiens syntrophin, beta 1 (dystrophin-associated protein Al, 3420739 NM_021021.2 SNTB1 884.95074 2.5900716 59kDa, basic component 1) (SNTB1), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 13933.806 2.5487765 mRNA. Homo sapiens RGM domain family, 840553 NM_001012761.1 RGMB member B (RGMB), transcript variant 1082.6854 2.5430445 1, mRNA. Homo sapiens collagen, type VI, alpha 7570598 NM_001848.2 COL6A1 16159.754 2.5309557 1 (COL6A1), mRNA. Homo sapiens vascular endothelial 7320039 NM_005429.2 VEGFC 2236.8167 2.5267491 growth factor C (VEGFC), mRNA. Homo sapiens netrin 4 (NTN4), 3190021 NM_021229.3 NTN4 2752.9059 2.502953 mRNA. Homo sapiens interleukin 16 5080615 NM_172217.2 IL16 (lymphocyte chemoattractant factor) 2 11.71755 2.4479562 (IL16), transcript variant 2, mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 4490563 NM_172244.2 SGCD 175.9059 2.445021 1 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens similar to common 4590438 NM_145252.1 LOCI 24220 salivary protein 1 (LOCI 24220), 191.97802 2.4274359 mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 5690167 NM_004186.2 SEMA3F 337.21 143 2.4259425 basic domain, secreted, (semaphorin) 3F (SEMA3F), mRNA.

Homo sapiens thrombospondin, type I, 290091 NM_018676.2 THSD1 domain containing 1 (THSD1), 201.46209 2.4002618 transcript variant 1, mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM 14A similarity 14, member A (FAM14A), 1855.3173 2.3909189 mPvNA. Homo sapiens integrin, beta-like 1 5570129 NM_004791.1 ITGBL1 (with EGF-like repeat domains) 381.01622 2.3840953 (ITGBL1), mRNA. Homo sapiens tyrosylprotein 5690347 NM_001008566.1 TPST2 sulfotransferase 2 (TPST2), transcript 4131.6522 2.3608107 variant 1, mRNA. Homo sapiens slit homolog 2 4560592 NM_004787.1 SLIT2 854.82153 2.3570471 (Drosophila) (SLIT2), mRNA. Homo sapiens low density lipoprotein- related protein 1 (alpha-2- 2710286 NM_002332.2 LRP1 569.24956 2.3364678 macroglobulin receptor) (LRP1), mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 1058.2519 2.3195857 mRNA. Homo sapiens WNT1 inducible 520717 NM_198239.1 WISP3 signaling pathway protein 3 (WISP3), 121.91401 2.2248541 transcript variant 3, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 486.5677 2.219739 c, mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 5080192 NM_006216.2 SERPINE2 26475.669 2.2133905 activator inhibitor type 1), member 2 (SERPINE2), mRNA.

Homo sapiens sema domain, immunoglobulin domain (Ig), short 5670246 NM_006379.2 SEMA3C 1135.1422 2.2087534 basic domain, secreted, (semaphorin) 3C (SEMA3C), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 201.92389 2.199824 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens endoglin (Osler-Rendu- 4610753 NM_0001 18.1 ENG 2340.1873 2.1940335 Weber syndrome 1) (ENG), mRNA. Homo sapiens regeneration associated 7320669 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 4852.0339 2.1842653 transcript variant 1, mRNA. Homo sapiens interleukin 26 (IL26), 6550008 NM_018402.1 IL26 132.05516 2.1767105 mRNA. Homo sapiens glutathione peroxidase 4 6520128 NM_001039847.1 GPX4 (phospholipid hydroperoxidase) 22246.979 2.1757187 (GPX4), transcript variant 2, mRNA. Homo sapiens cafhepsin O (CTSO), 1820300 NM_001334.2 CTSO 889.50737 2.1617021 mRNA. Homo sapiens bone gamma- 4830356 NM_199173.2 BGLAP carboxyglutamate (gla) protein 295.76991 2.1510376 (osteocalcin) (BGLAP), mRNA. Homo sapiens chemokine (C-X-C motif) ligand 12 (stromal cell-derived 4560020 NM_199168.2 CXCL12 12002.959 2.1398385 factor 1) (CXCL12), transcript variant 1, mRNA. Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 125.93628 2.1313451 mRNA. Homo sapiens phospholipase A2, 2600170 NM_003561.1 PLA2G10 140.08473 2.11 18584 group X (PLA2G10), mRNA.

Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 2511.0521 9.3249363 (Drosophila) (SLIT3), mRNA. Homo sapiens tumor necrosis factor receptor superfamily, member l i b 2370132 NM_002546.3 TNFRSF1 1B 7047.5294 8.672604 (osteoprotegerin) (TNFRSF11B), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 1013.6066 8.5086209 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 10988.747 8.4606882 transcript variant A, mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 4050326 NM_139125.2 MASP1 982.61814 8.3198373 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 3388.6546 8.2664125 (RECK), mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 837.31438 7.997321 1 (F10), mRNA. Homo sapiens pregnancy specific beta- 1690095 NM_002782.3 PSG6 1-glycoprotein 6 (PSG6), transcript 541.72153 7.8310027 variant 1, mRNA. Homo sapiens EGF-like-domain, 6330079 NM_015507.2 EGFL6 1263.0988 7.1578744 multiple 6 (EGFL6), mRNA. Homo sapiens lysyl oxidase-like 4 4150477 NM_03221 1.6 LOXL4 8605.1021 7.0967475 (LOXL4), mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 16258.189 7.0128853 transcript variant C, mRNA. Homo sapiens chloride intracellular 5870136 NM_004669.2 CLIC3 2088.9037 6.9798042 channel 3 (CLIC3), mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 3083.3575 6.758421 1 mRNA. Homo sapiens KIAA1 199 110181 NM_0 18689.1 KIAA1 199 13275.365 6.5253319 (KIAA1 199), mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 840678 NM_001040092.1 ENPP2 1976.0737 6.521 1026 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens slit homolog 2 4560592 NM_004787.1 SLIT2 2191.6243 6.043088 (Drosophila) (SLIT2), mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 2490152 NM_001040092.1 ENPP2 1364.4086 5.971 1241 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens inhibin, beta B (activin 50446 NM_002193.1 INHBB AB beta polypeptide) (INHBB), 2041.0838 5.9707503 mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 532.17507 5.8060274 (NAALADL1), mRNA. Homo sapiens deleted in bladder 4850450 NM_014618.2 DBC1 898.42847 5.784471 cancer 1 (DBC1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 420.58687 5.7255619 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 5032.2968 5.6580999 mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 5896.5647 5.6075696 variant 1, mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1590.2804 5.5871412 (LY96), mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 4390.26 5.5717191 (APOD), mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 580360 NM_001031849.1 MASP1 498.17094 5.4473155 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 6864.4329 5.394421 1 transcript variant A2, mRNA. Homo sapiens collagen, type XV, 5090026 NM_001855.3 COL15A1 3616.1996 5.3727201 alpha 1 (COL15A1), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARID1D), 349.92699 5.2064173 mRNA. Homo sapiens cafhepsin F (CTSF), 3930020 NM_003793.2 CTSF 864.28923 5.199812 mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 534.03702 5.0891325 complexing protein 2) (DPP4), mRNA. Homo sapiens RGM domain family, 840553 NM_001012761.1 RGMB member B (RGMB), transcript variant 2151.0059 5.0523482 1, mRNA. Homo sapiens Thy-l cell surface 6480204 NM_006288.2 THY1 11721.186 4.9202597 antigen (THY1), mRNA. Homo sapiens protease, serine, 12 2480692 NM_003619.2 PRSS12 (neurotrypsin, motopsin) (PRSS12), 792.86888 4.826047 mRNA. Homo sapiens fibulin 1 (FBLN1), 4830685 NM_006486.2 FBLN1 25880.203 4.8182009 transcript variant D, mRNA. Homo sapiens hypothetical protein 3190121 NM_177964.3 LOC130576 563.81814 4.7763286 LOC130576 (LOC130576), mRNA. Homo sapiens WAP four-disulfide 1230615 NM_02 1197.2 WFDC1 523.37139 4.6095686 core domain 1 (WFDC1), mRNA. Homo sapiens adipocyte-specific 5570682 NM_024769.2 ASAM 2764.6522 4.4121527 adhesion molecule (ASAM), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 1973.5556 4.357453 (SERPING1), transcript variant 2, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2128.3813 4.2963553 mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 3547.5987 4.2680037 1, r subcomponent (C1R), mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1222.1 199 4.2627132 specific (ECM2), mRNA. Homo sapiens wingless-type MMTV 6840202 NM_030761.3 WNT4 integration site family, member 4 241.04853 4.2383325 (WNT4), mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 5960438 NM_139125.2 MASP1 361.45524 4.2069571 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens similar to hypothetical 770156 NM_203422.1 LOC221091 310.61386 4.1340142 protein (LOC221091), mRNA. Homo sapiens pregnancy specific beta- 4210500 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 1082.4317 4.0607458 variant 1, mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 13794.697 3.8370673 mRNA. Homo sapiens wingless-type MMTV 1820343 NM_003392.3 WNT5A integration site family, member 5A 5294.9046 3.7817475 (WNT5A), mRNA. Homo sapiens carboxypeptidase Z 4390193 NM_001014447.1 CPZ 1171.0612 3.6678308 (CPZ), transcript variant 1, mRNA. Homo sapiens cafhepsin K (CTSK), 1430278 NM_000396.2 CTSK 3188.3801 3.64604 mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 1260040 NM_004105.3 EFEMP1 4598.9417 3.5848832 (EFEMP1), transcript variant 1, mRNA. Homo sapiens procollagen C- 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1921.326 3.446064 (PCOLCE2), mRNA. Homo sapiens pregnancy specific beta- 4480292 NM_002781.2 PSG5 186.18473 3.4050235 1-glycoprotein 5 (PSG5), mRNA. Homo sapiens fibrillin 2 (congenital 3440204 NM_001999.3 FBN2 contractural arachnodactyly) (FBN2), 6418.5507 3.398854 mRNA. Homo sapiens pregnancy specific beta- 5690681 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 285.11667 3.3249368 variant 1, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 4220433 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 338.15605 3.2904567 3B (SEMA3B), transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2015.301 3.2526063 3) (LTBR), mRNA. Homo sapiens proline/arginine-rich "7000446 NM_20 1348.1 PRELP end leucine-rich repeat protein 333.16091 3.1149997 (PRELP), transcript variant 2, mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 3678.6683 3.11 15066 mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 691.35959 3.0925982 transcript variant 1, mRNA. Homo sapiens vascular endothelial 7320039 NM_005429.2 VEGFC 2734.1034 3.0884933 growth factor C (VEGFC), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 526.62957 3.0617522 variant 2, mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6900408 NM_001039348.1 EFEMP1 13933.806 3.0489242 (EFEMP1), transcript variant 2, mRNA. Homo sapiens RPE-spondin (RPESP), 2600397 NM_153225.2 RPESP 261.78038 3.0374899 mRNA. Homo sapiens lymphocyte antigen 6 4890270 NM_002346.1 LY6E 6806.1903 3.0307279 complex, locus E (LY6E), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2505.0665 2.9928741 aminopeptidase, CD13, pi 50) (ANPEP), mRNA. Homo sapiens elastin microfibril 1190142 NM_032048.2 EMILIN2 927.231 12 2.9554533 interfacer 2 (EMILIN2), mRNA. Homo sapiens carboxypeptidase Z 5340064 NM_001014447.1 CPZ 426.35634 2.9216583 (CPZ), transcript variant 1, mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-1 beta (PTX3), 460.60959 2.9017653 mRNA. Homo sapiens fibulin 1 (FBLN1), 5050131 NM_006485.3 FBLN1 196.90339 2.8861509 transcript variant B, mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 947.59425 2.8820252 (SRGAP1), mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 273.11091 2.8525462 SHOX2a, mRNA. Homo sapiens EGF-containing fibulin- like extracellular matrix protein 1 6250563 NM_004105.3 EFEMP1 2254.5395 2.8385785 (EFEMP1), transcript variant 1, mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 548.46991 2.837454 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens oxytocin, prepro- 1850372 NM_000915.2 OXT 197.72301 2.8302173 (neurophysin I) (OXT), mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 36044.084 2.82297 transcript variant C, mRNA. Homo sapiens adrenomeduUin (ADM), 5670465 NM_001124.1 ADM 20167.417 2.7664714 mRNA. Homo sapiens ADAM metallopeptidase domain 33 3420025 NM_153202.1 ADAM33 199.62094 2.7268123 (ADAM33), transcript variant 2, mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 5080192 NM_006216.2 SERPINE2 32458.718 2.713579 activator inhibitor type 1), member 2 (SERPINE2), mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 649.73805 2.7105946 mRNA. Homo sapiens dickkopf homolog 1 4880609 NM_012242.2 DKK1 172.80442 2.6759062 (Xenopus laevis) (DKK1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 4490563 NM_172244.2 SGCD 192.48171 2.6754182 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens ADAM metallopeptidase domain 33 1440224 NM_025220.2 ADAM33 213.331 12 2.6728722 (ADAM33), transcript variant 1, mRNA. Homo sapiens Boc homolog (mouse) 75101 13 NM_033254.2 BOC 228.47375 2.6284338 (BOC), mRNA. Homo sapiens SPARC related modular 2630437 NM_022138.1 SMOC2 264.03968 2.6273557 calcium binding 2 (SMOC2), mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 5243.1438 2.5769384 transcript variant 2, mRNA. Homo sapiens chromosome 10 open 1110201 NM_00103 1746.2 C10orf72 reading frame 72 (C10orf72), 304.27839 2.5764793 transcript variant 1, mRNA. Homo sapiens forkhead box L2 4230750 NM_023067.2 FOXL2 208.75642 2.5043306 (FOXL2), mRNA. Homo sapiens cystatin E/M (CST6), 1070333 NM_001323.2 CST6 222.00782 2.5031241 mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 352.74145 2.4928213 (HOXA9), mRNA. Homo sapiens fms-related tyrosine 830324 NM_001459.2 FLT3LG 3 11.13304 2.4691771 kinase 3 ligand (FLT3LG), mRNA. Homo sapiens sulfatase 1 (SULF1), 2570240 NM_015170.1 SULF1 6636.9991 2.4426691 mRNA. Homo sapiens hypothetical protein 7510551 NM_024913.3 FLJ21986 1058.4771 2.4030942 FLJ21986 (FLJ21986), mRNA. Homo sapiens protease, serine, 3 5080139 NM_002771.2 PRSS3 220.67729 2.3761071 (mesotrypsin) (PRSS3), mRNA. Homo sapiens phospholipid 4120019 NM_020353.1 PLSCR4 1422.0497 2.364678 scramblase 4 (PLSCR4), mRNA. Homo sapiens 5'-nucleotidase, ecto 5960398 NM_002526.1 NT5E 1956.2917 2.3550354 (CD73) (NT5E), mRNA. Homo sapiens follistatin (FST), 6020286 NM_0 13409.1 FST 6246.1385 2.3332981 transcript variant FST344, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 430181 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 300.95074 2.3248369 3B (SEMA3B), transcript variant 2, mRNA. Homo sapiens wingless-type MMTV integration site family, member 2B 4640386 NM_024494.1 WNT2B 194.19344 2.3247367 (WNT2B), transcript variant WNT- 2B2, mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 471.60221 2.3055525 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating 5080072 NM_001035256.1 POMC 156.62198 2.3046575 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 12576.657 2.3005263 mRNA. Homo sapiens KIT ligand (KITLG), 5090500 NM_000899.3 KITLG 795.36755 2.2952673 transcript variant b, mRNA. Homo sapiens suppression of 5270563 NM_021908.2 ST7 tumorigenicity 7 (ST7), transcript 1122.3127 2.28248 variant b, mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 3252.2406 2.2747995 mRNA. Homo sapiens leucine rich repeat 2370041 NM_018334.3 LRRN3 182.22817 2.2506844 neuronal 3 (LRRN3), mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 161.52618 2.2279636 chromosome Y. Homo sapiens phosphoprotein 3610228 NM_003768.2 PEA15 enriched in astrocytes 15 (PEA15), 10828.476 2.2227647 mRNA. Homo sapiens collectin sub-family 2100767 NM_130386.1 COLEC12 3392.2383 2.2146566 member 12 (COLEC12), mRNA. Homo sapiens carboxypeptidase A3 2340743 NM_001870.1 CPA3 173.38555 2.1936656 (mast cell) (CPA3), mRNA. Homo sapiens laminin, alpha 4 5130435 NM_002290.2 LAMA4 824.82773 2.1792115 (LAMA4), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 199.89189 2.1776867 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens inter-alpha (globulin) 770193 NM_030569.4 ITIH5 inhibitor H5 (ITIH5), transcript variant 129.12625 2.1655328 1, mRNA. Homo sapiens peptidylprolyl 70001 14 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 3708.8383 2.1599696 mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 7286.5743 2.1582302 mRNA. Homo sapiens growth arrest-specific 6 70730 NM_000820.1 GAS6 8579.1652 2.1561314 (GAS6), mRNA. Homo sapiens collagen, type VI, alpha 7570598 NM_001848.2 COL6A1 13663.985 2.140066 1 (COL6A1), mRNA. Homo sapiens growth arrest-specific 6 4280632 NM_000820.1 GAS6 8283.9748 2.1303316 (GAS6), mRNA. Homo sapiens chromosome 5 open 1690240 NM_032385.3 C5orf4 reading frame 4 (C5orf4), transcript 454.32788 2.1249724 variant 2, mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 5790.7678 2.1210633 mRNA. Homo sapiens angiopoietin-like 2 7650672 NM_012098.2 ANGPTL2 2178.0894 2.1129499 (ANGPTL2), mRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 9395.8299 2.0951668 mRNA. Homo sapiens carboxyl ester lipase 6650593 NM_001807.3 CEL (bile salt-stimulated lipase) (CEL), 249.13201 2.0845963 mRNA. Homo sapiens interleukin 17 receptor 1070152 NM_018725.3 IL17RB 143.72131 2.047785 B (IL17RB), mRNA. Homo sapiens netrin 4 (NTN4), 3190021 NM_021229.3 NTN4 2233.7621 2.0309454 mRNA. Homo sapiens follistatin (FST), 1260068 NM_006350.2 FST 455.04912 2.0275508 transcript variant FST317, mRNA. Homo sapiens laminin, beta 2 (laminin 7650189 NM_002292.3 LAMB2 2015.301 2.0218177 S) (LAMB2), mRNA. Homo sapiens decorin (DCN), 50368 NM_001920.3 DCN 4859.9181 2.0120387 transcript variant Al, mRNA. Homo sapiens hematopoietic cell 1580088 NM_001007469.1 HCST signal transducer (HCST), transcript 420.46401 2.0098369 variant 2, mRNA. Homo sapiens insulin-like growth 3420682 NM_001007139.3 IGF2 factor 2 (somatomedin A) (IGF2), 470.78776 2.0014415 transcript variant 2, mRNA.

Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 584.36298 6.3753972 (NAALADL1), mRNA. Homo sapiens Notch homolog 3 2340692 NM_000435.1 NOTCH3 3599.6814 6.1258572 (Drosophila) (NOTCH3), mRNA. Homo sapiens carbonic anhydrase XII 3830075 NM_001218.3 CA12 1938.3504 6.1135949 (CA12), transcript variant 1, mRNA. Homo sapiens carbonic anhydrase XII 150474 NM_001218.3 CA12 7712.591 6.0689057 (CA12), transcript variant 1, mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 13864.881 5.9805445 transcript variant C, mRNA. Homo sapiens interleukin 1 receptor, 240274 NM_000877.2 IL1R1 1009.0606 5.827361 type I (IL1R1), mRNA. Homo sapiens pregnancy specific beta- 3400474 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 797.22847 5.8244698 variant 1, mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 1058.4771 5.7889445 cyclooxygenase) (PTGS1), transcript variant 1, mRNA. Homo sapiens pregnancy specific beta- 4120243 NM_002784.2 PSG9 531.66283 5.7579978 1-glycoprotein 9 (PSG9), mRNA. Homo sapiens pregnancy specific beta- 5960392 NM_001031850.2 PSG6 1-glycoprotein 6 (PSG6), transcript 441.06755 5.7261625 variant 2, mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 3400600 NM_014244.2 ADAMTS2 612.55229 5.6342794 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 6280168 NM_001085.4 SERPINA3 8283.9748 5.6221809 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA.

Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 4050326 NM_139125.2 MASP1 663.83923 5.6207332 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 30012.06 5.4898161 mRNA. Homo sapiens EROl-like (S. 4780671 NM_014584.1 EROIL 4282.2642 5.4528493 cerevisiae) (EROIL), mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 1215.1339 5.4355519 transcript variant 1, mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 4502.4693 5.4167784 1, r subcomponent (C1R), mRNA. Homo sapiens KIAA1 199 110181 NM_0 18689.1 KIAA1 199 10753.486 5.2857351 (KIAA1 199), mRNA. Homo sapiens neuronal pentraxin II 6420050 NM_002523.1 NPTX2 903.45059 5.0126971 (NPTX2), mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLF1 2847.6606 5.01 1301 1 factor 1 (CRLF1), mRNA. Homo sapiens neuromedin B (NMB), 5670594 NM_021077.3 NMB 2322.9397 4.780307 transcript variant 1, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 7582.6208 4.6370887 3, mRNA. Homo sapiens fibulin 1 (FBLN1), 5050131 NM_006485.3 FBLN1 313.08223 4.5890654 transcript variant B, mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 9090.7962 4.4680105 transcript variant 2, mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 4 112.7127 4.4575213 (ANG), transcript variant 2, mRNA. Homo sapiens fibulin 1 (FBLN1), 430088 NM_006487.2 FBLN1 272.52581 4.4264786 transcript variant A, mRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 2252.8875 4.402696 transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 3164.3146 4.3969961 1, mRNA. Homo sapiens glycogen synthase 1 5570270 NM_002103.3 GYS1 1268.0798 4.3817309 (muscle) (GYS1), mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1817.95 4.3645786 1, mRNA. Homo sapiens pregnancy specific beta- 1690095 NM_002782.3 PSG6 1-glycoprotein 6 (PSG6), transcript 300.24049 4.3402079 variant 1, mRNA. Homo sapiens hypoxia-inducible 7320441 NM_013332.3 HIG2 protein 2 (HIG2), transcript variant 1, 1486.2841 4.2995085 mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 5960438 NM_139125.2 MASP1 366.4972 4.2656402 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 1566.5006 4.1800672 mRNA. Homo sapiens lysyl oxidase-like 3 7200706 NM_032603.2 LOXL3 2965.5537 4.1798243 (LOXL3), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARID ID interactive domain ID (JARID1D), 279.27928 4.1552795 mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 489.09971 4.1056992 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens fibulin 1 (FBLN1), 4830685 NM_006486.2 FBLN1 21951.868 4.08685 transcript variant D, mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 1666.883 4.0662577 (RECK), mRNA. Homo sapiens procollagen-proline, 2- oxoglutarate 4-dioxygenase (proline 4- 7570379 NM_001017974.1 P4HA2 2014.6226 4.0634659 hydroxylase), alpha polypeptide II (P4HA2), transcript variant 3, mRNA. Homo sapiens angiopoietin-like 4 4610433 NM_1 393 14.1 ANGPTL4 (ANGPTL4), transcript variant 1, 7271.1268 3.9698796 mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 770408 NM_000602.1 SERPINE1 1891 1.169 3.9544419 activator inhibitor type 1), member 1 (SERPINE1), mRNA.

Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 3350.2642 3.1860651 variant 1, mRNA. Homo sapiens Thy-1 cell surface 6480204 NM_006288.2 THY1 7475.5754 3.138059 antigen (THY1), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1940.8714 3.1324801 3) (LTBR), mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 776.7 3.1158954 (WNT2), mRNA. Homo sapiens cathepsin F (CTSF), 3930020 NM_003793.2 CTSF 508.50973 3.0593404 mRNA. Homo sapiens neurotrophin 3 (NTF3), 2940441 NM_002527.3 NTF3 621.78805 3.0546892 mRNA. Homo sapiens elastin microfibril 1190142 NM_032048.2 EMILIN2 952.91 15 3.0373069 interfacer 2 (EMILFN2), mRNA. Homo sapiens fibroblast growth factor receptor 1 (fms-related tyrosine kinase 6450471 NM_023107.2 FGFR1 458.41401 3.0145507 2, Pfeiffer syndrome) (FGFR1), transcript variant 5, mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 287.47448 3.0025686 SHOX2a, mRNA. Homo sapiens chloride intracellular 5870136 NM_004669.2 CLIC3 889.67529 2.9727361 channel 3 (CLIC3), mRNA. Homo sapiens CDlc molecule 1500725 NM_001765.2 CD1C 563.62168 2.9570954 (CD1C), mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 3488.6454 2.9507807 mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 5619.4093 2.9465823 transcript variant 2, mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 6130577 NM_001081754.1 ELN 5759.3587 2.9404635 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens chromosome 5 open 1690240 NM_032385.3 C5orf4 reading frame 4 (C5orf4), transcript 616.93068 2.8854946 variant 2, mRNA. Homo sapiens RAP1, GTP-GDP 5560139 NM_021 159.3 RAP 1CDS 1 dissociation stimulator 1 827.61696 2.8644895 (RAP1GDS1), mRNA. Homo sapiens dickkopf homolog 3 5270408 NM_013253.4 DKK3 (Xenopus laevis) (DKK3), transcript 576.99749 2.8535391 variant 2, mRNA. Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 764.89587 2.8404848 (Drosophila) (SLIT3), mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 10039.543 2.7925517 mRNA. Homo sapiens N-glycanase 1 3780670 NM_018297.2 NGLY1 1139.1673 2.7890254 (NGLY1), mRNA. Homo sapiens procollagen-proline, 2- oxoglutarate 4-dioxygenase (proline 4- 270408 NM_001017974.1 P4HA2 10275.846 2.7772864 hydroxylase), alpha polypeptide II (P4HA2), transcript variant 3, mRNA.

Homo sapiens inhibitor of growth 5090040 NM_198219.1 ING1 family, member 1 (ING1), transcript 546.45782 2.5061253 variant 1, mRNA. Homo sapiens procollagen-lysine, 2- 4640187 NM_000935.2 PLOD2 oxoglutarate 5-dioxygenase 2 3255.3316 2.5031863 (PLOD2), transcript variant 2, mRNA. Homo sapiens laminin, beta 1 1510392 NM_002291.1 LAMB1 1718.977 2.4968164 (LAMB1), mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short 5080280 NM_198925.1 SEMA4B 1391.7149 2.4936116 cytoplasmic domain, (semaphorin) 4B (SEMA4B), transcript variant 2, mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 819.1671 1 2.4914253 (SRGAP1), mRNA. Homo sapiens procollagen-proline, 2- oxoglutarate 4-dioxygenase (proline 4- 4220731 NM_000917.2 P4HA1 5447.5102 2.4781465 hydroxylase), alpha polypeptide I (P4HA1), transcript variant 1, mRNA. Homo sapiens proteinase 3 (serine proteinase, neutrophil, Wegener 1770731 NM_002777.3 PRTN3 153.88341 2.4337024 granulomatosis autoantigen) (PRTN3), mRNA. Homo sapiens HtrA serine peptidase 3 4060703 NM_053044.2 HTRA3 193.90413 2.4308237 (HTRA3), mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 2960.1 136 2.427534 disease) (LIPA), mRNA. Homo sapiens RNA polymerase II 1450678 NM_015540.2 RPAP1 475.00015 2.4231 192 associated protein 1 (RPAP1), mRNA. Homo sapiens galanin prepropeptide 60452 NM_015973.3 GAL 923.85103 2.414561 1 (GAL), mRNA. Homo sapiens T-box 3 (ulnar 5560619 NM_016569.3 TBX3 mammary syndrome) (TBX3), 161.43245 2.4066549 transcript variant 2, mRNA. Homo sapiens sperm associated 1770730 NM_003971.3 SPAG9 2027.6386 2.3953381 antigen 9 (SPAG9), mRNA. Homo sapiens CD44 molecule (Indian 4560193 NM_001001392.1 CD44 blood group) (CD44), transcript variant 3098.0882 2.3781 137 5, mRNA. Homo sapiens chromosome 10 open 1110201 NM_00103 1746.2 C10orf72 reading frame 72 (C10orf72), 279.3885 2.3657239 transcript variant 1, mRNA. Homo sapiens oncostatin M receptor 3370632 NM_003999.1 OSMR 799.98525 2.3597131 (OSMR), mRNA. Homo sapiens angiopoietin-like 4 2450592 NM_001039667.1 ANGPTL4 (ANGPTL4), transcript variant 3, 340.0705 2.3571408 mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISP1 signaling pathway protein 1 (WISP1), 562.88009 2.3489453 transcript variant 1, mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 327.68201 2.3171201 mRNA. Homo sapiens sperm associated 130164 NM_003971.3 SPAG9 602.55678 2.3069303 antigen 9 (SPAG9), mRNA. Homo sapiens aspartate beta- 5890619 NM_004318.2 ASPH 389.79535 2.2855305 hydroxylase (ASPH), transcript variant

Homo sapiens sema domain, immunoglobulin domain (Ig), short 4220433 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 213.4615 2.0771057 3B (SEMA3B), transcript variant 2, mRNA. Homo sapiens CD109 molecule 4230292 NM_133493.2 CD109 384.36667 2.0749106 (CD109), mRNA. Homo sapiens phosphofructokinase, 5570242 NM_002626.4 PFKL liver (PFKL), transcript variant 2, 2081.8504 2.0461755 mRNA. PREDICTED: Homo sapiens inositol 510739 XM_001133189.1 INPP5A polyphosphate-5-phosphatase, 40kDa 1574.0158 2.0379823 (INPP5A), mRNA. Homo sapiens procollagen-lysine, 2- 160630 NM_001084.4 PLOD3 oxoglutarate 5-dioxygenase 3 6849.601 2.0323571 (PLOD3), mRNA. Homo sapiens growth arrest-specific 6 4570181 NM_000820.1 GAS6 751.60125 2.0294128 (GAS6), mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 286.5542 2.0250765 (HOXA9), mRNA. Homo sapiens collagen, type XVI, 5360743 NM_001856.3 COL16A1 2569.4426 2.016659 alpha 1 (COL16A1), mRNA. Homo sapiens guanine nucleotide 5890025 NM_0 18841.4 GNG12 binding protein (G protein), gamma 12 1816.9028 2.0007556 (GNG12), mRNA.

Xgene FB P9 Dl Chondro MM Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 1215.1339 11.605935 (F10), mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 1371.5616 9.7574035 (PTPRN), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 3290630 NM_000624.3 SERPINA5 1645.4088 9.4129631 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. Homo sapiens WAP four-disulfide 1230615 NM_02 1197.2 WFDC1 1028.3012 9.0567138 core domain 1 (WFDC1), mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 791.62581 8.6366336 (NAALADL1), mRNA. Homo sapiens RAS, dexamethasone- 2710735 NM_016084.3 RASD1 2336.9326 8.1505424 induced 1 (RASD1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 961.31637 8.0696754 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 6008.4678 7.6254014 (APOD), mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 6130577 NM_001081754.1 ELN 14604.974 7.4566276 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 9253.463 7.2718427 transcript variant A2, mRNA. Homo sapiens dermatopontin (DPT), 2100228 NM_001937.3 DPT 10828.476 7.0159302 mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 8371.1493 6.445292 transcript variant A, mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 2557.0417 6.2377446 (RECK), mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 14371.405 6.1990309 transcript variant C, mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLF1 3453.4966 6.0774487 factor 1 (CRLFl), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 5995.9971 5.7021286 variant 1, mRNA. Homo sapiens elastase 2, neutrophil 7650497 NM_001972.2 ELA2 380.62389 5.6406112 (ELA2), mRNA. Homo sapiens inhibin, beta B (activin 50446 NM_002193.1 INHBB AB beta polypeptide) (FNHBB), 1885.855 5.516662 mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 2032.9091 5.4246368 mRNA. Homo sapiens dickkopf homolog 1 4880609 NM_012242.2 DKK1 345.3941 5.348487 (Xenopus laevis) (DKK1), mRNA. Homo sapiens cafhepsin F (CTSF), 3930020 NM_003793.2 CTSF 871.13717 5.241011 1 mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 2362.8305 5.2169409 (SERPING1), transcript variant 2, mRNA. Homo sapiens chloride intracellular 5870136 NM_004669.2 CLIC3 1553.906 5.1921781 channel 3 (CLIC3), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 4047.7358 4.835945 aminopeptidase, CD13, p i 50) (ANPEP), mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1357.131 4.7680161 (LY96), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 1051.5746 4.6741462 mRNA. Homo sapiens cartilage intermediate layer protein, nucleotide 6400427 NM_003613.2 CILP 1689.1541 4.6505898 pyrophosphohydrolase (CILP), mRNA. Homo sapiens matrix metallopeptidase "7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 991.12168 4.643847 (MMP3), mRNA. Homo sapiens vitamin K epoxide reductase complex, subunit 1 6450546 NM_024006.4 VKORC1 6165.504 4.6329486 (VKORC1), transcript variant 1, mRNA. Homo sapiens oxytocin, prepro- 1850372 NM_000915.2 OXT 309.83075 4.4349333 (neurophysin I) (OXT), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM 14A similarity 14, member A (FAM14A), 3438.749 4.431463 mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISP1 signaling pathway protein 1 (WISP1), 1017.3243 4.2453788 transcript variant 1, mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 808.89646 4.1847445 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 1906.8108 4.1795445 mRNA. Homo sapiens proenkephalin (PENK), 6220019 NM_00621 1.2 PENK 4185.8173 4.0991 149 mRNA. Homo sapiens fibulin 1 (FBLN1), 5050131 NM_006485.3 FBLN1 277.64676 4.0696629 transcript variant B, mRNA. Homo sapiens proline/arginine-rich "7000446 NM_20 1348.1 PRELP end leucine-rich repeat protein 425.42788 3.9776807 (PRELP), transcript variant 2, mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 291.0851 3.9626196 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 3400600 NM_014244.2 ADAMTS2 428.21 165 3.9387072 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens interleukin 1 receptor, 240274 NM_000877.2 ILIRI 681.59705 3.9362472 type I (IL1R1), mRNA. Homo sapiens Thy-l cell surface 6480204 NM_006288.2 THY1 9367.4991 3.9322412 antigen (THY1), mRNA. Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 1044.6251 3.8792753 (Drosophila) (SLIT3), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 3850500 NM_005031.3 FXYDl 363.4528 3.8675832 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 12576.657 3.7251 139 mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 928.33968 3.7242298 (WNT2), mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 3046.295 3.664901 1 1, r subcomponent (C1R), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 334.63348 3.645605 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 7406.5817 3.6402405 transcript variant 2, mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARID ID interactive domain ID (JARID1D), 236.21888 3.5146019 mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 1300156 NM_001081754.1 ELN 483.50796 3.4948888 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 1727.773 3.4876865 mRNA. Homo sapiens CDlc molecule 1500725 NM_001765.2 CD1C 660.67847 3.4663132 (CD1C), mRNA.

Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 565.80295 2.7660778 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 306.12434 2.7660633 complex, locus H (LY6H), mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 2514.9283 2.7257792 (ANG), transcript variant 2, mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 2635.163 2.7011012 cyclooxygenase) (PTGS1), transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1663.174 2.684289 3) (LTBR), mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 5 113.3521 2.6812272 transcript variant 2, mRNA. Homo sapiens somatostatin (SST), 15001 13 NM_001048.3 SST 134.38643 2.6437196 mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 2385.932 2.5920572 (DPM3), transcript variant 1, mRNA. Homo sapiens olfactomedin 2 580475 NM_058164.1 OLFM2 246.82271 2.5803176 (OLFM2), mRNA. Homo sapiens dolichyl-phosphate 7320435 NM_153741.1 DPM3 mannosyltransferase polypeptide 3 3015.2937 2.5795988 (DPM3), transcript variant 2, mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 245.74558 2.566725 SHOX2a, mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 241.80206 2.561 1025 2, mRNA. Homo sapiens TIMP metallopeptidase 6980541 NM_003255.4 TIMP2 1344.8529 2.5158798 inhibitor 2 (TIMP2), mRNA. Homo sapiens placental growth factor 1940438 NM_002632.4 PGF 329.85693 2.5127676 (PGF), mRNA. Homo sapiens cafhepsin K (CTSK), 1430278 NM_000396.2 CTSK 2145.8987 2.4539209 mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (IGF1), 203.01726 2.4399726 mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 4490563 NM_172244.2 SGCD 175.46291 2.4388637 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens thrombospondin, type I, 2370056 NM_199296.1 THSD3 domain containing 3 (THSD3), 156.92257 2.4245336 transcript variant 1, mRNA. Homo sapiens protease, serine, 12 2480692 NM_003619.2 PRSS12 (neurotrypsin, motopsin) (PRSS12), 394.40295 2.4006582 mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISP1 signaling pathway protein 1 (WISP1), 179.15192 2.3956341 transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 3883.068 2.374658 3, mRNA. Homo sapiens proteinase 3 (serine proteinase, neutrophil, Wegener 1770731 NM_002777.3 PRTN3 150.13909 2.374485 granulomatosis autoantigen) (PRTN3), mRNA. Homo sapiens SPARC related modular 2630437 NM_022138.1 SMOC2 238.55324 2.3737502 calcium binding 2 (SMOC2), mRNA. Homo sapiens fibroblast growth factor 6420746 NM_002010.1 FGF9 9 (glia-activating factor) (FGF9), 141.3233 2.3705785 mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 6418.5507 2.3510098 mRNA. Homo sapiens collagen, type XVI, 5360743 NM_001856.3 COL16A1 2992.7693 2.3489123 alpha 1 (COL16A1), mRNA. Homo sapiens deleted in lymphocytic 5490053 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 959.1 118 2.3462378 13. Homo sapiens chemokine (C-X-C motif) ligand 12 (stromal cell-derived 4610615 NM_000609.4 CXCL12 6406.0473 2.3412149 factor 1) (CXCL12), transcript variant 2, mRNA. Homo sapiens peptidylprolyl 70001 14 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 4001.037 2.3301415 mRNA. Homo sapiens protease, serine, 3 5080139 NM_002771.2 PRSS3 216.25398 2.3284799 (mesotrypsin) (PRSS3), mRNA. Homo sapiens glutathione peroxidase 7 4200543 NM_015696.3 GPX7 4477.0171 2.3035524 (GPX7), mRNA. Homo sapiens tenascin C 6940102 NM_002160.1 TNC 2329.9013 2.3010902 (hexabrachion) (TNC), mRNA. Homo sapiens laminin, beta 2 (laminin 7650189 NM_002292.3 LAMB2 2290.51 17 2.2979182 S) (LAMB2), mRNA. Homo sapiens mucin 1, cell surface 7650026 NM_001044391.1 MUC1 associated (MUC1), transcript variant 1682.6323 2.2933045 6, mRNA. Homo sapiens matrix metallopeptidase 7150551 NM_001032360.1 MMP19 19 (MMP19), transcript variant 2, 225.59646 2.2819046 mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 165.33437 2.2804907 chromosome Y. Homo sapiens matrix metallopeptidase 730372 NM_002429.4 MMP19 19 (MMP19), transcript variant 1, 204.1205 2.2753403 mRNA. Homo sapiens myosin light chain 1300286 NM_053026.3 MYLK kinase (MYLK), transcript variant 2, 509.3264 2.2727309 mRNA. Homo sapiens fibulin 1 (FBLN1), 430088 NM_006487.2 FBLN1 139.82109 2.2710328 transcript variant A, mRNA. Homo sapiens neuronal pentraxin II 6420050 NM_002523.1 NPTX2 409.27736 2.2708308 (NPTX2), mRNA. Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 510736 NM_004530.2 MMP2 978.4649 2.2694158 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens wingless-type MMTV 4850370 NM_032642.2 WNT5B integration site family, member 5B 1726.8608 2.260199 (WNT5B), transcript variant 1, mRNA.

Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 2324.6993 2.0383129 mRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating 5260291 NM_001035256.1 POMC 121.43997 2.0297385 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA.

Homo sapiens wingless-type MMTV 1820343 NM_003392.3 WNT5A integration site family, member 5A 2837.3991 2.0265383 (WNT5A), mRNA. Homo sapiens lymphocyte antigen 6 4890270 NM_002346.1 LY6E 4529.2319 2.0168213 complex, locus E (LY6E), mRNA. Homo sapiens low density lipoprotein- related protein 1 (alpha-2- 2710286 NM_002332.2 LRP1 490.0646 2.01 14555 macroglobulin receptor) (LRP1), mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 278.78746 2.000854 matrix protein (SPON1), mRNA.

Xgene FB P9 D2 Chondro MM Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens WAP four-disulfide 1230615 NM_02 1197.2 WFDC1 1308.6939 11.526259 core domain 1 (WFDC1), mRNA. Homo sapiens dermatopontin (DPT), 2100228 NM_001937.3 DPT 17333.96 11.23093 mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 860.72655 8.2209344 (F10), mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 725.7486 7.9179136 (NAALADL1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 907.13215 7.6148314 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 8779.2857 6.89921 transcript variant A2, mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 2544.8822 6.7907912 mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 5096.5381 6.468063 (APOD), mRNA. Homo sapiens chloride intracellular 5870136 NM_004669.2 CLIC3 1912.8499 6.3915429 channel 3 (CLIC3), mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 8130.96 6.2603605 transcript variant A, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 3290630 NM_000624.3 SERPINA5 1090.9681 6.241 1496 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 6130577 NM_001081754.1 ELN 12054.09 6.1542633 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 2493.3482 6.0823682 (RECK), mRNA. Homo sapiens RAS, dexamefhasone- 2710735 NM_016084.3 RASD1 1731.7909 6.0399837 induced 1 (RASD1), mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 832.11431 5.9197306 (PTPRN), mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 13663.985 5.8938889 transcript variant C, mRNA. Homo sapiens dickkopf homolog 1 4880609 NM_012242.2 DKK1 369.19233 5.7170067 (Xenopus laevis) (DKK1), mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLF1 3 112.9574 5.4781692 factor 1 (CRLF1), mRNA. Homo sapiens neurotrophin 3 (NTF3), 2940441 NM_002527.3 NTF3 1043.91 15 5.1284761 mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 5260.306 5.0024944 variant 1, mRNA. Homo sapiens vitamin K epoxide reductase complex, subunit 1 6450546 NM_024006.4 VKORC1 6295.2746 4.7304623 (VKORC1), transcript variant 1, mRNA. Homo sapiens inhibin, beta B (activin 50446 NM_002193.1 INHBB AB beta polypeptide) (FNHBB), 1582.5139 4.6293029 mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 2081.8504 4.5965594 (SERPING1), transcript variant 2, mRNA. Homo sapiens SPARC related modular 2630437 NM_022138.1 SMOC2 460.60959 4.5833462 calcium binding 2 (SMOC2), mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 2055.86 4.5062461 mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1223.2373 4.2976067 (LY96), mRNA. Homo sapiens Thy-l cell surface 6480204 NM_006288.2 THY1 10105.223 4.2419192 antigen (THY1), mRNA. Homo sapiens interleukin 1 receptor, 240274 NM_000877.2 IL1R1 733.9 4.2382986 type I (IL1R1), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARID ID interactive domain ID (JARID1D), 273.9385 4.0758163 mRNA. Homo sapiens cafhepsin F (CTSF), 3930020 NM_003793.2 CTSF 677.30442 4.0748577 mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 786.61622 4.06948 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens CDlc molecule 1500725 NM_001765.2 CD1C 774.50819 4.0635318 (CD1C), mRNA. Homo sapiens oxytocin, prepro- 1850372 NM_000915.2 OXT 282.77876 4.0477097 (neurophysin I) (OXT), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 908.62271 4.038739 mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 3850500 NM_005031.3 FXYDl 375.1761 1 3.9923335 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 292.63392 3.9837041 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1134.6221 3.9575238 specific (ECM2), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM 14A similarity 14, member A (FAM14A), 3049.1 192 3.9293531 mRNA. Homo sapiens cartilage intermediate layer protein, nucleotide 6400427 NM_003613.2 CILP 1400.8435 3.8568112 pyrophosphohydrolase (CILP), mRNA. Homo sapiens periostin, osteoblast 510246 NM_006475.1 POSTN 2951.7027 3.8304008 specific factor (POSTN), mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 3121.7596 3.7556902 1, r subcomponent (C1R), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 3133.7056 3.7439271 aminopeptidase, CD13, p i 50) (ANPEP), mRNA.

Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISP1 signaling pathway protein 1 (WISP1), 893.00723 3.7265932 transcript variant 1, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 2183.9094 3.7053114 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 337.94897 3.681725 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens proline/arginine-rich "7000446 NM_20 1348.1 PRELP end leucine-rich repeat protein 386.79779 3.6164957 (PRELP), transcript variant 2, mRNA. Homo sapiens fibulin 1 (FBLN1), 5050131 NM_006485.3 FBLN1 243.43186 3.5681512 transcript variant B, mRNA. Homo sapiens matrix metallopeptidase "7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 747.30177 3.501442 (MMP3), mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 7077.169 3.4783384 transcript variant 2, mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 865.98142 3.4740666 (WNT2), mRNA. Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 934.36519 3.4698189 (Drosophila) (SLIT3), mRNA. Homo sapiens elastase 2, neutrophil 7650497 NM_001972.2 ELA2 226.58732 3.3578842 (ELA2), mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 3400600 NM_014244.2 ADAMTS2 357.34056 3.2868322 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens fibulin 5 (FBLN5), 4670441 NM_006329.2 FBLN5 6519.4003 3.2151658 mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 ILl lRA alpha (ILl lRA), transcript variant 1, 4568.4569 3.1954351 mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 350.95914 3.171 1795 complex, locus H (LY6H), mRNA. Homo sapiens forkhead box L2 4230750 NM_023067.2 FOXL2 262.08709 3.1441081 (FOXL2), mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 3713.0861 3.1406181 mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 1031 1.808 3.0542824 mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (IGF1), 252.61 18 3.036027 mRNA. Homo sapiens myosin light chain 1300286 NM_053026.3 MYLK kinase (MYLK), transcript variant 2, 679.16667 3.030597 mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 609.30369 2.9787426 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 4 11.22817 2.9513793 matrix protein (SPON1), mRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating 5080072 NM_001035256.1 POMC 194.43178 2.8610204 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 4490563 NM_172244.2 SGCD 204.78805 2.8464714 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens leptin (obesity homolog, 840309 NM_000230.1 LEP 519.77028 2.8308518 mouse) (LEP), mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 1384.7013 2.7951612 mRNA. Homo sapiens peptidylprolyl 70001 14 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 4784.469 2.7864001 mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 667.65251 2.7853306 mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 1300156 NM_001081754.1 ELN 385.3028 2.7850429 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 1169.3833 2.733448 mRNA. Homo sapiens collagen, type XVI, 5360743 NM_001856.3 COL16A1 3434.8845 2.6959119 alpha 1 (COL16A1), mRNA. Homo sapiens tenascin C 6940102 NM_002160.1 TNC 2724.6339 2.6909416 (hexabrachion) (TNC), mRNA. Homo sapiens cafhepsin K (CTSK), 1430278 NM_000396.2 CTSK 2324.6993 2.6583865 mRNA. Homo sapiens fibroblast growth factor 6420746 NM_002010.1 FGF9 9 (glia-activating factor) (FGF9), 158.42891 2.6575106 mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 14526.596 2.6572098 mRNA. Homo sapiens fibulin 1 (FBLN1), 4830685 NM_006486.2 FBLN1 14079.27 2.621 1832 transcript variant D, mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 2385.932 2.5920572 (DPM3), transcript variant 1, mRNA.

Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1152.7709 2.3405904 9, mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 4452.0853 2.3344866 transcript variant 2, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 1580608 NM_0 1243 1.1 SEMA3E 1771.3469 2.3278415 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. Homo sapiens stanniocalcin 2 (STC2), 1170170 NM_003714.2 STC2 10171.846 2.2897404 mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 2107.3842 2.2840667 (ANG), transcript variant 2, mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 165.51313 2.2829564 chromosome Y. Homo sapiens chromosome 2 open 1170524 NM_032319.1 C2orf7 843.70015 2.2641814 reading frame 7 (C2orf7), mRNA. Homo sapiens leucine rich repeat 2370041 NM_018334.3 LRRN3 182.47906 2.2537831 neuronal 3 (LRRN3), mRNA. Homo sapiens decorin (DCN), 50368 NM_001920.3 DCN 5419.1733 2.2435741 transcript variant Al, mRNA. Homo sapiens tumor necrosis factor (ligand) superfamily, member 14 1170673 NM_172014.1 TNFSF14 538.14985 2.2127382 (TNFSF14), transcript variant 2, mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 6019.1 19 2.2047046 mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 7150609 NM_021599.1 ADAMTS2 2 11.63547 2.2046474 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 4050326 NM_139125.2 MASP1 259.309 2.1955718 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 912.65516 2.1911247 1, mRNA. Homo sapiens interferon, alpha 10 3990563 NM_002171.1 IFNA10 156.42758 2.1888069 (IFNA10), mRNA. Homo sapiens FK506 binding protein 4150753 NM_017946.2 FKBP14 2151.0059 2.1885303 14, 22 kDa (FKBP14), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 375.8587 2.185191 variant 2, mRNA. Homo sapiens proteinase 3 (serine proteinase, neutrophil, Wegener 1770731 NM_002777.3 PRTN3 137.39086 2.1728688 granulomatosis autoantigen) (PRTN3), mRNA.

Homo sapiens pyrophosphatase (inorganic) 2 (PPA2), nuclear gene 770356 NM_006903.4 PPA2 3080.2386 2.1724985 encoding mitochondrial protein, transcript variant 2, mRNA. Homo sapiens cartilage oligomeric 2360148 NM_000095.2 COMP 6039.8732 2.144975 matrix protein (COMP), mRNA. Homo sapiens neuronal pentraxin II 6420050 NM_002523.1 NPTX2 386.11593 2.1423221 (NPTX2), mRNA. Homo sapiens synaptonemal complex 6760673 NM_006455.2 SC65 4595.7758 2.1368509 protein SC65 (SC65), mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 204.30848 2.1339293 SHOX2a, mRNA. Homo sapiens EGF-like-domain, 6330079 NM_015507.2 EGFL6 372.56748 2.11 13084 multiple 6 (EGFL6), mRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating 5260291 NM_001035256.1 POMC 125.68407 2.100674 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA.

Homo sapiens asparagine-linked glycosylation 5 homolog (S. 63701 13 NM_013338.3 ALG5 1991.3366 2.0994353 cerevisiae, dolichyl-phosphate beta- glucosyltransferase) (ALG5), mRNA. Homo sapiens nucleobindin 2 60427 NM_005013.2 NUCB2 2240.0342 2.0923376 (NUCB2), mRNA. Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 2314.2883 2.0291845 mRNA. Homo sapiens FK506 binding protein 60681 NM_021939.2 FKBP10 1329.8792 2.0290758 10, 65 kDa (FKBP10), mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 25880.203 2.0269356 transcript variant C, mRNA. Homo sapiens deleted in lymphocytic 5490053 NR_002605.1 DLEUl leukemia, 1 (DLEUl) on chromosome 827.93569 2.0253468 13. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 9009.6538 2.0090537 mRNA.

Xgene FB P9 D14 Chondro Pellet Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens neuronal pentraxin II 6420050 NM_002523.1 NPTX2 3636.9572 20.179261 (NPTX2), mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 15425.628 19.576806 (APOD), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 3290630 NM_000624.3 SERPINA5 3385.2972 19.366419 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. Homo sapiens SPARC-like 1 (mast9, 6960148 NM_004684.2 SPARCL1 2273.9765 19.260517 hevin) (SPARCL1), mRNA. Homo sapiens matrix metallopeptidase 3800088 NM_002423.3 MMP7 7 (matrilysin, uterine) (MMP7), 2922.415 16.191337 mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 IL1RL1 like 1 (ILIRLI), transcript variant 2, 1667.773 16.095125 mRNA. Homo sapiens chemokine (C-C motif) 6620121 NM_005623.2 CCL8 969.51 136 12.562221 ligand 8 (CCL8), mRNA. Homo sapiens dermatopontin (DPT), 2100228 NM_001937.3 DPT 17451.02 11.306774 mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 12919.429 10.152746 transcript variant A2, mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 1025.0364 9.7902832 (F10), mRNA. Homo sapiens cartilage intermediate layer protein, nucleotide 6400427 NM_003613.2 CILP 2930.2319 8.0675329 pyrophosphohydrolase (CILP), mRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 762.91814 7.8757894 mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 1376.0522 7.1188678 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens RAS, dexamefhasone- 2710735 NM_016084.3 RASD1 1905.7044 6.6465438 induced 1 (RASD1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 749.28658 6.2898123 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens SPARC related modular 2630437 NM_022138.1 SMOC2 609.73658 6.0672506 calcium binding 2 (SMOC2), mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1720.0053 5.9993207 specific (ECM2), mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 1225.646 5.9918956 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 518.9736 5.6619994 (NAALADL1), mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1611.2522 5.6608217 (LY96), mRNA. Homo sapiens cafhelicidin 5860075 NM_004345.3 CAMP antimicrobial peptide (CAMP), 335.49897 5.5851 133 mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2734.1034 5.5190673 mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLF1 2820.5214 4.9635416 factor 1 (CRLF1), mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 9910.1417 4.2746882 transcript variant C, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 6280168 NM_001085.4 SERPINA3 6295.2746 4.2724868 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. Homo sapiens apolipoprotein E 730414 NM_000041.2 APOE 10564.173 4.255266 (APOE), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 391.2969 4.1445117 2, mRNA. Homo sapiens RAB40A, member RAS 4490241 NM_080879.2 RAB40A 240.11785 4.0428719 oncogene family (RAB40A), mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 446.4087 4.0203229 transcript variant 1, mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 557.81976 4.0034653 matrix protein (SPON1), mRNA. Homo sapiens cartilage oligomeric 2360148 NM_000095.2 COMP 10753.486 3.8189473 matrix protein (COMP), mRNA. Homo sapiens coiled-coil domain 780341 NM_03 1455.2 CCDC3 650.0674 3.81 11946 containing 3 (CCDC3), mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 9090.7962 3.7610901 loop-helix protein (ID3), mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISP1 signaling pathway protein 1 (WISP1), 899.86519 3.755212 transcript variant 1, mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARID1D), 251.87375 3.7475241 mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILl lRA alpha (ILl lRA), transcript variant 1, 833.86593 3.7064524 mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 1663.174 3.6455164 mRNA. Homo sapiens fibulin 1 (FBLN1), 5050131 NM_006485.3 FBLN1 247.24786 3.624085 transcript variant B, mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 3757.6047 3.5734416 variant 1, mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (IGF1), 295.76991 3.5547248 mRNA. Homo sapiens apolipoprotein C-I 3830465 NM_001645.3 APOC1 726.97419 3.533025 (APOC1), mRNA. Homo sapiens decorin (DCN), 50368 NM_001920.3 DCN 8531.2376 3.5319895 transcript variant Al, mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 11675.871 3.4583078 mRNA. Homo sapiens cafhepsin K (CTSK), 1430278 NM_000396.2 CTSK 2978.8617 3.4064473 mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1995.2286 3.3851877 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 ILl lRA alpha (ILl lRA), transcript variant 1, 4822.3853 3.3730468 mRNA. Homo sapiens prolactin (PRL), 5860041 NM_000948.3 PRL 198.3924 3.3354795 mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 2747.9712 3.3059973 1, r subcomponent (C1R), mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 737.88392 3.3007114 transcript variant 1, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 18038.537 3.2996153 mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 1332.523 3.2506072 (RECK), mRNA. Homo sapiens prokineticin 1 7550131 NM_032414.2 PROK1 201.28178 3.2414343 (PROK1), mRNA. Homo sapiens WAP four-disulfide 1230615 NM_02 1197.2 WFDC1 367.67994 3.2383236 core domain 1 (WFDC1), mRNA. Homo sapiens Clq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 301.2146 3.2372949 transcript variant 2, mRNA. Homo sapiens cytochrome P450, 4250575 NM_000779.2 CYP4B1 family 4, subfamily B, polypeptide 1 192.15147 3.0882268 (CYP4B1), mRNA. Homo sapiens fibulin 1 (FBLN1), 4830685 NM_006486.2 FBLN1 16553.6 3.081837 transcript variant D, mRNA. Homo sapiens dickkopf homolog 1 4880609 NM_012242.2 DKK1 197.77257 3.0625422 (Xenopus laevis) (DKK1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 223.95745 3.0487928 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 3563.0409 2.9219834 disease) (LIPA), mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 3713.0861 2.8588577 transcript variant A, mRNA. Homo sapiens insulin-like 5 (FNSL5), 3180605 NM_005478.3 INSL5 204.30848 2.8138357 mRNA. Homo sapiens osteomodulin (OMD), 4610246 NM_005014.1 OMD 1143.3712 2.7744668 mRNA. Homo sapiens glutathione peroxidase 7 4200543 NM_015696.3 GPX7 5383.4422 2.7699339 (GPX7), mRNA.

Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating 5080072 NM_001035256.1 POMC 187.91917 2.7651888 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 3400600 NM_014244.2 ADAMTS2 299.34218 2.7533609 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens laminin, alpha 3 6480592 NM_198129.1 LAMA3 265.84012 2.7252626 (LAMA3), transcript variant 1, mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1133.0381 2.7202253 1, mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 5512.9174 2.7095287 transcript variant 2, mRNA. Homo sapiens osteoglycin (OGN), 4480152 NM_014057.3 OGN 717.31504 2.7027998 transcript variant 3, mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 647.64867 2.701878 mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 670.70457 2.6906724 (WNT2), mRNA. Homo sapiens X-prolyl aminopeptidase (aminopeptidase P) 2, 4780544 NM_003399.5 XPNPEP2 243.3708 2.6491577 membrane-bound (XPNPEP2), mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 988.40472 2.6374699 mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 450.89978 2.6214696 variant 2, mRNA. Homo sapiens peptidylprolyl 70001 14 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 4414.6049 2.570997 mRNA. Homo sapiens TIMP metallopeptidase 1090326 NM_003256.2 TIMP4 961.51637 2.5065959 inhibitor 4 (TIMP4), mRNA. Homo sapiens Thy-l cell surface 6480204 NM_006288.2 THY1 5952.7799 2.4988277 antigen (THY1), mRNA. Homo sapiens zinc finger protein 533 5290333 NM_152520.3 ZNF533 218.87699 2.4907406 (ZNF533), mRNA. Homo sapiens osteoglycin (OGN), 2940280 NM_014057.3 OGN 1226.7959 2.4551598 transcript variant 3, mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 31253.086 2.4477394 transcript variant C, mRNA. Homo sapiens mitochondrial ribosomal protein L43 (MRPL43), nuclear gene 6940521 NM_0321 12.2 MRPL43 1306.4966 2.4391244 encoding mitochondrial protein, transcript variant 1, mRNA. Homo sapiens proprotein convertase 520176 NM_000439.3 PCSK1 subtilisin/kexin type 1 (PCSK1), 165.7455 2.4240724 mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 337.65855 2.402131 1 (PTPRN), mRNA. Homo sapiens matrix Gla protein 1430487 NM_000900.2 MGP 8654.8028 2.3894208 (MGP), mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 2490152 NM_001040092.1 ENPP2 543.41755 2.3781833 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 1075.5087 2.3746372 (SERPING1), transcript variant 2, mRNA. Homo sapiens agouti signaling protein, 3460474 NM_001672.2 ASIP nonagouti homolog (mouse) (ASIP), 165.05708 2.3699492 mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 2169.2099 2.3510758 (ANG), transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 3844.1298 2.3508456 3, mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 7150609 NM_021599.1 ADAMTS2 224.84727 2.3422772 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. Homo sapiens periostin, osteoblast 510246 NM_006475.1 POSTN 1800.5978 2.3366212 specific factor (POSTN), mRNA. Homo sapiens glypican 3 (GPC3), 1340593 NM_004484.2 GPC3 356.34617 2.3245768 mRNA. Homo sapiens gelsolin (amyloidosis, 3940204 NM_000177.3 GSN Finnish type) (GSN), transcript variant 222.9017 2.3143678 1, mRNA. Homo sapiens vitamin K epoxide reductase complex, subunit 1 6450546 NM_024006.4 VKORC1 3077.4853 2.3125167 (VKORC1), transcript variant 1, mRNA. Homo sapiens tissue factor pathway inhibitor (lipoprotein-associated 4280674 NM_001032281.2 TFPI 316.24145 2.2483592 coagulation inhibitor) (TFPI), transcript variant 2, mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 314.80701 2.2247389 (HOXA9), mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 212.71608 2.2217437 SHOX2a, mRNA. Homo sapiens asparagine-linked glycosylation 5 homolog (S. 63701 13 NM_013338.3 ALG5 2080.3737 2.1933058 cerevisiae, dolichyl-phosphate beta- glucosyltransferase) (ALG5), mRNA.

Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 1824.2199 2.1794473 aminopeptidase, CD13, pi 50) (ANPEP), mRNA. Homo sapiens fibulin 1 (FBLN1), 430088 NM_006487.2 FBLN1 133.55295 2.1692231 transcript variant A, mRNA. Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CES1 (monocyte/macrophage serine esterase 134.11032 2.1661794 1) (CES1), transcript variant 1, mRNA. Homo sapiens CD58 molecule (CD58), 5900594 NM_001779.1 CD58 1118.2471 2.1399892 mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1536.5372 2.1351064 1, mRNA. Homo sapiens scrapie responsive 1110048 NM_007281.1 SCRG1 2822.9493 2.133594 protein 1 (SCRG1), mRNA. Homo sapiens SWI/SNF related, matrix associated, actin dependent 1580327 NM_003077.2 SMARCD2 801.17065 2.1125656 regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 191.68142 2.0882391 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 3850500 NM_005031.3 FXYDl 195.06143 2.0756927 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens chromosome 6 open 1190082 NM_001040437.1 C6orf48 reading frame 48 (C6orf48), transcript 225.98709 2.0748582 variant 1, mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 225.98709 2.0419631 complex, locus H (LY6H), mRNA. Homo sapiens neurotrophin 3 (NTF3), 2940441 NM_002527.3 NTF3 413.79779 2.032885 mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 861.21962 2.0131 115 mRNA. Homo sapiens cafhepsin F (CTSF), 3930020 NM_003793.2 CTSF 333.96003 2.0091993 mRNA.

Xgene FB P9 D14 Chondro MM Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens SPARC related modular 2630437 NM_022138.1 SMOC2 2292.1658 22.808447 calcium binding 2 (SMOC2), mRNA. Homo sapiens WAP four-disulfide 1230615 NM_02 1197.2 WFDC1 2062.6271 18.166491 core domain 1 (WFDC1), mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 2298.804 16.498487 matrix protein (SPON1), mRNA. Homo sapiens dermatopontin (DPT), 2100228 NM_001937.3 DPT 23004.187 14.904754 mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 932.11 165 12.689086 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens SPARC-like 1 (mast9, 6960148 NM_004684.2 SPARCL1 1471.9015 12.466964 hevin) (SPARCL1), mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 2124.8319 10.992604 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 2079.6658 10.166998 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens Clq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 924.61342 9.937255 transcript variant 2, mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 1149.0929 9.6459472 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens cartilage oligomeric 2360148 NM_000095.2 COMP 27098.344 9.623591 matrix protein (COMP), mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 3906.8519 9.5305227 (RECK), mRNA. Homo sapiens cartilage intermediate layer protein, nucleotide 6400427 NM_003613.2 CILP 3410.2531 9.3891304 pyrophosphohydrolase (CILP), mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 994.30133 8.9546023 transcript variant 1, mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 11489.875 8.8465273 transcript variant A, mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 10679.388 8.392407 transcript variant A2, mRNA. Homo sapiens CDlc molecule 1500725 NM_001765.2 CD1C 1505.5186 7.8988483 (CD1C), mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 2766.9904 7.3834673 mRNA. Homo sapiens slit homolog 2 4560592 NM_004787.1 SLIT2 2628.9071 7.2488321 (Drosophila) (SLIT2), mRNA. Homo sapiens fibrillin 2 (congenital 3440204 NM_001999.3 FBN2 contractural arachnodactyly) (FBN2), 13397.483 7.09445 mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1929.7683 6.7309669 specific (ECM2), mRNA. Homo sapiens periostin, osteoblast 510246 NM_006475.1 POSTN 5182.6953 6.7255419 specific factor (POSTN), mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 3400600 NM_014244.2 ADAMTS2 719.39838 6.6170539 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens growth arrest-specific 6 4570181 NM_000820.1 GAS6 2429.8056 6.5607641 (GAS6), mRNA. Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 7406.5817 6.4941437 mRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 3124.5562 6.106151 1 transcript variant 2, mRNA. Homo sapiens coiled-coil domain 780341 NM_03 1455.2 CCDC3 1019.9208 5.9795593 containing 3 (CCDC3), mRNA. Homo sapiens angiopoietin 1 3360066 NM_001 146.3 ANGPT1 2353.86 5.9459569 (ANGPT1), mRNA. Homo sapiens fibulin 5 (FBLN5), 4670441 NM_006329.2 FBLN5 12054.09 5.9447028 mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 3290630 NM_000624.3 SERPINA5 1015.3279 5.8084315 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. Homo sapiens stanniocalcin 2 (STC2), 1170170 NM_003714.2 STC2 25684.391 5.7817026 mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 6691.4562 5.6597956 mRNA. Homo sapiens osteomodulin (OMD), 4610246 NM_005014.1 OMD 2309.0232 5.6029991 mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISP1 signaling pathway protein 1 (WISP1), 1326.561 1 5.5358493 transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 3800088 NM_002423.3 MMP7 7 (matrilysin, uterine) (MMP7), 990.90959 5.4900317 mRNA. Homo sapiens limb bud and heart 840369 NM_030915.1 LBH development homolog (mouse) (LBH), 944.66232 5.4399225 mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 6130577 NM_001081754.1 ELN 10493.166 5.3573274 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 3121.7596 5.2965069 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (IGF1), 436.43761 5.2453463 mRNA. Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 1412.1392 5.24406 (Drosophila) (SLIT3), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARID1D), 348.34299 5.1828497 mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 1224.45 5.1081932 mRNA. Homo sapiens Thy-l cell surface 6480204 NM_006288.2 THY1 12159.015 5.1040495 antigen (THY1), mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 4230.1569 5.089168 1, r subcomponent (C1R), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 865.64985 5.0327697 variant 2, mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 1300156 NM_001081754.1 ELN 695.84882 5.0297294 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens syntaxin binding protein 7550022 NM_1 39244.2 STXBP5 1880.2898 5.026997 5 (tomosyn) (STXBP5), mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLF1 2798.517 4.9248183 factor 1 (CRLF1), mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 11027.86 4.7568101 transcript variant C, mRNA. Homo sapiens protease, serine, 12 2480692 NM_003619.2 PRSS12 (neurotrypsin, motopsin) (PRSS12), 773.64395 4.7090284 mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 9483.5714 4.6610545 transcript variant 2, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2302.2323 4.6472914 mRNA. Homo sapiens fibulin 1 (FBLN1), 4830685 NM_006486.2 FBLN1 24958.137 4.6465368 transcript variant D, mRNA. Homo sapiens myosin light chain 1300286 NM_053026.3 MYLK kinase (MYLK), transcript variant 2, 1040.7369 4.6440059 mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 7150609 NM_021599.1 ADAMTS2 443.78982 4.6230439 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. Homo sapiens chloride intracellular 5870136 NM_004669.2 CLIC3 1314.458 4.392093 channel 3 (CLIC3), mRNA. Homo sapiens secreted frizzled-related 3060639 NM_003013.2 SFRP2 4359.3979 4.3654025 protein 2 (SFRP2), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 3539.94 4.2292668 aminopeptidase, CD13, p i 50) (ANPEP), mRNA.

Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 4326.2069 4.1141761 variant 1, mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 13595.27 4.0268197 mRNA. Homo sapiens proline/arginine-rich "7000446 NM_20 1348.1 PRELP end leucine-rich repeat protein 429.96696 4.0201204 (PRELP), transcript variant 2, mRNA. Homo sapiens dickkopf homolog 2 4900050 NM_014421.2 DKK2 1011.6097 4.0057294 (Xenopus laevis) (DKK2), mRNA. Homo sapiens growth arrest-specific 6 70730 NM_000820.1 GAS6 15873.563 3.9893726 (GAS6), mRNA. Homo sapiens neurotrophin 3 (NTF3), 2940441 NM_002527.3 NTF3 797.83009 3.9195397 mRNA. Homo sapiens leptin (obesity homolog, 840309 NM_000230.1 LEP 698.11962 3.802205 mouse) (LEP), mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 1216.3071 3.6992919 (SRGAP1), mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISP1 signaling pathway protein 1 (WISP1), 273.86254 3.6621 122 transcript variant 2, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 20016.516 3.6614278 mRNA. Homo sapiens phospholipid 4120019 NM_020353.1 PLSCR4 2190.0962 3.6418362 scramblase 4 (PLSCR4), mRNA. Homo sapiens collagen, type XVI, 5360743 NM_001856.3 COL16A1 4595.7758 3.6070518 alpha 1 (COL16A1), mRNA. Homo sapiens wingless-type MMTV 1820343 NM_003392.3 WNT5A integration site family, member 5A 4991.946 3.5653672 (WNT5A), mRNA. Homo sapiens osteoglycin (OGN), 4480152 NM_014057.3 OGN 934.36519 3.5206316 transcript variant 3, mRNA. Homo sapiens glypican 3 (GPC3), 1340593 NM_004484.2 GPC3 534.38024 3.4859584 mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 364.04698 3.4770698 (F10), mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 4960.8145 3.469872 mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 1565.61 11 3.4316678 mRNA. Homo sapiens growth arrest-specific 6 4280632 NM_000820.1 GAS6 12976.429 3.337057 (GAS6), mRNA. Homo sapiens peptidylprolyl 70001 14 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 5649.8456 3.2903819 mRNA. Homo sapiens collagen, type XII, 3060095 NM_080645.2 COL12A1 alpha 1 (COL12A1), transcript variant 9879.3788 3.1900801 short, mRNA. Homo sapiens neuronal pentraxin II 6420050 NM_002523.1 NPTX2 574.37773 3.1868722 (NPTX2), mRNA. Homo sapiens tenascin C 6940102 NM_002160.1 TNC 3220.0619 3.1802433 (hexabrachion) (TNC), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1969.1799 3.1781688 3) (LTBR), mRNA. Homo sapiens fibulin 1 (FBLN1), 5050131 NM_006485.3 FBLN1 216.81681 3.1780359 transcript variant B, mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 708.27139 3.1682482 transcript variant 1, mRNA. Homo sapiens cafhepsin K (CTSK), 1430278 NM_000396.2 CTSK 2757.585 3.1534086 mRNA. Homo sapiens interleukin 6 signal transducer (gpl30, oncostatin M 3830048 NM_002184.2 IL6ST 272.04499 3.1465176 receptor) (IL6ST), transcript variant 1, mRNA. Homo sapiens RPE-spondin (RPESP), 2600397 NM_153225.2 RPESP 264.39602 3.0678397 mRNA. Homo sapiens osteoglycin (OGN), 2940280 NM_014057.3 OGN 1530.3845 3.0627251 transcript variant 3, mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 3722.3932 3.0526654 disease) (LIPA), mRNA. Homo sapiens follistatin-like 1 2650220 NM_007085.3 FSTL1 2 1186.499 3.0381817 (FSTL1), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 678.22478 3.0146427 mRNA. Homo sapiens follistatin (FST), 6020286 NM_0 13409.1 FST 7984.5058 2.9826799 transcript variant FST344, mRNA. Homo sapiens leucine rich repeat 2370041 NM_018334.3 LRRN3 240.65413 2.9722984 neuronal 3 (LRRN3), mRNA. Homo sapiens RAB40A, member RAS 4490241 NM_080879.2 RAB40A 175.40059 2.9532254 oncogene family (RAB40A), mRNA. Homo sapiens procollagen-lysine, 2- 4640187 NM_000935.2 PLOD2 oxoglutarate 5-dioxygenase 2 3835.0556 2.9489649 (PLOD2), transcript variant 2, mRNA. Homo sapiens laminin, alpha 3 6480592 NM_198129.1 LAMA3 283.19904 2.9032178 (LAMA3), transcript variant 1, mRNA. Homo sapiens myeloid cell leukemia 7380100 NM_021960.3 MCL1 sequence 1 (BCL2-related) (MCL1), 1268.3892 2.8962699 transcript variant 1, mRNA. Homo sapiens kallikrein-related 460202 NM_001030050.1 KLK3 peptidase 3 (KLK3), transcript variant 577.60531 2.8943079 6, mRNA. Homo sapiens interleukin 6 signal transducer (gpl30, oncostatin M 4260333 NM_002184.2 IL6ST 529.20428 2.8521 194 receptor) (IL6ST), transcript variant 1, mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 259.59086 2.8321349 (NAALADL1), mRNA. Homo sapiens cysteine-rich, 3930605 NM_001554.3 CYR61 angiogenic inducer, 6 1 (CYR61), 18155.869 2.8147086 mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 6791.0518 2.8096283 loop-helix protein (ID3), mRNA. Homo sapiens aspartate beta- 5890619 NM_004318.2 ASPH hydroxylase (ASPH), transcript variant 478.96851 2.8083894 1, mRNA. Homo sapiens guanine nucleotide 5890025 NM_0 18841.4 GNG12 binding protein (G protein), gamma 12 2529.0429 2.7849573 (GNG12), mRNA. Homo sapiens follistatin (FST), 1260068 NM_006350.2 FST 620.80863 2.7661213 transcript variant FST317, mRNA. Homo sapiens glutamate receptor, 1030240 NM_021956.2 GRIK2 ionotropic, kainate 2 (GRIK2), 189.19602 2.7092064 transcript variant 1, mRNA. Homo sapiens chromosome 5 open 940471 NM_004772.1 C5orfl3 24452.144 2.6901332 reading frame 13 (C5orfl3), mRNA. Homo sapiens insulin-like growth 6840372 NM_001013398.1 IGFBP3 factor binding protein 3 (IGFBP3), 20167.417 2.6884219 transcript variant 1, mRNA. Homo sapiens procollagen-proline, 2- oxoglutarate 4-dioxygenase (proline 4- 7570379 NM_001017974.1 P4HA2 1331.8667 2.6863567 hydroxylase), alpha polypeptide II (P4HA2), transcript variant 3, mRNA. Homo sapiens milk fat globule-EGF 5560075 NM_005928.1 MFGE8 27548.738 2.6668105 factor 8 protein (MFGE8), mRNA. Homo sapiens phospholipase C, beta 4 6280097 NM_000933.2 PLCB4 360.49912 2.6216331 (PLCB4), transcript variant 1, mRNA. Homo sapiens follistatin-like 3 2360356 NM_005860.2 FSTL3 (secreted glycoprotein) (FSTL3), 4299.9885 2.6165233 mRNA. Homo sapiens fibulin 2 (FBLN2), 780025 NM_001004019.1 FBLN2 148.89506 2.5632495 transcript variant 1, mRNA. Homo sapiens elastin microfibril 6760719 NM_007046.1 EMILINl 2341.8403 2.5630313 interfacer 1 (EMILINl), mRNA. Homo sapiens 24-dehydrocholesterol 4480341 NM_014762.3 DHCR24 1005.6569 2.5604675 reductase (DHCR24), mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 243.99226 2.5484122 SHOX2a, mRNA. Homo sapiens protein tyrosine 3940541 NM_030671.1 PTPRO phosphatase, receptor type, O 207.30782 2.5308748 (PTPRO), transcript variant 5, mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 627.78953 2.5185097 (WNT2), mRNA. Homo sapiens Ras suppressor protein 1 6 110209 NM_012425.3 RSU1 1319.342 2.5150778 (RSU1), transcript variant 1, mRNA. Homo sapiens decorin (DCN), 50368 NM_001920.3 DCN 6073.0357 2.5142775 transcript variant Al, mRNA. Homo sapiens hypothetical protein 3190121 NM_177964.3 LOC130576 295.59897 2.5041369 LOC130576 (LOC130576), mRNA. Homo sapiens RAP1, GTP-GDP 5560139 NM_021 159.3 RAP1GDS1 dissociation stimulator 1 721.69218 2.4978702 (RAP1GDS1), mRNA. Homo sapiens fibroblast growth factor 6420746 NM_002010.1 FGF9 9 (glia-activating factor) (FGF9), 148.45509 2.4902082 mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 4490563 NM_172244.2 SGCD 178.27802 2.4779927 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 4719.7603 2.4748442 transcript variant 2, mRNA. Homo sapiens collagen, type VIII, 3360452 NM_020351.2 COL8A1 alpha 1 (COL8A1), transcript variant 9009.6538 2.4698095 2, mRNA. Homo sapiens insulin-like growth 6590132 NM_000598.4 IGFBP3 factor binding protein 3 (IGFBP3), 26070.535 2.4677473 transcript variant 2, mRNA. Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CES1 (monocyte/macrophage serine esterase 152.42478 2.4619985 1) (CES1), transcript variant 1, mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 6663.6869 2.4407992 mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 770408 NM_000602.1 SERPINE1 11627.675 2.4314185 activator inhibitor type 1), member 1 (SERPINE1), mRNA. Homo sapiens fibroblast growth factor receptor 1 (fms-related tyrosine kinase 6450471 NM_023107.2 FGFR1 369.19233 2.427825 2, Pfeiffer syndrome) (FGFR1), transcript variant 5, mRNA. Homo sapiens RAS, dexamethasone- 2710735 NM_016084.3 RASD1 687.01246 2.3961 induced 1 (RASD1), mRNA. Homo sapiens glutathione peroxidase 7 4200543 NM_015696.3 GPX7 4608.6774 2.3712954 (GPX7), mRNA. Homo sapiens laminin, beta 2 (laminin 7650189 NM_002292.3 LAMB2 2360.9204 2.3685546 S) (LAMB2), mRNA. Homo sapiens adipocyte-specific 5570682 NM_024769.2 ASAM 1468.1515 2.3430465 adhesion molecule (ASAM), mRNA. Homo sapiens laminin, alpha 3 2650612 NM_198129.1 LAMA3 176.92353 2.3417843 (LAMA3), transcript variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade H (heat shock protein 7650017 NM_001235.2 SERPINH1 19881.979 2.332411 47), member 1, (collagen binding protein 1) (SERPINH1), mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 5080192 NM_006216.2 SERPINE2 27760.729 2.3208228 activator inhibitor type 1), member 2 (SERPINE2), mRNA. Homo sapiens collagen, type VIII, 2510091 NM_020351.2 COL8A1 alpha 1 (COL8A1), transcript variant 22542.571 2.3204069 2, mRNA. Homo sapiens Nedd4 family 60553 NM_030571.2 NDFIP1 interacting protein 1 (NDFIP1), 769.43304 2.3165503 mRNA. Homo sapiens chloride intracellular channel 4 (CLIC4), nuclear gene 270653 NM_0 13943.1 CLIC4 1201.4714 2.3078664 encoding mitochondrial protein, mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 29441.861 2.3058844 transcript variant C, mRNA. Homo sapiens microfibrillar-associated 2710307 NM_005927.3 MFAP3 662.4281 2.3056768 protein 3 (MFAP3), mRNA. Homo sapiens UDP-N-acetyl-alpha-D- galactosamine:polypeptide N- 3610202 NM_017540.3 GALNT10 acetylgalactosaminyltransferase 10 2097.356 2.3029913 (GalNAc-TIO) (GALNT10), transcript variant 2, mRNA.

Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 2490152 NM_001040092.1 ENPP2 526.1646 2.3026784 (autotaxin) (ENPP2), transcript variant 2, mRNA.

Homo sapiens UDP-N-acetyl-alpha-D- galactosamine:polypeptide N- 2060301 NM_198321.2 GALNT10 acetylgalactosaminyltransferase 10 260.53466 2.2879932 (GalNAc-TIO) (GALNT10), transcript variant 1, mRNA. Homo sapiens integrin, beta 5 26501 14 NM_002213.3 ITGB5 (ITGB5), mRNA. XM_944688 19599.502 2.2846037 XM_944693 Homo sapiens cafhepsin F (CTSF), 3930020 NM_003793.2 CTSF 379.26136 2.2817451 mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 412.82655 2.2578005 cyclooxygenase) (PTGS1), transcript variant 1, mRNA. Homo sapiens wingless-type MMTV 4850370 NM_032642.2 WNT5B integration site family, member 5B 1707.3892 2.2347138 (WNT5B), transcript variant 1, mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 840678 NM_001040092.1 ENPP2 676.70398 2.2331434 (autotaxin) (ENPP2), transcript variant 2, mRNA.

Homo sapiens scavenger receptor class 7570692 NM_153334.3 SCARF2 F, member 2 (SCARF2), transcript 187.0531 2.0801762 variant 1, mRNA. Homo sapiens Rho guanine nucleotide 3850333 NM_015320.2 ARHGEF4 exchange factor (GEF) 4 (ARHGEF4), 229.93083 2.077528 transcript variant 1, mRNA. Homo sapiens scavenger receptor class 5390703 NM_153334.3 SCARF2 F, member 2 (SCARF2), transcript 1439.5319 2.0626291 variant 1, mRNA. Homo sapiens collagen, type VI, alpha 7570598 NM_001848.2 COL6A1 13094.317 2.050844 1 (COL6A1), mRNA. Homo sapiens astrotactin 2 (ASTN2), 3120132 NM_198188.1 ASTN2 194.45413 2.0038667 transcript variant 4, mRNA. Homo sapiens protocadherin 10 1580753 NM_020815.1 PCDH10 (PCDH10), transcript variant 2, 285.19071 2.0020039 mRNA.

ASC-2 P4 Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 23476.049 82.604321 mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 19047.355 24.173172 (APOD), mRNA. Homo sapiens cafhepsin K (CTSK), 1430278 NM_000396.2 CTSK 20167.417 23.062247 mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 7475.5754 19.947907 mRNA. Homo sapiens apolipoprotein C-I 3830465 NM_001645.3 APOC1 3367.8413 16.367387 (APOC1), mRNA. Homo sapiens major histocompatibility 2570564 NM_0191 11.3 HLA-DRA complex, class II, DR alpha (HLA- 1591.126 16.259524 DRA), mRNA. Homo sapiens similar to hypothetical 770156 NM_203422.1 LOC221091 1201.4714 15.990593 protein (LOC221091), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 1403.7066 13.376693 complexing protein 2) (DPP4), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 5330.0074 11.76823 (SERPING1), transcript variant 2, mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 2490152 NM_001040092.1 ENPP2 2611.9798 11.430928 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 3235.8125 11.368399 (LY96), mRNA. Homo sapiens RAS, dexamethasone- 2710735 NM_016084.3 RASD1 3248.9969 11.331558 induced 1 (RASD1), mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 1506.3317 10.810923 matrix protein (SPON1), mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 840678 NM_001040092.1 ENPP2 3161.2938 10.432364 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens CUG triplet repeat, 5390575 NM_006561.2 CUGBP2 RNA binding protein 2 (CUGBP2), 697.7365 10.219749 transcript variant 2, mRNA. Homo sapiens cathepsin F (CTSF), 3930020 NM_003793.2 CTSF 1693.9279 10.191 156 mRNA. Homo sapiens family with sequence 2810373 NM_017565.2 FAM20A similarity 20, member A (FAM20A), 819.1671 1 9.9518396 mRNA. Homo sapiens netrin Gl (NTNGl), 6940053 NM_014917.2 NTNG1 1158.6235 9.5678363 transcript variant 3, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 4734.0848 9.5562344 mRNA. Homo sapiens prostaglandin E 1510181 NM_004878.3 PTGES 5718.701 9.1477662 synthase (PTGES), mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 3106.8338 8.9275469 (plasma) (GPX3), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 9009.6538 8.5680837 variant 1, mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 871.631 12 8.3250857 (F10), mRNA. Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CES1 (monocyte/macrophage serine esterase 501.80221 8.1052196 1) (CES1), transcript variant 1, mRNA. Homo sapiens superoxide dismutase 3, 3890095 NM_003102.2 SOD3 877.9674 7.9035598 extracellular (SOD3), mRNA. Homo sapiens apolipoprotein E 730414 NM_000041.2 APOE 19176.664 7.7243913 (APOE), mRNA. Homo sapiens X-prolyl aminopeptidase (aminopeptidase P) 2, 4780544 NM_003399.5 XPNPEP2 705.60826 7.6807391 membrane-bound (XPNPEP2), mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 6019.1 19 7.2414117 1, r subcomponent (C1R), mRNA. Homo sapiens chromosome 20 open 1690201 NM_182519.1 C20orfl86 reading frame 186 (C20orfl86), 390.27176 7.2188172 mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 646.16962 7.0395801 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 5886.2299 6.6182259 mRNA. Homo sapiens folate receptor 3 4010181 NM_000804.2 FOLR3 514.8826 6.5039844 (gamma) (FOLR3), mRNA. Homo sapiens phospholipase A2, 4480468 NM_000929.2 PLA2G5 353.4264 6.31 14421 group V (PLA2G5), mRNA. Homo sapiens complement component 670594 NM_000063.3 C2 493.28614 6.1900272 2 (C2), mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 7846.1456 6.165901 transcript variant A2, mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 1049.5171 6.1017488 variant 2, mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 549.42434 5.9942168 (NAALADL1), mRNA. Homo sapiens carbonic anhydrase XII 150474 NM_001218.3 CA12 7509.4586 5.9090642 (CA12), transcript variant 1, mRNA. Homo sapiens elastin microfibril 1190142 NM_032048.2 EMILIN2 1847.2586 5.8879456 interfacer 2 (EMILFN2), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 3850500 NM_005031.3 FXYDl 535.53333 5.6987309 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens SLIT and NTRK-like 7330477 NM_173078.2 SLITRK4 707.62139 5.6855049 family, member 4 (SLITRK4), mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 12976.429 5.5973152 transcript variant C, mRNA. Homo sapiens angiopoietin-like 2 7650672 NM_012098.2 ANGPTL2 5669.5187 5.4999622 (ANGPTL2), mRNA. Homo sapiens proteoglycan 2, bone marrow (natural killer cell activator, 3840072 NM_002728.4 PRG2 373.33555 5.3370873 eosinophil granule major basic protein) (PRG2), mRNA. Homo sapiens carbonic anhydrase XII 3830075 NM_001218.3 CA12 1691.9584 5.3364696 (CA12), transcript variant 1, mRNA. Homo sapiens chitinase 3-like 2 610598 NM_004000.2 CHI3L2 895.14572 4.8999976 (CHI3L2), transcript variant 1, mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 6332.4214 4.8755916 transcript variant A, mRNA. Homo sapiens fatty acid desaturase 1 2360020 NM_013402.3 FADS1 5438.1055 4.8477567 (FADS1), mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 684.35907 4.8363607 (HOXA9), mRNA. Homo sapiens collectin sub-family 2100767 NM_130386.1 COLEC12 7371.1814 4.8123493 member 12 (COLEC12), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2973.404 4.7989418 3) (LTBR), mRNA. Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, 6290356 NM_002615.4 SERPINF1 3434.8845 4.6060327 pigment epithelium derived factor), member 1 (SERPFNF1), mRNA. Homo sapiens fms-related tyrosine 830324 NM_001459.2 FLT3LG 554.96873 4.4042769 kinase 3 ligand (FLT3LG), mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 15335.1 4.2655386 mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 4050326 NM_139125.2 MASP1 482.63407 4.0864673 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens olfactomedin 1 2680072 NM_014279.4 OLFM1 637.01667 4.0736313 (OLFM1), transcript variant 1, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 21951.868 4.015443 mRNA. Homo sapiens lymphocyte antigen 6 4890270 NM_002346.1 LY6E 8983.3292 4.0001859 complex, locus E (LY6E), mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 13397.483 3.9682366 mRNA. Homo sapiens chemokine (C-X-C 4610615 NM_000609.4 CXCL12 motif) ligand 12 (stromal cell-derived 10717.151 3.9167919 factor 1) (CXCL12), transcript variant 2, mRNA.

Homo sapiens RGM domain family, 6020682 NM_02021 1.1 RGMA 1120.7732 3.9161543 member A (RGMA), mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 544.431 12 3.8498064 mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 3450538 NM_000062.2 SERPING1 member 1, (angioedema, hereditary) 304.48658 3.7717254 (SERPING1), transcript variant 1, mRNA. Homo sapiens sulfide quinone 6770707 NM_02 1199.2 SQRDL reductase-like (yeast) (SQRDL), 1041.2077 3.6484489 mRNA. Homo sapiens phospholipase A2, 4860152 NM_000300.2 PLA2G2A group IIA (platelets, synovial fluid) 348.64668 3.5644456 (PLA2G2A), mRNA. Homo sapiens msh homeobox 1 1010333 NM_002448.3 MSX1 4991.946 3.5499078 (MSX1), mRNA. Homo sapiens parathyroid hormone 6900414 NM_198965.1 PTHLH like hormone (PTHLH), transcript 1083.3996 3.5240639 variant 1, mRNA. Homo sapiens chemokine (C-X-C motif) ligand 12 (stromal cell-derived 4560020 NM_199168.2 CXCL12 19736.908 3.5186153 factor 1) (CXCL12), transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 510736 NM_004530.2 MMP2 1505.5186 3.4918449 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 413.2854 3.4692835 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens like-glycosyltransferase 10768 NM_004737.3 LARGE 06.4448 3.400453 (LARGE), transcript variant 1, mRNA. Homo sapiens carboxypeptidase B1 4230343 NM_001871.2 CPB1 247.2149 3.3591443 (tissue) (CPB1), mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 6406.0473 3.3590623 transcript variant 2, mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 1089.0429 3.312229 (SRGAP1), mRNA. Homo sapiens regeneration associated 7320669 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 7188.0348 3.2358749 transcript variant 1, mRNA. Homo sapiens CD14 molecule (CD14), 6370369 NM_001040021.1 CD14 344.75133 3.1969788 transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 5216.8513 3.1903221 3, mRNA. Homo sapiens protein S (alpha) 6420008 NM_000313.1 PROS1 2788.7059 3.1868165 (PROS1), mRNA. Homo sapiens elastase 2, neutrophil 7650497 NM_001972.2 ELA2 2 11.28127 3.131058 (ELA2), mRNA. Homo sapiens laminin, alpha 1 21901 13 NM_005559.2 LAMA1 432.8146 3.1285697 (LAMA1), mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 3762.0058 3.0851509 disease) (LIPA), mRNA. Homo sapiens phospholipid transfer 5690519 NM_1 82676.1 PLTP protein (PLTP), transcript variant 2, 8027.5717 3.0337069 mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 8262.2099 3.026312 mRNA. Homo sapiens nephroblastoma 4290037 NM_002514.2 NOV 663.94661 3.024181 1 overexpressed gene (NOV), mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 6106.4316 3.0012333 transcript variant 2, mRNA. Homo sapiens low density lipoprotein- related protein 1 (alpha-2- 2710286 NM_002332.2 LRP1 730.8674 2.9998234 macroglobulin receptor) (LRP1), mRNA. Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 806.29543 2.9942245 (Drosophila) (SLIT3), mRNA. Homo sapiens hepatitis A virus cellular 5220093 NM_032782.3 HAVCR2 328.38746 2.9826279 receptor 2 (HAVCR2), mRNA. Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 175.65251 2.9727422 mRNA. Homo sapiens bone morphogenetic 4280577 NM_001200.2 BMP2 661.60678 2.9324383 protein 2 (BMP2), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 276.77736 2.9315515 2, mRNA. Homo sapiens neuromedin B (NMB), 5670594 NM_021077.3 NMB 1423.549 2.9294782 transcript variant 1, mRNA. Homo sapiens Boc homolog (mouse) 75101 13 NM_033254.2 BOC 254.52729 2.928162 (BOC), mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 2095.9606 2.9124571 1, mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2429.8056 2.9029578 aminopeptidase, CD13, pi 50) (ANPEP), mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 2166.4069 2.8919645 mRNA. Homo sapiens sterol regulatory element binding transcription factor 1 3390343 NM_001005291.1 SREBF1 812.38024 2.8885229 (SREBFl), transcript variant 1, mRNA. Homo sapiens fibroblast activation 5090626 NM_004460.2 FAP 4535.774 2.8878109 protein, alpha (FAP), mRNA. Homo sapiens dipeptidyl-peptidase 7 670608 NM_013379.2 DPP7 985.09705 2.8808439 (DPP7), mRNA. Homo sapiens transcobalamin II; 5670100 NM_000355.2 TCN2 634.19322 2.8548233 macrocytic anemia (TCN2), mRNA. Homo sapiens cafhepsin H (CTSH), 1980288 NM_004390.2 CTSH 1094.9552 2.8106932 transcript variant 1, mRNA. Homo sapiens 6- 4640079 NM_012088.2 PGLS phosphogluconolactonase (PGLS), 5728.7796 2.8041639 mRNA. Homo sapiens sushi-repeat-containing 4900133 NM_006307.3 SRPX 14914.677 2.7716698 protein, X-linked (SRPX), mRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 12312.358 2.7455204 mRNA. Homo sapiens syntrophin, beta 1 (dystrophin-associated protein Al, 3420739 NM_021021.2 SNTB1 935.54971 2.7381646 59kDa, basic component 1) (SNTB1), mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 2524.9596 2.7366515 (ANG), transcript variant 2, mRNA. Homo sapiens sterol regulatory element binding transcription factor 1 6840044 NM_004176.3 SREBF1 359.24764 2.7239029 (SREBFl), transcript variant 2, mRNA. Homo sapiens fibulin 1 (FBLN1), 4830685 NM_006486.2 FBLN1 14604.974 2.7190552 transcript variant D, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 769.86202 2.6852528 specific (ECM2), mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1118.2471 2.6847147 1, mRNA. Homo sapiens cafhepsin B (CTSB), 60121 NM_001908.3 CTSB 14006.772 2.6745656 transcript variant 1, mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECMl protein 1 (ECMl), transcript variant 1, 1240.6128 2.649613 mRNA. Homo sapiens vascular endothelial 5890288 NM_003377.3 VEGFB 1166.958 2.6458331 growth factor B (VEGFB), mRNA. Homo sapiens parathyroid hormone 1980593 NM_198964.1 PTHLH like hormone (PTHLH), transcript 476.77094 2.5907747 variant 3, mRNA. Homo sapiens TIMP metallopeptidase 6980541 NM_003255.4 TIMP2 1384.7013 2.590426 inhibitor 2 (TIMP2), mRNA. Homo sapiens bone morphogenetic 990075 NM_1 3085 1.1 BMP4 protein 4 (BMP4), transcript variant 3, 1164.5298 2.5898274 mRNA. Homo sapiens N-sulfoglucosamine 1340538 NM_000199.2 SGSH sulfohydrolase (sulfamidase) (SGSH), 3381.8953 2.5807282 mRNA. Homo sapiens neuroblastoma, 5090156 NM_1 82744.1 NBL1 suppression of tumorigenicity 1 13275.365 2.518665 (NBL1), transcript variant 1, mRNA. Homo sapiens agouti signaling protein, 3460474 NM_001672.2 ASIP nonagouti homolog (mouse) (ASIP), 175.13879 2.514706 mRNA. Homo sapiens frizzled homolog 4 620255 NM_012193.2 FZD4 1238.2525 2.5003284 (Drosophila) (FZD4), mRNA. Homo sapiens lipopolysaccharide 1850564 NM_004139.2 LBP 202.86032 2.4931644 binding protein (LBP), mRNA. Homo sapiens paraoxonase 3 (PON3), 4210228 NM_000940.1 PON3 140.50103 2.4886608 mRNA. Homo sapiens complement component 5810424 NM_016546.1 C1RL 1, r subcomponent-like (CIRL), 1076.4614 2.4629412 mRNA. Homo sapiens olfactomedin 1 3800204 NM_006334.3 OLFM1 224.66844 2.451312 (OLFM1), transcript variant 2, mRNA. Homo sapiens CUG triplet repeat, 7400133 NM_001025077.2 CUGBP2 RNA binding protein 2 (CUGBP2), 157.8581 1 2.4434613 transcript variant 3, mRNA. Homo sapiens tumor necrosis factor 1090747 NM_003809.2 TNFSF12 (ligand) superfamily, member 12 865.98142 2.4387072 (TNFSF12), mRNA. Homo sapiens carboxylesterase 4-like 270575 NR_003276.1 CES4 136.29948 2.4288707 (CES4) on chromosome 16. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 580360 NM_001031849.1 MASP1 221.37227 2.4206241 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 2059.8953 2.4146759 variant 1, mRNA. Homo sapiens glutathione peroxidase 4 6520128 NM_001039847.1 GPX4 (phospholipid hydroperoxidase) 24616.781 2.4074815 (GPX4), transcript variant 2, mRNA. Homo sapiens chromosome 5 open 1690240 NM_032385.3 C5orf4 reading frame 4 (C5orf4), transcript 5 11.77699 2.3936721 variant 2, mRNA. Homo sapiens major histocompatibility 2470553 NM_0021 19.3 HLA-DOA complex, class II, DO alpha (HLA- 168.741 15 2.3762247 DOA), mRNA. Homo sapiens apolipoprotein M 3830022 NM_019101.2 APOM 338.29956 2.3754229 (APOM), mRNA. Homo sapiens procollagen C- 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1320.641 2.3686837 (PCOLCE2), mRNA. Homo sapiens follicular lymphoma 160537 NM_002035.1 FVT1 variant translocation 1 (FVT1), 1613.9291 2.3465605 mRNA. Homo sapiens N-acetylglucosamine-1- phosphodiester alpha-N- 6400630 NM_016256.2 NAGPA 736.8031 2.3448938 acetylglucosaminidase (NAGPA), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 995.99012 2.3281392 mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 557.73186 2.3267607 mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 1400091 NM_005031.3 FXYDl 173.74145 2.3255421 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens TBC1 domain family, 2510441 NM_024682.1 TBC1D17 440.36932 2.2934781 member 17 (TBC1D17), mRNA. Homo sapiens AU RNA binding protein/enoyl-Coenzyme A hydratase 7330180 NM_001698.1 AUH 605.73289 2.2880137 (AUH), nuclear gene encoding mitochondrial protein, mRNA. Homo sapiens family with sequence 4860646 NM_020223.2 FAM20C similarity 20, member C (FAM20C), 2791.0782 2.2858576 mRNA. Homo sapiens retinoic acid receptor responder (tazarotene induced) 1 2340681 NM_206963.1 PvARRESl 9 8.04543 2.2822457 (RARRESl), transcript variant 1, mRNA. Homo sapiens engrailed homeobox 1 5820025 NM_001426.3 EN1 155.67249 2.2791719 (EN1), mRNA. Homo sapiens ST6 (alpha-N-acetyl- neuraminyl-2,3-beta-galactosyl-l, 3)- 3780608 NM_013443.3 ST6GALNAC6 N-acetylgalactosaminide alpha-2,6- 1597.322 2.2712315 sialyltransferase 6 (ST6GALNAC6), mRNA. Homo sapiens collagen, type VI, alpha 7570598 NM_001848.2 COL6A1 14371.405 2.2508628 1 (COL6A1), mRNA. Homo sapiens decorin (DCN), 50368 NM_001920.3 DCN 5428.6664 2.2475042 transcript variant Al, mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 6295.2746 2.2392791 (NBL1), transcript variant 2, mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 28435.106 2.2270354 transcript variant C, mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 426.89543 2.2085006 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens fibulin 2 (FBLN2), 780025 NM_001004019.1 FBLN2 128.06999 2.2047429 transcript variant 1, mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 900.38215 2.1964264 (RECK), mRNA. Homo sapiens glucosidase, beta; acid 4780133 NM_001005742.1 GBA (includes glucosylceramidase) (GBA), 2565.2454 2.1957987 transcript variant 3, mRNA. Homo sapiens alpha-2-macroglobulin 2370438 NM_000014.4 A2M 220.53274 2.1949574 (A2M), mRNA. Homo sapiens deleted in bladder 4850450 NM_014618.2 DBC1 339.97124 2.1888818 cancer 1 (DBC1), mRNA. Homo sapiens EPH receptor A4 6650482 NM_004438.3 EPHA4 376.07906 2.1882828 (EPHA4), mRNA. Homo sapiens phospholipid transfer 4260215 NM_006227.2 PLTP protein (PLTP), transcript variant 1, 1312.8142 2.1802159 mRNA. Homo sapiens D site of albumin 7050458 NM_001352.2 DBP promoter (albumin D-box) binding 274.8646 2.1669633 protein (DBP), mRNA. Homo sapiens zinc finger protein, 7320494 NM_153813.2 ZFPM1 1399.4174 2.1626504 multitype 1 (ZFPM1), mRNA. Homo sapiens neuronal pentraxin I 6100468 NM_002522.2 NPTX1 1317.4451 2.1541729 (NPTX1), mRNA. Homo sapiens galanin prepropeptide 60452 NM_015973.3 GAL 823.87847 2.1532746 (GAL), mRNA. Homo sapiens hypothetical protein 2900139 NM_017842.1 FLJ20489 529.91 165 2.152888 FLJ20489 (FLJ20489), mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 237.51681 2.1461428 complex, locus H (LY6H), mRNA. Homo sapiens heart and neural crest 4640563 NM_021973.2 HAND2 derivatives expressed 2 (HAND2), 265.44882 2.1457284 mRNA. Homo sapiens mitochondrial ribosomal protein L43 (MRPL43), nuclear gene 6940521 NM_0321 12.2 MRPL43 1148.5529 2.1442563 encoding mitochondrial protein, transcript variant 1, mRNA. Homo sapiens SPARC related modular 840008 NM_001034852.1 SMOCl calcium binding 1 (SMOCl), transcript 246.98503 2.1417404 variant 1, mRNA. Homo sapiens glutathione peroxidase 4 2600382 NM_001039847.1 GPX4 (phospholipid hydroperoxidase) 10679.388 2.1408968 (GPX4), transcript variant 2, mRNA. Homo sapiens retinoic acid receptor responder (tazarotene induced) 1 1010132 NM_002888.2 RARRES1 516.06165 2.1328194 (RARRES1), transcript variant 2, mRNA. Homo sapiens angiotensin I converting 3830398 NM_000789.2 ACE enzyme (peptidyl-dipeptidase A) 1 122.39248 2.1267258 (ACE), transcript variant 1, mRNA. Homo sapiens ADAM metallopeptidase domain 33 1440224 NM_025220.2 ADAM33 168.1132 2.106327 (ADAM33), transcript variant 1, mRNA. Homo sapiens adrenomedullin (ADM), 5670465 NM_001124.1 ADM 15246.368 2.091425 mRNA. Homo sapiens proteasome (prosome, macropain) subunit, beta type, 8 (large 7210326 NM_004159.4 PSMB8 1757.9959 2.0792649 multifunctional peptidase 7) (PSMB8), transcript variant 1, mRNA. Homo sapiens cafhepsin O (CTSO), 1820300 NM_001334.2 CTSO 847.01 106 2.0584265 mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 4490563 NM_172244.2 SGCD 148.03643 2.0576467 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens hypothetical protein 7510551 NM_024913.3 FLJ21986 899.86519 2.0429926 FLJ21986 (FLJ21986), mRNA. Homo sapiens dipeptidyl-peptidase 7 2480364 NM_013379.2 DPP7 1082.178 2.036927 (DPP7), mRNA. Homo sapiens tumor necrosis factor 6840020 NM_006573.3 TNFSF13B (ligand) superfamily, member 13b 190.87861 2.036255 (TNFSF13B), mRNA. Homo sapiens insulin-like growth 7510414 NM_001552.2 IGFBP4 factor binding protein 4 (IGFBP4), 14152.081 2.0243596 mRNA. Homo sapiens chemokine (C-C motif) 6620121 NM_005623.2 CCL8 156.07345 2.022286 ligand 8 (CCL8), mRNA. Homo sapiens Clq and tumor necrosis 5090079 NM_198594.1 C1QTNF1 factor related protein 1 (C1QTNF1), 1723.9373 2.0193724 mRNA. Homo sapiens ADAMTS-like 1 6180209 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 147.55206 2.0136186 mRNA. Homo sapiens lipase, hepatic (LIPC), 2350044 NM_000236.1 LIPC 103.39897 2.0125544 mRNA. Homo sapiens dullard homolog 3290672 NM_015343.3 DULLARD (Xenopus laevis) (DULLARD), 724.30398 2.01 19449 mRNA. Homo sapiens Niemann-Pick disease, 540075 NM_006432.3 NPC2 25120.052 2.01 11172 type C2 (NPC2), mRNA. Homo sapiens colony stimulating 4640048 NM_172212.1 CSF1 factor 1 (macrophage) (CSF1), 134.28459 2.0086846 transcript variant 4, mRNA. Homo sapiens platelet-derived growth 7200168 NM_006207.1 PDGFRL factor receptor-like (PDGFRL), 2609.8069 2.0036434 mRNA.

ASC-1 P4 Adipose derived mesenchymal stem cells Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 21642.052 76.151 105 mRNA. Homo sapiens cathepsin K (CTSK), 1430278 NM_000396.2 CTSK 21334.193 24.396502 mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 18527.698 23.513671 (APOD), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 1896.4149 18.071981 complexing protein 2) (DPP4), mRNA. Homo sapiens similar to hypothetical 770156 NM_203422.1 LOC221091 1309.0147 17.421906 protein (LOC221091), mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 5392.0814 14.388289 mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 6141.2795 13.559454 (SERPING1), transcript variant 2, mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 3722.3932 13.077906 (LY96), mRNA. Homo sapiens chromosome 20 open 1690201 NM_182519.1 C20orfl86 reading frame 186 (C20orfl86), 602.34189 11.141457 mRNA. Homo sapiens apolipoprotein C-I 3830465 NM_001645.3 APOC1 2269.0869 11.027545 (APOC1), mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 2490152 NM_001040092.1 ENPP2 2355.6105 10.308967 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens cathepsin F (CTSF), 3930020 NM_003793.2 CTSF 1645.4088 9.8992517 mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 840678 NM_001040092.1 ENPP2 2946.2733 9.7227903 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens superoxide dismutase 3, 3890095 NM_003102.2 SOD3 1069.0412 9.6236269 extracellular (SOD3), mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 991.12168 9.4663588 (F10), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 762.35634 8.3053558 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens family with sequence 2810373 NM_017565.2 FAM20A similarity 20, member A (FAM20A), 681.47891 8.2791029 mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 2825.2081 8.1182901 (plasma) (GPX3), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 8283.9748 7.8779708 variant 1, mRNA. Homo sapiens RAS, dexamethasone- 2710735 NM_016084.3 RASD1 2167.7979 7.5606498 induced 1 (RASD1), mRNA. Homo sapiens CUG triplet repeat, 5390575 NM_006561.2 CUGBP2 RNA binding protein 2 (CUGBP2), 482.87087 7.0726113 transcript variant 2, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 3427.7982 6.9193613 mRNA. Homo sapiens angiopoietin-like 2 7650672 NM_012098.2 ANGPTL2 7062.4838 6.8512682 (ANGPTL2), mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 5688.735 6.8439371 1, r subcomponent (C1R), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 3850500 NM_005031.3 FXYDl 641.20413 6.8231977 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 8485.8577 6.6686193 transcript variant A2, mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 586.88024 6.4028604 (NAALADL1), mRNA. Homo sapiens netrin Gl (NTNG1), 6940053 NM_014917.2 NTNG1 762.91814 6.3001278 transcript variant 3, mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 863.75627 6.1991677 matrix protein (SPON1), mRNA. Homo sapiens prostaglandin E 1510181 NM_004878.3 PTGES 3849.0354 6.1570059 synthase (PTGES), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 1057.7951 6.149876 variant 2, mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 4944.818 5.5597425 mRNA. Homo sapiens phospholipase A2, 4860152 NM_000300.2 PLA2G2A group IIA (platelets, synovial fluid) 541.90324 5.5402353 (PLA2G2A), mRNA. Homo sapiens secreted frizzled-related 3060639 NM_003013.2 SFRP2 5419.1733 5.4266376 protein 2 (SFRP2), mRNA. Homo sapiens elastin microfibril 1190142 NM_032048.2 EMILIN2 1660.2335 5.2918225 interfacer 2 (EMILFN2), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 3450538 NM_000062.2 SERPING1 member 1, (angioedema, hereditary) 404.94912 5.0161714 (SERPING1), transcript variant 1, mRNA. Homo sapiens X-prolyl aminopeptidase (aminopeptidase P) 2, 4780544 NM_003399.5 XPNPEP2 459.00265 4.9963695 membrane-bound (XPNPEP2), mRNA. Homo sapiens complement component 670594 NM_000063.3 C2 391.23709 4.9094594 2 (C2), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2973.404 4.7989418 3) (LTBR), mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 11107.818 4.7912997 transcript variant C, mRNA. Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, 6290356 NM_002615.4 SERPINF1 3536.0537 4.7416963 pigment epithelium derived factor), member 1 (SERPFNF1), mRNA.

Homo sapiens proteoglycan 2, bone marrow (natural killer cell activator, 3840072 NM_002728.4 PRG2 326.35059 4.6654051 eosinophil granule major basic protein) (PRG2), mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 657.02493 4.6431905 (HOXA9), mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 5832.8319 4.4909371 transcript variant A, mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 5199.3549 4.3860819 (RARRES2), mRNA. Homo sapiens SLIT and NTRK-like 7330477 NM_173078.2 SLITRK4 537.24122 4.3165564 family, member 4 (SLITRK4), mRNA. Homo sapiens cathepsin H (CTSH), 1980288 NM_004390.2 CTSH 1654.7553 4.2476712 transcript variant 1, mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 15078.149 4.1940663 mRNA. Homo sapiens nephroblastoma 4290037 NM_002514.2 NOV 912.84027 4.1578559 overexpressed gene (NOV), mRNA. Homo sapiens neuronal pentraxin I 6100468 NM_002522.2 NPTX1 2520.9232 4.1219967 (NPTX1), mRNA. Homo sapiens folate receptor 3 4010181 NM_000804.2 FOLR3 324.24779 4.0958902 (gamma) (FOLR3), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 1728.7556 4.0409875 mRNA. Homo sapiens collectin sub-family 2100767 NM_130386.1 COLEC12 6061.4093 3.9572515 member 12 (COLEC12), mRNA. Homo sapiens fms-related tyrosine 830324 NM_001459.2 FLT3LG 495.57124 3.9328936 kinase 3 ligand (FLT3LG), mRNA. Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 510736 NM_004530.2 MMP2 1690.9984 3.92204 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens RGM domain family, 6020682 NM_02021 1.1 RGMA 1121.2869 3.9179493 member A (RGMA), mRNA. Homo sapiens phospholipase A2, 4480468 NM_000929.2 PLA2G5 217.20767 3.878866 group V (PLA2G5), mRNA. Homo sapiens fatty acid desaturase 1 2360020 NM_013402.3 FADS1 4305.8224 3.8383918 (FADS1), mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 7286.5743 3.8207737 transcript variant 2, mRNA. Homo sapiens lymphocyte antigen 6 4890270 NM_002346.1 LY6E 8579.1652 3.8202158 complex, locus E (LY6E), mRNA. Homo sapiens regeneration associated 7320669 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 8371.1493 3.7684837 transcript variant 1, mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 530.33953 3.7501613 mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 12634.643 3.7422891 mRNA. Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 1003.8014 3.7276743 (Drosophila) (SLIT3), mRNA. Homo sapiens carbonic anhydrase XII 3830075 NM_001218.3 CA12 1180.4296 3.723098 (CA12), transcript variant 1, mRNA. Homo sapiens alpha-2-macroglobulin 2370438 NM_000014.4 A2M 373.38584 3.7163008 (A2M), mRNA. Homo sapiens elastase 2, neutrophil 7650497 NM_001972.2 ELA2 250.37404 3.7103888 (ELA2), mRNA. Homo sapiens Boc homolog (mouse) 75101 13 NM_033254.2 BOC 312.01298 3.5894955 (BOC), mRNA. Homo sapiens sulfide quinone 6770707 NM_02 1199.2 SQRDL reductase-like (yeast) (SQRDL), 1016.9034 3.5632854 mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 19176.664 3.5078019 mRNA. Homo sapiens apolipoprotein E 730414 NM_000041.2 APOE 8508.4919 3.4272343 (APOE), mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 1396.631 1 3.4069949 (RECK), mRNA. Homo sapiens protein S (alpha) 6420008 NM_000313.1 PROS1 2919.6888 3.3364982 (PROS1), mRNA. Homo sapiens carbonic anhydrase XII 150474 NM_001218.3 CA12 4216.406 3.3178176 (CA12), transcript variant 1, mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 309.95531 3.2829634 2, mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 6650.5519 3.2686615 transcript variant 2, mRNA. Homo sapiens agouti signaling protein, 3460474 NM_001672.2 ASIP nonagouti homolog (mouse) (ASIP), 225.32264 3.2352639 mRNA. Homo sapiens acyl-CoA synthetase 7040286 NM_016234.3 ACSL5 long-chain family member 5 (ACSL5), 304.27839 3.2133919 transcript variant 1, mRNA. Homo sapiens sterol regulatory element binding transcription factor 1 3390343 NM_001005291.1 SREBF1 896.9767 3.1893166 (SREBFl), transcript variant 1, mRNA. Homo sapiens chemokine (C-X-C motif) ligand 12 (stromal cell-derived 4610615 NM_000609.4 CXCL12 8702.0709 3.1803415 factor 1) (CXCL12), transcript variant 2, mRNA. Homo sapiens olfactomedin 1 2680072 NM_014279.4 OLFM1 492.79971 3.1513843 (OLFM1), transcript variant 1, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 5056.0653 3.0919947 3, mRNA. Homo sapiens pregnancy specific beta- 4480292 NM_002781.2 PSG5 169.01755 3.0910629 1-glycoprotein 5 (PSG5), mRNA. Homo sapiens vascular endothelial 5890288 NM_003377.3 VEGFB 1346.5192 3.0529504 growth factor B (VEGFB), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 359.30229 3.0161276 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens TIMP metallopeptidase 6980541 NM_003255.4 TIMP2 1592.892 2.9798982 inhibitor 2 (TIMP2), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2493.3482 2.978874 aminopeptidase, CD13, pi 50) (ANPEP), mRNA. Homo sapiens like-glycosyltransferase 10768 NM_004737.3 LARGE 1471.9015 2.9330756 (LARGE), transcript variant 1, mRNA. Homo sapiens D site of albumin 7050458 NM_001352.2 DBP promoter (albumin D-box) binding 370.96327 2.924581 1 protein (DBP), mRNA. Homo sapiens procollagen C- 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1622.9176 2.9108428 (PCOLCE2), mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1349.1923 2.8815094 mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1195.2953 2.869694 1, mRNA. Homo sapiens chemokine (C-X-C motif) ligand 12 (stromal cell-derived 4560020 NM_199168.2 CXCL12 15965.421 2.84625 factor 1) (CXCL12), transcript variant 1, mRNA. Homo sapiens fibroblast activation 5090626 NM_004460.2 FAP 4458.1727 2.8384041 protein, alpha (FAP), mRNA. Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 164.41283 2.782522 mRNA. Homo sapiens growth differentiation 5690095 NM_004962.2 GDF10 433.91372 2.7660331 factor 10 (GDF10), mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 302.89823 2.736913 complex, locus H (LY6H), mRNA. Homo sapiens follicular lymphoma 160537 NM_002035.1 FVT1 variant translocation 1 (FVT1), 1874.505 2.725423 mRNA. Homo sapiens fibulin 1 (FBLN1), 4830685 NM_006486.2 FBLN1 14371.405 2.6755708 transcript variant D, mRNA. Homo sapiens interleukin 15 receptor, 940356 NM_002189.2 IL15RA alpha (IL15RA), transcript variant 1, 175.65251 2.652823 mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 510.69292 2.6420185 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 4050326 NM_139125.2 MASP1 3 11.08923 2.6339955 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens retinoic acid receptor responder (tazarotene induced) 1 2340681 NM_206963.1 PvARRESl 1127.9347 2.6320087 (RARRESl), transcript variant 1, mRNA. Homo sapiens sterol regulatory element binding transcription factor 1 6840044 NM_004176.3 SREBF1 346.0646 2.6239459 (SREBFl), transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1888.2673 2.6238553 1, mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 1196.7127 2.6230783 mRNA. Homo sapiens complement component 5810424 NM_016546.1 C1RL 1, r subcomponent-like (CIRL), 1141.281 2.61 12483 mRNA. Homo sapiens laminin, alpha 1 21901 13 NM_005559.2 LAMA1 357.87375 2.5868651 (LAMA1), mRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 11581.945 2.5826464 mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 7000.5994 2.5642047 mRNA. Homo sapiens sushi-repeat-containing 4900133 NM_006307.3 SRPX 13794.697 2.5635383 protein, X-linked (SRPX), mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 734.69086 2.562577 specific (ECM2), mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 3124.5562 2.5623903 disease) (LIPA), mRNA. Homo sapiens 6- 4640079 NM_012088.2 PGLS phosphogluconolactonase (PGLS), 5216.8513 2.5535816 mRNA. Homo sapiens tumor necrosis factor 1090747 NM_003809.2 TNFSF12 (ligand) superfamily, member 12 904.39646 2.5468886 (TNFSF12), mRNA. Homo sapiens interleukin 1 receptor, 240274 NM_000877.2 IL1R1 439.38584 2.5374689 type I (IL1R1), mRNA. Homo sapiens olfactomedin 1 3800204 NM_006334.3 OLFMl 231.95664 2.5308321 (OLFMl), transcript variant 2, mRNA. Homo sapiens decorin (DCN), 50368 NM_001920.3 DCN 6106.4316 2.5281036 transcript variant Al, mRNA. Homo sapiens TBC1 domain family, 2510441 NM_024682.1 TBC1D17 483.66586 2.5189698 member 17 (TBC1D17), mRNA. Homo sapiens regeneration associated 5670543 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 225.32264 2.5159215 transcript variant 1, mRNA. Homo sapiens apolipoprotein M 3830022 NM_019101.2 APOM 357.50361 2.5102672 (APOM), mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 2311.6676 2.5054772 (ANG), transcript variant 2, mRNA. Homo sapiens dipeptidyl-peptidase 7 670608 NM_013379.2 DPP7 843.53945 2.4668691 (DPP7), mRNA. Homo sapiens carboxypeptidase B1 4230343 NM_001871.2 CPB1 180.96888 2.4589965 (tissue) (CPB1), mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 518.45914 2.4487353 (CYP51A1), mRNA. Homo sapiens galanin prepropeptide 60452 NM_015973.3 GAL 936.32906 2.4471735 (GAL), mRNA. Homo sapiens glutathione peroxidase 4 2600382 NM_001039847.1 GPX4 (phospholipid hydroperoxidase) 12107.229 2.4271361 (GPX4), transcript variant 2, mRNA. Homo sapiens ADAM metallopeptidase domain 33 1440224 NM_025220.2 ADAM33 191.93068 2.4047414 (ADAM33), transcript variant 1, mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 2213.2993 2.4045104 (DPM3), transcript variant 1, mRNA. Homo sapiens hypothetical protein 7510551 NM_024913.3 FLJ21986 1046.4021 2.37568 FLJ21986 (FLJ21986), mRNA. Homo sapiens CD14 molecule (CD14), 6370369 NM_001040021.1 CD14 256.01888 2.3741371 transcript variant 2, mRNA. Homo sapiens ST6 (alpha-N-acetyl- neuraminyl-2,3-beta-galactosyl-l, 3)- 3780608 NM_013443.3 ST6GALNAC6 N-acetylgalactosaminide alpha-2,6- 1665.9712 2.3688438 sialyltransferase 6 (ST6GALNAC6), mRNA. Homo sapiens extracellular matrix 3450521 NM_022664.1 ECMl protein 1 (ECMl), transcript variant 2, 1272.9947 2.366821 mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 566.56925 2.3636287 mRNA. Homo sapiens laminin, alpha 4 5130435 NM_002290.2 LAMA4 894.43997 2.3631285 (LAMA4), mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 776.40324 2.3613627 (SRGAP1), mRNA. Homo sapiens chromosome 5 open 1690240 NM_032385.3 C5orf4 reading frame 4 (C5orf4), transcript 500.64218 2.3415926 variant 2, mRNA. Homo sapiens neuromedin B (NMB), 5670594 NM_021077.3 NMB 1133.0381 2.3316446 transcript variant 1, mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 29729.883 2.3284422 transcript variant C, mRNA. Homo sapiens glutathione peroxidase 4 6520128 NM_001039847.1 GPX4 (phospholipid hydroperoxidase) 23635.518 2.31 15156 (GPX4), transcript variant 2, mRNA. Homo sapiens growth differentiation 5090671 NM_004864.1 GDF15 1907.9462 2.3060485 factor 15 (GDF15), mRNA. Homo sapiens 5'-nucleotidase, ecto 5960398 NM_002526.1 NT5E 1900.9569 2.2884219 (CD73) (NT5E), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 1400091 NM_005031.3 FXYDl 169.21976 2.265019 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens parathyroid hormone 6900414 NM_198965.1 PTHLH like hormone (PTHLH), transcript 689.50568 2.2428123 variant 1, mRNA. Homo sapiens syntrophin, beta 1 (dystrophin-associated protein Al, 3420739 NM_021021.2 SNTB1 "761.64491 2.2291804 59kDa, basic component 1) (SNTB1), mRNA. Homo sapiens fibulin 2 (FBLN2), 780025 NM_001004019.1 FBLN2 128.34646 2.2095025 transcript variant 1, mRNA. Homo sapiens AU RNA binding protein/enoyl-Coenzyme A hydratase 7330180 NM_001698.1 AUH 584.86519 2.2091909 (AUH), nuclear gene encoding mitochondrial protein, mRNA. Homo sapiens EPH receptor A4 6650482 NM_004438.3 EPHA4 379.481 12 2.2080783 (EPHA4), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM 14A similarity 14, member A (FAM14A), 1711.181 1 2.2051728 mRNA. Homo sapiens interferon, alpha 10 3990563 NM_002171.1 IFNA10 157.19683 2.1995706 (IFNA10), mRNA. Homo sapiens dolichyl-phosphate 7320435 NM_153741.1 DPM3 mannosyltransferase polypeptide 3 2561.1535 2.1910796 (DPM3), transcript variant 2, mRNA. Homo sapiens retinoic acid receptor responder (tazarotene induced) 1 1010132 NM_002888.2 PvARRESl 528.65369 2.1848607 (RARRESl), transcript variant 2, mRNA. Homo sapiens N-sulfoglucosamine 1340538 NM_000199.2 SGSH sulfohydrolase (sulfamidase) (SGSH), 2855.0425 2.1786862 mRNA. Homo sapiens dipeptidyl-peptidase 7 2480364 NM_013379.2 DPP7 1146.4945 2.1579866 (DPP7), mRNA. Homo sapiens cathepsin O (CTSO), 1820300 NM_001334.2 CTSO 887.74425 2.1574173 mRNA. Homo sapiens ADAM metallopeptidase domain 33 3420025 NM_153202.1 ADAM33 155.63555 2.1259739 (ADAM33), transcript variant 2, mRNA. Homo sapiens major histocompatibility 2570564 NM_0191 11.3 HLA-DRA complex, class II, DR alpha (HLA- 207.06283 2.1159501 DRA), mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 580360 NM_001031849.1 MASP1 192.53451 2.1052939 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 3990441 NR_003087.1 ABCC13 151.38319 2.1014514 13 (ABCC13) on chromosome 21. XR_017987 XR_017988 XR_017989 Homo sapiens like-glycosyltransferase 4570242 NM_133642.2 LARGE 339.37625 2.075886 (LARGE), transcript variant 2, mRNA. Homo sapiens deleted in bladder 4850450 NM_014618.2 DBC1 322.31 106 2.075178 cancer 1 (DBC1), mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 424.2323 2.0739721 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 452.80059 2.0656923 c, mRNA. Homo sapiens phospholipid transfer 5690519 NM_1 82676.1 PLTP protein (PLTP), transcript variant 2, 5456.904 2.0622235 mRNA. Homo sapiens CUG triplet repeat, 2320162 NM_001025076.2 CUGBP2 RNA binding protein 2 (CUGBP2), 141.21335 2.0544027 transcript variant 1, mRNA. Homo sapiens dullard homolog 3290672 NM_015343.3 DULLARD (Xenopus laevis) (DULLARD), 729.68496 2.0268919 mRNA. Homo sapiens low density lipoprotein- related protein 1 (alpha-2- 2710286 NM_002332.2 LRP1 492.31 18 2.020679 macroglobulin receptor) (LRP1), mRNA. Homo sapiens oxytocin, prepro- 1850372 NM_000915.2 OXT 140.96003 2.0177091 (neurophysin I) (OXT), mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 1720.9615 2.0173667 variant 1, mRNA. Homo sapiens vascular endothelial 4060333 NM_003377.3 VEGFB 12210.763 2.0144895 growth factor B (VEGFB), mRNA. Homo sapiens paraoxonase 3 (PON3), 4210228 NM_000940.1 PON3 113.41814 2.0089481 mRNA. Homo sapiens CUG triplet repeat, 7400133 NM_001025077.2 CUGBP2 RNA binding protein 2 (CUGBP2), 129.70966 2.0077558 transcript variant 3, mRNA.

ASCI P8 Chondro ctrl Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 10419.73 36.663526 mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 2062.6271 19.655909 complexing protein 2) (DPP4), mRNA. Homo sapiens superoxide dismutase 3, 3890095 NM_003102.2 SOD3 1892.8861 17.039971 extracellular (SOD3), mRNA. Homo sapiens cathepsin K (CTSK), 1430278 NM_000396.2 CTSK 13529.286 15.471279 mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 4305.8224 15.127671 (LY96), mRNA. Homo sapiens family with sequence 2810373 NM_017565.2 FAM20A similarity 20, member A (FAM20A), 1101.6819 13.384035 mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 9575.8774 12.152834 (APOD), mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 2490152 NM_001040092.1 ENPP2 2757.585 12.068146 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 840678 NM_001040092.1 ENPP2 3536.0537 11.669083 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens cathepsin F (CTSF), 3930020 NM_003793.2 CTSF 1727.773 10.394778 mRNA. Homo sapiens netrin Gl (NTNG1), 6940053 NM_014917.2 NTNG1 1175.1836 9.7045891 transcript variant 3, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 4317.4003 9.5324747 (SERPING1), transcript variant 2, mRNA. Homo sapiens similar to hypothetical 770156 NM_203422.1 LOC221091 706.34469 9.4008649 protein (LOC221091), mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 1166.6873 8.244971 (HOXA9), mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 1064.7677 7.6418241 matrix protein (SPON1), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 7964.1763 7.5738458 variant 1, mRNA. Homo sapiens RAS, dexamethasone- 2710735 NM_016084.3 RASD1 2135.6245 .4484382 induced 1 (RASD1), mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 753.68186 7.1985338 (F10), mRNA. Homo sapiens carbonic anhydrase XII 3830075 NM_001218.3 CA12 2128.3813 6.7129558 (CA12), transcript variant 1, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 3273.137 6.6071618 mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 5339.0529 6.4232457 1, r subcomponent (C1R), mRNA. Homo sapiens bone morphogenetic 4280577 NM_001200.2 BMP2 1383.5751 6.1324167 protein 2 (BMP2), mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 7712.591 6.060947 transcript variant A2, mRNA. Homo sapiens procollagen C- 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 3265.1431 5.8563161 (PCOLCE2), mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 580360 NM_001031849.1 MASP1 519.86401 5.6845212 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 1506.3317 5.5938495 (Drosophila) (SLIT3), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 942.50546 5.4795977 variant 2, mRNA. Homo sapiens prostaglandin E 1510181 NM_004878.3 PTGES 3315.4509 5.3034718 synthase (PTGES), mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 2172.9114 5.3006825 (RECK), mRNA. Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, 6290356 NM_002615.4 SERPINF1 3916.6706 5.2520873 pigment epithelium derived factor), member 1 (SERPINF1), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 3450538 NM_000062.2 SERPING1 member 1, (angioedema, hereditary) 420.64948 5.2106544 (SERPING1), transcript variant 1, mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 2439.2568 5.2095919 mRNA. Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 300.07198 5.0784167 mRNA. Homo sapiens retinoic acid receptor responder (tazarotene induced) 1 2340681 NM_206963.1 RARRES1 2156.2206 5.0314895 (RARRESl), transcript variant 1, mRNA. Homo sapiens retinoic acid receptor responder (tazarotene induced) 1 1010132 NM_002888.2 RARRES1 1198.1003 4.9516013 (RARRESl), transcript variant 2, mRNA. Homo sapiens major histocompatibility 2570564 NM_0191 11.3 HLA-DRA complex, class II, DR alpha (HLA- 481.60273 4.9214401 DRA), mRNA. Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 510736 NM_004530.2 MMP2 2097.356 4.864531 1 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens interleukin 1 receptor, 240274 NM_000877.2 IL1R1 807.83982 4.6653037 type I (IL1R1), mRNA. Homo sapiens laminin, alpha 4 5130435 NM_002290.2 LAMA4 1754.9236 4.6365436 (LAMA4), mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 5995.9971 4.6165647 transcript variant A, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2820.5214 4.5521961 3) (LTBR), mRNA. Homo sapiens collectin sub-family 2100767 NM_130386.1 COLEC12 6970.2916 4.5506244 member 12 (COLEC12), mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 2074.8298 4.547826 mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 4006.333 4.50455 mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 16065.361 4.4686646 mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 624.77507 4.4179382 mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 398.5208 4.3478599 (NAALADL1), mRNA. Homo sapiens D site of albumin 7050458 NM_001352.2 DBP promoter (albumin D-box) binding 546.36438 4.3073992 protein (DBP), mRNA. Homo sapiens carbonic anhydrase XII 150474 NM_001218.3 CA12 5330.0074 4.1940914 (CA12), transcript variant 1, mRNA. Homo sapiens lymphocyte antigen 6 4890270 NM_002346.1 LY6E 9225.5096 4.1080264 complex, locus E (LY6E), mRNA. Homo sapiens apolipoprotein C-I 3830465 NM_001645.3 APOC1 844.04366 4.1019715 (APOC1), mRNA. Homo sapiens TIMP metallopeptidase 6980541 NM_003255.4 TIMP2 2159.1524 4.039228 inhibitor 2 (TIMP2), mRNA. Homo sapiens vascular endothelial 5890288 NM_003377.3 VEGFB 1772.4016 4.0185497 growth factor B (VEGFB), mRNA. Homo sapiens tissue factor pathway 5080543 NM_006528.2 TFPI2 1449.059 3.9860383 inhibitor 2 (TFPI2), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 3850500 NM_005031.3 FXYDl 370.69167 3.9446136 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 554.11571 3.9420254 (PTPRN), mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 13094.317 3.878441 mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 4050326 NM_139125.2 MASP1 453.16077 3.8369166 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens CD44 molecule (Indian 4560193 NM_001001392.1 CD44 blood group) (CD44), transcript variant 4952.8723 3.8018586 5, mRNA. Homo sapiens phospholipase A2, 4860152 NM_000300.2 PLA2G2A group IIA (platelets, synovial fluid) 368.69041 3.769366 (PLA2G2A), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 344.13643 3.7491332 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens sushi-repeat-containing 4900133 NM_006307.3 SRPX 20167.417 3.7478132 protein, X-linked (SRPX), mRNA. Homo sapiens TBC1 domain family, 2510441 NM_024682.1 TBC1D17 715.25413 3.7250998 member 17 (TBC1D17), mRNA. Homo sapiens fibulin 2 (FBLN2), 780025 NM_001004019.1 FBLN2 215.55914 3.7108812 transcript variant 1, mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 1387.5391 3.7025244 mRNA. Homo sapiens folate receptor 3 4010181 NM_000804.2 FOLR3 292.59292 3.6960266 (gamma) (FOLR3), mRNA. Homo sapiens vitamin K epoxide reductase complex, subunit 1 6450546 NM_024006.4 VKORC1 4867.6444 3.6576972 (VKORC1), transcript variant 1, mRNA. Homo sapiens vascular endothelial 5700201 NM_003377.3 VEGFB 330.58473 3.5658593 growth factor B (VEGFB), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 19176.664 3.5078019 mRNA. Homo sapiens core 1 synthase, glycoprotein-N-acetylgalactosamine 3- 580066 NM_020156.1 C1GALT1 552.2323 3.4988217 beta-galactosyltransferase, 1 (C1GALT1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 412.37375 3.4616307 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens 5'-nucleotidase, ecto 5960398 NM_002526.1 NT5E 2875.3429 3.4614134 (CD73) (NT5E), mRNA. Homo sapiens neuronal pentraxin I 6100468 NM_002522.2 NPTX1 2061.2785 3.3704252 (NPTX1), mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 748.70088 3.3490979 transcript variant 1, mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 1081.2357 3.288484 (SRGAP1), mRNA. Homo sapiens chemokine (C-C motif) 6620121 NM_005623.2 CCL8 249.80516 3.2367932 ligand 8 (CCL8), mRNA. Homo sapiens regeneration associated 7320669 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 7188.0348 3.2358749 transcript variant 1, mRNA. Homo sapiens cysteine sulfinic acid 2810255 NM_015989.3 CSAD 1090.4855 3.2308742 decarboxylase (CSAD), mRNA. Homo sapiens nephroblastoma 4290037 NM_002514.2 NOV 703.17168 3.2028457 overexpressed gene (NOV), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2646.1994 3.1614896 aminopeptidase, CD13, p i 50) (ANPEP), mRNA. Homo sapiens low density lipoprotein- related protein 1 (alpha-2- 2710286 NM_002332.2 LRP1 766.73643 3.1470467 macroglobulin receptor) (LRP1), mRNA. Homo sapiens parathyroid hormone 6900414 NM_198965.1 PTHLH like hormone (PTHLH), transcript 961.91209 3.1288913 variant 1, mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 446.19624 3.11 11206 variant 1, mRNA. Homo sapiens ADAM metallopeptidase domain 33 1440224 NM_025220.2 ADAM33 246.78997 3.0920855 (ADAM33), transcript variant 1, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 1580608 NM_0 1243 1.1 SEMA3E 2317.8257 3.0460046 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 582.39041 3.0129383 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens prenylcysteine oxidase 840392 NM_016297.2 PCYOX1 3955.7942 3.01 14146 1 (PCYOX1), mRNA. Homo sapiens deleted in bladder 4850450 NM_014618.2 DBC1 465.76386 2.9987892 cancer 1 (DBC1), mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 5718.701 2.9986467 transcript variant 2, mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 6925.3973 2.9872342 transcript variant C, mRNA. Homo sapiens CD164 molecule, 10142 NM_006016.3 CD164 524.67205 2.9704992 sialomucin (CD164), mRNA. Homo sapiens growth differentiation 5690095 NM_004962.2 GDF10 460.68886 2.9367144 factor 10 (GDF10), mRNA. Homo sapiens angiotensin I converting 3830398 NM_000789.2 ACE enzyme (peptidyl-dipeptidase A) 1 168.09469 2.9208602 (ACE), transcript variant 1, mRNA. Homo sapiens AU RNA binding protein/enoyl-Coenzyme A hydratase 7330180 NM_001698.1 AUH 772.46903 2.9178203 (AUH), nuclear gene encoding mitochondrial protein, mRNA. Homo sapiens angiopoietin-like 2 7650672 NM_012098.2 ANGPTL2 2984.4357 2.895181 1 (ANGPTL2), mRNA. Homo sapiens fibulin 1 (FBLN1), 4830685 NM_006486.2 FBLN1 15425.628 2.871839 transcript variant D, mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 317.10413 2.865274 complex, locus H (LY6H), mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 2140.0109 2.8567281 mRNA. Homo sapiens decorin (DCN), 50368 NM_001920.3 DCN 6775.5385 2.8051 183 transcript variant Al, mRNA. Homo sapiens complement component 670594 NM_000063.3 C2 223.05354 2.7989992 2 (C2), mRNA. Homo sapiens hepatocyte growth 3130451 NM_000601.4 HGF factor (hepapoietin A; scatter factor) 242.40162 2.7554355 (HGF), transcript variant 1, mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 5960438 NM_139125.2 MASP1 236.71394 2.7551001 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens extracellular matrix 3450521 NM_022664.1 ECM1 protein 1 (ECM1), transcript variant 2, 1476.5799 2.7453378 mRNA. Homo sapiens endoglin (Osler-Rendu- 4610753 NM_0001 18.1 ENG 2922.415 2.7398989 Weber syndrome 1) (ENG), mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 7475.5754 2.7381806 mRNA. Homo sapiens baculoviral IAP repeat- 3060255 NM_1 82962.1 BIRC3 containing 3 (BIRC3), transcript 1474.1922 2.7345404 variant 2, mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 944.46519 2.713939 (plasma) (GPX3), mRNA. Homo sapiens iduronidase, alpha-L- 7400259 NM_000203.3 IDUA 1460.4976 2.6909509 (IDUA), mRNA. Homo sapiens family with sequence 4830059 NM_020223.2 FAM20C similarity 20, member C (FAM20C), 375.28791 2.6637403 mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 33906.985 2.6555926 transcript variant C, mRNA. Homo sapiens engrailed homeobox 1 5820025 NM_001426.3 EN1 181.33024 2.6548221 (EN1), mRNA. Homo sapiens family with sequence 5960376 NM_020223.2 FAM20C similarity 20, member C (FAM20C), 480.76932 2.6438522 mRNA. Homo sapiens olfactomedin 1 2680072 NM_014279.4 OLFM1 4 11.98658 2.6345958 (OLFM1), transcript variant 1, mRNA. Homo sapiens FK506 binding protein 4150753 NM_017946.2 FKBP14 2557.0417 2.6016495 14, 22 kDa (FKBP14), mRNA. Homo sapiens protein S (alpha) 6420008 NM_000313.1 PROS1 2275.6465 2.6005136 (PROS1), mRNA. Homo sapiens family with sequence 4860646 NM_020223.2 FAM20C similarity 20, member C (FAM20C), 3170.1951 2.5963496 mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1119.2699 2.5688421 mRNA. Homo sapiens phospholipase A2, 4480468 NM_000929.2 PLA2G5 143.53968 2.5633126 group V (PLA2G5), mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2715.2746 2.5555685 1, mRNA. Homo sapiens chemokine (C-X-C motif) ligand 12 (stromal cell-derived 4610615 NM_000609.4 CXCL12 6985.1221 2.5528491 factor 1) (CXCL12), transcript variant 2, mRNA. Homo sapiens pregnancy specific beta- 4480292 NM_002781.2 PSG5 139.48909 2.5510341 1-glycoprotein 5 (PSG5), mRNA. Homo sapiens regeneration associated 5670543 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 228.32876 2.5494875 transcript variant 1, mRNA. Homo sapiens growth differentiation 5090671 NM_004864.1 GDF15 2085.4076 2.5205381 factor 15 (GDF15), mRNA. Homo sapiens fibulin 1 (FBLN1), 5050131 NM_006485.3 FBLN1 170.86416 2.5044756 transcript variant B, mRNA. Homo sapiens protease, serine, 3 5080139 NM_002771.2 PRSS3 232.57183 2.5041797 (mesotrypsin) (PRSS3), mRNA. Homo sapiens secreted frizzled-related 3060639 NM_003013.2 SFRP2 2444.995 2.4483627 protein 2 (SFRP2), mRNA. Homo sapiens fms-related tyrosine 830324 NM_001459.2 FLT3LG 305.30229 2.4229037 kinase 3 ligand (FLT3LG), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM 14A similarity 14, member A (FAM14A), 1853.0636 2.3880146 mRNA. Homo sapiens interleukin 6 signal transducer (gpl30, oncostatin M 4260333 NM_002184.2 IL6ST 443.01637 2.3876141 receptor) (IL6ST), transcript variant 1, mRNA. Homo sapiens fibroblast activation 5090626 NM_004460.2 FAP 3713.0861 2.3640266 protein, alpha (FAP), mRNA. Homo sapiens hypothetical protein 7510551 NM_024913.3 FLJ21986 1033.5914 2.3465956 FLJ21986 (FLJ21986), mRNA. Homo sapiens laminin, alpha 1 21901 13 NM_005559.2 LAMA1 318.43075 2.3017542 (LAMA1), mRNA. Homo sapiens CD44 molecule (Indian 5860152 NM_001001391.1 CD44 blood group) (CD44), transcript variant 17797.649 2.301006 4, mRNA. Homo sapiens chemokine (C-X-C motif) ligand 12 (stromal cell-derived 4560020 NM_199168.2 CXCL12 12803.772 2.2826041 factor 1) (CXCL12), transcript variant 1, mRNA. Homo sapiens chromosome 5 open 1690240 NM_032385.3 C5orf4 reading frame 4 (C5orf4), transcript 487.90627 2.2820245 variant 2, mRNA. Homo sapiens collagen, type VI, alpha 7570598 NM_001848.2 COL6A1 14526.596 2.2751689 1 (COL6A1), mRNA. Homo sapiens anthrax toxin receptor 2 10685 NM_058172.3 ANTXR2 4748.3382 2.2672626 (ANTXR2), mRNA. Homo sapiens protein kinase C 2850639 NM_001001329.1 PRKCSH substrate 80K-H (PRKCSH), transcript 635.03997 2.2505033 variant 2, mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 476.46608 2.2503978 (CYP51A1), mRNA. Homo sapiens glypican 6 (GPC6), 2370593 NM_005708.2 GPC6 1040.4938 2.2497122 mRNA. Homo sapiens ST6 (alpha-N-acetyl- neuraminyl-2,3-beta-galactosyl-l, 3)- 3780608 NM_013443.3 ST6GALNAC6 N-acetylgalactosaminide alpha-2,6- 1581.6991 2.2490173 sialyltransferase 6 (ST6GALNAC6), mRNA. Homo sapiens adipocyte-specific 5570682 NM_024769.2 ASAM 1407.3236 2.2459703 adhesion molecule (ASAM), mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 6307.2208 2.2435284 (NBL1), transcript variant 2, mRNA. Homo sapiens slit homolog 2 4560592 NM_004787.1 SLIT2 812.07035 2.2391669 (Drosophila) (SLIT2), mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 5080192 NM_006216.2 SERPINE2 26691.038 2.2313956 activator inhibitor type 1), member 2 (SERPINE2), mRNA. Homo sapiens butyrophilin, subfamily 4610674 NM_007047.3 BTN3A2 543.41755 2.2292557 3, member A2 (BTN3A2), mRNA. Homo sapiens RGM domain family, 6020682 NM_02021 1.1 RGMA 635.46726 2.2204206 member A (RGMA), mRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 9910.1417 2.2098526 mRNA. Homo sapiens follicular lymphoma 160537 NM_002035.1 FVT1 variant translocation 1 (FVT1), 1519.7494 2.2096287 mRNA. Homo sapiens sulfide quinone 6770707 NM_02 1199.2 SQRDL reductase-like (yeast) (SQRDL), 630.15723 2.2081056 mRNA. Homo sapiens ADAMTS-like 1 6180209 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 161.54558 2.2045857 mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 3595.6016 2.1988603 3, mRNA. Homo sapiens olfactomedin 1 3800204 NM_006334.3 OLFM1 201.41 106 2.1975555 (OLFM1), transcript variant 2, mRNA. Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 449.08628 2.196051 1 b, mRNA. Homo sapiens dullard homolog 3290672 NM_015343.3 DULLARD (Xenopus laevis) (DULLARD), 790.0354 2.1945312 mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1074.624 2.1819207 9, mRNA. Homo sapiens chromosome 1 open 4180132 NM_198264.1 Clorf2 reading frame 2 (ClorfZ), transcript 308.06777 2.1704522 variant 2, mRNA. Homo sapiens ADP-ribosylhydrolase 5570446 NM_138430.3 ADPRHL1 like 1 (ADPRHL1), transcript variant 154.97478 2.1682646 1, mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 440.43827 2.1531993 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens colony stimulating 4640048 NM_172212.1 CSF1 factor 1 (macrophage) (CSF1), 143.53968 2.147126 transcript variant 4, mRNA. Homo sapiens beta-2-microglobulin 240195 NM_004048.2 B2M 12054.09 2.1294427 (B2M), mRNA. Homo sapiens chemokine (C-X-C motif) ligand 6 (granulocyte 60192 NM_002993.2 CXCL6 1276.7519 2.1280242 chemotactic protein 2) (CXCL6), mRNA. Homo sapiens interleukin 10 (IL10), 3990703 NM_000572.2 IL10 1685.483 2.1 156254 mRNA. Homo sapiens colony stimulating 2900093 NM_172212.1 CSF1 factor 1 (macrophage) (CSF1), 156.03665 2.0971862 transcript variant 4, mRNA. Homo sapiens 6- 4640079 NM_012088.2 PGLS phosphogluconolactonase (PGLS), 4264.5345 2.0874348 mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 1917.81 2.0834933 (DPM3), transcript variant 1, mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIPl FLU) interacting protein 1 (LRRFIPl), 2616.2982 2.0832999 mRNA. Homo sapiens myosin IIIB (MY03B), 2940450 NM_138995.1 MY03B 228.184 2.0773329 mRNA. Homo sapiens leukocyte receptor 2000142 NM_052925.1 LENG8 cluster (LRC) member 8 (LENG8), 201.89845 2.0677592 mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 7150609 NM_021599.1 ADAMTS2 198.24698 2.0651768 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. Homo sapiens multiple coagulation 6330672 NM_139279.3 MCFD2 222.84476 2.053578 factor deficiency 2 (MCFD2), mRNA. Homo sapiens apolipoprotein E 730414 NM_000041.2 APOE 5079.7496 2.0461313 (APOE), mRNA. Homo sapiens hepatocyte growth 2340292 NM_001010932.1 HGF factor (hepapoietin A; scatter factor) 215.3941 2.0405989 (HGF), transcript variant 3, mRNA. Homo sapiens syntrophin, beta 1 (dystrophin-associated protein Al, 3420739 NM_021021.2 SNTB1 695.84882 2.0366086 59kDa, basic component 1) (SNTB1), mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 4126.0963 2.0279238 transcript variant 2, mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 2469.7686 2.0254112 disease) (LIPA), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 190.71 136 2.0199635 2, mRNA. Homo sapiens AT rich interactive 6510553 NM_005224.2 ARID3A domain 3A (BRIGHT-like) (ARID3A), 1548.6169 2.0101974 mRNA.

ASCI P8 Dl Chondro MM Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens matrix metallopeptidase "7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 7964.1763 37.315717 (MMP3), mRNA. Homo sapiens tissue factor pathway 5080543 NM_006528.2 TFPI2 4928.7565 13.55791 inhibitor 2 (TFPI2), mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISP1 signaling pathway protein 1 (WISP1), 2616.2982 10.918029 transcript variant 1, mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 1507.9124 10.822268 matrix protein (SPON1), mRNA. Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 2948.8968 10.376176 mRNA. Homo sapiens deoxyribonuclease I- 290739 NM_004944.2 DNASE1L3 484.67537 8.807931 like 3 (DNASE1L3), mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 3051.8251 .4447378 (RECK), mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 1418.6827 7.3394122 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens pregnancy specific beta- 4480292 NM_002781.2 PSG5 366.60959 6.7047079 1-glycoprotein 5 (PSG5), mRNA. Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSLl long-chain family member 1 (ACSLl), 2224.1767 6.5496493 mRNA. Homo sapiens cafhepsin K (CTSK), 1430278 NM_000396.2 CTSK 5484.1 111 6.2713001 mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 5216.8513 6.2327205 aminopeptidase, CD13, p i 50) (ANPEP), mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 7769.0105 6.1052843 transcript variant A2, mRNA. Homo sapiens interleukin 1 receptor, 240274 NM_000877.2 IL1R1 1026.1274 5.9259224 type I (IL1R1), mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 580360 NM_001031849.1 MASP1 531.82773 5.8153401 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens matrix Gla protein 1430487 NM_000900.2 MGP 19736.908 5.448972 (MGP), mRNA. Homo sapiens dickkopf homolog 1 4880609 NM_012242.2 DKK1 345.04366 5.3430603 (Xenopus laevis) (DKK1), niRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 1080.274 5.2812061 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1487.4189 5.2257573 (LY96), mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 732.31681 5.1752777 (HOXA9), mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 459.58599 5.0140808 (NAALADL1), mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISP1 signaling pathway protein 1 (WISP1), 373.94307 5.0003973 transcript variant 2, mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-1 beta (PTX3), 778.75251 4.9060139 mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 494.74499 4.725387 (F10), mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2173.6863 4.3878081 mRNA. Homo sapiens leucine rich repeat 2370041 NM_018334.3 LRRN3 353.47559 4.3657465 neuronal 3 (LRRN3), mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 479.51504 4.3327786 complex, locus H (LY6H), mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 2490152 NM_001040092.1 ENPP2 961.11637 4.2061779 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 1580608 NM_0 1243 1.1 SEMA3E 3155.027 4.146225 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLF1 2333.3537 4.1062259 factor 1 (CRLF1), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 426.63156 4.0656068 complexing protein 2) (DPP4), mRNA. Homo sapiens matrix metallopeptidase 4760626 NM_002426.2 MMP12 12 (macrophage elastase) (MMP12), 233.8149 4.0563988 mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 718.88746 3.9316862 cyclooxygenase) (PTGS1), transcript variant 1, mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 827.30988 3.9074687 (CYP51A1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 455.34351 3.8223362 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 840678 NM_001040092.1 ENPP2 1133.559 3.7407787 (autotaxin) (ENPP2), transcript variant 2, mRNA.

Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1757.0146 2.9810239 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 3990441 NR_003087.1 ABCC13 214.6604 2.9798448 13 (ABCC13) on chromosome 21. XR_017987 XR_017988 XR_017989 Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 418.0559 2.9740846 (PTPRN), mRNA. Homo sapiens baculoviral IAP repeat- 3060255 NM_1 82962.1 BIRC3 containing 3 (BIRC3), transcript 1594.6568 2.9579952 variant 2, mRNA. Homo sapiens retinol dehydrogenase 2340494 NM_016026.2 RDH1 1 11 (all-trans/9-cis/l l-cis) (RDH1 1), 1566.5006 2.9462495 mRNA. Homo sapiens cystatin SN (CST1), 6370541 NM_001898.2 CST1 790.46917 2.8356689 mRNA. Homo sapiens CDlc molecule 1500725 NM_001765.2 CD1C 539.16018 2.8287558 (CD1C), mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1228.5353 2.8196176 mRNA. Homo sapiens SPARC-like 1 (mast9, 6960148 NM_004684.2 SPARCL1 330.77802 2.8016805 hevin) (SPARCL1), mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1309.6802 2.7971223 mRNA. Homo sapiens myosin IIIB (MY03B), 2940450 NM_138995.1 MY03B 304.44653 2.7716089 mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 2690.5128 2.7578361 cyclooxygenase) (PTGS1), transcript variant 2, mRNA. Homo sapiens core 1 synthase, glycoprotein-N-acetylgalactosamine 3- 580066 NM_020156.1 C1GALT1 434.73968 2.7544144 beta-galactosyltransferase, 1 (C1GALT1), mRNA. Homo sapiens secreted frizzled-related 3060639 NM_003013.2 SFRP2 2738.6683 2.7424405 protein 2 (SFRP2), mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1348.8577 2.7387256 9, mRNA. Homo sapiens gonadotropin-releasing 5080017 NM_001501.1 GNRH2 hormone 2 (GNRH2), transcript 223.13658 2.7256134 variant 1, mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 4050326 NM_139125.2 MASP1 317.69845 2.6899559 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens CD164 molecule, 10142 NM_006016.3 CD164 473.87271 2.6828921 sialomucin (CD164), mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 2208.6037 2.6571012 1, r subcomponent (C1R), mRNA. Homo sapiens lymphocyte antigen 6 4890270 NM_002346.1 LY6E 5963.4501 2.6554642 complex, locus E (LY6E), mRNA. Homo sapiens vitamin K epoxide 6450546 NM_024006.4 VKORC1 reductase complex, subunit 1 3517.0867 2.6428467 (VKORC1), transcript variant 1, mRNA.

Homo sapiens chemokine (C-C motif) 4280301 NM_006072.4 CCL26 297.331 12 2.6201 177 ligand 26 (CCL26), mRNA. Homo sapiens vascular endothelial 5700201 NM_003377.3 VEGFB 242.77353 2.6186818 growth factor B (VEGFB), mRNA. Homo sapiens SWI/SNF related, matrix associated, actin dependent 1580327 NM_003077.2 SMARCD2 992.83215 2.6179479 regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. Homo sapiens FK506 binding protein 4150753 NM_017946.2 FKBP14 2548.7735 2.5932369 14, 22 kDa (FKBP14), mRNA. Homo sapiens interleukin 17 receptor 150041 1 NM_032732.3 IL17RC C (IL17RC), transcript variant 3, 237.6733 2.5923851 mRNA. Homo sapiens fatty acid desaturase 1 2360020 NM_013402.3 FADS1 2888.4212 2.5748606 (FADS1), mRNA. Homo sapiens ribosome binding 4540327 NM_001042576.1 RRBP1 protein 1 homolog 180kDa (dog) 1189.8499 2.5647928 (RRBP1), transcript variant 1, mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 576.71394 2.563437 mRNA. Homo sapiens sushi-repeat-containing 4900133 NM_006307.3 SRPX 13732.304 2.5519435 protein, X-linked (SRPX), mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 7171.9072 2.551 1043 (NBL1), transcript variant 2, mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 9171.2147 2.5510216 mRNA. Homo sapiens transmembrane protein 1510564 NM_014255.3 TMEM4 3691.6471 2.5400519 4 (TMEM4), mRNA. Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, 6290356 NM_002615.4 SERPINF1 1876.8382 2.5167595 pigment epithelium derived factor), member 1 (SERPFNF1), mRNA.

Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 5960438 NM_139125.2 MASP1 216.08953 2.5150538 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 428.9545 2.4938827 variant 2, mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2648.324 2.4925558 1, mRNA. Homo sapiens peptidylprolyl 70001 14 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 4276.1642 2.4903713 mRNA. Homo sapiens pregnancy specific beta- 5960392 NM_001031850.2 PSG6 1-glycoprotein 6 (PSG6), transcript 190.52419 2.4734816 variant 2, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 13462.134 2.4624981 mRNA. Homo sapiens olfactomedin 1 2680072 NM_014279.4 OLFMl 383.11431 2.4499617 (OLFMl), transcript variant 1, mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 31253.086 2.4477394 transcript variant C, mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 7150609 NM_021599.1 ADAMTS2 234.59403 2.44381 11 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 FLU) interacting protein 1 (LRRFIPl), 3068.7876 2.4436071 mRNA. Homo sapiens hepatocyte growth 3130451 NM_000601.4 HGF factor (hepapoietin A; scatter factor) 213.18658 2.4233413 (HGF), transcript variant 1, mRNA. Homo sapiens leptin (obesity homolog, 840309 NM_000230.1 LEP 443.29764 2.4143549 mouse) (LEP), mRNA. Homo sapiens cafhepsin Z (CTSZ), 4220259 NM_001336.2 CTSZ 2639.5761 2.4126224 mRNA. Homo sapiens interleukin 17 receptor 3450228 NM_153461.1 IL17RC C (IL17RC), transcript variant 1, 466.94152 2.41 12196 mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 3400600 NM_014244.2 ADAMTS2 261.52802 2.4055448 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens hypothetical protein 2030672 NM_001031744.1 LOC158160 LOC158160 (LOC158160), transcript 386.34985 2.4038842 variant 1, mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 2211.6603 2.4027299 (DPM3), transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 510736 NM_004530.2 MMP2 1032.259 2.3941839 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens collagen, type V, alpha 5560300 NM_015719.3 COL5A3 325.79292 2.3815737 3 (COL5A3), mRNA. Homo sapiens vascular endothelial 5890288 NM_003377.3 VEGFB 1046.6157 2.3729821 growth factor B (VEGFB), mRNA. Homo sapiens laminin, beta 1 1510392 NM_002291.1 LAMB1 1630.21 11 2.3678838 (LAMB1), mRNA. Homo sapiens MYC-associated zinc finger protein (purine-binding 4830689 NM_001042539.1 MAZ 657.02493 2.3666616 transcription factor) (MAZ), transcript variant 2, mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 333.72094 2.3598229 mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 4495.9982 2.3575127 transcript variant 2, mRNA. Homo sapiens pleiotrophin (heparin binding growth factor 8, neurite 4920576 NM_002825.5 PTN 2273.9765 2.3563426 growth-promoting factor 1) (PTN), mRNA. Homo sapiens fibronectin 1 (FN1), 5670228 NM_054034.2 FN1 305.56468 2.3538203 transcript variant 7, mRNA. Homo sapiens interleukin 17 receptor 3120368 NM_153480.1 IL17RE E (IL17RE), transcript variant 1, 152.97153 2.3515812 mRNA. Homo sapiens angiotensin I converting 3830398 NM_000789.2 ACE enzyme (peptidyl-dipeptidase A) 1 134.8233 2.3427273 (ACE), transcript variant 1, mRNA. Homo sapiens multiple coagulation 6330672 NM_139279.3 MCFD2 252.78097 2.3294486 factor deficiency 2 (MCFD2), mRNA. Homo sapiens collagen, type VI, alpha 7570598 NM_001848.2 COL6A1 14680.028 2.2991996 1 (COL6A1), mRNA. Homo sapiens jumonji, AT rich 1660546 NM_004187.2 JARID1C interactive domain 1C (JARID1C), 258.71969 2.2903786 mRNA. Homo sapiens deleted in lymphocytic 1260612 NR_002605.1 DLEUl leukemia, 1 (DLEUl) on chromosome 227.5854 2.2774742 13. Homo sapiens periostin, osteoblast 510246 NM_006475.1 POSTN 1746.81 2.2668213 specific factor (POSTN), mRNA. Homo sapiens leucine rich repeat 2640195 NM_1 30830.2 LRRC15 658.84823 2.2599621 containing 15 (LRRC15), mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 6130577 NM_001081754.1 ELN 4420.5171 2.2569126 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens integrin, beta-like 1 5570129 NM_004791.1 ITGBL1 (with EGF-like repeat domains) 359.7823 2.2512304 (ITGBL1), mRNA. Homo sapiens superoxide dismutase 3, 3890095 NM_003102.2 SOD3 249.80516 2.2487737 extracellular (SOD3), mRNA. Homo sapiens protease, serine, 3 5080139 NM_002771.2 PRSS3 207.55015 2.2347627 (mesotrypsin) (PRSS3), mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 316.65413 2.2078832 variant 1, mRNA. Homo sapiens dermatopontin (DPT), 2100228 NM_001937.3 DPT 3403.187 2.2049753 mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 997.68968 2.1868391 mRNA. Homo sapiens interleukin 10 (IL10), 3990703 NM_000572.2 IL10 1740.1982 2.1843041 mRNA. Homo sapiens Thy-l cell surface 6480204 NM_006288.2 THY1 5182.6953 2.1755655 antigen (THY1), mRNA. Homo sapiens asparagine-linked glycosylation 5 homolog (S. 63701 13 NM_013338.3 ALG5 2061.2785 2.1731739 cerevisiae, dolichyl-phosphate beta- glucosyltransferase) (ALG5), mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 1623.81 11 2.1676463 mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 158.60737 2.1591647 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating 5080072 NM_001035256.1 POMC 146.66866 2.1581967 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. Homo sapiens cysteine sulfinic acid 2810255 NM_015989.3 CSAD 723.40206 2.1432848 decarboxylase (CSAD), mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 770408 NM_000602.1 SERPINE1 10206.614 2.1342659 activator inhibitor type 1), member 1 (SERPINE1), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 909.91829 2.1269452 mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 2584.1923 2.119248 disease) (LIPA), mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 5749.4299 2.1059219 mRNA. Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen 5080192 NM_006216.2 SERPINE2 24787.53 2.0722606 activator inhibitor type 1), member 2 (SERPINE2), mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 715.25413 2.0552966 (plasma) (GPX3), mRNA. Homo sapiens pyrophosphatase (inorganic) 2 (PPA2), nuclear gene 770356 NM_006903.4 PPA2 2891.0987 2.0390977 encoding mitochondrial protein, transcript variant 2, mRNA.

Homo sapiens mitochondrial ribosomal protein S21 (MRPS21), nuclear gene 3830671 NM_0 18997.1 MRPS21 7807.071 1 2.0330028 encoding mitochondrial protein, transcript variant 2, mRNA. Homo sapiens opioid receptor, sigma 1 2940528 NM_005866.2 OPRS1 1507.1599 2.0252971 (OPRS1), transcript variant 1, mRNA. Homo sapiens cathepsin C (CTSC), 2640768 NM_001814.2 CTSC 1751.8841 2.0193393 transcript variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 3450538 NM_000062.2 SERPING1 member 1, (angioedema, hereditary) 162.30708 2.0105245 (SERPING1), transcript variant 1, mRNA.

ASCI P8 D2 Chondro MM Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens matrix metallopeptidase "7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 6806.1903 31.890036 (MMP3), mRNA. Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 6493.396 22.848077 mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 2507.1 158 17.993538 matrix protein (SPON1), mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 2415.0167 12.493846 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens leucine rich repeat 2370041 NM_018334.3 LRRN3 817.92478 10.102118 neuronal 3 (LRRN3), mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 1030.7128 9.2825215 transcript variant 1, mRNA. Homo sapiens kallikrein-related 5290707 NM_004917.3 KLK4 1414.6617 9.2605828 peptidase 4 (KLK4), mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 1785.0743 8.7268093 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens CDlc molecule 1500725 NM_001765.2 CD1C 1605.6167 8.4240225 (CD1C), mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 10564.173 8.3018655 transcript variant A2, mRNA. Homo sapiens cafhepsin K (CTSK), 1430278 NM_000396.2 CTSK 6940.3176 7.9365304 mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 580360 NM_001031849.1 MASP1 674.46313 7.3750056 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 735.7264 7.0270384 (F10), mRNA. Homo sapiens matrix Gla protein 1430487 NM_000900.2 MGP 24787.53 6.8433496 (MGP), mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISP1 signaling pathway protein 1 (WISP1), 1638.2027 6.8363555 transcript variant 1, mRNA. Homo sapiens netrin Gl (NTNG1), 6940053 NM_014917.2 NTNG1 824.52065 6.8088373 transcript variant 3, mRNA. Homo sapiens Clq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 623.08658 6.6966043 transcript variant 2, mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 2694.8009 6.5737995 (RECK), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 2710.6993 6.336293 mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 4991.946 6.3353243 (APOD), mRNA. Homo sapiens secreted frizzled-related 3060639 NM_003013.2 SFRP2 6153.1031 6.1615783 protein 2 (SFRP2), mRNA. Homo sapiens cartilage intermediate layer protein, nucleotide 6400427 NM_003613.2 CILP 2187.7521 6.023333 pyrophosphohydrolase (CILP), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 2624.6886 5.7951027 (SERPING1), transcript variant 2, mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 521.1 1254 5.6853352 (NAALADL1), mRNA. Homo sapiens cafhepsin F (CTSF), 3930020 NM_003793.2 CTSF 922.55074 5.5503299 mRNA. Homo sapiens scrapie responsive 1110048 NM_007281.1 SCRG1 7337.5677 5.5457568 protein 1 (SCRG1), mRNA. Homo sapiens dermatopontin (DPT), 2100228 NM_001937.3 DPT 8463.3285 5.4835159 mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLF1 3015.2937 5.306301 factor 1 (CRLF1), mRNA. Homo sapiens heart and neural crest 4640563 NM_021973.2 HAND2 derivatives expressed 2 (HAND2), 635.25959 5.1350559 mRNA. Homo sapiens pregnancy specific beta- 4480292 NM_002781.2 PSG5 280.17795 5.1240103 1-glycoprotein 5 (PSG5), mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 670.9326 4.7414759 (HOXA9), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 4944.818 4.7024686 variant 1, mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 3880.5912 4.6686165 1, r subcomponent (C1R), mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1307.7577 4.5945526 (LY96), mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 5357.031 4.5190946 (RARRES2), mRNA. Homo sapiens fibulin 5 (FBLN5), 4670441 NM_006329.2 FBLN5 9064.792 4.470474 mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2180.9981 4.4025677 mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 522.85236 4.3890326 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 3400600 NM_014244.2 ADAMTS2 473.55988 4.355822 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 397.06726 4.3257787 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 4050326 NM_139125.2 MASP1 507.35413 4.2957723 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 6130577 NM_001081754.1 ELN 8262.2099 4.2183041 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens TIMP metallopeptidase 6980541 NM_003255.4 TIMP2 2241.5409 4.1933561 inhibitor 2 (TIMP2), mRNA. Homo sapiens tissue factor pathway 5080543 NM_006528.2 TFPI2 1516.4777 4.1714922 inhibitor 2 (TFPI2), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 3850500 NM_005031.3 FXYDl 379.09181 4.0340015 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 1300156 NM_001081754.1 ELN 553.73724 4.0025196 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1121.8139 3.912849 specific (ECM2), mRNA. Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, 6290356 NM_002615.4 SERPINF1 2904.0591 3.8942187 pigment epithelium derived factor), member 1 (SERPFNF1), mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 703.90103 3.8497235 cyclooxygenase) (PTGS1), transcript variant 1, mRNA. Homo sapiens protease, serine, 3 5080139 NM_002771.2 PRSS3 356.97765 3.8436993 (mesotrypsin) (PRSS3), mRNA. Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSL1 long-chain family member 1 (ACSL1), 1303.3388 3.8380098 mRNA. 1430521 NM_053276.2 VIT Homo sapiens vitrin (VIT), mRNA. 362.8056 3.8022078 Homo sapiens deoxyribonuclease I- 290739 NM_004944.2 DNASE1L3 208.85833 3.7955504 like 3 (DNASE1L3), mRNA. Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 510736 NM_004530.2 MMP2 1630.6443 3.782057 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 395.66748 3.770533 complexing protein 2) (DPP4), mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 1409.9098 3.7622186 mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1751.8841 3.7415499 mRNA. Homo sapiens cystatin SN (CST1), 6370541 NM_001898.2 CST1 1037.4619 3.7217119 mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 1278.5968 3.6740725 (plasma) (GPX3), mRNA. Homo sapiens superoxide dismutase 3, 3890095 NM_003102.2 SOD3 407.70649 3.670219 extracellular (SOD3), mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 7150609 NM_021599.1 ADAMTS2 346.73134 3.61 1967 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. Homo sapiens osteoglycin (OGN), 4480152 NM_014057.3 OGN 938.04152 3.5344838 transcript variant 3, mRNA. Homo sapiens major histocompatibility 2570564 NM_0191 11.3 HLA-DRA complex, class II, DR alpha (HLA- 341.06298 3.4852814 DRA), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILl lRA alpha (ILl lRA), transcript variant 1, 756.57382 3.3628965 mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 5960438 NM_139125.2 MASP1 288.32463 3.3557941 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA.

Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2720.0167 3.2496812 aminopeptidase, CD13, pi 50) (ANPEP), mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 774.21497 3.2298907 mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1988.5909 3.2094972 3) (LTBR), mRNA. Homo sapiens interleukin 17 receptor 3120368 NM_153480.1 IL17RE E (IL17RE), transcript variant 1, 208.64978 3.2075046 mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 10828.476 3.2073157 mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 3098.0882 3.17561 cyclooxygenase) (PTGS1), transcript variant 2, mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 545.16357 3.1695063 variant 2, mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 2815.7177 3.1658729 mRNA. Homo sapiens cartilage oligomeric 2360148 NM_000095.2 COMP 8902.9174 3.1617443 matrix protein (COMP), mRNA. Homo sapiens peptidylprolyl 70001 14 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 5428.6664 3.1615706 mRNA. Homo sapiens engrailed homeobox 1 5820025 NM_001426.3 EN1 214.7472 3.1440736 (EN1), mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 344.84543 3.1159375 complex, locus H (LY6H), mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 2490152 NM_001040092.1 ENPP2 7 11.93451 3.1156718 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens interleukin 1 receptor, 240274 NM_000877.2 ILIRI 539.16018 3.1136692 type I (IL1R1), mRNA. Homo sapiens oxytocin, prepro- 1850372 NM_000915.2 OXT 213.96829 3.0627531 (neurophysin I) (OXT), mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 10948.097 3.0452707 mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 5709.1668 2.9936474 transcript variant 2, mRNA. Homo sapiens gonadotropin-releasing 5080017 NM_001501.1 GNRH2 hormone 2 (GNRH2), transcript 243.3708 2.9727743 variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 3450538 NM_000062.2 SERPING1 member 1, (angioedema, hereditary) 237.45708 2.94142 (SERPING1), transcript variant 1, mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 840678 NM_001040092.1 ENPP2 878.6823 2.8996779 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens interleukin 17 receptor 3450228 NM_153461.1 IL17RC C (IL17RC), transcript variant 1, 561.09712 2.8974257 mRNA. Homo sapiens EPH receptor A4 6650482 NM_004438.3 EPHA4 492.55907 2.8660425 (EPHA4), mRNA. Homo sapiens interleukin 17 receptor 150041 1 NM_032732.3 IL17RC C (IL17RC), transcript variant 3, 261.27183 2.8497824 mRNA. Homo sapiens vitamin K epoxide reductase complex, subunit 1 6450546 NM_024006.4 VKORC1 3788.9917 2.8471645 (VKORC1), transcript variant 1, mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISP1 signaling pathway protein 1 (WISP1), 212.4708 2.8411769 transcript variant 2, mRNA. Homo sapiens SWI/SNF related, matrix associated, actin dependent 1580327 NM_003077.2 SMARCD2 1074.8536 2.8342261 regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. Homo sapiens RAB40A, member RAS 4490241 NM_080879.2 RAB40A 168.1132 2.8305274 oncogene family (RAB40A), mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 1580608 ΝΜ_01243 1.1 SEMA3E 2147.377 2.822007 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. Homo sapiens decorin (DCN), 50368 NM_001920.3 DCN 6775.5385 2.8051 183 transcript variant Al, mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 392.76976 2.7941969 (PTPRN), mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 913.02537 2.776887 (SRGAP1), mRNA. Homo sapiens SPARC-like 1 (mast9, 6960148 NM_004684.2 SPARCL1 326.53437 2.7657368 hevin) (SPARCL1), mRNA. Homo sapiens tenascin C 6940102 NM_002160.1 TNC 2774.1647 2.7398599 (hexabrachion) (TNC), mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 7693.5345 2.7366512 (NBL1), transcript variant 2, mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (IGF1), 227.441 15 2.7335123 mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 7406.5817 2.7129094 mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1590.2804 2.6981357 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens osteomodulin (OMD), 4610246 NM_005014.1 OMD 1111.6476 2.6974873 mRNA. Homo sapiens pleiotrophin (heparin binding growth factor 8, neurite 4920576 NM_002825.5 PTN 2592.795 2.686709 growth-promoting factor 1) (PTN), mRNA. Homo sapiens G protein-coupled 6040736 NM_032777.6 GPR124 1757.0146 2.6654166 receptor 124 (GPR124), mRNA. Homo sapiens Thy-l cell surface 6480204 NM_006288.2 THY1 6176.5406 2.5927568 antigen (THY1), mRNA. Homo sapiens sushi-repeat-containing 4900133 NM_006307.3 SRPX 13933.806 2.5893897 protein, X-linked (SRPX), mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 3700.132 2.58808 mRNA. Homo sapiens jumonji, AT rich 1660546 NM_004187.2 JARID1C interactive domain 1C (JARID1C), 291.5761 1 2.581248 mRNA. Homo sapiens collagen, type VI, alpha 7570598 NM_001848.2 COL6A1 16447.124 2.5759639 1 (COL6A1), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 14079.27 2.5753849 mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 361.45524 2.5559389 mRNA. Homo sapiens collagen, type V, alpha 5560300 NM_015719.3 COL5A3 348.89558 2.5504561 3 (COL5A3), mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 32458.718 2.5421644 transcript variant C, mRNA. Homo sapiens X-prolyl aminopeptidase (aminopeptidase P) 2, 4780544 NM_003399.5 XPNPEP2 232.95383 2.5357663 membrane-bound (XPNPEP2), mRNA. Homo sapiens glutathione peroxidase 7 4200543 NM_015696.3 GPX7 4897.5056 2.5199057 (GPX7), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 183.18525 2.49375 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens cathepsin Z (CTSZ), 4220259 NM_001336.2 CTSZ 2717.5947 2.4839328 mRNA. Homo sapiens leucine rich repeat 2640195 NM_1 30830.2 LRRC15 717.82375 2.4622582 containing 15 (LRRC15), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM 14A similarity 14, member A (FAM14A), 1894.1037 2.4409024 mRNA. Homo sapiens ADAM metallopeptidase domain 33 1440224 NM_025220.2 ADAM33 194.67271 2.439097 (ADAM33), transcript variant 1, mRNA. Homo sapiens lymphocyte antigen 6 4890270 NM_002346.1 LY6E 5456.904 2.4299043 complex, locus E (LY6E), mRNA. Homo sapiens collagen, type XVI, 5360743 NM_001856.3 COL16A1 3080.2386 2.4175636 alpha 1 (COL16A1), mRNA. Homo sapiens nephroblastoma 4290037 NM_002514.2 NOV 524.22522 2.3877704 overexpressed gene (NOV), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 3290630 NM_000624.3 SERPINA5 416.13525 2.3806033 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 5739.405 2.3745357 loop-helix protein (ID3), mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 1065.6829 2.3358737 mRNA. Homo sapiens cardiotrophin 1 (CTFl), 1190025 NM_001330.2 CTF1 389.14071 2.3308377 mRNA. Homo sapiens peptidase inhibitor 16 6980129 NM_153370.2 PI16 472.04838 2.327943 (PI16), mRNA. Homo sapiens low density lipoprotein- related protein 1 (alpha-2- 2710286 NM_002332.2 LRP1 564.38776 2.3165126 macroglobulin receptor) (LRP1), mRNA. Homo sapiens matrix metallopeptidase 7150551 NM_001032360.1 MMP19 19 (MMP19), transcript variant 2, 228.77353 2.3140406 mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 1731.7909 2.31 17899 mRNA. Homo sapiens heparan sulfate 1500139 NM_006042.1 HS3ST3A1 (glucosamine) 3-O-sulfotransferase 3661.8096 2.2769896 3A1 (HS3ST3A1), mRNA. Homo sapiens extracellular matrix 3450521 NM_022664.1 ECM1 protein 1 (ECM1), transcript variant 2, 1221.5493 2.271 1708 mRNA. Homo sapiens angiotensin I converting 3830398 NM_000789.2 ACE enzyme (peptidyl-dipeptidase A) 1 130.47994 2.2672559 (ACE), transcript variant 1, mRNA. Homo sapiens osteoglycin (OGN), 2940280 NM_014057.3 OGN 1125.5703 2.2525792 transcript variant 3, mRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 9972.642 2.2237895 mRNA. Homo sapiens iduronidase, alpha-L- 7400259 NM_000203.3 IDUA 1203.2155 2.2169114 (IDUA), mRNA. Homo sapiens solute carrier family 1 7610433 NM_005628.1 SLC1A5 (neutral amino acid transporter), 2380.5841 2.197802 member 5 (SLC1A5), mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 2839.9069 2.186561 1 transcript variant A, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 3559.0261 2.1764928 3, mRNA. Homo sapiens fibulin 2 (FBLN2), 780025 NM_001004019.1 FBLN2 126.30383 2.1743384 transcript variant 1, mRNA. Homo sapiens cysteine sulfinic acid 2810255 NM_015989.3 CSAD 733.76202 2.1739791 decarboxylase (CSAD), mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1070.4357 2.1734166 9, mRNA. Homo sapiens ribosome binding 4540327 NM_001042576.1 RRBP1 protein 1 homolog 180kDa (dog) 1004.4283 2.1651055 (RRBP1), transcript variant 1, mRNA. Homo sapiens bone morphogenetic 6980064 NM_001718.4 BMP6 226.75524 2.1526819 protein 6 (BMP6), mRNA. Homo sapiens TBC1 domain family, 2510441 NM_024682.1 TBC1D17 412.37375 2.1476749 member 17 (TBC1D17), mRNA. Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 2447.908 2.1463432 mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 4365.4193 2.145548 transcript variant 2, mRNA. Homo sapiens matrix metallopeptidase 4760626 NM_002426.2 MMP12 12 (macrophage elastase) (MMP12), 123.66018 2.1453509 mRNA. Homo sapiens interferon, alpha 10 3990563 NM_002171.1 IFNA10 153.16947 2.1432179 (IFNA10), mRNA. Homo sapiens procollagen C- 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1192.2636 2.1384277 (PCOLCE2), mRNA. Homo sapiens retinol dehydrogenase 2340494 NM_016026.2 RDH1 1 11 (all-trans/9-cis/l l-cis) (RDH1 1), 1134.6221 2.1339793 mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 201.35973 2.1327482 2, mRNA. Homo sapiens leptin (obesity homolog, 840309 NM_000230.1 LEP 391.5326 2.1324242 mouse) (LEP), mRNA. Homo sapiens nucleobindin 2 60427 NM_005013.2 NUCB2 2275.6465 2.1256018 (NUCB2), mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 1955.0771 2.12398 (DPM3), transcript variant 1, mRNA. Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 3990441 NR_003087.1 ABCC13 152.28097 2.1 139142 13 (ABCC13) on chromosome 21. XR_017987 XR_017988 XR_017989 Homo sapiens amylase, alpha 1A 1740220 NM_004038.3 AMYl A (salivary) (AMYl A), transcript variant 2341.8403 2.1082485 1, mRNA. Homo sapiens sphingomyelin 1500193 NM_001007593.1 SMPD1 phosphodiesterase 1, acid lysosomal 505.82493 2.0879872 (SMPD1), transcript variant 2, mRNA. Homo sapiens cAMP responsive 3060326 NM_052854.2 CREB3L1 element binding protein 3-like 1 166.58385 2.0704775 (CREB3L1), mRNA. Homo sapiens pregnancy specific beta- 4120243 NM_002784.2 PSG9 190.71 136 2.065436 1-glycoprotein 9 (PSG9), mRNA. Homo sapiens FK506 binding protein 60681 NM_021939.2 FKBP10 1351.2798 2.0617279 10, 65 kDa (FKBP10), mRNA. Homo sapiens FK506 binding protein 4150753 NM_017946.2 FKBP14 2023.715 2.0590188 14, 22 kDa (FKBP14), mRNA. Homo sapiens proenkephalin (PENK), 6220019 NM_00621 1.2 PENK 2097.356 2.0539128 mRNA. Homo sapiens Clq and tumor necrosis 1510092 NM_1 82486.1 C1QTNF6 factor related protein 6 (C1QTNF6), 188.82065 2.0514252 transcript variant 2, mRNA. Homo sapiens cystatin C (CST3), 6450543 NM_000099.2 CST3 23004.187 2.0506108 mRNA. Homo sapiens blocked early in 3130672 NM_016526.3 BET1L transport 1 homolog (S. cerevisiae)- 465.84189 2.0461326 like (BET1L), mRNA. Homo sapiens protein kinase C 2850639 NM_001001329.1 PRKCSH substrate 80K-H (PRKCSH), transcript 571.36313 2.0248404 variant 2, mRNA. Homo sapiens Sin3A-associated 1780673 NM_003864.3 SAP30 1185.3361 2.0248244 protein, 30kDa (SAP30), mRNA. Homo sapiens MYC-associated zinc finger protein (purine-binding 4830689 NM_001042539.1 MAZ 560.62788 2.019431 transcription factor) (MAZ), transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 837.14322 2.0098338 1, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 440.09484 2.0077282 c, mRNA. Homo sapiens proline/arginine-rich "7000446 NM_20 1348.1 PRELP end leucine-rich repeat protein 214.38178 2.0044344 (PRELP), transcript variant 2, mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2125.5403 2.0005209 1, mRNA.

ASCI P8 D14 Chondro Pellet Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CES1 (monocyte/macrophage serine esterase 1279.2183 20.662215 1) (CES1), transcript variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 3290630 NM_000624.3 SERPINA5 3139.7591 17.961759 antiproteinase, antitrypsin), member 5 (SERPIN A5), mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 IL1RL1 like 1 (ILIRLI), transcript variant 2, 1753.8156 16.925494 mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 2862.6472 14.809618 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 2023.715 14.524177 matrix protein (SPON1), mRNA. Homo sapiens RAS, dexamethasone- 2710735 NM_016084.3 RASD1 3687.3715 12.860481 induced 1 (RASD1), mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 2367.9966 11.576579 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 13153.34 10.336565 transcript variant A2, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 4656.3031 10.280745 (SERPING1), transcript variant 2, mRNA. Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 2813.1919 9.8986763 mRNA. Homo sapiens hypoxia-inducible 7320441 NM_013332.3 HIG2 protein 2 (HIG2), transcript variant 1, 3374.7597 9.7624731 mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 7271.1268 9.2278535 (APOD), mRNA. Homo sapiens leptin (obesity homolog, 840309 NM_000230.1 LEP 1626.518 8.8585892 mouse) (LEP), mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 1192.5484 8.4277309 (HOXA9), mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLFl 4548.4928 8.0044183 factor 1 (CRLFl), mRNA. Homo sapiens matrix metallopeptidase 3800088 NM_002423.3 MMP7 7 (matrilysin, uterine) (MMP7), 1401.5296 7.7650296 mRNA. Homo sapiens prostaglandin E 1510181 NM_004878.3 PTGES 4852.0339 7.7614255 synthase (PTGES), mRNA. Homo sapiens dermatopontin (DPT), 2100228 NM_001937.3 DPT 11721.186 7.5943298 mRNA. Homo sapiens carbonic anhydrase XII 3830075 NM_001218.3 CA12 2404.0568 7.5824417 (CA12), transcript variant 1, mRNA. Homo sapiens SPARC-like 1 (mast9, 6960148 NM_004684.2 SPARCL1 863.5826 7.3145202 hevin) (SPARCL1), mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 1006.0832 7.1573597 (PTPRN), mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 5908.2373 7.1080134 1, r subcomponent (C1R), mRNA. Homo sapiens scrapie responsive 1110048 NM_007281.1 SCRG1 9395.8299 7.1013979 protein 1 (SCRG1), mRNA. Homo sapiens Sin3A-associated 1780673 NM_003864.3 SAP30 4057.9473 6.9318992 protein, 30kDa (SAP30), mRNA. Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSLl long-chain family member 1 (ACSLl), 2321.2472 6.8354979 mRNA. Homo sapiens kallikrein-related 5290707 NM_004917.3 KLK4 1010.7487 6.6165091 peptidase 4 (KLK4), mRNA. Homo sapiens interleukin 1 receptor, 240274 NM_000877.2 IL1R1 1143.8901 6.6060061 type I (IL1R1), mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 3226.2173 6.5124495 mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISP1 signaling pathway protein 1 (WISP1), 1559.7164 6.5088257 transcript variant 1, mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 6733.5934 6.4035748 variant 1, mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 694.85265 6.2577903 transcript variant 1, mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1720.9615 6.046264 (LY96), mRNA. Homo sapiens carboxypeptidase E 5390687 NM_001873.1 CPE 5260.306 5.8776569 (CPE), mRNA. Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 528.65369 5.7676091 (NAALADL1), mRNA. Homo sapiens apolipoprotein C-I 3830465 NM_001645.3 APOC1 1160.4304 5.6395807 (APOC1), mRNA. Homo sapiens cartilage oligomeric 2360148 NM_000095.2 COMP 15780.728 5.6043009 matrix protein (COMP), mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (IGF1), 457.67507 5.5005898 mRNA. Homo sapiens matrix metallopeptidase "7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 1150.6465 5.3912917 (MMP3), mRNA. Homo sapiens X-prolyl aminopeptidase (aminopeptidase P) 2, 4780544 NM_003399.5 XPNPEP2 481.75833 5.2440713 membrane-bound (XPNPEP2), mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 6200.4392 5.2305786 (RARRES2), mRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 IL1RL1 like 1 (ILIRLI), transcript variant 2, 492.00914 5.07913 mRNA. Homo sapiens gonadotropin-releasing 5080017 NM_001501.1 GNRH2 hormone 2 (GNRH2), transcript 406.13997 4.9609999 variant 1, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 2909.3212 4.9360752 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens zinc finger protein 533 5290333 NM_152520.3 ZNF533 431.19012 4.9067868 (ZNF533), mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 1992.6388 4.8609186 (RECK), mRNA. Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, 6290356 NM_002615.4 SERPINF1 3603.6146 4.8322926 pigment epithelium derived factor), member 1 (SERPFNF1), mRNA.

Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 580360 NM_001031849.1 MASP1 432.40664 4.7282071 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens procollagen-lysine, 2- 4640187 NM_000935.2 PLOD2 oxoglutarate 5-dioxygenase 2 5985.4358 4.6024992 (PLOD2), transcript variant 2, mRNA. Homo sapiens laminin, beta 1 1510392 NM_002291.1 LAMB1 3094.9801 4.4954627 (LAMB1), mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 7150609 NM_021599.1 ADAMTS2 431.46106 4.4946128 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1843.8252 4.4267005 1, mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 1056.1743 4.406176 mRNA. Homo sapiens matrix Gla protein 1430487 NM_000900.2 MGP 15873.563 4.3823785 (MGP), mRNA. Homo sapiens cathepsin F (CTSF), 3930020 NM_003793.2 CTSF 710.31785 4.2734759 mRNA. Homo sapiens secretoglobin, family 6350367 NM_006551.3 SCGB1D2 225.59646 4.2644554 ID, member 2 (SCGB1D2), mRNA. Homo sapiens G0/G1 switch 2 (G0S2), 6180427 NM_015714.2 G0S2 702.16445 4.2131981 mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 6280168 NM_001085.4 SERPINA3 6141.2795 4.1679731 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 510736 NM_004530.2 MMP2 1747.8246 4.0538407 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 423.3292 4.0432837 (F10), mRNA. Homo sapiens TIMP metallopeptidase 1090326 NM_003256.2 TIMP4 1533.6102 3.9979985 inhibitor 4 (TFMP4), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 676.82286 3.9349554 variant 2, mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 13217.852 3.9150313 mRNA. 7200427 NM_017413.3 APLN Homo sapiens apelin (APLN), mRNA. 386.6306 3.8852622 Homo sapiens ADAM metallopeptidase with thrombospondin 3400600 NM_014244.2 ADAMTS2 419.61807 3.8596631 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens carbonic anhydrase XII 150474 NM_001218.3 CA12 4889.6842 3.8476087 (CA12), transcript variant 1, mRNA. Homo sapiens cathepsin K (CTSK), 1430278 NM_000396.2 CTSK 3284.7252 3.7562145 mRNA. Homo sapiens apolipoprotein E 730414 NM_000041.2 APOE 9309.5316 3.7498944 (APOE), mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 361 1.9826 3.7023632 cyclooxygenase) (PTGS1), transcript variant 2, mRNA. Homo sapiens fibulin 1 (FBLN1), 5050131 NM_006485.3 FBLN1 246.85538 3.6183322 transcript variant B, mRNA. Homo sapiens carboxylesterase 4-like 270575 NR_003276.1 CES4 200.76984 3.5777391 (CES4) on chromosome 16. Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 207.3646 3.5094375 mRNA. Homo sapiens proline/arginine-rich "7000446 NM_20 1348.1 PRELP end leucine-rich repeat protein 373.28525 3.4901557 (PRELP), transcript variant 2, mRNA. Homo sapiens complement component 4860494 NM_000064.1 C3 258.12802 3.4727939 3 (C3), mRNA. Homo sapiens serum amyloid Al 1690563 NM_199161.1 SAA1 481.75833 3.4606675 (SAA1), transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2131.2603 3.4397594 3) (LTBR), mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 5609.1248 3.4302137 3, mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 3155.027 3.4195435 (ANG), transcript variant 2, mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 1183.637 3.4012039 (plasma) (GPX3), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2786.331 3.3289088 aminopeptidase, CD13, p i 50) (ANPEP), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 18155.869 3.3210776 mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 392.01652 3.290744 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 3450538 NM_000062.2 SERPING1 member 1, (angioedema, hereditary) 263.02847 3.2581769 (SERPING1), transcript variant 1, mRNA. Homo sapiens procollagen-proline, 2- oxoglutarate 4-dioxygenase (proline 4- 4220731 NM_000917.2 P4HA1 7123.9139 3.2407653 hydroxylase), alpha polypeptide I (P4HA1), transcript variant 1, mRNA. Homo sapiens lipoprotein lipase 5560674 NM_000237.2 LPL 266.31091 3.2036576 (LPL), mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 1459.3704 3.1987986 mRNA. Homo sapiens engrailed homeobox 1 5820025 NM_001426.3 EN1 214.21445 3.1362738 (EN1), mRNA. Homo sapiens procollagen C- 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1736.6329 3.114801 1 (PCOLCE2), mRNA. Homo sapiens CDlc molecule 1500725 NM_001765.2 CD1C 591.15428 3.1015479 (CD1C), mRNA. Homo sapiens neuromedin B (NMB), 5670594 NM_021077.3 NMB 1495.0994 3.0767196 transcript variant 1, mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 339.57308 3.0682979 complex, locus H (LY6H), mRNA. Homo sapiens fibulin 2 (FBLN2), 780025 NM_001004019.1 FBLN2 178.16822 3.067191 transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 7100338 NM_001032278.1 MMP28 28 (MMP28), transcript variant 3, 483.42463 3.0569024 mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISP1 signaling pathway protein 1 (WISP1), 227.38201 3.0405708 transcript variant 2, mRNA. Homo sapiens glypican 6 (GPC6), 2370593 NM_005708.2 GPC6 1379.6024 2.9829186 mRNA. Homo sapiens vitamin K epoxide reductase complex, subunit 1 6450546 NM_024006.4 VKORC1 3960.6569 2.976159 (VKORC1), transcript variant 1, mRNA. Homo sapiens vascular endothelial 5890288 NM_003377.3 VEGFB 1310.9029 2.9721981 growth factor B (VEGFB), mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 3835.0556 2.952767 transcript variant A, mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 5578.7437 2.925259 transcript variant 2, mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1362.41 17 2.9097423 mRNA. Homo sapiens vascular endothelial 5700201 NM_003377.3 VEGFB 266.41888 2.8737329 growth factor B (VEGFB), mRNA. Homo sapiens decorin (DCN), 50368 NM_001920.3 DCN 6849.601 2.8357807 transcript variant Al, mRNA. Homo sapiens carboxypeptidase B1 4230343 NM_001871.2 CPB1 207.94027 2.8254825 (tissue) (CPB1), mRNA. Homo sapiens wingless-type MMTV 4730176 NM_004626.2 WNT1 1 integration site family, member 11 248.09985 2.8045125 (WNT1 1), mRNA. Homo sapiens proprotein convertase 520176 NM_000439.3 PCSK1 subtilisin/kexin type 1 (PCSK1), 191.68142 2.8033921 mRNA. Homo sapiens low density lipoprotein- related protein 1 (alpha-2- 2710286 NM_002332.2 LRP1 675.1677 2.7712056 macroglobulin receptor) (LRP1), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 3850500 NM_005031.3 FXYDl 260.32603 2.770188 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens chromosome 6 open 1190082 NM_001040437.1 C6orf48 reading frame 48 (C6orf48), transcript 301.30531 2.7663783 variant 1, mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 6650.5519 2.7515 loop-helix protein (ID3), mRNA. Homo sapiens frizzled homolog 4 620255 NM_012193.2 FZD4 1360.4313 2.7470366 (Drosophila) (FZD4), mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 840678 NM_001040092.1 ENPP2 830.71431 2.7413821 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens jumonji, AT rich 1660546 NM_004187.2 JARIDIC interactive domain 1C (JARIDIC), 303.86586 2.690046 mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 7526.9794 2.6774062 (NBL1), transcript variant 2, mRNA. Homo sapiens glycogen synthase 1 5570270 NM_002103.3 GYS1 769.14145 2.6576962 (muscle) (GYS1), mRNA. Homo sapiens sushi-repeat-containing 4900133 NM_006307.3 SRPX 14223.845 2.6432891 protein, X-linked (SRPX), mRNA. Homo sapiens Clq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 242.27662 2.6038607 transcript variant 2, mRNA. Homo sapiens netrin Gl (NTNG1), 6940053 NM_014917.2 NTNG1 312.90022 2.5839095 transcript variant 3, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 738.12316 2.5745488 specific (ECM2), mRNA. Homo sapiens alpha-2-macroglobulin 2370438 NM_000014.4 A2M 257.71077 2.5649894 (A2M), mRNA. Homo sapiens superoxide dismutase 3, 3890095 NM_003102.2 SOD3 284.80664 2.5638609 extracellular (SOD3), mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 1580608 NM_0 1243 1.1 SEMA3E 1946.6975 2.558281 1 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. Homo sapiens CD164 molecule, 10142 NM_006016.3 CD164 449.01608 2.542163 sialomucin (CD164), mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 462.54735 2.5297298 cyclooxygenase) (PTGS1), transcript variant 1, mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM 14A similarity 14, member A (FAM14A), 1953.8538 2.5179014 mRNA. Homo sapiens cysteine-rich with EGF- 2940561 NM_001031717.1 CRELD1 like domains 1 (CRELDl), transcript 214.88842 2.5168938 variant 1, mRNA. Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 3990441 NR_003087.1 ABCC13 179.4382 2.4909019 13 (ABCC13) on chromosome 21. XR_017987 XR_017988 XR_017989

Homo sapiens SWI/SNF related, matrix associated, actin dependent 1580327 NM_003077.2 SMARCD2 941.7056 2.4831349 regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1216.8699 2.4707372 9, mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 258.39985 2.4624343 complexing protein 2) (DPP4), mRNA. Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral 1050671 NM_005228.3 EGFR 906.39543 2.4520536 (v-erb-b) oncogene homolog, avian) (EGFR), transcript variant 1, mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1066.1392 2.4469016 mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 350.90878 2.4467251 variant 1, mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1755.9617 2.4400091 1, mRNA. Homo sapiens cysteine sulfinic acid 2810255 NM_015989.3 CSAD 822.28392 2.4362505 decarboxylase (CSAD), mRNA. Homo sapiens biliverdin reductase B 6620521 NM_000713.1 BLVRB (flavin reductase (NADPH)) 608.88186 2.4327729 (BLVRB), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 229.59233 2.4317803 2, mRNA. Homo sapiens baculoviral IAP repeat- 3060255 NM_1 82962.1 BIRC3 containing 3 (BIRC3), transcript 1286.0277 2.3855063 variant 2, mRNA. Homo sapiens secreted frizzled-related 3060639 NM_003013.2 SFRP2 2364.5975 2.3678544 protein 2 (SFRP2), mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 226.64285 2.3672038 SHOX2a, mRNA. Homo sapiens FK506 binding protein 4150753 NM_017946.2 FKBP14 2326.433 2.3670178 14, 22 kDa (FKBP14), mRNA. Homo sapiens adipocyte-specific 5570682 NM_024769.2 ASAM 1482.786 2.3664019 adhesion molecule (ASAM), mRNA. Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 2490152 NM_001040092.1 ENPP2 540.53982 2.3655894 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 5474.621 1 2.3614494 transcript variant C, mRNA. Homo sapiens fibroblast growth factor receptor 1 (fms-related tyrosine kinase 6770128 NM_023106.2 FGFR1 262.57279 2.3525859 2, Pfeiffer syndrome) (FGFR1), transcript variant 4, mRNA. Homo sapiens CDId molecule 6400358 NM_001766.3 CD1D 213.60177 2.3197914 (CD1D), mRNA. Homo sapiens interferon, alpha 10 3990563 NM_002171.1 IFNA10 165.57286 2.3167719 (IFNA10), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 2 11.66401 2.305936 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2444.995 2.301 1861 1, mRNA. Homo sapiens olfactomedin 1 2680072 NM_014279.4 OLFM1 355.76563 2.2750708 (OLFM1), transcript variant 1, mRNA. Homo sapiens fibulin 1 (FBLN1), 4830685 NM_006486.2 FBLN1 12107.229 2.2540418 transcript variant D, mRNA. Homo sapiens fibulin 2 (FBLN2), 7330292 NM_001998.2 FBLN2 4581.7084 2.2518513 transcript variant 2, mRNA. Homo sapiens protease, serine, 3 5080139 NM_002771.2 PRSS3 208.64978 2.2466028 (mesotrypsin) (PRSS3), mRNA. Homo sapiens AT rich interactive 6510553 NM_005224.2 ARID3A domain 3A (BRIGHT-like) (ARID3A), 1726.8608 2.2415686 mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 FLU) interacting protein 1 (LRRFIPl), 2793.5261 2.2244225 mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 1963.5723 2.2077569 mRNA.

Homo sapiens prenylcysteine oxidase 840392 NM_016297.2 PCYOX1 2661.3662 2.0260096 1 (PCYOX1), mRNA. Homo sapiens tissue factor pathway inhibitor (lipoprotein-associated 4280674 NM_001032281.2 TFPI 284.02021 2.0192782 coagulation inhibitor) (TFPI), transcript variant 2, mRNA. Homo sapiens gonadotropin-releasing hormone 1 (luteinizing-releasing 2340553 NM_000825.3 GNRH1 269.04897 2.009401 hormone) (GNRH1), transcript variant 1, mRNA. Homo sapiens plexin B3 (PLXNB3), 4060139 NM_005393.1 PLXNB3 160.16283 2.0087789 mRNA. Homo sapiens Clq and tumor necrosis 6180719 NM_198593.1 C1QTNF1 factor related protein 1 (C1QTNF1), 158.5559 2.0082489 transcript variant 2, mRNA. Homo sapiens cartilage intermediate layer protein, nucleotide 6400427 NM_003613.2 CILP 727.80265 2.0037909 pyrophosphohydrolase (CILP), mRNA.

ASC1 P8 D14 Chondro MM Fold over ProbelD RefSeq_ID Symbol Definition RFU Ave Homo sapiens matrix metallopeptidase "7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 7108.8637 33.308196 (MMP3), mRNA. Homo sapiens glutathione peroxidase 3 5490019 NM_002084.3 GPX3 8262.2099 23.74162 (plasma) (GPX3), mRNA. Homo sapiens SPARC related modular 2630437 NM_022138.1 SMOC2 2316.061 1 23.046219 calcium binding 2 (SMOC2), mRNA. Homo sapiens cartilage intermediate layer protein, nucleotide 6400427 NM_003613.2 CILP 7526.9794 20.723327 pyrophosphohydrolase (CILP), mRNA. Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 5832.8319 20.523774 mRNA. Homo sapiens spondin 1, extracellular 3370162 NM_006108.2 SPON1 2573.9904 18.473496 matrix protein (SPON1), mRNA. Homo sapiens dermatopontin (DPT), 2100228 NM_001937.3 DPT 25120.052 16.275654 mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 1470296 NM_000426.3 LAMA2 2793.5261 14.452027 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (IGF1), 1181.2435 14.196832 mRNA. Homo sapiens apolipoprotein D 7150634 NM_001647.2 APOD 10564.173 13.407089 (APOD), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 5619.4093 12.407206 (SERPING1), transcript variant 2, mRNA. Homo sapiens laminin, alpha 2 (merosin, congenital muscular 360181 NM_001079823.1 LAMA2 2516.9678 12.304865 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens complement component 4920221 NM_000587.2 C7 1388.2357 11.719473 7 (C7), mRNA. Homo sapiens secreted frizzled-related 3060639 NM_003013.2 SFRP2 10528.006 10.542508 protein 2 (SFRP2), mRNA. Homo sapiens scrapie responsive 1110048 NM_007281.1 SCRG1 13864.881 10.479121 protein 1 (SCRG1), mRNA. Homo sapiens superoxide dismutase 3, 3890095 NM_003102.2 SOD3 1162.3444 10.463553 extracellular (SOD3), mRNA. Homo sapiens matrix metallopeptidase 3800088 NM_002423.3 MMP7 7 (matrilysin, uterine) (MMP7), 1824.2199 10.106901 mRNA. Homo sapiens SPARC-like 1 (mast9, 6960148 NM_004684.2 SPARCL1 1175.4553 9.9560732 hevin) (SPARCL1), mRNA. Homo sapiens netrin Gl (NTNG1), 6940053 NM_014917.2 NTNG1 1171.0612 9.6705465 transcript variant 3, mRNA. Homo sapiens osteoglycin (OGN), 4480152 NM_014057.3 OGN 2487.3723 9.3722685 transcript variant 3, mRNA. Homo sapiens leptin (obesity homolog, 840309 NM_000230.1 LEP 1696.8497 9.2416404 mouse) (LEP), mRNA. Homo sapiens complement component 5260474 NM_001733.4 C1R 7475.5754 8.9936282 1, r subcomponent (C1R), mRNA. Homo sapiens decorin (DCN), 5550719 NM_133503.2 DCN 11313.736 8.8909102 transcript variant A2, mRNA. Homo sapiens kallikrein-related 5290707 NM_004917.3 KLK4 1356.4662 8.879627 peptidase 4 (KLK4), mRNA. Homo sapiens cartilage oligomeric 2360148 NM_000095.2 COMP 24958.137 8.8635268 matrix protein (COMP), mRNA. Homo sapiens reversion-inducing- 3390487 NM_0211 11.1 RECK cysteine-rich protein with kazal motifs 3460.3842 8.4413925 (RECK), mRNA. Homo sapiens matrix Gla protein 1430487 NM_000900.2 MGP 28663.545 7.9134409 (MGP), mRNA. Homo sapiens leucine rich repeat 2370041 NM_018334.3 LRRN3 601.53289 7.4294809 neuronal 3 (LRRN3), mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 2081.8504 7.2614244 specific (ECM2), mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 805.39838 7.2533567 transcript variant 1, mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 6130577 NM_001081754.1 ELN 13933.806 7.1 1396 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens elastin (supravalvular aortic stenosis, Williams-Beuren 1300156 NM_001081754.1 ELN 968.27168 6.9988544 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 8152.2937 6.8771278 (RARRES2), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CIS 1, s subcomponent (CIS), transcript 7047.5294 6.7021245 variant 1, mRNA. Homo sapiens cafhepsin K (CTSK), 1430278 NM_000396.2 CTSK 5855.7001 6.696227 mRNA. Homo sapiens homeobox A9 2810673 NM_152739.3 HOXA9 940.13805 6.6439489 (HOXA9), mRNA. Homo sapiens glypican 3 (GPC3), 1340593 NM_004484.2 GPC3 964.70664 6.2931355 mRNA. Homo sapiens proline/arginine-rich "7000446 NM_20 1348.1 PRELP end leucine-rich repeat protein 671.62832 6.2796143 (PRELP), transcript variant 2, mRNA. Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSL1 long-chain family member 1 (ACSL1), 2125.5403 6.2591895 mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2928.9726 5.9124307 mRNA. Homo sapiens lymphocyte antigen 96 70167 NM_015364.2 LY96 1661.1791 5.83623 (LY96), mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 IL1RL1 like 1 (ILIRLI), transcript variant 2, 588.40369 5.678489 mRNA. Homo sapiens cafhepsin F (CTSF), 3930020 NM_003793.2 CTSF 929.48555 5.5920517 mRNA. Homo sapiens carboxypeptidase B1 4230343 NM_001871.2 CPB1 4 11.29174 5.5886126 (tissue) (CPB1), mRNA. Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, 6290356 NM_002615.4 SERPINF1 4147.5046 5.5616257 pigment epithelium derived factor), member 1 (SERPFNF1), mRNA. Homo sapiens heart and neural crest 4640563 NM_021973.2 HAND2 derivatives expressed 2 (HAND2), 666.05855 5.3840162 mRNA. Homo sapiens serpin peptidase inhibitor, clade G (CI inhibitor), 3450538 NM_000062.2 SERPING1 member 1, (angioedema, hereditary) 429.76268 5.3235412 (SERPING1), transcript variant 1, mRNA. Homo sapiens complement component 1300327 NM_201442.1 CIS 1, s subcomponent (CIS), transcript 915.61386 5.3232536 variant 2, mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 5860022 NM_021902.2 FXYDl 483.98333 5.2726705 (phospholemman) (FXYDl), transcript variant b, mRNA. Homo sapiens slit homolog 3 990458 NM_003062.1 SLIT3 1393.1774 5.1736446 (Drosophila) (SLIT3), mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 3037.6749 5.1538454 type 1 motif, 1 (ADAMTS1), mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-1 beta (PTX3), 808.58267 5.093939 mRNA. Homo sapiens fibulin 2 (FBLN2), 780025 NM_001004019.1 FBLN2 293.07242 5.0452832 transcript variant 1, mRNA. Homo sapiens Clq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 465.84189 5.0066217 transcript variant 2, mRNA. Homo sapiens CDlc molecule 1500725 NM_001765.2 CD1C 951.16903 4.9903999 (CD1C), mRNA. Homo sapiens FXYD domain containing ion transport regulator 1 3850500 NM_005031.3 FXYDl 460.541 15 4.9007222 (phospholemman) (FXYDl), transcript variant a, mRNA. Homo sapiens osteoglycin (OGN), 2940280 NM_014057.3 OGN 2405.8639 4.8148029 transcript variant 3, mRNA. Homo sapiens fibromodulin (FMOD), 1710484 NM_002023.3 FMOD 1141.281 4.7612265 mRNA. Homo sapiens slit homolog 2 4560592 NM_004787.1 SLIT2 1714.6506 4.7279017 (Drosophila) (SLIT2), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 1063.3442 4.726461 mRNA. 1430521 NM_053276.2 VIT Homo sapiens vitrin (VIT), mRNA. 447.24985 4.6871847 Homo sapiens N-acetylated alpha- 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 420.32861 4.5857831 (NAALADL1), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 2450327 NM_172244.2 SGCD 517.3104 4.342511 1 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens osteomodulin (OMD), 4610246 NM_005014.1 OMD 1732.7583 4.2046538 mRNA. Homo sapiens haptoglobin (HP), 2640025 NM_005143.2 HP 255.71445 4.2006481 mRNA. Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating 580360 NM_001031849.1 MASPl 378.40347 4.1377023 component of Ra-reactive factor) (MASPl), transcript variant 3, mRNA. Homo sapiens X-prolyl aminopeptidase (aminopeptidase P) 2, 4780544 NM_003399.5 XPNPEP2 377.77655 4.112201 1 membrane-bound (XPNPEP2), mRNA. Homo sapiens laminin, alpha 3 6480592 NM_198129.1 LAMA3 399.44838 4.094949 (LAMA3), transcript variant 1, mRNA. Homo sapiens cytokine receptor-like 4760095 NM_004750.2 CRLF1 2302.2323 4.0514587 factor 1 (CRLF1), mRNA. Homo sapiens zinc finger protein 533 5290333 NM_152520.3 ZNF533 353.85162 4.0267028 (ZNF533), mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISP1 signaling pathway protein 1 (WISP1), 964.30959 4.0241438 transcript variant 1, mRNA. Homo sapiens Boc homolog (mouse) 75101 13 NM_033254.2 BOC 349.04757 4.015553 (BOC), mRNA. Homo sapiens platelet derived growth 5690139 NM_033135.3 PDGFD factor D (PDGFD), transcript variant 2, 2233.7621 3.9147582 mRNA. Homo sapiens follistatin (FST), 1260068 NM_006350.2 FST 869.23134 3.873012 transcript variant FST317, mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 IL1 1RA alpha (IL1 1RA), transcript variant 1, 5521.4304 3.8619982 mRNA. Homo sapiens angiopoietin 1 3360066 NM_001 146.3 ANGPT1 1494.2975 3.7746631 (ANGPT1), mRNA. Homo sapiens coagulation factor X 5340358 NM_000504.3 F10 379.31527 3.6228997 (F10), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha- 1 3290630 NM_000624.3 SERPINA5 629.9382 3.6037153 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. Homo sapiens SWI/SNF related, matrix associated, actin dependent 1580327 NM_003077.2 SMARCD2 1361.7698 3.5907805 regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. Homo sapiens fibulin 1 (FBLN1), 6040494 NM_006487.2 FBLN1 4595.7758 3.5384768 transcript variant A, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 1580608 ΝΜ_01243 1.1 SEMA3E 2679.2959 3.521036 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2105.91 15 3.3988475 3) (LTBR), mRNA. Homo sapiens collagen, type V, alpha 5560300 NM_015719.3 COL5A3 464.79705 3.3977056 3 (COL5A3), mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 621.13156 3.3970468 cyclooxygenase) (PTGS1), transcript variant 1, mRNA. Homo sapiens decorin (DCN), 50368 NM_001920.3 DCN 8173.1729 3.3837483 transcript variant Al, mRNA. Homo sapiens EPH receptor A4 6650482 NM_004438.3 EPHA4 581.30516 3.3824274 (EPHA4), mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 7150609 NM_021599.1 ADAMTS2 324.15442 3.3767789 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. Homo sapiens matrix metallopeptidase 24501 10 NM_006983.1 MMP23B 2471.569 3.3247587 23B (MMP23B), mRNA. Homo sapiens tenascin C 6940102 NM_002160.1 TNC 3315.4509 3.2744526 (hexabrachion) (TNC), mRNA. Homo sapiens pleiotrophin (heparin binding growth factor 8, neurite 4920576 NM_002825.5 PTN 3139.7591 3.2534849 growth-promoting factor 1) (PTN), mRNA. Homo sapiens cafhepsin O (CTSO), 1820300 NM_001334.2 CTSO 1304.9395 3.1712952 mRNA. Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 3607.7851 3.1633317 mRNA. Homo sapiens ADAM metallopeptidase with thrombospondin 3400600 NM_014244.2 ADAMTS2 337.1 1401 3.1007876 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens fibulin 5 (FBLN5), 4670441 NM_006329.2 FBLN5 6223.7752 3.0693727 mRNA. Homo sapiens follistatin (FST), 6020286 NM_0 13409.1 FST 8196.2295 3.061771 1 transcript variant FST344, mRNA. Homo sapiens platelet derived growth 4480445 NM_025208.4 PDGFD factor D (PDGFD), transcript variant 1, 1339.346 3.0322254 mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 317.28599 3.0235927 complexing protein 2) (DPP4), mRNA. Homo sapiens acyl-CoA synthetase 7040286 NM_016234.3 ACSL5 long-chain family member 5 (ACSL5), 285.66032 3.0167721 transcript variant 1, mRNA. Homo sapiens integrin, beta-like 1 5570129 NM_004791.1 ITGBL1 (with EGF-like repeat domains) 480.53761 3.0068207 (ITGBL1), mRNA. Homo sapiens lumican (LUM), 7400735 NM_002345.3 LUM 1367.8171 2.9981226 mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 1268.6987 2.9655988 mRNA. Homo sapiens fibulin 1 (FBLN1), 4830685 NM_006486.2 FBLN1 15162.419 2.8228365 transcript variant D, mRNA. Homo sapiens complement component 4860494 NM_000064.1 C3 209.26254 2.8153691 3 (C3), mRNA. Homo sapiens jumonji, AT rich 1660546 NM_004187.2 JARID1C interactive domain 1C (JARID1C), 314.66799 2.7856745 mRNA. Homo sapiens core 1 synthase, glycoprotein-N-acetylgalactosamine 3- 580066 NM_020156.1 C1GALT1 439.10118 2.782048 beta-galactosyltransferase, 1 (C1GALT1), mRNA. Homo sapiens sushi-repeat-containing 4900133 NM_006307.3 SRPX 14914.677 2.7716698 protein, X-linked (SRPX), mRNA. Homo sapiens Nedd4 family 60553 NM_030571.2 NDFIP1 interacting protein 1 (NDFIP1), 904.20575 2.7223137 mRNA. Homo sapiens interleukin 1 receptor, 240274 NM_000877.2 IL1R1 470.7177 2.7184115 type I (IL1R1), mRNA. Homo sapiens FK506 binding protein 4150753 NM_017946.2 FKBP14 2663.567 2.710033 14, 22 kDa (FKBP14), mRNA. Homo sapiens laminin, alpha 3 2650612 NM_198129.1 LAMA3 204.25664 2.7035692 (LAMA3), transcript variant 1, mRNA. Homo sapiens ADAM metallopeptidase domain 33 1440224 NM_025220.2 ADAM33 213.10406 2.6700273 (ADAM33), transcript variant 1, mRNA. Homo sapiens serum amyloid Al 1690563 NM_199161.1 SAA1 370.74764 2.6632322 (SAA1), transcript variant 2, mRNA. Homo sapiens laminin, beta 1 1510392 NM_002291.1 LAMB1 1830.6968 2.6590895 (LAMB1), mRNA. Homo sapiens prostaglandin- endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 2584.1923 2.6488551 cyclooxygenase) (PTGS1), transcript variant 2, mRNA. Homo sapiens fibulin 2 (FBLN2), 6550762 NM_001998.2 FBLN2 5040.2081 2.6428735 transcript variant 2, mRNA. Homo sapiens bone morphogenetic 6980064 NM_001718.4 BMP6 277.98569 2.639034 protein 6 (BMP6), mRNA. Homo sapiens colony stimulating 4640048 NM_172212.1 CSF1 factor 1 (macrophage) (CSF1), 175.9059 2.6312735 transcript variant 4, mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1293.737 2.6268085 9, mRNA. Homo sapiens peptidylprolyl 70001 14 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 4470.1937 2.603371 mRNA. Homo sapiens collagen, type XVI, 5360743 NM_001856.3 COL16A1 3298.5431 2.5889026 alpha 1 (COL16A1), mRNA. Homo sapiens prokineticin 1 7550131 NM_032414.2 PROK1 158.18923 2.5474735 (PROK1), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 6280168 NM_001085.4 SERPINA3 3753.0189 2.5471047 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. Homo sapiens matrilin 3 (MATN3), 2320767 NM_002381.4 MATN3 1122.3127 2.5260306 mRNA. Homo sapiens podocan (PODN), 6480040 NM_153703.3 PODN 938.21 18 2.5035346 mRNA. Homo sapiens anthrax toxin receptor 2 10685 NM_058172.3 ANTXR2 5216.8513 2.4909708 (ANTXR2), mRNA. Homo sapiens decorin (DCN), 7650296 NM_133505.2 DCN 31632.622 2.4774646 transcript variant C, mRNA. Homo sapiens similar to hypothetical 770156 NM_203422.1 LOC221091 185.16018 2.4643291 protein (LOC221091), mRNA. Homo sapiens gonadotropin-releasing 5080017 NM_001501.1 GNRH2 hormone 2 (GNRH2), transcript 200.59749 2.4502984 variant 1, mRNA. Homo sapiens Sin3A-associated 1780673 NM_003864.3 SAP30 1427.142 2.437884 protein, 30kDa (SAP30), mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1060.825 2.4347049 mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 795.05649 2.4180949 (SRGAP1), mRNA. Homo sapiens MYC-associated zinc finger protein (purine-binding 4830689 NM_001042539.1 MAZ 669.85583 2.4128797 transcription factor) (MAZ), transcript variant 2, mRNA. Homo sapiens cysteine sulfinic acid 2810255 NM_015989.3 CSAD 807.52714 2.3925293 decarboxylase (CSAD), mRNA. Homo sapiens RAB40A, member RAS 4490241 NM_080879.2 RAB40A 141.96667 2.3902973 oncogene family (RAB40A), mRNA. Homo sapiens sarcoglycan, delta (35kDa dystrophin-associated 70088 NM_000337.4 SGCD 174.29263 2.3726923 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 510736 NM_004530.2 MMP2 1018.2142 2.3616088 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens engrailed homeobox 1 5820025 NM_001426.3 EN1 160.61003 2.3514614 (EN1), mRNA. Homo sapiens asparagine-linked glycosylation 5 homolog (S. 63701 13 NM_013338.3 ALG5 2225.0185 2.3458025 cerevisiae, dolichyl-phosphate beta- glucosyltransferase) (ALG5), mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2492.3701 2.3457747 1, mRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 IL1RL1 like 1 (ILIRLI), transcript variant 2, 224.69912 2.3196236 mRNA. Homo sapiens carboxypeptidase E 5390687 NM_001873.1 CPE 2065.1832 2.3075536 (CPE), mRNA. Homo sapiens collagen, type VI, alpha 24701 14 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 7731.2385 2.2899364 mRNA. Homo sapiens adipocyte-specific 5570682 NM_024769.2 ASAM 1425.3473 2.2747345 adhesion molecule (ASAM), mRNA. Homo sapiens procollagen-lysine, 2- 4640187 NM_000935.2 PLOD2 oxoglutarate 5-dioxygenase 2 2919.6888 2.2450939 (PLOD2), transcript variant 2, mRNA. Homo sapiens TIMP metallopeptidase 1090326 NM_003256.2 TIMP4 856.48776 2.2327947 inhibitor 4 (TIMP4), mRNA. Homo sapiens protein O- 290348 NM_015352.1 POFUT1 fucosyltransferase 1 (POFUT1), 4477.0171 2.2322299 transcript variant 1, mRNA. Homo sapiens fibulin 1 (FBLN1), 5050131 NM_006485.3 FBLN1 152.12434 2.2297929 transcript variant B, mRNA. Homo sapiens fibroblast growth factor receptor 1 (fms-related tyrosine kinase 6770128 NM_023106.2 FGFR1 248.76298 2.2288535 2, Pfeiffer syndrome) (FGFR1), transcript variant 4, mRNA. Homo sapiens myosin IIIB (MY03B), 2940450 NM_138995.1 MY03B 244.02522 2.2215476 mRNA. Homo sapiens lipoprotein lipase 5560674 NM_000237.2 LPL 182.54617 2.1959874 (LPL), mRNA. Homo sapiens cystatin C (CST3), 6450543 NM_000099.2 CST3 24616.781 2.1943587 mRNA. Homo sapiens CD164 molecule, 10142 NM_006016.3 CD164 385.01895 2.179835 sialomucin (CD164), mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 1927.294 2.1669671 mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 2540.8603 2.149121 1 mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 308.20841 2.1489951 variant 1, mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 5865.4063 2.1484021 mRNA. Homo sapiens vascular endothelial 5890288 NM_003377.3 VEGFB 944.03555 2.140403 growth factor B (VEGFB), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 1786.0841 2.1338854 aminopeptidase, CD13, pi 50) (ANPEP), mRNA. Homo sapiens matrix metallopeptidase 730372 NM_002429.4 MMP19 19 (MMP19), transcript variant 1, 191.21062 2.1314333 mRNA. Homo sapiens c-fos induced growth 4640672 NM_004469.2 FIGF factor (vascular endothelial growth 151.66136 2.127942 factor D) (FIGF), mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISP1 signaling pathway protein 1 (WISP1), 158.77375 2.1231355 transcript variant 2, mRNA. Homo sapiens vascular endothelial 5700201 NM_003377.3 VEGFB 195.28245 2.1064183 growth factor B (VEGFB), mRNA. Homo sapiens ATP-binding cassette, 4890609 NM_000033.2 ABCD1 sub-family D (ALD), member 1 368.0767 2.1006915 (ABCD1), mRNA. Homo sapiens glutathione peroxidase 7 4200543 NM_015696.3 GPX7 4078.8431 2.0986806 (GPX7), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 196.82861 2.0847558 2, mRNA. Homo sapiens lymphocyte antigen 6 3990561 NM_002347.2 LY6H 230.45265 2.0823128 complex, locus H (LY6H), mRNA. Homo sapiens fibulin 1 (FBLN1), 580739 NM_001996.2 FBLN1 4807.2606 2.0735869 transcript variant C, mRNA. Homo sapiens acyl-CoA synthetase 620577 NM_203379.1 ACSL5 long-chain family member 5 (ACSL5), 117.6809 2.0638646 transcript variant 2, mRNA. Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 121.66128 2.058995 mRNA. Homo sapiens G protein-coupled 6040736 NM_032777.6 GPR124 1344.8529 2.0401614 receptor 124 (GPR124), mRNA. Homo sapiens matrix metallopeptidase 7150551 NM_001032360.1 MMP19 19 (MMP19), transcript variant 2, 200.92419 2.032345 mRNA. Homo sapiens neuroblastoma, 7100010 NM_0053804 NBL1 suppression of tumorigenicity 1 5669.5187 2.0166928 (NBL1), transcript variant 2, mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 FLU) interacting protein 1 (LRRFIPl), 2526.9444 2.0121494 mRNA. Homo sapiens heterogeneous nuclear 2570358 NM_031372.1 HNRPDL ribonucleoprotein D-like (HNRPDL), 755.06844 2.0102774 transcript variant 2, mRNA.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims. WHAT IS CLAIMED IS:

1. A method of generating cutaneous adipocytes in a subject comprising administering to said subject a clonally pruified embryonic cutaneous adipocyte progenitor cells (ECAPC) positive for the expression of the gene EYA4 in a therapeutically acceptable carrier.

2. The method of claim 1, wherein said method is a method of treating a subject for a condition selected from: type 2 diabetes mellitus, dyslipidemia, cholesterol gallstones, hypertension, atherosclerosis, and hepatic steatosis, obesity, and combinations thereof.

3. The method of claim 2, wherein said method further comprises monitoring said subject for improved glucose metabolism, improved lipid metabolism, increased energy consumption, overall loss of body fat, and combinations thereof, after said adminsitering.

4. The method of claim 1, wherein wherein said ECAPC is cultured under adipocyte inducing conditions prior to said administering.

5. The method of claim 1, wherein the embryonic progenitor cell line is selected from: C4ELSR2, C4ELS5. 1, E l 11, E120, J16, and RAD20.5.

6. The method of claim 1, wherein the pharmaceutically acceptable carrier is selected from one or more of: Hextend; hyaluronan and polymers thereof; chondroitin sulfate; type I collagen; type II collagen; polyanhydride, polyorthoester, polyglycolic acid and copolymers thereof; alginate; agarose; polaxomers; fibrin; chitin; and chitosan.

7. A method of producing cutaneous adipocytes comprising culturing a clonally pruified embryonic cutaneous adipocyte progenitor cells (ECAPC) positive for the expression of the gene EYA4 in under adipocyte producing conditions.

8. The method of claim 7, wherein the ECAPC is selected from: C4ELSR2, C4ELS5. 1, E l 11, E l 20, 16, and RAD20.5.

9. The method of claim 7, wherein the adipocyte producing conditions is selected from one or more of: chondrocyte culture conditions; impregnating the embryonic progenitor cell line into synthetic matrices or biological resorbable immobilization vehicles; and placing the embryonic progenitor cell line into a molded structure. 10. The method of claim 7, wherein the cutaneous adipocytes produced by said ECAPC is transplanted to a subject.

11. A kit comprising a clonally pruified embryonic cutaneous adipocyte progenitor cell (ECAPC) positive for the expression of the gene EYA4 and reagents for inducing cutaneous adipocyte production from said cell line.

12. The kit of claim 11, wherein said embryonic progenitor cell line is selected from: C4ELSR2, C4ELS5.1, El 11, E120, J16, and RAD20.5.

13. A method of generating dopaminergic cells in a subject comprising administering to said subject an embryonic progenitor cell line positive for the expression of the genes: tyrosine hydroxylase, CRABP1 abd NTRK in a therapeutically acceptable carrier.

14. The method of claim 13, wherein the embryonic progenitor cell line is U31.

15. A method of producing dopaminergic cells comprising culturing a clonally-purified embryonic progenitor cell line positive for the expression of the genes: tyrosine hydroxylase, CRABP1 abd NTRK under cartilage producing conditions.

16. The method of claim 15, wherein the embryonic progenitor cell line is U31.

17. A method of generating smooth muscle cells in a subject comprising administering to said subject an embryonic progenitor cell line positive for the expression of the genes: HAND2 and SCARA5 in a therapeutically acceptable carrier.

18. The method of claim 17, wherein the embryonic progenitor cell line is W10.

19. A method of producing smooth muscle cells comprising culturing a clonally-purified embryonic progenitor cell line positive for the expression of the genes: HAND2 and SCARA5 under cartilage producing conditions.

20. The method of claim 19, wherein the embryonic progenitor cell line is W10.

21. A method of generating cells that are derivatives of intermediate mesoderm in a subject comprising administering to said subject an embryonic progenitor cell line positive for the expression of the genes: WT1 and NPNT in a therapeutically acceptable carrier. 22. The method of claim 21, wherein the embryonic progenitor cell line is RASM012.

23. A method of producing cells that are derivatives of intermediate mesoderm comprising culturing a clonally-purified embryonic progenitor cell line positive for the expression of the genes: WT1 and NPNT under cartilage producing conditions.

24. The method of claim 23, wherein the embryonic progenitor cell line is RASM012.

25. A method of incresing bone mass in a subject, said method comprising administering to said subject an embryonic progenitor cell line positive for the expression of one or more genes selected from: UGT2B17, UGT2B10, MASPl, Amelotin (AMTN), FOXQl.and HOXC6 in a therapeutically acceptable carrier.

26. The method of claim 25, wherein the embryonic progenitor cell line is Z2.

27. The method of claim 25, wherien the subject has a condition characterized by reduced bone mass.

28. The merhod of claim 27, wherein the condition characterized by reduced bone mass is osteoporosis or osteonecrosis.

29. The method of claim 25, wherein the embryonic progenitor cell line is cultured in the presence of EGF prior to said administration.

30. A method of producing isolated BMP2 and/or BMP7, the method comprising; culturing an embryonic progenitor cell line positive for the expression of one or more of the genes: UGT2B17, UGT2B10, MASPl, Amelotin (AMTN), FOXQl.and HOXC6, in the presence of EGF for a time sufficient to induce the expression BMP2 and/or BMP7 protein by said embryonic progenitor cell line; and isolating said BMP2 and/or BMP7 protein from said culture.

31. The method of claim 30, wherien said embryonic progenitor cell line is Z2.

32. The method of claim 30, wherein said BMP2 and/or BMP7 protein is isolated from the media of said culture.

33. The method of claim 30, wherein said culturing step is from 5 days to 30 days.