Packrat Parsing: Simple, Powerful, Lazy, Linear Time
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Design and Evaluation of an Auto-Memoization Processor
DESIGN AND EVALUATION OF AN AUTO-MEMOIZATION PROCESSOR Tomoaki TSUMURA Ikuma SUZUKI Yasuki IKEUCHI Nagoya Inst. of Tech. Toyohashi Univ. of Tech. Toyohashi Univ. of Tech. Gokiso, Showa, Nagoya, Japan 1-1 Hibarigaoka, Tempaku, 1-1 Hibarigaoka, Tempaku, [email protected] Toyohashi, Aichi, Japan Toyohashi, Aichi, Japan [email protected] [email protected] Hiroshi MATSUO Hiroshi NAKASHIMA Yasuhiko NAKASHIMA Nagoya Inst. of Tech. Academic Center for Grad. School of Info. Sci. Gokiso, Showa, Nagoya, Japan Computing and Media Studies Nara Inst. of Sci. and Tech. [email protected] Kyoto Univ. 8916-5 Takayama Yoshida, Sakyo, Kyoto, Japan Ikoma, Nara, Japan [email protected] [email protected] ABSTRACT for microprocessors, and it made microprocessors faster. But now, the interconnect delay is going major and the This paper describes the design and evaluation of main memory and other storage units are going relatively an auto-memoization processor. The major point of this slower. In near future, high clock rate cannot achieve good proposal is to detect the multilevel functions and loops microprocessor performance by itself. with no additional instructions controlled by the compiler. Speedup techniques based on ILP (Instruction-Level This general purpose processor detects the functions and Parallelism), such as superscalar or SIMD, have been loops, and memoizes them automatically and dynamically. counted on. However, the effect of these techniques has Hence, any load modules and binary programs can gain proved to be limited. One reason is that many programs speedup without recompilation or rewriting. have little distinct parallelism, and it is pretty difficult for We also propose a parallel execution by multiple compilers to come across latent parallelism. -
Parallel Backtracking with Answer Memoing for Independent And-Parallelism∗
Under consideration for publication in Theory and Practice of Logic Programming 1 Parallel Backtracking with Answer Memoing for Independent And-Parallelism∗ Pablo Chico de Guzman,´ 1 Amadeo Casas,2 Manuel Carro,1;3 and Manuel V. Hermenegildo1;3 1 School of Computer Science, Univ. Politecnica´ de Madrid, Spain. (e-mail: [email protected], fmcarro,[email protected]) 2 Samsung Research, USA. (e-mail: [email protected]) 3 IMDEA Software Institute, Spain. (e-mail: fmanuel.carro,[email protected]) Abstract Goal-level Independent and-parallelism (IAP) is exploited by scheduling for simultaneous execution two or more goals which will not interfere with each other at run time. This can be done safely even if such goals can produce multiple answers. The most successful IAP implementations to date have used recomputation of answers and sequentially ordered backtracking. While in principle simplifying the implementation, recomputation can be very inefficient if the granularity of the parallel goals is large enough and they produce several answers, while sequentially ordered backtracking limits parallelism. And, despite the expected simplification, the implementation of the classic schemes has proved to involve complex engineering, with the consequent difficulty for system maintenance and extension, while still frequently running into the well-known trapped goal and garbage slot problems. This work presents an alternative parallel backtracking model for IAP and its implementation. The model fea- tures parallel out-of-order (i.e., non-chronological) backtracking and relies on answer memoization to reuse and combine answers. We show that this approach can bring significant performance advantages. Also, it can bring some simplification to the important engineering task involved in implementing the backtracking mechanism of previous approaches. -
Derivatives of Parsing Expression Grammars
Derivatives of Parsing Expression Grammars Aaron Moss Cheriton School of Computer Science University of Waterloo Waterloo, Ontario, Canada [email protected] This paper introduces a new derivative parsing algorithm for recognition of parsing expression gram- mars. Derivative parsing is shown to have a polynomial worst-case time bound, an improvement on the exponential bound of the recursive descent algorithm. This work also introduces asymptotic analysis based on inputs with a constant bound on both grammar nesting depth and number of back- tracking choices; derivative and recursive descent parsing are shown to run in linear time and constant space on this useful class of inputs, with both the theoretical bounds and the reasonability of the in- put class validated empirically. This common-case constant memory usage of derivative parsing is an improvement on the linear space required by the packrat algorithm. 1 Introduction Parsing expression grammars (PEGs) are a parsing formalism introduced by Ford [6]. Any LR(k) lan- guage can be represented as a PEG [7], but there are some non-context-free languages that may also be represented as PEGs (e.g. anbncn [7]). Unlike context-free grammars (CFGs), PEGs are unambiguous, admitting no more than one parse tree for any grammar and input. PEGs are a formalization of recursive descent parsers allowing limited backtracking and infinite lookahead; a string in the language of a PEG can be recognized in exponential time and linear space using a recursive descent algorithm, or linear time and space using the memoized packrat algorithm [6]. PEGs are formally defined and these algo- rithms outlined in Section 3. -
Buffered Shift-Reduce Parsing*
BUFFERED SHIFT-REDUCE PARSING* Bing Swen (Sun Bin) Dept. of Computer Science, Peking University, Beijing 100871, China [email protected] Abstract A parsing method called buffered shift-reduce parsing is presented, which adds an intermediate buffer (queue) to the usual LR parser. The buffer’s usage is analogous to that of the wait-and-see parsing, but it has unlimited buffer length, and may serve as a separate reduction (pruning) stack. The general structure of its parser and some features of its grammars and parsing tables are discussed. 1. Introduction It is well known that the LR parsing is hitherto the most general shift-reduce method of bottom-up parsing [1], and is among the most widely used. For example, almost all compilers of mainstream programming languages employ the LR-like parsing (via an LALR(1) compiler generator such as YACC or GNU Bison [2]), and many NLP systems use a generalized version of LR parsing (GLR, also called the Tomita algorithm [3]). In some earlier research work on LR(k) extensions for NLP [4] and generalization of compiler generator [5], an idea naturally occurred that one can make a modification to the LR parsing so that after each reduction, the resulting symbol may not be necessarily pushed onto the analysis stack, but instead put back into the input, waiting for decisions in the following steps. This strategy postpones the time of some reduction actions in traditional LR parser, partly deviating from leftmost pruning (Leftmost Reduction). This may cause performance loss for some grammars, with the gained opportunities of earlier error detecting and avoidance of false reductions, as well as later handling of ambiguities, which is significant for the processing of highly ambiguous input strings like natural language sentences. -
A Typed, Algebraic Approach to Parsing
A Typed, Algebraic Approach to Parsing Neelakantan R. Krishnaswami Jeremy Yallop University of Cambridge University of Cambridge United Kingdom United Kingdom [email protected] [email protected] Abstract the subject have remained remarkably stable: context-free In this paper, we recall the definition of the context-free ex- languages are specified in BackusśNaur form, and parsers pressions (or µ-regular expressions), an algebraic presenta- for these specifications are implemented using algorithms tion of the context-free languages. Then, we define a core derived from automata theory. This integration of theory and type system for the context-free expressions which gives a practice has yielded many benefits: we have linear-time algo- compositional criterion for identifying those context-free ex- rithms for parsing unambiguous grammars efficiently [Knuth pressions which can be parsed unambiguously by predictive 1965; Lewis and Stearns 1968] and with excellent error re- algorithms in the style of recursive descent or LL(1). porting for bad input strings [Jeffery 2003]. Next, we show how these typed grammar expressions can However, in languages with good support for higher-order be used to derive a parser combinator library which both functions (such as ML, Haskell, and Scala) it is very popular guarantees linear-time parsing with no backtracking and to use parser combinators [Hutton 1992] instead. These li- single-token lookahead, and which respects the natural de- braries typically build backtracking recursive descent parsers notational semantics of context-free expressions. Finally, we by composing higher-order functions. This allows building show how to exploit the type information to write a staged up parsers with the ordinary abstraction features of the version of this library, which produces dramatic increases programming language (variables, data structures and func- in performance, even outperforming code generated by the tions), which is sufficiently beneficial that these libraries are standard parser generator tool ocamlyacc. -
Dynamic Programming Via Static Incrementalization 1 Introduction
Dynamic Programming via Static Incrementalization Yanhong A. Liu and Scott D. Stoller Abstract Dynamic programming is an imp ortant algorithm design technique. It is used for solving problems whose solutions involve recursively solving subproblems that share subsubproblems. While a straightforward recursive program solves common subsubproblems rep eatedly and of- ten takes exp onential time, a dynamic programming algorithm solves every subsubproblem just once, saves the result, reuses it when the subsubproblem is encountered again, and takes p oly- nomial time. This pap er describ es a systematic metho d for transforming programs written as straightforward recursions into programs that use dynamic programming. The metho d extends the original program to cache all p ossibly computed values, incrementalizes the extended pro- gram with resp ect to an input increment to use and maintain all cached results, prunes out cached results that are not used in the incremental computation, and uses the resulting in- cremental program to form an optimized new program. Incrementalization statically exploits semantics of b oth control structures and data structures and maintains as invariants equalities characterizing cached results. The principle underlying incrementalization is general for achiev- ing drastic program sp eedups. Compared with previous metho ds that p erform memoization or tabulation, the metho d based on incrementalization is more powerful and systematic. It has b een implemented and applied to numerous problems and succeeded on all of them. 1 Intro duction Dynamic programming is an imp ortant technique for designing ecient algorithms [2, 44 , 13 ]. It is used for problems whose solutions involve recursively solving subproblems that overlap. -
Efficient Computation of LALR(1) Look-Ahead Sets
Efficient Computation of LALR(1) Look-Ahead Sets FRANK DeREMER and THOMAS PENNELLO University of California, Santa Cruz, and MetaWare TM Incorporated Two relations that capture the essential structure of the problem of computing LALR(1) look-ahead sets are defined, and an efficient algorithm is presented to compute the sets in time linear in the size of the relations. In particular, for a PASCAL grammar, the algorithm performs fewer than 15 percent of the set unions performed by the popular compiler-compiler YACC. When a grammar is not LALR(1), the relations, represented explicitly, provide for printing user- oriented error messages that specifically indicate how the look-ahead problem arose. In addition, certain loops in the digraphs induced by these relations indicate that the grammar is not LR(k) for any k. Finally, an oft-discovered and used but incorrect look-ahead set algorithm is similarly based on two other relations defined for the fwst time here. The formal presentation of this algorithm should help prevent its rediscovery. Categories and Subject Descriptors: D.3.1 [Programming Languages]: Formal Definitions and Theory--syntax; D.3.4 [Programming Languages]: Processors--translator writing systems and compiler generators; F.4.2 [Mathematical Logic and Formal Languages]: Grammars and Other Rewriting Systems--parsing General Terms: Algorithms, Languages, Theory Additional Key Words and Phrases: Context-free grammar, Backus-Naur form, strongly connected component, LALR(1), LR(k), grammar debugging, 1. INTRODUCTION Since the invention of LALR(1) grammars by DeRemer [9], LALR grammar analysis and parsing techniques have been popular as a component of translator writing systems and compiler-compilers. -
A Declarative Extension of Parsing Expression Grammars for Recognizing Most Programming Languages
Journal of Information Processing Vol.24 No.2 256–264 (Mar. 2016) [DOI: 10.2197/ipsjjip.24.256] Regular Paper A Declarative Extension of Parsing Expression Grammars for Recognizing Most Programming Languages Tetsuro Matsumura1,†1 Kimio Kuramitsu1,a) Received: May 18, 2015, Accepted: November 5, 2015 Abstract: Parsing Expression Grammars are a popular foundation for describing syntax. Unfortunately, several syn- tax of programming languages are still hard to recognize with pure PEGs. Notorious cases appears: typedef-defined names in C/C++, indentation-based code layout in Python, and HERE document in many scripting languages. To recognize such PEG-hard syntax, we have addressed a declarative extension to PEGs. The “declarative” extension means no programmed semantic actions, which are traditionally used to realize the extended parsing behavior. Nez is our extended PEG language, including symbol tables and conditional parsing. This paper demonstrates that the use of Nez Extensions can realize many practical programming languages, such as C, C#, Ruby, and Python, which involve PEG-hard syntax. Keywords: parsing expression grammars, semantic actions, context-sensitive syntax, and case studies on program- ming languages invalidate the declarative property of PEGs, thus resulting in re- 1. Introduction duced reusability of grammars. As a result, many developers need Parsing Expression Grammars [5], or PEGs, are a popu- to redevelop grammars for their software engineering tools. lar foundation for describing programming language syntax [6], In this paper, we propose a declarative extension of PEGs for [15]. Indeed, the formalism of PEGs has many desirable prop- recognizing context-sensitive syntax. The “declarative” exten- erties, including deterministic behaviors, unlimited look-aheads, sion means no arbitrary semantic actions that are written in a gen- and integrated lexical analysis known as scanner-less parsing. -
Backtrack Parsing Context-Free Grammar Context-Free Grammar
Context-free Grammar Problems with Regular Context-free Grammar Language and Is English a regular language? Bad question! We do not even know what English is! Two eggs and bacon make(s) a big breakfast Backtrack Parsing Can you slide me the salt? He didn't ought to do that But—No! Martin Kay I put the wine you brought in the fridge I put the wine you brought for Sandy in the fridge Should we bring the wine you put in the fridge out Stanford University now? and University of the Saarland You said you thought nobody had the right to claim that they were above the law Martin Kay Context-free Grammar 1 Martin Kay Context-free Grammar 2 Problems with Regular Problems with Regular Language Language You said you thought nobody had the right to claim [You said you thought [nobody had the right [to claim that they were above the law that [they were above the law]]]] Martin Kay Context-free Grammar 3 Martin Kay Context-free Grammar 4 Problems with Regular Context-free Grammar Language Nonterminal symbols ~ grammatical categories Is English mophology a regular language? Bad question! We do not even know what English Terminal Symbols ~ words morphology is! They sell collectables of all sorts Productions ~ (unordered) (rewriting) rules This concerns unredecontaminatability Distinguished Symbol This really is an untiable knot. But—Probably! (Not sure about Swahili, though) Not all that important • Terminals and nonterminals are disjoint • Distinguished symbol Martin Kay Context-free Grammar 5 Martin Kay Context-free Grammar 6 Context-free Grammar Context-free -
Adaptive LL(*) Parsing: the Power of Dynamic Analysis
Adaptive LL(*) Parsing: The Power of Dynamic Analysis Terence Parr Sam Harwell Kathleen Fisher University of San Francisco University of Texas at Austin Tufts University [email protected] [email protected] kfi[email protected] Abstract PEGs are unambiguous by definition but have a quirk where Despite the advances made by modern parsing strategies such rule A ! a j ab (meaning “A matches either a or ab”) can never as PEG, LL(*), GLR, and GLL, parsing is not a solved prob- match ab since PEGs choose the first alternative that matches lem. Existing approaches suffer from a number of weaknesses, a prefix of the remaining input. Nested backtracking makes de- including difficulties supporting side-effecting embedded ac- bugging PEGs difficult. tions, slow and/or unpredictable performance, and counter- Second, side-effecting programmer-supplied actions (muta- intuitive matching strategies. This paper introduces the ALL(*) tors) like print statements should be avoided in any strategy that parsing strategy that combines the simplicity, efficiency, and continuously speculates (PEG) or supports multiple interpreta- predictability of conventional top-down LL(k) parsers with the tions of the input (GLL and GLR) because such actions may power of a GLR-like mechanism to make parsing decisions. never really take place [17]. (Though DParser [24] supports The critical innovation is to move grammar analysis to parse- “final” actions when the programmer is certain a reduction is time, which lets ALL(*) handle any non-left-recursive context- part of an unambiguous final parse.) Without side effects, ac- free grammar. ALL(*) is O(n4) in theory but consistently per- tions must buffer data for all interpretations in immutable data forms linearly on grammars used in practice, outperforming structures or provide undo actions. -
Disambiguation Filters for Scannerless Generalized LR Parsers
Disambiguation Filters for Scannerless Generalized LR Parsers Mark G. J. van den Brand1,4, Jeroen Scheerder2, Jurgen J. Vinju1, and Eelco Visser3 1 Centrum voor Wiskunde en Informatica (CWI) Kruislaan 413, 1098 SJ Amsterdam, The Netherlands {Mark.van.den.Brand,Jurgen.Vinju}@cwi.nl 2 Department of Philosophy, Utrecht University Heidelberglaan 8, 3584 CS Utrecht, The Netherlands [email protected] 3 Institute of Information and Computing Sciences, Utrecht University P.O. Box 80089, 3508TB Utrecht, The Netherlands [email protected] 4 LORIA-INRIA 615 rue du Jardin Botanique, BP 101, F-54602 Villers-l`es-Nancy Cedex, France Abstract. In this paper we present the fusion of generalized LR pars- ing and scannerless parsing. This combination supports syntax defini- tions in which all aspects (lexical and context-free) of the syntax of a language are defined explicitly in one formalism. Furthermore, there are no restrictions on the class of grammars, thus allowing a natural syntax tree structure. Ambiguities that arise through the use of unrestricted grammars are handled by explicit disambiguation constructs, instead of implicit defaults that are taken by traditional scanner and parser gener- ators. Hence, a syntax definition becomes a full declarative description of a language. Scannerless generalized LR parsing is a viable technique that has been applied in various industrial and academic projects. 1 Introduction Since the introduction of efficient deterministic parsing techniques, parsing is considered a closed topic for research, both by computer scientists and by practi- cioners in compiler construction. Tools based on deterministic parsing algorithms such as LEX & YACC [15,11] (LALR) and JavaCC (recursive descent), are con- sidered adequate for dealing with almost all modern (programming) languages. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.