DOCSLIB.ORG

THE BLOOD GROUP ANTIGEN Factsbook Marion-Fm.Qxd 7/3/03 7:16 PM Page II

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
THE BLOOD GROUP ANTIGEN Factsbook Marion-Fm.Qxd 7/3/03 7:16 PM Page II Marion-fm.qxd 7/3/03 7:16 PM Page I THE BLOOD GROUP ANTIGEN FactsBook Marion-fm.qxd 7/3/03 7:16 PM Page II Other titles in the FactsBook series include: Marie-Paule Lefranc and Gérard Lefranc The Immunoglobulin FactsBook Hans G. Drexler The Leukemia-Lymphoma Cell Line FactsBook Katherine A. Fitzgerald, Luke A.J. O’Neill, Andy J.H. Gearing, Robin E. Callard The Cytokine FactsBook, 2nd edition Marie-Paule Lefranc and Gérard Lefranc The T Cell Receptor FactsBook Vincent Laudet and Hinrich Gronemeyer The Nuclear Receptor FactsBook A. Neil Barclay, Marion H. Brown, S.K. Alex Law, Andrew J. McKnight, Michael G. Tomlinson, P. Anton van der Merwe The Leukocyte Antigen FactsBook, 2nd edition Clare M. Isacke and Michael A. Horton The Adhesion Molecule FactsBook, 2nd edition Kris Vaddi, Margaret Keller and Robert Newton The Chemokine FactsBook Edward C. Conley The Ion Channel FactsBook I: Extracellular Ligand Gated Channels Edward C. Conley The Ion Channel FactsBook II: Intracellular Ligand Gated Channels Edward C. Conley and William J. Brammar The Ion Channel FactsBook IV: Voltage Gated Channels Steven G.E. Marsh, Peter Parham and Linda Barber The HLA FactsBook See http://www.elsevier-international.com/catalogue/titlesearch.cfm for more details Marion-fm.qxd 7/3/03 7:16 PM Page III THE BLOOD GROUP ANTIGEN FactsBook Marion E. Reid Christine Lomas-Francis Immunohematology Laboratory New York Blood Center, New York Amsterdam Boston Heidelberg London New York Oxford Paris San Diego San Francisco Singapore Sydney Tokyo Marion-fm.qxd 7/3/03 7:16 PM Page IV This book is printed on acid-free paper Copyright 2004, Elsevier Ltd. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Academic Press An Imprint of Elsevier 84 Theobald’s Road, London WC1X 8RR, UK http://www.academicpress.com Academic Press An Imprint of Elsevier 525 B Street, Suite 1900 San Diego, California 92101-4495, USA http://www.academicpress.com ISBN 0–12–586585–6 Library of Congress Catalog Number: 2003102995 A catalogue record for this book is available from the British Library Typeset by Newgen Imaging Systems (P) Ltd, Chennai, India Printed and bound in Great Britain by Biddles Ltd, Guildford and Kings Lynn 0304050607987654321 Marion-fm.qxd 7/3/03 7:16 PM Page V Contents Preface x Abbreviations xi Section I THE INTRODUCTORY CHAPTERS Chapter 1 Introduction 3 Chapter 2 Organization of the Data 7 Section II THE BLOOD GROUP SYSTEMS AND ANTIGENS ABO Blood Group System 19 Mit antigen 73 A antigen 23 Dantu antigen 75 B antigen 25 Hop antigen 76 A1 antigen 26 Nob antigen 78 Ena antigen 80 MNS Blood Group System 29 ENKT antigen 81 M antigen 34 ‘N’ antigen 83 N antigen 36 Or antigen 84 S antigen 38 DANE antigen 85 s antigen 40 TSEN antigen 87 U antigen 41 MINY antigen 89 He antigen 43 MUT antigen 91 Mia antigen 46 SAT antigen 92 Mc antigen 48 ERIK antigen 94 Vw antigen 49 Osa antigen 96 Mur antigen 51 ENEP antigen 97 Mg antigen 53 ENEH antigen 98 Vr antigen 55 HAG antigen 100 Me antigen 57 ENAV antigen 101 Mta antigen 58 MARS antigen 102 Sta antigen 59 Ria antigen 62 P Blood Group System 105 Cla antigen 63 P1 antigen 106 Nya antigen 64 Hut antigen 65 Rh Blood Group System 109 Hil antigen 67 D antigen 121 Mv antigen 69 C antigen 131 Far antigen 71 E antigen 133 sD antigen 72 c antigen 135 V Marion-fm.qxd 7/4/03 6:42 PM Page VI Contents e antigen 137 Lu4 antigen 202 f antigen 139 Lu5 antigen 203 Ce antigen 140 Lu6 antigen 204 CW antigen 141 Lu7 antigen 206 CX antigen 143 Lu8 antigen 207 V antigen 144 Lu9 antigen 209 EW antigen 146 Lu11 antigen 210 G antigen 147 Lu12 antigen 212 Hr0 antigen 148 Lu13 antigen 213 Hr antigen 150 Lu14 antigen 214 hrS antigen 151 Lu16 antigen 216 VS antigen 152 Lu17 antigen 217 CG antigen 154 Aua antigen 218 CE antigen 154 Aub antigen 220 DW antigen 155 Lu20 antigen 221 Rh26 (c-like) antigen 157 Lu21 antigen 223 cE antigen 158 Kell Blood Group System 225 hrH antigen 159 K antigen 231 Rh29 antigen 160 a k antigen 233 Go antigen 161 a B Kp antigen 234 hr antigen 162 b Rh32 antigen 164 Kp antigen 236 Ku antigen 238 Rh33 antigen 166 a B Js antigen 239 Hr antigen 167 b Rh35 antigen 168 Js antigen 241 Ula Bea antigen 170 antigen 242 Evans antigen 171 K11 antigen 244 Rh39 antigen 172 K12 antigen 245 Tar antigen 173 K13 antigen 246 Rh41 antigen 175 K14 antigen 248 Rh42 antigen 175 K16 antigen 249 Crawford antigen 176 K17 antigen 249 Nou antigen 177 K18 antigen 251 Riv antigen 178 K19 antigen 252 Km antigen 253 Sec antigen 179 c Dav antigen 180 Kp antigen 255 JAL antigen 181 K22 antigen 256 STEM antigen 182 K23 antigen 258 FPTT antigen 183 K24 antigen 259 MAR antigen 185 VLAN antigen 260 BARC antigen 187 TOU antigen 261 JAHK antigen 188 RAZ antigen 263 DAK antigen 190 Lewis Blood Group System 265 LOCR antigen 191 Lea antigen 269 Leb antigen 270 Lutheran Blood Group System 193 Leab antigen 272 Lua antigen 197 LebH antigen 273 Lub antigen 199 ALeb antigen 274 Lu3 antigen 200 BLeb antigen 276 VI Marion-fm.qxd 7/3/03 7:16 PM Page VII Contents Duffy Blood Group System 278 Dombrock Blood Group System 353 Fya antigen 281 Doa antigen 356 Fyb antigen 283 Dob antigen 357 Fy3 antigen 284 Gya antigen 359 Fy4 antigen 286 Hy antigen 360 Fy5 antigen 286 Joa antigen 362 Fy6 antigen 288 Colton Blood Group System 364 Kidd Blood Group System 290 Coa antigen 367 a Jk antigen 293 Cob antigen 368 b Jk antigen 294 Co3 antigen 369 Jk3 antigen 296 Landsteiner–Wiener Blood Group Diego Blood Group System 298 System 372 Dia antigen 302 LWa antigen 375 Dib antigen 303 LWab antigen 377 Wra antigen 305 LWb antigen 378 Wrb antigen 306 Wda antigen 308 Rba antigen 310 Chido/Rodgers Blood Group WARR antigen 311 System 381 ELO antigen 312 Ch1 antigen 384 Wu antigen 314 Ch2 antigen 385 Bpa antigen 315 Ch3 antigen 386 Moa antigen 316 Ch4 antigen 386 Hga antigen 318 Ch5 antigen 387 Vga antigen 319 Ch6 antigen 387 Swa antigen 321 WH antigen 388 BOW antigen 322 Rg1 antigen 389 NFLD antigen 323 Rg2 antigen 390 Jna antigen 325 KREP antigen 326 Hh Blood Group System 391 Tra antigen 328 H antigen 395 Fra antigen 329 SW1 antigen 330 Xk Blood Group System 398 Kx antigen 401 Yt Blood Group System 332 Yta antigen 334 Gerbich Blood Group System 403 Ytb antigen 336 Ge2 antigen 406 Ge3 antigen 408 Xg Blood Group System 338 Ge4 antigen 410 Xga antigen 341 Wb antigen 412 a CD99 antigen 343 Ls antigen 413 Ana antigen 415 a Scianna Blood Group System 344 Dh antigen 417 Sc1 antigen 347 Sc2 antigen 348 Cromer Blood Group System 419 a Sc3 antigen 349 Cr antigen 422 a Sc4 antigen 351 Tc antigen 424 VII Marion-fm.qxd 7/3/03 7:16 PM Page VIII Contents Tcb antigen 425 Cost Blood Group Collection 483 Tcc antigen 427 Csa antigen 483 Dra antigen 428 Csb antigen 485 Esa antigen 430 IFC antigen 431 Ii Blood Group Collection 486 WESa antigen 433 i antigen 487 WESb antigen 434 UMC antigen 436 Er Blood Group Collection 489 GUTI antigen 437 Era antigen 489 Erb antigen 490 Knops Blood Group System 439 Kna antigen 443 Globoside Blood Group Knb antigen 445 Collection 492 McCa antigen 446 Pk antigen 495 Sla antigen 448 LKE antigen 497 Yka antigen 449 McCb antigen 451 Unnamed Blood Group Vil antigen 452 Collection 499 Sl3 antigen 453 Lec antigen 499 Led antigen 500 Indian Blood Group System 455 Ina antigen 458 The 700 Series of Low Incidence Inb antigen 459 Antigens 501 OK Blood Group System 461 The 901 Series of High Incidence Oka antigen 463 Antigens 503 Vel antigen 503 RAPH Blood Group System 465 Lan antigen 505 MER2 antigen 465 Ata antigen 506 Jra antigen 507 JMH Blood Group System 467 Emm antigen 508 JMH antigen 469 AnWj antigen 509 Sda antigen 511 I Blood Group System 471 Duclos antigen 513 I antigen 473 PEL antigen 514 ABTI antigen 515 Globoside Blood Group System 475 MAM antigen 516 P antigen 477 GIL Blood Group System 479 GIL antigen 481 VIII Marion-fm.qxd 7/3/03 7:16 PM Page IX Contents Section III OTHER USEFUL FACTS Antigen-based Facts 521 Autoantibody-based and Drug Facts 530 Clinically Useful Information 535 Blood Group System and Protein-based Facts 541 Lectins and Polyagglutination Information 545 Gene-based Facts 548 Useful Definitions 551 Index 552 IX Marion-fm.qxd 7/3/03 7:16 PM Page X Preface We thank Gail Coghlan, Laura Cooling, George Garratty, Carole Green, Peter Howell, Marilyn Moulds, Cyril Levene, Martin Olsson, Ragnhild Øyen, Joyce Poole, Jill Storry, Yoshihiko Tani, Marilyn Telen and Mikoto Uchikawa for providing information. We appreciate the help from Tessa Picknett and Mukesh V.S. Last but not least, we are indebted to Robert Ratner for his skill and patience in preparing the manuscript and figures. Without his help, this project would not have been possible. In compiling the entries for this text, we were again impressed at the rapid pace with which new information became available.
Load more

Recommended publications
  • Other Blood Group Systems—Diego,Yt, Xg, Scianna, Dombrock
    Review: other blood group systems—Diego, Yt, Xg, Scianna, Dombrock, Colton, Landsteiner- Wiener, and Indian K.M. B YRNE AND P.C. B YRNE Introduction Diego Blood Group System This review was prepared to provide a basic The Diego blood group system (ISBT: DI/010) has overview of “Other Blood Groups.” Some of the more expanded from its humble beginnings to now include major blood group systems, i.e., ABO, Rh, Kell, Duffy, up to 21 discrete antigens (Table 1). 3 Band 3, an anion and Kidd, are also reviewed in this issue and are not exchange, multi-pass membrane glycoprotein, is the covered here. The sheer mass of data on the MNS basic structure that carries the Diego system antigenic blood group system is so extensive and complicated determinants. 4 The gene that encodes the Band 3 that it justifies a review all of its own, and it is therefore protein is named SLC4A1 and its chromosomal location not discussed in this article. However, various aspects is 17q12–q21. 4 of MNS were described in recent papers in Di a and Di b are antithetical, resulting from a single Immunohematology. 1,2 nucleotide substitution (2561T>C) that gives rise to The blood group systems that are covered are those amino acid changes in the Band 3 protein (Leu854Pro). that most workers believe to have some degree of To date, the Di(a–b–) phenotype has not been clinical importance or interesting features: Diego (DI), described. The Di a and Di b antigens are resistant to Yt (YT), Xg (XG), Scianna (SC), Dombrock (DO), Colton treatment with the following enzymes/chemicals: (CO), Landsteiner-Wiener (LW), and Indian (IN).
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • The Membrane Complement Regulatory Protein CD59 and Its Association with Rheumatoid Arthritis and Systemic Lupus Erythematosus
    Current Medicine Research and Practice 9 (2019) 182e188 Contents lists available at ScienceDirect Current Medicine Research and Practice journal homepage: www.elsevier.com/locate/cmrp Review Article The membrane complement regulatory protein CD59 and its association with rheumatoid arthritis and systemic lupus erythematosus * Nibhriti Das a, Devyani Anand a, Bintili Biswas b, Deepa Kumari c, Monika Gandhi c, a Department of Biochemistry, All India Institute of Medical Sciences, New Delhi 110029, India b Department of Zoology, Ramjas College, University of Delhi, India c University School of Biotechnology, Guru Gobind Singh Indraprastha University, India article info abstract Article history: The complement cascade consisting of about 50 soluble and cell surface proteins is activated in auto- Received 8 May 2019 immune inflammatory disorders. This contributes to the pathological manifestations in these diseases. In Accepted 30 July 2019 normal health, the soluble and membrane complement regulatory proteins protect the host against Available online 5 August 2019 complement-mediated self-tissue injury by controlling the extent of complement activation within the desired limits for the host's benefit. CD59 is a membrane complement regulatory protein that inhibits the Keywords: formation of the terminal complement complex or membrane attack complex (C5b6789n) which is CD59 generated on complement activation by any of the three pathways, namely, the classical, alternative, and RA SLE the mannose-binding lectin pathway. Animal experiments and human studies have suggested impor- Pathophysiology tance of membrane complement proteins including CD59 in the pathophysiology of rheumatoid arthritis Disease marker (RA) and systemic lupus erythematosus (SLE). Here is a brief review on CD59 and its distribution, structure, functions, and association with RA and SLE starting with a brief introduction on the com- plement system, its activation, the biological functions, and relations of membrane complement regu- latory proteins, especially CD59, with RA and SLE.
    [Show full text]
  • This Dissolution Has Bean Microfilmed Exactly As Received Mic 60-4060
    This dissolution has bean microfilmed exactly as received Mic 60-4060 BAER, Harry L ionet THE ASSOCIATION BETWEEN CERTAIN EXTRACELLULAR FACTORS OF ERYTHROCYTES AND SEVERAL MEASURABLE PERFORMANCE TRAITS IN DAIRY CATTLE. The Ohio State University, Ph. D ., 1960 Biology - Genetics University Microfilms, Inc., Ann Arbor, Michigan TIE ASSOCIATION BETWEEN CERTAIN EXTRACELLULAR FACTORS OF ERYTHROCYTES AND SEVERAL MEASURABLE PERFORMANCE TRAITS IN DAIRY CATTLE DISSERTATION Presented. In Partial Fulfillment of the Requirements for the Degree Dootor of Philosophy in the Graduate Sohool of The Ohio State University By HARRY LIONEL BARR, B. S. in A gr., M. Sc. ###### The Ohio S ta te U n iv ersity 1960 Approved by Soienoe ACKN0W1EDC3£BNT It would bo very difficult to mention each person who has con­ tributed in some way to the completion of this study. Therefore. I w ill mention the few without whose help the work would have been severely handioapped. I wish to express my appreciation to my adviser. Dr. Thomas Ludwiok for first stimulating my interest in graduate study, and then for supplying me with the aoademio and personal guidance with whioh to carry it through. I would likB to extend my thanks to Dr. Fordyce Ely, Chairman of the Department of Dairy Science, for permitting me the opportunity of pursuing graduate study while serving as a member of his Btaff. My thanks also to the personnel of the NC-2 Breeding Project for making available their store of data, and speoial thanks to Don Richardson and Dr. Herman Riokard who were instrumental in the planning of this study* To Dr.
    [Show full text]
  • Mcleod Neuroacanthocytosis Syndrome
    NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health. Pagon RA, Adam MP, Ardinger HH, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993- 2017. McLeod Neuroacanthocytosis Syndrome Hans H Jung, MD Department of Neurology University Hospital Zurich Zurich, Switzerland [email protected] Adrian Danek, MD Neurologische Klinik Ludwig-Maximilians-Universität München, Germany ed.uml@kenad Ruth H Walker, MD, MBBS, PhD Department of Neurology Veterans Affairs Medical Center Bronx, New York [email protected] Beat M Frey, MD Blood Transfusion Service Swiss Red Cross Schlieren/Zürich, Switzerland [email protected] Christoph Gassner, PhD Blood Transfusion Service Swiss Red Cross Schlieren/Zürich, Switzerland [email protected] Initial Posting: December 3, 2004; Last Update: May 17, 2012. Summary Clinical characteristics. McLeod neuroacanthocytosis syndrome (designated as MLS throughout this review) is a multisystem disorder with central nervous system (CNS), neuromuscular, and hematologic manifestations in males. CNS manifestations are a neurodegenerative basal ganglia disease including (1) movement disorders, (2) cognitive alterations, and (3) psychiatric symptoms. Neuromuscular manifestations include a (mostly subclinical) sensorimotor axonopathy and muscle weakness or atrophy of different degrees. Hematologically, MLS is defined as a specific blood group phenotype (named after the first proband, Hugh McLeod) that results from absent expression of the Kx erythrocyte antigen and weakened expression of Kell blood group antigens. The hematologic manifestations are red blood cell acanthocytosis and compensated hemolysis. Allo-antibodies in the Kell and Kx blood group system can cause strong reactions to transfusions of incompatible blood and severe anemia in newborns of Kell-negative mothers.
    [Show full text]
  • Biological and Clinical Aspects of ABO Blood Group System
    174 REVIEW Biological and clinical aspects of ABO blood group system Eiji Hosoi Department of Cells and Immunity Analytics, Institute of Health Biosciences, the University of Tokushima Graduate School, Tokushima, Japan Abstract : The ABO blood group was discovered in 1900 by Austrian scientist, Karl Land- steiner. At present, the International Society of Blood Transfusion (ISBT) approves as 29 human blood group systems. The ABO blood group system consists of four antigens (A, B, O and AB). These antigens are known as oligosaccharide antigens, and widely ex- pressed on the membranes of red cell and tissue cells as well as, in the saliva and body fluid. The ABO blood group antigens are one of the most important issues in transfusion medicine to evaluate the adaptability of donor blood cells with bone marrow transplan- tations, and lifespan of the hemocytes. This article reviews the serology, biochemistry and genetic characteristics, and clini- cal application of ABO antigens. J. Med. Invest. 55 : 174-182, August, 2008 Keywords : ABO blood group, glycosyltransferase, ABO allele, cisAB allele, PASA : PCR amplification of spe- cific alleles INTRODUCTION The genes of ABO blood group has been deter- mined at chromosome locus 9 (6-9), and Yamamoto, The ABO blood group system was discovered by et al. cloned and determined the structures. It has Austrian scientist, Karl Landsteiner, who found made it possible to analyze genetically ABO blood three different blood types (A, B and O) in 1900 group antigens using molecular biology techniques from serological differences in blood called the Land- (7, 10 - 18). steiner Law (1). In 1902, DesCasterllo and Sturli dis- covered the fourth type, AB (2).
    [Show full text]
  • Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS
    Journal of Blood Group Serology and Molecular Genetics VOLUME 34, N UMBER 1, 2018 This issue of Immunohematology is supported by a contribution from Grifols Diagnostics Solutions, Inc. Dedicated to advancement and education in molecular and serologic immunohematology Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS S EROLOGIC M ETHOD R EVIEW 1 Warm autoadsorption using ZZAP F.M. Tsimba-Chitsva, A. Caballero, and B. Svatora R EVIEW 4 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai A brief overview of clinical significance of blood group antibodies M.J. Gandhi, D.M. Strong, B.I. Whitaker, and E. Petrisli C A S E R EPORT 7 Management of pregnancy sensitized with anti-Inb with monocyte monolayer assay and maternal blood donation R. Shree, K.K. Ma, L.S. Er and M. Delaney R EVIEW 11 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai A review of in vitro methods to predict the clinical significance of red blood cell alloantibodies S.J. Nance S EROLOGIC M ETHOD R EVIEW 16 Recovery of autologous sickle cells by hypotonic wash E. Wilson, K. Kezeor, and M. Crosby TO THE E DITOR 19 The devil is in the details: retention of recipient group A type 5 years after a successful allogeneic bone marrow transplant from a group O donor L.L.W.
    [Show full text]
  • Bombay Blood Group
    Bombay blood group April 15, 2020 Why in news? Recently there has been a spike in demand for a rare blood type called Bombay blood group. About the Bombay blood Group: Blood types are divided into four common blood groups under ABO’s blood group scheme, i.e. A, B, O, AB. Each red blood cell has a surface antigen that helps to determine which group it belongs to. Depending upon a person’s ABO blood type, the H antigen is converted into either the A antigen, B antigen, or both. If a person has group O blood, the H antigen remains unmodified. Therefore, the H antigen is present more in blood type O and less in blood type AB. In the Bombay blood group, individuals have inherited two recessive alleles of the H gene (i.e. their genotype is hh). This means that there is no antigen H in the RBC of the hh blood group. Dr Y M Bhendefirst discovered the rare Bombay blood group in 1952 in Mumbai (then in Bombay). The occurrence of the hh blood type is one in four million worldwide. Nevertheless, because of inbreeding and close marriage between groups, the blood type is more prevalent in South Asia than anywhere else. In India, between 7,600 and 10,000 people are born of this kind. Because of the rare hh blood type, patients experience blood transfusion problems, which often lead to death. Individuals with the blood group of Bombay can only transfuse blood from people with a very unusual Bombay hh phenotype. This is not usually stored in blood banks, particularly because it is rare and blood shelf-life is 35-42 days.
    [Show full text]
  • Genes and Human History
    Genes and human history Gil McVean, Department of Statistics, Oxford Contact: [email protected] 2 3 • Where does the variation come from? • How old are the genetic differences between us? • Are these differences important? How different are our genomes? 5 Serological techniques for detecting variation Rabbit Anti-A antibodies Human A A B AB O 6 Blood group systems in humans • 28 known systems – 39 genes, 643 alleles System Genes Alleles Knops CR1 24+ ABO ABO 102 Landsteiner- ICAM4 3 Wiener Colton C4A, C4B 7+ Lewis FUT3, FUT6 14/20 Chido-rodgers AQP1 7 Lutheran LU 16 Colton DAF 10 MNS GYPA,GYPB,G 43 Diego SLC4A1 78 YPE Dombrock DO 9 OK BSG 2 Duffy FY 9 P-related A4GALT, 14/5 Gerbich GYPC 9 B3GALT3 GIL AQP3 2 RAPH-MER2 CD151 3 H/h FUT1, FUT2 27/22 Rh RHCE, RHD, 129 I GCNT2 7 RHAG Indian CD44 2 Scianna ERMAP 4 Kell KEL, XK 33/30 Xg XG, CD99 - Kidd SLC14A1 8 YT ACHE 4 http://www.bioc.aecom.yu.edu/bgmut/summary.htm 7 Protein electroporesis • Changes in mass/charge ratio resulting from amino acid substitutions in proteins can be detected Starch or agar gel -- +- + +- - - - -- - + - + +- -- Direction of travel • In humans, about 30% of all loci show polymorphism with a 6% chance of a pair of randomly drawn alleles at a locus being different Lewontin and Hubby (1966) Harris(1966) 8 The rise of DNA sequencing GATAAGACGGTGATACTCACGCGACGGGCTTGGGCGCCGACTCGTTCAGACGGTGACCCAACTTATCCGATCGACCC CGGGTCCCGATTTAGACTCGGTATCATTTCTGGTGATTATCGCCTGCAGGTTCAAGAACACGTTTGCAGCAAGAAGT GAGGGATTTTGTCAGTGATCCCAGTCTACGGAGCCAGTCACCTCTGGTAGTGAAATTTTATTCGTTCATCTTCATAT AAGTCGCAGACCGCACGATGGGGGACAGAATACTCGCACAGGAAGAACCGCGATGAACCGAGGTAACCTAACATCCT
    [Show full text]
  • Blood Bank I D
    The Osler Institute Blood Bank I D. Joe Chaffin, MD Bonfils Blood Center, Denver, CO The Fun Just Never Ends… A. Blood Bank I • Blood Groups B. Blood Bank II • Blood Donation and Autologous Blood • Pretransfusion Testing C. Blood Bank III • Component Therapy D. Blood Bank IV • Transfusion Complications * Noninfectious (Transfusion Reactions) * Infectious (Transfusion-transmitted Diseases) E. Blood Bank V (not discussed today but available at www.bbguy.org) • Hematopoietic Progenitor Cell Transplantation F. Blood Bank Practical • Management of specific clinical situations • Calculations, Antibody ID and no-pressure sample questions Blood Bank I Blood Groups I. Basic Antigen-Antibody Testing A. Basic Red Cell-Antibody Interactions 1. Agglutination a. Clumping of red cells due to antibody coating b. Main reaction we look for in Blood Banking c. Two stages: 1) Coating of cells (“sensitization”) a) Affected by antibody specificity, electrostatic RBC charge, temperature, amounts of antigen and antibody b) Low Ionic Strength Saline (LISS) decreases repulsive charges between RBCs; tends to enhance cold antibodies and autoantibodies c) Polyethylene glycol (PEG) excludes H2O, tends to enhance warm antibodies and autoantibodies. 2) Formation of bridges a) Lattice structure formed by antibodies and RBCs b) IgG isn’t good at this; one antibody arm must attach to one cell and other arm to the other cell. c) IgM is better because of its pentameric structure. P}Chaffin (12/28/11) Blood Bank I page 1 Pathology Review Course 2. Hemolysis a. Direct lysis of a red cell due to antibody coating b. Uncommon, but equal to agglutination. 1) Requires complement fixation 2) IgM antibodies do this better than IgG.
    [Show full text]
  • Iraqi Academic Scientific Journals
    Baghdad Science Journal Vol.11(2)2014 Gene frequencies of ABO and rhesus blood groups in Sabians (Mandaeans), Iraq Alia E. M. Alubadi* Asmaa M. Salih** Maisam B. N. Alkhamesi** Noor J.Ali*** Received 20, December, 2012 Accepted 3, March, 2014 Abstract: The present study aimed to determine the frequency of ABO and Rh blood group antigens among Sabians (Mandaeans) population. This paper document the frequency of ABO and Rh blood groups among the Sabians (Mandaeans) population of Iraq.There is no data available on the ABO/Rh (D) frequencies in the Sabians (Mandaeans) population. Total 341 samples analyzed; phenotype O blood type has the highest frequency 49.9%, followed by A 28.7%, and B 13.8% whereas the lowest prevalent blood group was AB 7.6%. The overall phenotypic frequencies of ABO blood groups were O>A>B>AB. The allelic frequencies of O, A, and B alleles were 0.687, 0.2 and 0.1122 respectively. Rhesus study showed that with a percentage of 96.2% Rh (D) positive is by far the most prevalent, while Rh (d) negative is present only in 3.8% of the total population. The Sabians (Mandaeans) ethnic group showed the same distribution of ABO and Rh blood groups with others ethnic groups in Iraqi population. Key words: Gene, ABO, rhesus blood groups, Sabians, Gene frequencies Introduction: We are very thankful to Shakoori of pre-Arab and pre-Islamic origin. Farhan dakhel and Nisreen Iehad Badri They are Semites and speak a dialect for their support and guidelines in of Eastern Aramaic known as Mandaic.
    [Show full text]
  • Immuno 2014 No. 1
    Journal of Blood Group Serology and Molecular Genetics VOLUME 30, N UMBER 1, 2014 Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 30, Number 1, 2014 CONTENTS R EPORT 1 Indirect antiglobulin test-crossmatch using low-ionic-strength saline–albumin enhancement medium and reduced incubation time: effectiveness in the detection of most clinically significant antibodies and impact on blood utilization C.L. Dinardo, S.L. Bonifácio, and A. Mendrone, Jr. R EV I EW 6 Raph blood group system M. Hayes R EPORT 11 I-int phenotype among three individuals of a Parsi community from Mumbai, India S.R. Joshi C A SE R EPORT 14 Evans syndrome in a pediatric liver transplant recipient with an autoantibody with apparent specificity for the KEL4 (Kpb) antigen S.A. Koepsell, K. Burright-Hittner, and J.D. Landmark R EV I EW 18 JMH blood group system: a review S.T. Johnson R EPORT 24 Demonstration of IgG subclass (IgG1 and IgG3) in patients with positive direct antiglobulin tests A. Singh, A. Solanki, and R. Chaudhary I N M EMOR ia M 28 George Garratty, 1935–2014 Patricia A. Arndt and Regina M. Leger 30 A NNOUNCEMENTS 34 A DVERT I SEMENTS 39 I NSTRUCT I ONS FOR A UTHORS E D I TOR - I N -C H I EF E D I TOR ia L B OA RD Sandra Nance, MS, MT(ASCP)SBB Philadelphia, Pennsylvania Patricia Arndt, MT(ASCP)SBB Paul M. Ness, MD Pomona, California Baltimore, Maryland M A N AG I NG E D I TOR James P.
    [Show full text]