Genetic Polymorphisms in the DNA Double-Strand Break Repair Genes

1048 Null Results in Brief

Genetic Polymorphisms in the DNA Double-Strand Break Repair Genes XRCC3, XRCC2, and NBS1 Are Not Associated with Acute Side Effects of Radiotherapy in Breast Cancer Patients

Odilia Popanda,1 Xiang-Lin Tan,2 Christine B. Ambrosone,3 Silke Kropp,2 Irmgard Helmbold,2 Dietrich von Fournier,4 Wulf Haase,5 Marie Luise Sautter-Bihl,6 Frederik Wenz,7 Peter Schmezer,1 and Jenny Chang-Claude2 Divisions of 1Toxicology and Cancer Risk Factors and 2Clinical Epidemiology, German Cancer Research Center, Heidelberg, Germany; 3Department of Epidemiology, Division of Cancer Prevention and Population Science, Roswell Park Cancer Institute, Buffalo, New York; 4Department of Gynecological Radiology, Heidelberg University Hospital, Heidelberg, Germany; 5Clinic for Radiotherapy and Radio-Oncology, St. Vincentius-Kliniken Karlsruhe; 6Clinic for Radiotherapy, Karlsruhe Hospital GmbH, Karlsruhe, Germany; and 7Department of Radiation Oncology, Universita¨tsklinikum Mannheim, Mannheim, Germany

Introduction

Clinical sensitivity to ionizing radiation varies considerably (12). The XRCC2 Arg188His (rs3218536) and the NBS1 among patients, and radiation-induced adverse effects devel- Glu185Gln (rs1805794) polymorphisms were measured as oping in normal tissue can be therapy limiting in >10% of other variants in (12) by melting curve analysis of se- patients (1). Ionizing radiation induces both DNA single- quence-specific hybridization probes (LightCycler, Roche strand breaks and double-strand breaks (DSB), with the DSBs Diagnostics, Mannheim, Germany). For XRCC2 Arg188His, generally considered the lethal event (2). Several syndromes PCR primers were 5¶-TTGATATGCTCCGGCTAGTTA-3¶ and associated with increased radiosensitivity are caused by 5¶-CTGCCATGCCTTACAGAGATAA-3¶,andprobeswere deficiencies in genes of DSB repair, leading to the hypothesis 5¶-CTTGTAAATGACTATCACCTGGTTCTT-FITC-3¶ and that the individual repair capacity for these lesions should 5¶-LCRed640-TGCAACGACACAAACTATAATGCA- be an important determinant of individual radiosensitivity GAAAGCp-3¶;forNBS1 Glu185Gln, primers were 5¶- (3, 4). Here, three polymorphisms in genes involved in TTTTATGGATGTAAACAGCCTCT-3¶ and 5¶-AAACCTTC- homologous recombination (XRCC3 Thr241Met, XRCC2 CATTAATAATACCGAA-3¶, and probes were 5¶-LCRed640- Arg188His, and NBS1 Glu185Gln) with potential functional AGAAGCAGCCTCCACAAATTGAAAGGTp-3¶ and effects (5-8) were evaluated for a possible association with 5¶-TGAATTCCTGAAAGCAGTTCAGTCC-FITC-3¶ (Tib the risk of developing acute skin reactions following radio- Molbiol, Berlin, Germany). Genotype information was therapy in a prospective epidemiologic study. incomplete for two samples because of an inadequate amount of DNA. Materials and Methods Occurrence of acute skin toxicity was analyzed using Cox proportional hazards model in relation to biologically effective Study subjects included female breast cancer patients receiving radiation dose instead of time in days during radiotherapy, primary radiotherapy after breast-conserving surgery as thereby adjusting for differences in radiation dose when acute reported (ref. 9; reference no. 37/98 of the ethical committee skin toxicity occurred and for the total dose received (13). As of the University of Heidelberg). All the patients were given a possible confounders, differences by treating hospitals and typical breast radiation treatment with an average biologically body mass index were included in all models (9). effective radiation dose of 54.0 F 4.8 Gy. Clinical radiation reaction developing in the skin within the radiation field of the breast was documented at regular time intervals during Results treatment, and the severity of acute side effects was assessed Frequencies of rare alleles were 0.41, 0.07, and 0.32 for using a classification system based on the Common Toxicity 241 188 185 Criteria of the U.S. NIH (10). Seventy-seven of the 446 XRCC3 Met, XRCC2 His, and NBS1 Gln, respectively, participants presented with increased acute toxicity (at least consistent with published reports (0.39, XRCC3; 0.06, XRCC2; one moist desquamation or interruption of radiotherapy due to and 0.32, NBS1) in European populations (8, 12, 14). All toxicity) by the end of treatment (9, 11). genotype distributions were in Hardy-Weinberg equilibrium. DNA extraction, analysis of the XRCC3 Thr241Met poly- Overall, we did not observe a significant association between morphism (rs861539), and quality control was as described the genetic polymorphisms investigated and the risk of acute skin toxicity after radiotherapy (Table 1). Analysis yielded differences in the associations between XRCC3 and NBS1 Cancer Epidemiol Biomarkers Prev 2006;15(5):1048 – 50 polymorphisms and acute skin toxicity for patients with Received 1/26/06; accepted 3/2/06. normal weight and overweight (Table 1), which were, Grant support: German Office for Radiation Protection project no. St. Sch. 4116 and 4233 and however, not statistically significant. When combined effects USAMRMC FY01 Breast Cancer Research Program grant DAMD17-02-1-0500. of alleles were examined, there was neither a significant trend The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. (Ptrend = 0.08) for increased protection associated with Section 1734 solely to indicate this fact. increasing number of potentially protective alleles (XRCC3 Requests for reprints: Odilia Popanda, Division of Toxicology and Cancer Risk Factors, 241Thr, XRCC2 188His, and NBS1 185Gln) in normal weight German Cancer Research Center, Im Neuenheimer Feld 280, D-69120, Heidelberg, Germany. Phone: 49-6221-423315; Fax: 49-6221-423359. E-mail: [email protected] patients nor significant risk alterations (hazard ratio for Copyright D 2006 American Association for Cancer Research. carriers of three and more alleles, 0.26; 95% confidence doi:10.1158/1055-9965.EPI-06-0046 interval, 0.04-1.66; data not shown).

Cancer Epidemiol Biomarkers Prev 2006;15(5). May 2006 Downloaded from cebp.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research. Cancer Epidemiology, Biomarkers &Prevention 1049

Table 1. Genetic polymorphisms in DNA DSB repair genes XRCC3, XRCC2, and NBS1 and risk of developing acute skin toxicity after radiotherapy investigated in all participants and stratified by body mass index

Gene polymorphism Total population Normal weight (BMI V 25.0) Overweight (BMI > 25.0) c c c No.* HR (95% CI) No.* HR (95% CI) No.* HR (95% CI)

XRCC3 Thr241Met Thr/Thr 156/21 1.00 85/5 1.00 71/16 1.00 Thr/Met 212/41 1.34 (0.79-2.29) 104/13 2.28 (0.79-6.56) 108/28 1.15 (0.61-2.14) Met/Met 76/14 1.28 (0.64-2.56) 38/4 1.84 (0.48-6.97) 38/10 1.16 (0.51-2.61) Met carrier 288/55 1.33 (0.80-2.21) 142/17 2.15 (0.78-5.94) 146/38 1.15 (0.64-2.08)b XRCC2 Arg188His Arg/Arg 387/71 1.00 194/21 1.00 193/50 1.00 Arg/His 55/5 0.56 (0.22-1.39) 34/2 0.48 (0.11-2.10) 21/3 0.67 (0.20-2.18) His/His 3/1 0.95 (0.13-7.02) 0/0 NC 3/1 0.73 (0.10-5.55) His carrier 58/6 0.60 (0.26-1.39) 34/2 0.48 (0.11-2.10) 24/4 0.68 (0.24-1.94) NBS1 Glu185Gln Glu/Glu 196/36 1.00 110/16 1.00 86/20 1.00 Glu/Gln 210/35 0.94 (0.58-1.52) 104/7 0.61 (0.24-1.50) 106/28 1.28 (0.70-2.33) Gln/Gln 39/6 0.90 (0.37-2.22) 14/0 NC 25/6 1.25 (0.48-3.28) Gln carrier 249/41 0.93 (0.59-1.49) 118/7 0.54 (0.22-1.35) 131/34 1.28 (0.71-2.28)x

Abbreviations: HR, hazard ratio; 95% CI, 95% confidence interval; BMI, body mass index; NC, not calculated. *Number of participants/ patients with acute side effects. cAdjusted for BMI, hospital (four clinics), and photon beam quality for whole breast (two categories) and for boost irradiation (no boost and four categories; ref. 9). b P interaction = 0.41. x P interaction = 0.08.

Discussion patients were not correlated (20). Thus, the polymorphisms investigated, although apparently functional, may not give Our data did not support a significant association of risk of total information about variability in gene function. In the acute skin toxicity in breast cancer patients receiving radio- future, a more detailed haplotype analysis of the genes and a therapy after breast-conserving surgery with the XRCC3 comprehensive analysis, including variants in genes of both 241 188 185 Thr Met, XRCC2 Arg His, and NBS1 Glu Gln polymor- DSB repair pathways (homologous recombination and nonho- phisms. The possibility of an interaction between genotypes mologous end joining), and consideration of late effects of and body mass index cannot be excluded because of the small radiotherapy will be necessary. number of participants in some of the genotype categories. Nevertheless, our study is one of the largest reported and has >80% power to detect a 1.9-fold risk in carriers of the XRCC3 241 185 Acknowledgments Met allele or the NBS1 Gln allele in the overall study We thank the staff of the participating clinics for their contribution to population (see also ref. 13). We minimized sources of bias in the data collection; Belinda Kaspereit, Kati Smit, and Peter Waas in our study by restriction on tumor type and type of side effects DKFZ for excellent technical assistance; and all the patients who and accounted for confounding by treatment-related or participated in the study. patient-related characteristics in the data analysis. Analysis for effect modification by body mass index was driven by the previous observation of differential associations between skin References toxicity and DNA repair gene polymorphisms in the base 1. Andreassen CN, Alsner J, Overgaard J. Does variability in normal tissue excision repair genes XRCC1 and APE1 by body mass index reactions after radiotherapy have a genetic basis: where and how to look for (9, 13). it? Radiother Oncol 2002;64:131 – 40. To our knowledge, this is the first study to investigate the 2. Hoeijmakers JH. Genome maintenance mechanisms for preventing cancer. 188 185 Nature 2001;411:366 – 74. association between XRCC2 Arg His and NBS1 Glu Gln 3. Digweed M, Sperling K. Nijmegen breakage syndrome: clinical manifesta- polymorphisms and acute side effects of radiotherapy. For tion of defective response to DNA double-strand breaks. DNA Repair XRCC3 Thr241Met, the Thr/Thr genotype was reported to be (Amst) 2004;3:1207 – 17. 4. Gatti RA. The inherited basis of human radiosensitivity. Acta Oncol 2001;40: correlated with increased risk of late effects in irradiated breast 702 – 11. cancer patients, such as s.c. fibrosis and telangiectasia (15). 5. Aka P, Mateuca R, Buchet JP, Thierens H, Kirsch-Volders M. Are genetic This finding was not confirmed in another study of late- polymorphisms in OGG1, XRCC1 and XRCC3 genes predictive for the adverse radiotherapy effects in gynecologic tumors (16). Our DNA strand break repair phenotype and genotoxicity in workers exposed 241 to low dose ionising radiations? Mutat Res 2004;556:169 – 81. results weakly implicated the XRCC3 Met allele as risk allele 6. Angelini S, Kumar R, Carbone F, et al. Micronuclei in humans induced by and may differ from the other studies because we focused on exposure to low level of ionizing radiation: influence of polymorphisms in acute side effects rather than late effects of radiotherapy, which DNA repair genes. Mutat Res 2005;570:105 – 17. are not necessarily related (17). 7. Medina PP, Ahrendt SA, Pollan M, Fernandez P, Sidransky D, Sanchez- Cespedes M. Screening of homologous recombination gene polymorph- All three polymorphisms investigated were predicted to isms in lung cancer patients reveals an association of the NBS1 – 185Gln have an maximal effect on cellular, and possibly clinical, variant and p53 gene mutations. Cancer Epidemiol Biomarkers Prev 2003; function using a algorithm based on allele frequency, 12:699 – 704. potential functional effect, and results from previous epide- 8. Rafii S, O’Regan P, Xinarianos G, et al. A potential role for the XRCC2 R188H 241 polymorphic site in DNA-damage repair and breast cancer. Hum Mol Genet miologic studies (18). The XRCC3 Met allele has in fact been 2002;11:1433 – 8. associated with an increased number of micronuclei in 9. Twardella D, Popanda O, Helmbold I, et al. Personal characteristics, therapy peripheral lymphocytes of humans exposed to ionizing modalities and individual DNA repair capacity as predictive factors of acute radiation (5, 6). No differences in homology-directed repair skin toxicity in an unselected cohort of breast cancer patients receiving radiotherapy. Radiother Oncol 2003;69:145 – 53. of DSB have, however, been found between the wild-type and 10. Cancer Therapy Evaluation Program. Common Toxicity Criteria. NIH 1998; the variant XRCC3 protein (19), and DSB repair in vitro and Available from: http://ctep.cancer.gov/reporting/ctc.html. acute normal tissue reaction after radiotherapy of breast cancer 11. Popanda O, Ebbeler R, Twardella D, et al. Radiation-induced DNA damage

Cancer Epidemiol Biomarkers Prev 2006;15(5). May 2006 Downloaded from cebp.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research. 1050 Double-Strand Break Repair and Radiosensitivity

and repair in lymphocytes from breast cancer patients and their correlation normal tissues after radiotherapy in patients treated for gynecologic tumors: with acute skin reactions to radiotherapy. Int J Radiat Oncol Biol Phys 2003; association with single nucleotide polymorphisms in XRCC1, XRCC3, and 55:1216 – 25. OGG1 genes and in vitro chromosomal radiosensitivity in lymphocytes. Int J 12. Popanda O, Schattenberg T, Phong CT, et al. Specific combinations of DNA Radiat Oncol Biol Phys 2005;62:1140 – 9. repair gene variants and increased risk for non-small cell lung cancer. 17. Bentzen SM, Overgaard M. Relationship between early and late normal- Carcinogenesis 2004;25:2433 – 41. tissue injury after postmastectomy radiotherapy. Radiother Oncol 1991;20: 13. Chang-Claude J, Popanda O, Tan XL, et al. Association between poly- 159 – 65. morphisms in the DNA repair genes, XRCC1, APE1, and XPD and acute side 18. Millikan RC, Player JS, Decotret AR, Tse CK, Keku T. Polymorphisms in effects of radiotherapy in breast cancer patients. Clin Cancer Res 2005;11: DNA repair genes, medical exposure to ionizing radiation, and breast cancer 4802 – 9. risk. Cancer Epidemiol Biomarkers Prev 2005;14:2326 – 34. 14. Kuschel B, Auranen A, McBride S, et al. Variants in DNA double-strand 19. Araujo FD, Pierce AJ, Stark JM, Jasin M. Variant XRCC3 implicated in cancer break repair genes and breast cancer susceptibility. Hum Mol Genet 2002;11: is functional in homology-directed repair of double-strand breaks. Onco- 1399 – 407. gene 2002;21:4176 – 80. 15. Andreassen CN, Alsner J, Overgaard M, Overgaard J. Prediction of normal 20. El Awady RA, Mahmoud M, Saleh EM, et al. No correlation between tissue radiosensitivity from polymorphisms in candidate genes. Radiother radiosensitivity or double-strand break repair capacity of normal fibroblasts Oncol 2003;69:127 – 35. and acute normal tissue reaction after radiotherapy of breast cancer patients. 16. De Ruyck K, Van Eijkeren M, Claes K, et al. Radiation-induced damage to Int J Radiat Biol 2005;81:501 – 8.

Cancer Epidemiol Biomarkers Prev 2006;15(5). May 2006 Downloaded from cebp.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research. Genetic Polymorphisms in the DNA Double-Strand Break Repair Genes XRCC3, XRCC2, and NBS1 Are Not Associated with Acute Side Effects of Radiotherapy in Breast Cancer Patients

Odilia Popanda, Xiang-Lin Tan, Christine B. Ambrosone, et al.

Cancer Epidemiol Biomarkers Prev 2006;15:1048-1050.

Updated version Access the most recent version of this article at: http://cebp.aacrjournals.org/content/15/5/1048

Cited articles This article cites 18 articles, 3 of which you can access for free at: http://cebp.aacrjournals.org/content/15/5/1048.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://cebp.aacrjournals.org/content/15/5/1048.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cebp.aacrjournals.org/content/15/5/1048. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.