DOCSLIB.ORG

Regulatory T Cell Numbers in Inflamed Skin Are Controlled by Local Inflammatory Cues That Upregulate CD25 and Facilitate Antigen

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulatory T Cell Numbers in Inflamed Skin Are Controlled by Local Inflammatory Cues That Upregulate CD25 and Facilitate Antigen Regulatory T Cell Numbers in Inflamed Skin Are Controlled by Local Inflammatory Cues That Upregulate CD25 and Facilitate Antigen-Driven Local Proliferation This information is current as of October 4, 2021. Alison C. Billroth-MacLurg, Jill Ford, Alexander Rosenberg, Jim Miller and Deborah J. Fowell J Immunol 2016; 197:2208-2218; Prepublished online 10 August 2016; doi: 10.4049/jimmunol.1502575 Downloaded from http://www.jimmunol.org/content/197/6/2208 Supplementary http://www.jimmunol.org/content/suppl/2016/08/10/jimmunol.150257 Material 5.DCSupplemental http://www.jimmunol.org/ References This article cites 69 articles, 29 of which you can access for free at: http://www.jimmunol.org/content/197/6/2208.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on October 4, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Regulatory T Cell Numbers in Inflamed Skin Are Controlled by Local Inflammatory Cues That Upregulate CD25 and Facilitate Antigen-Driven Local Proliferation Alison C. Billroth-MacLurg,* Jill Ford,* Alexander Rosenberg,† Jim Miller,* and Deborah J. Fowell* CD4+Foxp3+ regulatory T cells (Tregs) are key immune suppressors that regulate immunity in diverse tissues. The tissue and/or inflammatory signals that influence the magnitude of the Treg response remain unclear. To define signals that promote Treg accumulation, we developed a simple system of skin inflammation using defined Ags and adjuvants that induce distinct cytokine milieus: OVA protein in CFA, aluminum salts (Alum), and Schistosoma mansoni eggs (Sm Egg). Polyclonal and Ag-specific Treg accumulation in the skin differed significantly between adjuvants. CFA and Alum led to robust Treg accumulation, with >50% of all skin CD4+ T cells being Foxp3+. In contrast, Tregs accumulated poorly in the Sm Egg–inflamed skin. Surprisingly, we found no Downloaded from evidence of inflammation-specific changes to the Treg gene program between adjuvant-inflamed skin types, suggesting a lack of selective recruitment or adaptation to the inflammatory milieu. Instead, Treg accumulation patterns were linked to differences in CD80/CD86 expression by APC and the regulation of CD25 expression, specifically in the inflamed skin. Inflammatory cues alone, without cognate Ag, differentially supported CD25 upregulation (CFA and Alum > Sm Egg). Only in inflammatory milieus that upregulated CD25 did the provision of Ag enhance local Treg proliferation. Reduced IL-33 in the Sm Egg–inflamed environment was shown to contribute to the failure to upregulate CD25. Thus, the magnitude of the Treg response in inflamed tissues is http://www.jimmunol.org/ controlled at two interdependent levels: inflammatory signals that support the upregulation of the important Treg survival factor CD25 and Ag signals that drive local expansion. The Journal of Immunology, 2016, 197: 2208–2218. D4+Foxp3+ regulatory T cells (Tregs) are important im- factors controlling the accumulation, size, and function of the Treg mune sentinels that orchestrate the control of homeo- compartment in specific tissues will be important as strategies for C static and infectious immune activation. Studies have therapeutic manipulation of Treg advance. elegantly defined Treg differentiation, homeostasis, phenotype, Increases in Treg number are seen in a variety of infected and and suppressive function using Tregs within lymphoid tissues (1). autoimmune tissues (12–17). Local Treg proliferation in non- by guest on October 4, 2021 However, recent observations suggest that there is a substantial lymphoid tissues has been observed (15, 18, 19) and can be linked degree of peripheral reshaping of Treg phenotype and function in part to cognate Ag expression (13, 20). Costimulatory signals depending on the tissue location and inflammatory milieu (2–4). from CD28 and CTLA-4, important for Treg development and Tregs in distinct peripheral tissues express specific gene programs homeostasis (21, 22), also tune Ag-induced Treg proliferation and that appear to facilitate tailored local function (5, 6), whereas the function in the periphery (23–27). IL-2 provides a potent survival type of inflammation can also drive Treg functional specialization signal to Tregs (28–31) and has recently become a primary target (7–11). The relative contribution of location and inflammation to for regulating Treg number in vivo (32–34). A deficiency in IL-2 Treg dynamics in peripheral tissues remains unclear. Defining the within target tissues has been linked to the negative regulation of Tregs in autoimmune settings through downregulation of CD25 expression (19). Less well understood are the positive signals that *Department of Microbiology and Immunology, David H. Smith Center for Vaccine support CD25 expression by Tregs in peripheral tissues and pro- Biology and Immunology, Aab Institute of Biomedical Sciences, University of mote local Treg accumulation. Recent studies suggest IL-33 may † Rochester, Rochester, NY 14642; and Division of Allergy, Immunology and Rheu- be an important factor in promoting Treg expansion in tissues via matology, University of Rochester Medical Center, Rochester, NY 14642 upregulation of local IL-2 (35, 36) and can be counterregulated by ORCID: 0000-0001-7093-4448 (D.J.F.). IL-23 (37). Received for publication December 15, 2015. Accepted for publication July 11, 2016. To study the signals that modulate Treg accumulation at sites This work was supported by National Institutes of Health/National Institute of of inflammation we focused our studies on the skin and assessed Allergy and Infectious Diseases Grants P01 AI02851, R01 AI070826 and HHSN272201200005C (to D.J.F.). Treg accumulation to OVA immunization in the context of different Address correspondence and reprint requests to Dr. Deborah J. Fowell, David H. Smith types of induced inflammation, using distinct Th1 CFA or Th2- Center for Vaccine Biology and Immunology, University of Rochester, 601 Elmwood inducing (aluminum salts [Alum] or Schistosome mansoni Eggs Avenue, Box 609, Rochester, NY 14642. E-mail address: Deborah_Fowell@urmc. [Sm Egg]) adjuvants. We demonstrate distinct variations in Treg rochester.edu accumulation in the skin between inflammatory milieus with ro- The online version of this article contains supplemental material. bust accumulation of Tregs in CFA and Alum-induced skin in- Abbreviations used in this article: Alum, aluminum salt; DC, dendritic cell; dLN, draining lymph node; KLH, keyhole limpet hemocyanin; LN, lymph node; pOVA, flammation but not in Sm Egg–inflamed skin. This was tissue OVA peptide; Sm Egg, Schistosoma mansoni egg; Tconv, conventional CD4+ T cell; specific, observed in the inflamed skin but not the draining lymph Tg, transgenic; TLDA, TaqMan low-density array; Treg, regulatory T cell; WT, wild- node (dLN), and cell type specific, seen for polyclonal and Ag- type. specific Tregs but not conventional CD4+ T cells (Tconv). The Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00 differences were not dependent on the primary effector cytokines www.jimmunol.org/cgi/doi/10.4049/jimmunol.1502575 The Journal of Immunology 2209 in the skin, nor did they reflect the selection of particular milieu- TaqMan low-density array specific Treg subsets. Rather, we found the distinct inflammatory cDNA from purified Tregs from ear and LN was isolated using the Cells-To- milieus differentially regulated the expression of CD25 by Tregs CT kit (Ambion Life Technologies). Samples were preamplified using in the skin, independent of Ag. CFA and Alum potently upregu- primer pools specific to custom TaqMan low-density arrays (TLDAs) lated CD25 on Tregs, whereas the Sm Egg milieu failed to support (Supplemental Fig. 1). Amplified samples were loaded onto TLDA cards CD25 upregulation. The upregulation of CD25 correlated with and RT-PCR performed using 7900HT Fast Real-Time PCR System (Applied Biosystems) at the University of Rochester Genomics Center. differences in extent of CD80/CD86 expression by APCs in the Hypoxanthine phosphoribosyltransferase and GAPDH were used as en- skin. However, CD25 upregulation by the inflammatory milieu dogenous controls, and Treg samples from non-dLN were used as the was not sufficient to drive local Treg proliferation, which required calibrator. cognate Ag. Unexpectedly, the effect of Ag was only seen in in- Anti–IL-23 blockade and IL-33 administration flammatory settings that supported CD25 upregulation in the ab- sence of Ag, suggesting that distinct inflammatory cues precondition Anti–IL-23 Ab (BioLegend) or control IgG was administered to immu- Tregs for receptivity to Ag in inflamed tissues. nized mice on days 4, 5, and 6 postimmunization, 100 mg/mouse i.p. (40). rIL-33 (BioLegend) or PBS was administered to immunized mice on days 4, 5, and 6 postimmunization,
Load more

Recommended publications
  • Single-Cell RNA Sequencing Demonstrates the Molecular and Cellular Reprogramming of Metastatic Lung Adenocarcinoma
    ARTICLE https://doi.org/10.1038/s41467-020-16164-1 OPEN Single-cell RNA sequencing demonstrates the molecular and cellular reprogramming of metastatic lung adenocarcinoma Nayoung Kim 1,2,3,13, Hong Kwan Kim4,13, Kyungjong Lee 5,13, Yourae Hong 1,6, Jong Ho Cho4, Jung Won Choi7, Jung-Il Lee7, Yeon-Lim Suh8,BoMiKu9, Hye Hyeon Eum 1,2,3, Soyean Choi 1, Yoon-La Choi6,10,11, Je-Gun Joung1, Woong-Yang Park 1,2,6, Hyun Ae Jung12, Jong-Mu Sun12, Se-Hoon Lee12, ✉ ✉ Jin Seok Ahn12, Keunchil Park12, Myung-Ju Ahn 12 & Hae-Ock Lee 1,2,3,6 1234567890():,; Advanced metastatic cancer poses utmost clinical challenges and may present molecular and cellular features distinct from an early-stage cancer. Herein, we present single-cell tran- scriptome profiling of metastatic lung adenocarcinoma, the most prevalent histological lung cancer type diagnosed at stage IV in over 40% of all cases. From 208,506 cells populating the normal tissues or early to metastatic stage cancer in 44 patients, we identify a cancer cell subtype deviating from the normal differentiation trajectory and dominating the metastatic stage. In all stages, the stromal and immune cell dynamics reveal ontological and functional changes that create a pro-tumoral and immunosuppressive microenvironment. Normal resident myeloid cell populations are gradually replaced with monocyte-derived macrophages and dendritic cells, along with T-cell exhaustion. This extensive single-cell analysis enhances our understanding of molecular and cellular dynamics in metastatic lung cancer and reveals potential diagnostic and therapeutic targets in cancer-microenvironment interactions. 1 Samsung Genome Institute, Samsung Medical Center, Seoul 06351, Korea.
    [Show full text]
  • Opposing Regulatory Functions of the TIM3 (HAVCR2)
    Opposing regulatory functions of the TIM3 (HAVCR2) signalosome in primary effector T cells as revealed by quantitative interactomics Yunhao Zhai, Javier Celis-Gutierrez, Guillaume Voisinne, Daiki Mori, Laura Girard, Odile Burlet-Schiltz, Anne Gonzalez de Peredo, Romain Roncagalli, Bernard Malissen To cite this version: Yunhao Zhai, Javier Celis-Gutierrez, Guillaume Voisinne, Daiki Mori, Laura Girard, et al.. Opposing regulatory functions of the TIM3 (HAVCR2) signalosome in primary effector T cells as revealed by quantitative interactomics. Cellular and molecular immunology, Nature Publishing Group/Chinese Society of Immunology, In press, 10.1038/s41423-020-00575-7. hal-03086942 HAL Id: hal-03086942 https://hal-amu.archives-ouvertes.fr/hal-03086942 Submitted on 23 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Cellular & Molecular Immunology www.nature.com/cmi CORRESPONDENCE OPEN Opposing regulatory functions of the TIM3 (HAVCR2) signalosome in primary effector T
    [Show full text]
  • Regulatory Lymphocytes: the Dice That Resolve the Tumor Endgame Subhadip Pati, Anandi Chowdhury, Sumon Mukherjee, Aharna Guin, Shravanti Mukherjee and Gaurisankar Sa*
    Pati et al. Applied Cancer Research (2020) 40:7 Applied Cancer Research https://doi.org/10.1186/s41241-020-00091-0 REVIEW Open Access Regulatory lymphocytes: the dice that resolve the tumor endgame Subhadip Pati, Anandi Chowdhury, Sumon Mukherjee, Aharna Guin, Shravanti Mukherjee and Gaurisankar Sa* Abstract A large number of cancer patients relapse after chemotherapeutic treatment. The immune system is capable of identifying and destroying cancer cells, so recent studies have highlighted the growing importance of using combinatorial chemotherapy and immunotherapy. However, many patients have innate or acquired resistance to immunotherapies. Long-term follow-up in a pooled meta-analysis exhibited long-term survival in approximately 20% of patients treated with immune checkpoint inhibitors or the adoptive transfer of chimeric T cells. It has been reported that high levels of immunoregulatory cells in cancer patients contribute to immunotherapy resistance via immunosuppression. Among the most important regulatory cell subtypes are the CD4+ T-regulatory cells (Tregs), identified by their expression of the well-characterized, lineage-specific transcription factor FOXP3. In addition to CD4+ Tregs, other regulatory cells present in the tumor microenvironment, namely CD8+ Tregs and IL10-producing B-regulatory cells (Bregs) that also modulate the immune response in solid and lymphoid tumors. These cells together have detrimental effects on tumor immune surveillance and anti-tumor immunity. Therefore, targeting these regulatory lymphocytes will be crucial in improving treatment outcomes for immunotherapy. Keywords: Breg, CTLA4, FOXP3, Immunotherapy, IL10, PDL1, Treg Background neo-antigens, which are not present in non-cancerous The suppression of anti-tumor immune responses and cells [5]. These neo-antigens offer a clinical advantage augmentation of tumor-promoting immune responses since the tumor cells expressing neo-antigens are then both contribute to tumor progression [1].
    [Show full text]
  • Regulatory T Cell Research
    Regulatory T cell research Unique kits for cell isolation Harmonized cell culture and expansion tools Convenient functional assay tools Germany/Austria/ Benelux France Nordics and Baltics South Korea Switzerland Miltenyi Biotec B.V. Miltenyi Biotec SAS Miltenyi Biotec Norden AB Miltenyi Biotec Korea Co., Ltd Reliable flow cytometry analysis Miltenyi Biotec GmbH Schipholweg 68 H 10 rue Mercoeur Scheelevägen 17 Arigi Bldg. 8F Friedrich-Ebert-Straße 68 2316 XE Leiden 75011 Paris, France 223 70 Lund 562 Nonhyeon-ro 51429 Bergisch Gladbach The Netherlands Phone +33 1 56 98 16 16 Sweden Gangnam-gu Germany [email protected] Fax +33 1 56 98 16 17 [email protected] Seoul 06136, South Korea Phone +49 2204 8306-0 Customer service [email protected] Customer service Sweden Phone +82 2 555 1988 Fax +49 2204 85197 The Netherlands Phone 0200-111 800 Fax +82 2 555 8890 [email protected] Phone 0800 4020120 Italy Fax 046-280 72 99 [email protected] Fax 0800 4020100 Miltenyi Biotec S.r.l. Customer service Denmark USA/Canada Customer service Belgium Via Persicetana, 2/D Phone 80 20 30 10 Spain Miltenyi Biotec Inc. Phone 0800 94016 40012 Calderara di Reno (BO) Fax +46 46 280 72 99 Miltenyi Biotec S.L. 2303 Lindbergh Street Fax 0800 99626 Italy Customer service C/Luis Buñuel 2 Auburn, CA 95602, USA Customer service Luxembourg Phone +39 051 6 460 411 Norway, Finland, Iceland, Ciudad de la Imagen Phone 800 FOR MACS Phone 800 24971 Fax +39 051 6 460 499 and Baltic countries 28223 Pozuelo de Alarcón (Madrid) Phone +1 530 888 8871 Fax 800 24984 [email protected] Phone +46 46 280 72 80 Spain Fax +1 877 591 1060 Fax +46 46 280 72 99 Phone +34 91 512 12 90 [email protected] China Japan Fax +34 91 512 12 91 Miltenyi Biotec Technology & Miltenyi Biotec K.K.
    [Show full text]
  • CD8+CD122+Cd49dlow Regulatory T Cells Maintain T-Cell
    + + CD8 CD122 CD49dlow regulatory T cells maintain T-cell homeostasis by killing activated T cells via Fas/FasL-mediated cytotoxicity Kazuyuki Akanea,b, Seiji Kojimab, Tak W. Makc,1, Hiroshi Shikud,e, and Haruhiko Suzukia,1 aDepartment of Immunology, Nagoya University Graduate School of Medicine, Nagoya, Aichi 466-8550, Japan; bDepartment of Pediatrics, Nagoya University Graduate School of Medicine, Nagoya, Aichi 466-8550, Japan; cCampbell Family Institute for Breast Cancer Research, Princess Margaret Cancer Centre/University Health Network, Toronto, Ontario, Canada M5G 2M9; dDepartment of Cancer Vaccine, Mie University Graduate School of Medicine, Tsu, Mie 514-8507, Japan; and eDepartment of Immuno-Gene Therapy, Mie University Graduate School of Medicine, Tsu, Mie 514-8507, Japan Contributed by Tak W. Mak, January 15, 2016 (sent for review October 5, 2015; reviewed by Toshiaki Ohteki and Heiichiro Udono) The Fas/FasL (CD95/CD178) system is required for immune regula- regulatory action are available. Therefore, it is not clear precisely tion; however, it is unclear in which cells, when, and where Fas/FasL which subset of T cells express FasL or where Fas/FasL-dependent + molecules act in the immune system. We found that CD8+CD122+ CD8 Tregs, if such cells exist, are located and at which point cells, which are mostly composed of memory T cells in compari- they function. Thus, the ultimate pathophysiological role of the + − son with naïve cells in the CD8 CD122 population, were previ- Fas/FasL system is still unknown. ously shown to include cells with regulatory activity and could Regulation of the immune reaction is of pivotal importance be separated into CD49dlow cells and CD49dhigh cells.
    [Show full text]
  • Melanoma Single-Cell Biology in Experimental and Clinical Settings
    Journal of Clinical Medicine Review Melanoma Single-Cell Biology in Experimental and Clinical Settings Hans Binder 1 , Maria Schmidt 1 , Henry Loeffler-Wirth 1, Lena Suenke Mortensen 1 and Manfred Kunz 2,* 1 Interdisciplinary Center for Bioinformatics, University of Leipzig, 04107 Leipzig, Germany; [email protected] (H.B.); [email protected] (M.S.); [email protected] (H.L.-W.); [email protected] (L.S.M.) 2 Department of Dermatology, Venereology and Allergology, University of Leipzig Medical Center, Philipp-Rosenthal-Str. 23-25, 04103 Leipzig, Germany * Correspondence: [email protected]; Tel.: +49-341-97-18610; Fax: +49-341-97-18609 Abstract: Cellular heterogeneity is regarded as a major factor for treatment response and resistance in a variety of malignant tumors, including malignant melanoma. More recent developments of single-cell sequencing technology provided deeper insights into this phenomenon. Single-cell data were used to identify prognostic subtypes of melanoma tumors, with a special emphasis on immune cells and fibroblasts in the tumor microenvironment. Moreover, treatment resistance to checkpoint inhibitor therapy has been shown to be associated with a set of differentially expressed immune cell signatures unraveling new targetable intracellular signaling pathways. Characterization of T cell states under checkpoint inhibitor treatment showed that exhausted CD8+ T cell types in melanoma lesions still have a high proliferative index. Other studies identified treatment resistance mechanisms to targeted treatment against the mutated BRAF serine/threonine protein kinase including repression of the melanoma differentiation gene microphthalmia-associated transcription factor (MITF) and induction of AXL receptor tyrosine kinase.
    [Show full text]
  • Vaccine Immunology Claire-Anne Siegrist
    2 Vaccine Immunology Claire-Anne Siegrist To generate vaccine-mediated protection is a complex chal- non–antigen-specifc responses possibly leading to allergy, lenge. Currently available vaccines have largely been devel- autoimmunity, or even premature death—are being raised. oped empirically, with little or no understanding of how they Certain “off-targets effects” of vaccines have also been recog- activate the immune system. Their early protective effcacy is nized and call for studies to quantify their impact and identify primarily conferred by the induction of antigen-specifc anti- the mechanisms at play. The objective of this chapter is to bodies (Box 2.1). However, there is more to antibody- extract from the complex and rapidly evolving feld of immu- mediated protection than the peak of vaccine-induced nology the main concepts that are useful to better address antibody titers. The quality of such antibodies (e.g., their these important questions. avidity, specifcity, or neutralizing capacity) has been identi- fed as a determining factor in effcacy. Long-term protection HOW DO VACCINES MEDIATE PROTECTION? requires the persistence of vaccine antibodies above protective thresholds and/or the maintenance of immune memory cells Vaccines protect by inducing effector mechanisms (cells or capable of rapid and effective reactivation with subsequent molecules) capable of rapidly controlling replicating patho- microbial exposure. The determinants of immune memory gens or inactivating their toxic components. Vaccine-induced induction, as well as the relative contribution of persisting immune effectors (Table 2.1) are essentially antibodies— antibodies and of immune memory to protection against spe- produced by B lymphocytes—capable of binding specifcally cifc diseases, are essential parameters of long-term vaccine to a toxin or a pathogen.2 Other potential effectors are cyto- effcacy.
    [Show full text]
  • Havcr2 (NM 001100762) Rat Untagged Clone – RN206032 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RN206032 Havcr2 (NM_001100762) Rat Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Havcr2 (NM_001100762) Rat Untagged Clone Tag: Tag Free Symbol: Havcr2 Synonyms: tim3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >RN206032 representing NM_001100762 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTTTCATGGCTTCCCTTCAGCTGTGCCCTGCTGCTGCTGCAACCACTACCTGCAAGGTCCTTGGAAA ATGCTTACACAGCTGAGGTCGGGAAGAATGCCTATCTGCCCTGCAGCTACACTGTACCTGCCCCTGGGAC GCTCGTGCCTATCTGCTGGGGCAAGGGATCCTGTCCTTTGTTACAGTGTGCCAGTGTGGTGCTCAGAACG GATGAAACGAATGTGACATATCGGAAATCCAGAAGATACCAGCTAAAGGGGAATTTCTACAAAGGAGACA TGTCGCTGACCATAAAGAATGTGACTCTAGCTGACTCTGGGACCTACTGCTGCAGGATACAATTCCCTGG CCCAATGAATGATGAAAAATTAGAGCTGAAATTAAGCATCACTGAACCAGCCAAAGTCATCCCAGCTGGG ACTGCTCATGGGGATTCTACAACAGCTTCTCCCAGAACCCTAACCACTGAGGGAAGTGGCTCAGAGACAC AGACCCTGGTGACCCTCCATGATAACAATGGAACAAAAATTTCCACATGGGCCGATGAAATTAAGGACTC TGGAGAAACTATCAGAACTGCTGTCCACATTGGAGTAGGCGTCTCTGCTGGGCTGGCCCTGGCACTTATT CTTGGTGTTTTAATCCTTAAATGGTATTCCTCTAAGAAAAAGAAGTTGCAGGATTTGAGTCTTATTACAC TGGCCAACTCCCCACCAGGAGGGTTGGTGAATGCAGGAGCAGGCAGGATTCGGTCTGAGGAAAACATCTA CACTATAGAGGAGAACATATATGAAATGGAGAATTCAAATGAGTACTACTGCTATGTCAGCAGCCAGCAG CCATCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
    [Show full text]
  • Recruitment and Expansion of Tregs Cells in the Tumor Environment—How to Target Them?
    cancers Review Recruitment and Expansion of Tregs Cells in the Tumor Environment—How to Target Them? Justine Cinier 1,†, Margaux Hubert 1,†, Laurie Besson 1, Anthony Di Roio 1 ,Céline Rodriguez 1, Vincent Lombardi 2, Christophe Caux 1,‡ and Christine Ménétrier-Caux 1,*,‡ 1 University of Lyon, Claude Bernard Lyon 1 University, INSERM U-1052, CNRS 5286 Centre Léon Bérard, Cancer Research Center of Lyon (CRCL), 69008 Lyon, France; [email protected] (J.C.); [email protected] (M.H.); [email protected] (L.B.); [email protected] (A.D.R.); [email protected] (C.R.); [email protected] (C.C.) 2 Institut de Recherche Servier, 125 Chemin de Ronde, 78290 Croissy-sur-Seine, France; [email protected] * Correspondence: [email protected] † Co-first authorship. ‡ Co-last authorship. Simple Summary: The immune response against cancer is generated by effector T cells, among them cytotoxic CD8+ T cells that destroy cancer cells and helper CD4+ T cells that mediate and support the immune response. This antitumor function of T cells is tightly regulated by a particular subset of CD4+ T cells, named regulatory T cells (Tregs), through different mechanisms. Even if the complete inhibition of Tregs would be extremely harmful due to their tolerogenic role in impeding autoimmune diseases in the periphery, the targeted blockade of their accumulation at tumor sites or their targeted Citation: Cinier, J.; Hubert, M.; depletion represent a major therapeutic challenge. This review focuses on the mechanisms favoring Besson, L.; Di Roio, A.; Rodriguez, C.; Treg recruitment, expansion and stabilization in the tumor microenvironment and the therapeutic Lombardi, V.; Caux, C.; strategies developed to block these mechanisms.
    [Show full text]
  • T Cells by Regulatory T Cells + CD8 Differential Suppression of Tumor
    Differential Suppression of Tumor-Specific CD8 + T Cells by Regulatory T Cells Edward James, Alex Yeh, Cathy King, Firouzeh Korangy, Ian Bailey, Denise S. Boulanger, Benoît J. Van den Eynde, This information is current as Nicholas Murray and Tim J. Elliott of October 2, 2021. J Immunol 2010; 185:5048-5055; Prepublished online 4 October 2010; doi: 10.4049/jimmunol.1000134 http://www.jimmunol.org/content/185/9/5048 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2010/10/04/jimmunol.100013 Material 4.DC1 References This article cites 42 articles, 19 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/185/9/5048.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 2, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Differential Suppression of Tumor-Specific CD8+ T Cells by Regulatory T Cells Edward James,* Alex Yeh,*,1 Cathy King,* Firouzeh Korangy,† Ian Bailey,* Denise S.
    [Show full text]
  • Regulatory T-Cell Therapy in Crohn's Disease: Challenges and Advances
    Recent advances in basic science Regulatory T- cell therapy in Crohn’s disease: Gut: first published as 10.1136/gutjnl-2019-319850 on 24 January 2020. Downloaded from challenges and advances Jennie N Clough ,1,2 Omer S Omer,1,3 Scott Tasker ,4 Graham M Lord,1,5 Peter M Irving 1,3 1School of Immunology and ABStract pathological process increasingly recognised as Microbial Sciences, King’s The prevalence of IBD is rising in the Western world. driving intestinal inflammation and autoimmunity College London, London, UK 2NIHR Biomedical Research Despite an increasing repertoire of therapeutic targets, a is the loss of immune homeostasis secondary to Centre at Guy’s and Saint significant proportion of patients suffer chronic morbidity. qualitative or quantitative defects in the regulatory Thomas’ NHS Foundation Trust Studies in mice and humans have highlighted the critical T- cell (Treg) pool. and King’s College, London, UK + 3 role of regulatory T cells in immune homeostasis, with Tregs are CD4 T cells that characteristically Department of defects in number and suppressive function of regulatory Gastroenterology, Guy’s and express the high- affinity IL-2 receptor α-chain Saint Thomas’ Hospitals NHS T cells seen in patients with Crohn’s disease. We review (CD25) and master transcription factor Forkhead Trust, London, UK the function of regulatory T cells and the pathways by box P-3 (Foxp3) which is essential for their suppres- 4 Division of Transplantation which they exert immune tolerance in the intestinal sive phenotype and stability.4–6
    [Show full text]
  • TIM-3 Expression Is Downregulated on Human NK Cells in Response to Cancer Targets in Synergy with Activation
    cancers Article TIM-3 Expression Is Downregulated on Human NK Cells in Response to Cancer Targets in Synergy with Activation Tram N. Dao 1, Sagar Utturkar 2 , Nadia Atallah Lanman 2,3 and Sandro Matosevic 1,2,* 1 Department of Industrial and Physical Pharmacy, Purdue University, West Lafayette, IN 47907, USA; [email protected] 2 Center for Cancer Research, Purdue University, West Lafayette, IN 47907, USA; [email protected] (S.U.); [email protected] (N.A.L.) 3 Department of Comparative Pathobiology, Purdue University, West Lafayette, IN 47907, USA * Correspondence: [email protected] Received: 23 June 2020; Accepted: 24 August 2020; Published: 26 August 2020 Abstract: Among natural killer (NK) cell receptors, the T-cell immunoglobulin and mucin-containing domain (TIM-3) has been associated with both inhibitory and activating functions, depending on context and activation pathway. Ex vivo and in vitro, expression of TIM-3 is inducible and depends on activation stimulus. Here, we report that TIM-3 expression can be downregulated on NK cells under specific conditions. When NK cells are exposed to cancer targets, they synergize with stimulation conditions to induce a substantial decrease in TIM-3 expression on their surface. We found that such downregulation occurs following prior NK activation. Downregulated TIM-3 expression correlated to lower cytotoxicity and lower interferon gamma (IFN-γ) expression, fueling the notion that TIM-3 might function as a benchmark for human NK cell dysfunction. Keywords: TIM-3; NK cell receptor; immunotherapy; solid tumor; NK cell activation 1. Introduction It is increasingly evident that modulation of immune-regulatory receptors in the tumor microenvironment in favor of restored anti-tumor immunity is becoming one of the pivotal strategies in the adaptation of cell-based immunotherapies to target various cancers [1].
    [Show full text]