A Dissertation Entitled HDAC Mediated Integration of NF-Κb

A Dissertation

entitled

HDAC Mediated Integration of NF-κB Transcriptional Regulation

Lindsay Marie Schreiner

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the

Doctor of Philosophy Degree in

Biology

______Dr. Brian P. Ashburner, Committee Chair

______Dr. Patricia R. Komuniecki, Dean College of Graduate Studies

The University of Toledo

August 2014

This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of

HDAC Mediated Integration of NF-κB Transcriptional Regulation

Lindsay Marie Schreiner

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biology

The University of Toledo

August 2014

Nuclear Factor kappa B (NF-κB) is a family of dimeric transcription factors conserved in structure and function from the fruit fly drosophila melanogaster. NF-κB is involved in survival, inflammatory responses, immune responses, apoptosis, cell cycle regulation, and growth and development. All members of the NF-κB/Rel family contain a Rel-homology domain (RHD) that allows these proteins to dimerize, bind to DNA, and translocate to the nucleus. Certain members of the Rel family contain a transactivation domain (TAD) which activates transcription. Dysregulation of the NF-κB pathway is observed in many disease states including, cancer, heart disease, chronic inflammation, viral infection, cachexia, and neurological disorders.

In the classical pathway, NF-κB consists of a heterodimer of p50/p65 that is sequestered in the cytoplasm by IκBα, a member of the IκB family of inhibitory proteins.

When cells are induced by a pro-inflammatory cytokine, such as TNFα, intracellular signals that affect NF-κB converge at the IKK proteins. Activated IKK kinases phosphorylate IκBα, which is then ubiquitinated and degraded by the 26s proteasome.

After degradation of IκBα, the nuclear localization signal of the p50/p65 heterodimer is

iii exposed and NF-κB translocates to the nucleus where it binds to promoters to activate transcription of NF-κB regulated genes.

The NF-κB pathway is regulated on several levels. Classical NF-κB regulates transcription of its own inhibitor, IκBα, thus limiting the time NF-κB is transcriptionally active. Coactivators are protiens that enhance the activity of transcription factors. NF-

κB activity is enhanced by coactivators, especially the histone acetyltransferases (HATs)

CBP/p300 and pCAF. HATs acetylate histones, transcription factors and cofactors to enhance transcription. Corepressors are proteins that repress the activity of transcription factors. NF-κB activity is repressed by various corepressors including histone deacetylases (HDACs) which deacetylate histones to repress transcription. HDACs also deacetylate transcription factors and other non-histone proteins. HAT and HDAC activity help regulate the overall level of transcription taking place by affecting acetylation, which is a post-translational modification. Phosphorylation is another posttranslational modification involved in regulating NF-κB activity. Phosphorylation occurs at every step in the NF-κB pathway to signal for kinase activity, degradation, other modifications, or protein-protein interactions. Regulation of the NF-κB pathway is complex and involves the cooperation of many different proteins.

HDAC1, HDAC2, and HDAC3 are the focus of the research described in this dissertation because these are the class I HDACs most responsible for regulating classical

NF-κB activity. Stable knockdown cell lines were created using a lentiviral RNAi system and shRNAs specific to each gene to study the individual roles of HDAC1, HDAC2, and

HDAC3. Individual knockdown of HDAC1, HDAC2, and HDAC3 all caused changes in

IκBα gene expression, p65 nuclear localization, and IKKα nuclear localization.

Knockdown of HDAC3 alone enhanced nuclear NF-κB in HeLa cells treated with TNFα in a similar manner to previous studies that utilized a pan-HDAC inhibitor Trichostatin A

(TSA), and individual knockdown of HDAC1 and HDAC2 did not show enhanced nuclear NF-κB. Interestingly, knockdown of HDAC3 caused a decrease in IκBα protein in HeLa cells treated with TNFα, despite causing an increase in IκBα gene expression. It was hypothesized that increased IKK kinase activity in the HDAC3 knockdown cell line was responsible for the decreased IκBα protein upon TNFα treatment; however, the

HDAC3 knockdown cell line showed neither increased IKK kinase activity nor increased

IκBα phosphorylation compared to control. Surprisingly, increased IKK kinase activity was detected with knockdown of HDAC2 in HeLa cells treated with TNFα, and this observation has yet to be further explored. Gene expression and promoter studies in

TNFα treated HeLa cells with HDAC3 knockdown indicate that there is a highly specific and complex system of regulation at each different gene promoter.

I dedicate this dissertation to my mother, Christy Lou Tubbs. She was intelligent, kind, and strong. She was a solver of every problem. She was self-sacrificing and loving, and she had an amazing sense of humor.

Although I finished my graduate work after you were gone, I was able to finish because of the lessons you taught me. Thank you.

Acknowledgements

I would like to thank my mentor, Dr. Brian Ashburner, for his guidance and patience in working on my project, and his advice on life.

I would like to thank my committee members for their time, and their guidance on which direction to take my project.

Thank you to the University of Toledo for funding and the opportunity to gain experience teaching which is what I would like to continue doing.

I would like to thank my family for all their support. My dad, Wesley Tubbs, has been my swim coach since I was a child, and the hard work ethic from athletics translates into all of life’s challenges. My brother, Brian, and sister, Cari, have always been an incredible unconditional loving support network. My mom, Christy (Momma Tubbs) was a constant calming influence, reminding me that if I do my best, that is all anyone can ask. And my husband, Elliott, has taken on many tasks to allow me the opportunity to finish my degree and provided loving support all the way.

I would like to thank all of my friends who have been a constant source of joy and support throughout the most challenging parts of my life so far. Katie Halter, you are my soul sister. Natalya Blessing and April Brockman: thank you for making two of the most difficult transitions of my life more bearable and bringing humor and joy to my every-day life. Alexandra Judd (and Judd family): thank you for being my family on the other side of the world. v

Table of Contents

Abstract ...... iii

Acknowledgements ...... v

Table of Contents ...... vi

List of Tables ...... ix

List of Figures ...... x

List of Abbreviations ...... xii

1 Introduction…...... 1

1.1. NF-κB/Rel proteins……..……………………………………………………1

1.2. NF-κB activation……………………………………………………………..4

1.3. Inhibitor of κB (IκB) proteins………………………………………………..4

1.4. IκB kinases…………………………………………………………………..7

1.5. Transcriptional coactivator and corepressor proteins…………………….....11

1.5.1. Coactivators……………………………………………………….11

1.5.2. Corepressors……………………………………………………….11

1.6. HDAC Family of corepressors………………………………………………14

1.7. HDAC1, HDAC2, and HDAC3……………………………………………..16

1.8. Regulation of NF-κB by posttranslational modifications…………………...17

2 Methods…………………………………………………………………………..19

2.1. Cells and Reagents…………………………………………………………..19 vi

2.2. Knockdown of HDACs 1, 2, and 3 using RNAi…………………………….20

2.3. Whole Cell Extracts…………………………………………………………22

2.4 Cytoplasmic and Nuclear Extracts…………………………………………...23

2.5. Western Blot Analysis………………………………………………………24

2.6. Densitometry………………………………………………………………..25

2.7. Electrophoretic Mobility Shift Assay (EMSA)……………………………..25

2.8. RNA Isolation……………………………………………………………….27

2.9. RT PCR……………………………………………………………………...27

2.10 Real Time RT PCR…………………………………………………………29

2.11 Coimmunoprecipitation (CoIP)…………………………………………….29

2.12 IKK Kinase Assay………………………………………………………….30

2.13. Chromatin Immunoprecipitation (ChIP) Assay...... 31

2.14. Luciferase Assay and β-Gal Assay………………………………...………34

2.15. Cell Counting………………………………………………………………35

2.16. Statistical Analysis…………………………………………………………36

3. Results……………………………………………………………………………37

3.1. Individual HDAC1, HDAC2, and HDAC3 shRNA knockdown……………37

3.2. Nuclear p65 is enhanced with individual HDAC1, HDAC2, and HDAC3

knockdown ………………………………………………………………………41

3.3. IκBα gene expression and protein level with individual HDAC1, HDAC2,

and HDAC3 knockdown………………………………………………………..45

3.4. Decreased IκBα protein level in HD3KD cells is not due to shorter

half-life………………………………………………………………………….51

vii

3.5. Nuclear IKKα is enhanced with individual HDAC1, 2, and 3

knockdown…………………………………………………………………..…...54

3.6. Ectopically expressed HDAC3 and IKKα play antagonistic roles……….…54

3.7. IKK Kinase activity is increased by HDAC2 knockdown but not HDAC1 and

3 knockdown………………………………………………………………….…57

3.8. IκBα phosphorylation and protein levels in HDAC1, 2, and 3 knockdown are

comparable to control when proteosomal degradation is blocked………………59

3.9. Knockdown of HDAC3 in HeLa cells treated with TNFα causes changes in

NF-κB regulated gene expression………………………………………………..59

3.10. HDAC3 Knockdown causes changes in protein binding at the promoters of

NF-κB regulated genes…………………………………………………………..63

3.10.1. IκBα promoter……………………………………………….…..66

3.10.2. IL-8 promoter…………………………………………………….66

3.10.3. cIAP2 promoter…………………………………………………..71

3.11. Individual knockdown of HDAC1, HDAC2, and HDAC3 causes HeLa cells

to proliferate slower than vector control cells……………………………………71

4. Discussion………………………………………………………………………..73

References………………………………………………………………………………..84

viii

List of Tables

2.1 ID# and target sequence of lentiviral shRNAs…………………………………..22

2.2 RT PCR Primers…………………………………………………………………28

2.3 ChIP PCR Primers ...... 33

List of Figures

1-1 Figure 1. NF-κB regulated genes ...... 2

1-2 Figure 2. Members of the NF-κB/Rel family...... 3

1-3 Figure 3. Classical NF-κB activation ...... 5

1-4 Figure 4. IκB family members ...... 8

1-5 Figure 5. HATs and HDACs……………………………………………………..12

1-6 Figure 6. The HDAC family of Corepressors……………………………………15

3-1 Figure 7. Individual HDAC 1, 2, and 3 Protein Knockdowns in HeLa cells…….39

3-2 Figure 8. Nuclear NF-κB is affected by individual knockdowns………………..43

3-3 Figure 9. Individual HDAC 1, 2, and 3 Knockdown affects IκBα……………....48

3-4 Figure 10. IκBα half-life is not significantly altered by HDAC3 KD…………...52

3-5 Figure 11. Knockdowns enhance nuclear IKKα…………………………………55

3-6 Figure 12. Ectopically expressed HDAC 3 and IKKα…………………………..56

3-7 Figure 13. Knockdown of HDAC 2 affects IKK Kinase activity…………….…58

3-8 Figure 14. IκBα phosphorylation with blocked proteosomal degradation………60

3-9 Figure 15. Knockdown of HDAC3 causes changes in gene expression…………61

3-10 Figure 16. HDAC3 Knockdown causes changes at the IκBα promoter…………64

3-11 Figure 17. HDAC3 Knockdown causes changes at the IL-8 promoter………….67

3-12 Figure 18. HDAC3 Knockdown causes changes at the cIAP2 promoter………..69

3-13 Figure 19. Knockdown of HDAC1, 2, and 3 slows proliferation……………….72

4-1 Figure 20. Hypothesized HDAC3 effects on the NF-κB pathway……………....82

List of Abbreviations

CE……………………………………………………………………..Cytoplasmic Extract CBP………………………………………………………………...CREB Binding Protein ChIP……………………………………………….Chromatin Immunoprecipitation Assay cIAP2………………………………………………………Cellular Inhibitor of Apoptosis CoREST……………………………………………………………...Corepressor of REST CPM…………………………………………………………………….Counts per minute

HAT……………………………………………………………..Histone Acetyltransferase HDAC………………………………………………………………...Histone Deacetylase HD1KD……………………………………………………………….HDAC3 knockdown HD2KD……………………………………………………………….HDAC2 knockdown HD3KD……………………………………………………………….HDAC3 knockdown

IκB………………………………………………………………………….Inhibitor of κB IKK……………………………………………………………………………..IκB Kinase IL-1……………………………………………………………………………Interleukin 1 IL-8……………………………………………………………………………Interleukin 8

LPS…………………………………………………………………….Lipopolysaccharide

MCP-1……………………………………………… Monocyte Chemoattractant Protein 1 MSK1………………………………….…Mitogen- and Stress-activated Protein Kinase 1

NAD………………………………………………….Nicotinamide Adenine Dinucleotide N-CoR………………………………………………………Nuclear Receptor Corepressor NE………………………………………………………………………….Nuclear Extract NF-κB……………………………………………………………..Nuclear Factor kappa B NLS…………………………………………………………..Nuclear Localization Signal

PCAF………………………………………………………..p/300/CBP Associated Factor PVDF………………………………………………………………….polyvinyl difluoride

RHD……………………………………………………………….Rel Homology Domain RNAi…………………………………………………………………….RNA interference shRNA…………………………………………………………………..short hairpin RNA xii

SMRT…………………Silencing Mediator for Retinoid and Thyroid Hormone Receptors

TAD……………………………………………………………….Transactivation Domain TBST…………………………………………………Tris Buffered Saline with Tween-20 TNFα……………………………………………………………..Tumor Necrosis Factor α TSA………………………………………………………………………….Trichostatin A

xiii

Chapter 1

Introduction

1.1. NF-κB/Rel proteins

Nuclear factor kappa B (NF-κB) is a family of dimeric transcription factors that activate expression of genes responsible for inflammatory and immune responses, cell survival, anti-apoptosis, apoptosis, and negative feedback through transcriptional activation of inhibitor of κB (IκB) proteins [1-3]. NF-κB regulated genes and disease states where dysregulation of NF-κB occur are listed in Figure 1. The NF-κB/Rel family consists of RelA (p65), RelB, c-Rel, p105/p50, and p100/p52 [3, 4](Figure 2). All Rel family members contain a conserved 300- amino acid sequence called the Rel homology domain (RHD) at the amino terminus responsible for dimerization, nuclear localization, and DNA binding [3]. RelA, RelB, and c-Rel each contain a carboxy-terminal transactivation domain (TAD) that is responsible for activating transcription [2]. Rel proteins form homo- and heterodimers that serve specific purposes in response to specific inducers. Classical NF-κB is composed of a p65/p50 heterodimer that remains inactive while bound to an inhibitor of NF-κB (a member of the IκB protein family) in the cytoplasm.

1-1 Figure 1. NF-κB regulated genes and diseases with NF-κB dysregulation. NF-

κB regulates genes involved in survival, apoptosis, proliferation, immunity, and its own negative feedback. Dysregulation of NF-κB is seen in many disease states including cancer, cachexia, neurological disorders, chronic inflammation, heart disease, and viral infection.

1-2 Figure 2. Members of the NF-κB/Rel family of transcription factors. The NF-

κB/Rel family consists of RelA (p65) RelB, c-Rel, p100 which is cleaved to form p52, and p105 which is cleaved to form p50. All family members contain a Rel Homology

Doman (RHD). RelA, RelB, and c-Rel contain a Transactivation Domail (TAD).

1.2. NF-κB activation

The pathway leading to NF-κB activity is induced by a variety of stimuli, including inflammatory cytokines (such as TNFα), bacterial toxins (such as lipopolysaccharides), mitogens, phorbol esters, UV light, viruses, and more [3]. In the classical NF-κB pathway, these signals converge on the IκB kinase (IKK) complex [5].

The IKK complex contains IKKα and IKKβ which are catalytic subunits as well as IKKγ

(NEMO) that acts as a regulatory scaffolding protein [6, 7]. IKKs become activated through phosphorylation. IKKβ and IKKγ are necessary and sufficient for IκBα

(inhibitor of NF-κB) phosphorylation. IKK proteins regulate NF-κB nuclear translocation by phosphorylating IκBα. Phosphorylated IκBα is ubiquitinated on lysines

21 and 22 and degraded by the 26S proteasome [7-10]. Upon removal of IκBα the NF-

κB nuclear localization signal is exposed allowing the p65/p50 heterodimer to shuttle into the nucleus and bind to the promoters of NF-κB regulated genes to activate transcription.

NF-κB activates transcription of its own inhibitor, IκBα, causing a negative feedback loop to regulate the duration of NF-κB activity [11, 12]. Newly synthesized IκBα protein enters the nucleus, binds to NF-κB and transports NF-κB back out to the cytoplasm [13].

1.3. Inhibitor of κB (IκB) proteins

NF-κB activity is inhibited in uninduced cells by the IκB family of inhibitor proteins. The IκB family members include: IκBα, IκBβ, IκBε, IκBγ, BCL-3, and IκBζ

(Figure 4) [1, 3, 13, 14]. IκB proteins contain ankyrin repeats which are responsible for protein-protein binding [15]. Ankyrin repeats are 33 residue motifs in proteins that exibit helix-turn-helix conformation, they are conserved from yeast and Drosophila.

1-3 Figure 3. Activation of the Classical NF-κB Pathway. When a cell is stimulated the IKK complex (IKKα/β/γ) becomes activated and phosphorylates serines 32 and 36 on

IκBα. Phosphorylated IκBα is ubiquitinated on lysines 21 and 22 and degraded by the

26S proteasome. Removal of IκBα exposes the nuclear localization signal (NLS) on NF-

κB enabling NF-κB to translocate to the nucleus, bind to promoters, and activate transcription of various genes, including IκBα. Newly synthesized IκBα protein enters the nucleus, binds to NF-κB, and takes NF-κB back out to the cytoplasm completing the negative feedback loop.

Unprocessed p100 and 105 still contain ankyrin repeats and bind to NF-κB proteins to inhibit activity as well [3]. Specific IκB proteins bind to certain NF-κB family members and combinations of members [3]. IκBα is the best characterized of the IκBs and consists of 3 main regions: an N-teminal region responsible for signal dependent degradation, an ankyrin repeat domain responsible for protein binding, and a C-terminal region that regulates basal degradation [16, 17]. In classical NF-κB, the first two ankyrin repeats of

IκBα cover the p65 NLS and the sixth ankyrin repeat covers the NF-κB binding cleft in the p50/p65 heterodimer [18]. IκBα binds the p50/p65 heterodimer in the cytoplasm until IκBα is phosphorylated at serines 32 and 36 during classical NF-κB induction [3].

The phosphorylated phospho-acceptor sites of IκBα signal for E3RS an SFC-like E3 ubiquitin ligase [8]. After phosphorylation, IκBα is ubiquitinated on lysines 21 and 22 and degraded by the 26S proteasome [8]. Degradation of IκBα unmasks the NLS on p65 and p50 allowing NF-κB to translocate to the nucleus and activate transcription. IκBα transcription is then activated by NF-κB. When new IκBα protein is synthesized it travels into the nucleus, binds to NF-κB, and removes NF-κB from promoters [19].

IκBα has an N-terminal nuclear export signal, so it removes NF-κB from the nucleus, completing a negative feedback loop that restores equilibrium in the cell (Figure 3) [19,

20].

1.4. IκB kinases

I kappa B kinases (IKK) regulate activation of the NF-κB pathway by phosphorylating IκB. Phosphorylation of IκB proteins leads to their degradation and subsequent NF-κB transcriptional activation. In the classical NF-κB pathway signals from various stimuli converge at a high molecular weight IKK complex consisting of two 7

1-4 Figure 4. IκB Family Members. A. Members of the IκB (inhibitor of NF-κB) family of proteins. The ovals represent ankyrin repeats. Serines 32 and 36 of IκBα are indicated, and these are the sites that get phosphorylated during classical NF-κB activity.

B. The classical NF-κB heterodimer, composed of p50 and p65, is bound to IκBα and sequestered in the cytoplasm in uninduced cells. 8

catalytic subunits, IKKα and IKKβ, and a regulatory scaffolding subunit, IKKγ (NEMO)

[6, 7, 21-23]. IKKα and IKKβ share fifty percent sequence identity and are structurally similar with amino terminal kinase domains, helix-loop-helix (HLH) domains important for modulating IKK kinase activity, and leucine zipper (LZ) domains that allow dimerization of the kinases. Activation of IKKα requires phosphorylation of serines 176 and 180, and activation of IKKβ requires phosphorylation of serines 177 and 181 [24].

IKKγ is a 419 amino acid protein that contains two coil-coil domains, an NOA domain responsible for ubiquitin binding, a leucine zipper (LZ) domain, and a zinc finger domain

(ZF) that also has ubiquitin activity. Lysine 63 linked, non-degradative polyubiquitination is necessary for IKKγ functioning in the NF-κB pathway [7, 23].

Both IKKα and IKKβ are capable of phosphorylating IκBα in vitro, but IKKβ and IKKγ are the proteins necessary and sufficient to phosphorylate IκBα, signaling for its degradation in classical NF-κB signaling [24, 25]. IKKα contains a putative NLS that could be responsible for its shuttling between the cytoplasm and nucleus which it does, independent of IKKβ and IKKγ [26].

IKK proteins also regulate transcription through phosphorylation of coactivators and corepressors. IKKα phosphorylates CREB binding protein (CBP), a coactivator with lysine acetyltransferase activity, and causes it to change binding preference from p53 to

NF-κB [27]. The lysine acetyltransferase activity of CBP enhances transcription, so when IKKα phosphorylates CBP a switch from an apoptotic to a survival pathway occurs. IKKα is also responsible for SMRT derepression [28]. SMRT is a corepressor that binds to chromatin to block NF-κB transcriptional activation. Derepression happens 9

when corepressor complexes are phosphorylated and exported from the nucleus [28].

Histone deacetylase 3 (HDAC3) is recruited to promoters to increase repression. IKKα directly phosphorylates SMRT resulting in SMRT and HDAC3 being exported from the nucleus [28]. SMRT derepression is required for NF-κB transcription [28]. Therefore,

IKK proteins activate NF-κB by phosphorylating IκB and corepressors, and IKK proteins enhance NF-κB activity by phosphorylating coactivators. It is interesting to note that

IKKα and HDAC3 have roles at the promoters of NF-κB regulated genes and both proteins have the ability to shuttle back and forth between the nucleus and cytoplasm.

IKKα phosphorylates proteins at the promoters of NF-κB genes to regulate transcription [29, 30]. IKKα regulates NF-κB through phosphorylation of p65 and histone H3 [29, 31, 32]. IKKα phosphorylates histone H3 leading to another posttranslational modification, acetylation of lysine 14 on histone H3 [29-31]. This acetylation causes increased NF-κB regulated gene transcription. IKKα also phosphorylates p65 leading to reversible acetylation of p65 which affects the duration of

NF-κB transcriptional activity [33-36]. IKKα phosphorylation of p65 affects NF-κB

DNA binding, but how binding is affected depends on the promoter [37]. For example,

IKKα is recruited to the mcp-1 promoter to remove promoter bound HDAC3 and p65 binding to DNA is increased; however the absence of IKKα at the iκbα promoter results in better p65 binding to DNA [37]. IKKα promoter specificity adds another level of complexity to regulation of NF-κB transcriptional activity.

1.5. Transcriptional coactivator and corepressor proteins

1.5.1. Coactivators:

Coactivator proteins enhance the ability of transcription factors to activate transcription [38]. Coactivators alter chromatin structure through posttranslational modification of core histone proteins. Transcription factors and other proteins involved in transcription are also modified by coactivators. NF-κB regulated gene transcription is enhanced by coactivator proteins [39, 40]. The acetylation status of histones determines which parts of the chromatin are available for basal transcription machinery and transcription factors such as NF-κB [41]. The packaging of DNA involves compacting into chromatin and forming tight nucleosomes, and chromatin remodeling must occur to provide access to promoters [41, 42]. The nucleosome is composed of an octamer of core histones (two of each: H2A, H2B, H3, and H4) and DNA that is wrapped around the core histones. Histone acetyltransferases (HATs) are coactivators. HATs acetylate amino- terminal histone tails which changes their charge causing DNA to bind less tightly around the core histones. Loosening of the chromatin allows room at the promoters for basal transcription machinery and transcription factors to bind [41, 43-45]. HATs also interact with non-histone proteins, such as transcription factors [38]. Coactovators CREB binding protein (CBP)/p300 and p/300/CBP associated factor (p/CAF) interact directly with the p65 subunit of NF-κB to enhance transcription [39, 40, 46].

1.5.2. Corepressors:

Corepressor proteins repress transcriptional activity through posttranslational modifications of histones, transcription factors, and other proteins involved in transcription. Corepressors repress transcription of NF-κB regulated genes. Histone 11

1-5 Figure 5. HATs and HDACs. A. HATs acetylate lysine residues on amino-ε histone tails to enhance transcription. HATs acetylate lysines on non-histone proteins with varying effects depending on the specific residue(s) modified. B. HDACs deacetylate lysines on histones tails to repress transcription. HDACs also deacetylate non-histone proteins.

deacetylases (HDACs) alter chromatin structure by deacetylating lysine residues on the

N-terminal tails of histone proteins. Deacetylation of histones causes chromatin to bind tighter to histones making nucleosomes more compact [42]. Chromatin compaction blocks binding of transcription factors to promoters and represses transcription [42].

HDACs all contain a conserved deacetylase domain; however, HDACs usually require interactions with other proteins to carry out deacetylase activity. HDACs are often found in corepressor complexes with such proteins as NuRD, CoREST, Sin3, N-CoR, and

SMRT [28, 47-51]. HDAC activity as well as the function they serve at a particular promoter is dependent on which proteins do the recruiting.

HDAC activity is balanced by the activity of HATs. HATs and HDACs both interact with histone and non-histone proteins, including transcription factors, to regulate gene expression. The balance between HAT and HDAC activity in response to cellular signals contributes to maintaining the overall transcription levels in the cell.

1.6. HDAC Family of corepressors

There are eighteen known mammalian HDACs which are divided into four classes based on their homology to yeast HDACs (Figure 6). In mammals class I contains HDACs 1, 2, 3, and 8 which are homologous to the yeast Rpd3 HDACs.

Mammalian class II contains HDACs 4, 5, 6, 7, 9, and 10 which are homologous to yeast hda1. Class III HDACs are known as the sirtuins (SIRT1-7) (homologous to yeast Sir2), and their deacetylase function is coupled with NAD hydrolysis [52, 53]. Because class

III HDACS function by a different mechanism than class I and II, Pan-HDAC inhibitors like trichostatin A (TSA) that inhibit class I and some class II HDAC activity do not

1-6 Figure 6. HDAC Family of Corepressors. There are 18 known mammalian

HDACs separated into four classes. The grey boxes represent deacetylase domains and stars indicate the proteins researched for this project.

inhibit the sirtuins [53]. Class IV includes HDAC 11 and related proteins, but this group is not well characterized [53].

1.7. HDAC1, HDAC2, and HDAC3

HDACs are responsible for altering chromatin structure through posttranslational modification of core histones to regulate the overall amount of transcription that is taking place. HDACs mostly function within corepressor complexes [52]. HDACs 1 and 2 are found in many complexes together. Corepressor complexes containing HDACs 1and 2 interact with p50 and p65 at the promoters of certain NF-κB regulated genes [52, 54].

Also associated with p65 and NF-κB regulated genes is HDAC3 [36]. HDAC3 associates with SMRT and N-CoR in complexes which are different from those that contain HDACs

1 and 2 [28, 47-51]. Another trait that differs in HDAC3 is the ability to shuttle back and forth between the nucleus and cytoplasm [52]. HDACs 1 and 2 are predominantly found in the nucleus [52]. Most of the HDAC regulation of classical NF-κB is done by Class I

HDACs 1, 2, and 3 and Class III HDAC SIRT1. My project focuses on 3 particular class

I HDACs: HDACs 1, 2, and 3.

HDAC inhibitors that are commonly used in research and clinical trials inhibit many HDAC proteins. For example, Trichostatin A (TSA) inhibits all class I HDAC activity and to a lesser extent, class II HDAC activity. TSA renders class I and II

HDACs unable to perform their deacetylase functions [53]. This has widespread consequences, including an overall increase in NF-κB activity meaning higher expression of NF-κB regulated genes. TSA prolongs TNFα stimulated NF-κB nuclear localization and DNA binding [36, 54, 55]. IKK activity is also prolonged with TSA treatment in

TNFα induced cells [53]. Since NF-κB is affected at so many levels by HDAC 16

inhibition, it is important to discern individual roles for the HDAC proteins in order to develop more specific treatments for diseases involving NF-κB dysregulation.

1.8. Regulation of NF-κB by posttranslational modifications

Posttranslational modifications, such as phosphorylation and acetylation, play very important roles in regulating classical NF-κB activity. Phosphorylation of IKK and

IκBα are important for signal transduction that causes NF-κB to translocate to the nucleus

[56, 57]. IKKα phosphorylates coactivators CBP and p300, as well as, serine 10 on histone H3 at promoters, favoring NF-κB transcriptional activity [27, 58]. Depending on the stimulus and specific promoter IKKα, IKKβ, mitogen-and-stress-activated protein kinase (MSK1), or PKA are recruited to histone H3, which leads to enhanced transcription of NF-κB regulated genes [46, 59, 60]. Various kinases phosphorylate p65 on serines 276, 311, and 536. Phosphorylation of serine 276 enhances interaction with

CBP, dimerization, and DNA binding and inhibits binding of corepressors to enhance transcription [61, 62]. Serine 311 phosphorylation on p65 enhances NF-κB transcriptional activation [63, 64]. Phosphorylation of p65 occurs at two sites within the carboxyterminal TAD, serines 529 and 536 resulting in enhanced NF-κB transcriptional activity [65-69]. Serine 536 can be phosphorylated by the IKKs, and phosphorylation at this site decreases affinity for IκBα.

Acetylation and deacetlyation alter chromatin structure, protein-protein interactions, and certain protein’s ability to bind DNA which all have consequences for transcriptional activity. Hyperacetylation of histones H3 and H4 are seen at the promoters of many NF-κB regulated genes with high transcriptional activity [70, 71].

Identified acetylation sites on p65 include lysines 122, 123, 218, 221, and 310 [35, 72]. 17

Acetylation at lysines 122 and 123 of p65 actually reduces binding to DNA and NF-κB transcriptional activity, whereas acetylation of p65 on lysines 218 and 221 increases

DNA binding and decreases binding to IκBα resulting in increased NF-κB mediated transcription [35, 72]. p65 acetylation at lysine 310 is required for full transcriptional activity [35].

It has been suggested that there is a code of modifications that signal for specific transcriptional activities. For example phosphorylation of p65 recruits CBP which acetylates p65 and enhances NF-κB transcription [33]. Also, IKKα phosphorylates histone H3 leading to acetylation of H3 causing enhanced NF-κB transcription. To make the code even more complex, certain combinations of modifications seem to be promoter/gene specific. Plus, as in the p65 examples above, many proteins have multiple phosphorylation and acetylation sites that signal for different functions.

Chapter 2

Methods

2.1. Cells and Reagents

HeLa and HEK293T cells were maintained at 37° Celsius in an incubator with 5%

CO₂. Cells were cultured in HyClone® DMEM/high glucose (Thermo Scientific) supplemented with 10% Fetal Bovine Serum (FBS) (Gibco®, Invitrogen™) and 0.5%

Penicillin/Streptomycin (Mediatech Inc., Manassas, VA). Cells were treated with TNFα

(Invitrogen, Camarillo, CA) at a final concentration of 10 ng/mL for the indicated times.

Puromycin (InvivoGen, San Diego, CA) was used at a final concentration of 2μg/mL.

Polybrene (Millipore™, Billerica, MA) was used at a final concentration of 8 μg/mL.

HDAC1, HDAC2, HDAC3, IKKα, IKKγ, IκBα, p65,and lamin A/C primary antibodies were obtained from Santa Cruz Biotechnology, Inc. (Dallas, Texas). IKKβ, IKKα, p-p65

(S536), p-IκBα, and Ac-K (Ac-K-103) antibodies were obtained from Cell Signaling

Technology, Inc. (Boston, MA). β-actin antibody was obtained from abcam®

(Cambridge, MA). Anti-Ubiquitin antibody was obtained from BD Pharmingen™ (BD

Biosciences, San Jose, CA). Anti-rabbit (H&L) HRP and anti-mouse (H&L) HRP secondary antibodies were obtained from Promega Corporation (Madison, WI).

2.2 Knockdown of HDACs 1, 2, and 3 using RNAi

Expression of Hdac1, Hdac2, and Hdac3 genes were individually knocked down in

HeLa cells using an shRNA approach. A lentiviral RNAi system from OpenBioSystems

(Huntsville, AL) was used to generate HeLa cell lines stably expressing the shRNAs.

The RNAi Consortium collection from OpenBioSystems includes a library of short hairpin RNAs (shRNAs) cloned into a pLKO.1 lentviral vector that contains a puromycin resistance gene. For virus production human embryonic kidney (HEK) 293T cells were transfected with an expression plasmid (pLKO.1 puro, 1 μg), packaging plasmids (RRE

0.9 μg, RSV 0.9 μg, and VSVG 0.1 μg), and the appropriate shRNA expression plasmid using TransIT®-LT1 Transfection Reagent (Mirus Bio LLC, Madison, WI) to produce the lentivirus that was then harvested and used to infect HeLa cells. The lentivirus was harvested by collecting the media from the HEK-293T cells 40 hours after transfection and freezing it at -20°C. New media was added to the HEK-293T cells and collected again after another 24 hours. The two viral harvests were combined, centrifuged at 1250 rpm to pellet any cells in the media, and aliquoted into 1.0 mL aliquots in sterile polystyrene microfuge tubes. Aliquots not used right away were stored at -80°C. One

1.0 mL aliquot was used to infect a 60 mm plate of HeLa cells containing 4.0 mL of growth media (DMEM with 10% FBS). Puromycin was added to the HeLa cells 24 hours after infection to select for cells with HDAC knockdown. A minimum of four days later, cells were analyzed for protein knockdown by Western Blot using antibodies specific for the proteins of interest.

Originally, five different shRNAs were tested for maximal knockdown of expression of each gene. Each shRNA targets a different part of the mRNA of interest. 20

The shRNA that caused the greatest amount of protein knockdown was used to create a stable cell line. Three individual HDAC knockdown HeLa cell lines were created

(HD1KD = HDAC1 knockdown, HD2KD = HDAC2 knockdown, and HD3KD =

HDAC3 knockdown), as well as a control HeLa cell line (HC). All the identification numbers and target sequences for the shRNAs tested are listed in Table 2.1. The shRNAs used to make stable cell lines are highlighted. More information about the RNAi

Consortium (TRC) and the vector and shRNAs used can be found at:

http://www.broadinstitute.org/rnai/public/

Table 2.1. Identification numbers and target sequences of the shRNA constructs used to produce lentivirus for individual HDAC1, HDAC2, and HDAC3 knockdown

HDAC1 Clone ID Target Sequence shRNA1 TRCN0000004814 CGTTCTTAACTTTGAACCATA shRNA2 TRCN0000004815 CGGTGGTTACACCATTCGTAA shRNA3 TRCN0000004816 GCCGGTCATGTCCAAAGTAAT shRNA4 TRCN0000004817 CCGCAAGAACTCTTCCAACTT shRNA5 TRCN0000004818 GCTGCTCAACTATGGTCTCTA HDAC2 Clone ID Target Sequence shRNA1 TRCN0000004819 CAGTCTCACCAATTTCAGAAA shRNA2 TRCN0000004820 CCAGCGTTTGATGGACTCTTT shRNA3 TRCN0000004821 GCCTATTATCTCAAAGGTGAT shRNA4 TRCN0000004822 GCAGACTCATTATCTGGTGAT shRNA5 TRCN0000004823 GCAAATACTATGCTGTCAATT HDAC3 Clone ID Target Sequence shRNA1 TRCN0000004824 GTACCTATTAGGGATGGAGAT shRNA2 TRCN0000004825 CCTTCCACAAATACGGAAATT shRNA3 TRCN0000004826 GCACCCAATGAGTTCTATGAT shRNA4 TRCN0000004827 CGGTCTCTATAAGAAGATGAT shRNA5 TRCN0000004828 GCACCTAGTGTCCAGATTCAT

2.3. Whole Cell Extracts

After the indicated treatments, cells were harvested by removing media, washing with PBS, removing PBS, adding 1.0 ml PBS, scraping cells off plates, transferring cells to microcetrifuge tubes, and cells were pelleted by centrifugation at 13,000 rpm for 1 min. The whole cell extracts were collected from cells lysed with cell lysis buffer (150 mM Tris-HCl, pH 7.5; 200 mM NaCl, 1% Triton X-100; 0.1% NP-40; 10 mM EDTA,

protease and phosphatase inhibitors). Cells were pipetted up and down with cell lysis buffer and incubated on ice for 20 minutes, followed by centrifugation at 13,000 rpm for

15 min at 4°C. The supernatant (cell lysate) was transferred to a new tube and protein concentration was determined by performing a Bradford Assay with Bio-Rad protein assay reagent (Bio-Rad, Hercules, CA). The volume for the desired protein amount was then added to new microcentrifuge tubes with 2X SDS-PAGE sample buffer (5.0 mL

TRIS pH 6.8, 8.0 mL glycerol, 16.0 mL 10% SDS, 4.0 mL β-mercaptoethanol, 17.0 mL ddH₂O). Samples were then used for Western Blot analysis.

2.4. Cytoplasmic and Nuclear Extracts

After the indicated treatments, cells were harvested by removing media, washing with PBS, removing PBS, adding 1.0 ml PBS, scraping cells off plates, transferring cells to microcentrifuge tubes, and cells were pelleted by centrifugation at 13,000 rpm for 1 min. Cytoplasmic and nuclear fractions were collected from cells by following the

Dignam method [73]. The cells were resuspended in 5 pellet volumes of cytoplasmic extract (CE) buffer (10 mM Hepes pH 6.7, 60 mM KCl, 1mM EDTA, 0.3% NP-4 ,1mM

DTT, 1 mM PMSF, 10.0 μl/ml protease inhibitor and phosphatase inhibitor cocktails), mixed gently and incubated on ice for 3 min. The samples were pelleted by centrifugation at 2000 rpm for 4 min at 4°C. The cytoplasmic extracts (supernatant) were collected and placed in new tubes, leaving the nuclear pellet behind. The nuclear pellet was washed with CE buffer without NP-40 (same recipe but with no NP-40) and mixed gently. Pellets were centrifuged as before, and the CE wash buffer was removed and discarded. Two pellet volumes of nuclear extract (NE) buffer (20 mM Tris pH 8.0, 420

mM NaCl, 1.5 mM MgCl₂, 0.2 mM EDTA, 25 % glycerol, H₂O, 1 mM PMSF, 10.0

μl/ml protease inhibitor and phosphatase inhibitor cocktails) was added to the nuclei and pipetted up and down. Salt concentration was adjusted to 400 mM by adding 5 M NaCl.

Samples were vortexed and incubated on ice for 20 min. Both cytoplasmic and nuclear extract samples were centrifuged at 13,000 rpm for 15 min at 4°C. Extracts were moved to new tubes and glycerol was added to cytoplasmic extract samples to 20% of the volume. Samples were stored at -20°C short term and -80°C long term.

2.5. Western Blot Analysis

For Western Blot analysis, lysates were prepared by mixing equal protein amounts with 2X SDS-PAGE sample buffer and boiled for 5-10 min followed by centrifugation at 13,000 rpm for 1 min. Sample proteins were separated on a 10% SDS

(Boston Bioproducts, Ashland, MA) polyacrylamide gel. The proteins were transferred to a PVDF membrane (Thermo Fisher Scientific, Rockford, IL) that was then blocked in

1XTBST (20 mM Tris-HCl, 137 mM NaCl, 0.1% Tween-20) with 5% non-fat dry milk, washed with 1X TBST 3x5 min and probed with the indicated primary antibody overnight at 4°C with rotation. All primary antibodies were used at a 1:1000 dilution in

1XTBST. The membranes were washed with 1X TBST 3x10 min and an HRP-secondary antibody was added for 60 min with rotation. Anti-Rabbit HRP antibody was used at a

1:20,000 dilution in 1X TBST. Anti-Mouse HRP antibody was used at a 1:10,000 dilution in 1X TBST. Membranes were washed in 1X TBST 3x10 min. Pico West

Chemiluminescent reagent (Pierce, Rockford, IL) was added to the membranes and

images were captured on autoradiography film (LabScientific, Highlands, NJ) or the

Kodak Image Station 4000R Pro utilizing Kodak MI SE software.

2.6. Densitometry

Band intensities on Western Blots and ethidium bromide stained gels were measured using Kodak MI SE software. Data were quantified by dividing the intensity of the band of interest by its respective loading control and represented as relative intensities.

2.7. Electrophoretic Mobility Shift Assay (EMSA)

A double stranded DNA probe that contains an NF-κB binding site was radiolabeled using the following protocol: two strands of the EMSA probe (UV1:

CAGGGCTGGGGATTCCCCATCTCCACAGTTTCACTTC; and UV2:

GGTGTCAAAGTGAAG) were annealed and the overhang was filled in to label with

³²P, 2.0 μl annealed probe (UV21), 4.0 μl 10 mM dATP, 4.0 μl 10 mM dTTP, 4.0 μl 10 mM dGTP, 1.0 μl 0.1 mM dCTP, 5.0 μl 10X Klenow buffer, 19.0 μl ddH₂O, 10.0 μl ³²P- dCTP, and 1 μl Klenow was mixed in a 1.5 ml tube and incubated in a heat block at 37°C for 45 min. 5.0 μl of cold 10.0 mM dCTP was added to the mix and incubated at 37°C for 15 min. Microspin G-50 columns were used to remove free ³²P-dCTP from the labeled probe mixture. The probe was cleaned and a 1.0 μl sample was counted using a scintillation counter to find the counts per minute (CPM) per μl. A binding reaction was done with the nuclear extracts and the radiolabeled probe. A tube was set up for each nuclear extract sample (collected by same protocol as cytoplasmic and nuclear extract protocol) plus an extra tube for a mock reaction. 5.0 μg of NE sample was added to each

tube and the volume was brought up to 10.0 μl with ddH₂O (mock sample was 10.0 μl ddH₂O). Then a master mix was prepared with 4.0 μl/sample 5X binding buffer (500μl :

25.0 μl 5M NaCl, 25.0 μl 1M Tris pH 7.7, 312.5 μl 80% Glycerol, 2.5 μl 1M DTT, 2.5 μl

0.5 M EDTA, and 132.5 μl ddH₂O), 1.0 μl/sample poly dI-dC, 20,000 CPM/sample labeled probe, and the volume was brought up to 10 μl/sample with ddH₂O. 10.0 μl master mix was added to each tube with NE and ddH₂O mix. Samples were incubated for 15 min and just before 15 min was up 4.0 μl 6X DNA dye (0.25% bromophenol blue,

0.25% xylene cyanol FF, and 15% Ficoll in ddH₂O) was added to the mock sample for tracking. The entire samples were loaded on a polyacrylamide non-denaturing gel (50.0 ml: 6.6 ml 40% Acrl-Bis, 5.0 ml 50% Glycerol, 5.0 ml 10XTGE (1.0 L: 30.28 g TRIS,

142.00 g Glycine, 3.72 g EDTA, up to 1.0 L with ddH₂O), 33.4 ml ddH₂O, 400.0 μl APS, and 50.0 μl TEMED) and run at 20 milliamps for 2.5 hours (keep bottom dye, xylene cyanol, about an inch from the bottom of the gel). Prior to loading the gel was pre-run for 15-30 minutes at 20 milliamps. After the gel was done running it was transferred to a piece of Whatman™ 3MM Chromatography Paper (Fisher Scientific, Rockford, IL).

Another piece of Whatman paper was placed under the first and saran wrap was placed on top of the gel. The gel was then dried on a Welch GelMaster vacuum gel dryer

(Gardner Denver, Niles, IL) for 60 min at 80°C. After drying the gel was exposed to autoradiography film or phosphor-screen 12-24 hours. Film was developed by the SRX-

101A film processor (Konica Minolta, Newark, NJ). Phosphor-screens were scanned on a Typhoon TRIO Variable Mode Imager from GE Healthcare.

2.8. RNA Isolation

After treatment with TNFα cells were harvested and pelleted by the same method used in “Whole Cell Extract” protocol. 1.0 ml of TRIzol (Invitrogen) reagent was added to the cell pellet and pipetted up and down until homogenized. Samples were incubated for 5 min at room temperature on a Nutator. 200 μl of chloroform was added and samples were vortexed and incubated on the Nutator for 3 min at room temperature.

Samples were then centrifuged at 12,000 x gravity (g) for 15 min at 4°C after which, the aqueous (upper) phase of the samples were transferred to new tubes. RNA was precipitated by adding 500 μl of isopropyl alcohol, incubating at room temperature for 10 min, and centrifugation at 12,000 x g for 10 min at 4°C. The supernatant was removed and 1.0 ml of 75% ethanol was used to wash the pellets. Samples were mixed with the vortex and then centrifuged at 7,500 x g for 5 min and 4°C. The supernatant was removed being careful not to disturb the pellet. The pellets were air dried to remove as much ethanol as possible without letting the pellet completely dry. Pellets were resuspended in 30-50 μl of ddH₂O, pipetted up and down, and incubated at 55-60°C for

10 min. RNA concentration was determined by making a 1:100 dilution and reading it with a UV spectrometer. Samples were stored at -80°C.

2.9. Reverse Transcription Polymerase Chain Reaction (RT-PCR)

For RT-PCR 2.0 μg of total cellular RNA was added to a microcentrifuge tube.

Each new tube also contained 1.0 μg random hexamer primers and enough ddH₂O to bring the total volume up to 7.0 μl. The RNA was denatured by incubating at 70°C for

10 min, transferred to ice for a quick chill, and centrifuged at 13, 000 rpm for 1 min.

Samples were transferred into 0.2 ml PCR tubes. 13.0 μl of a master mix (per sample:

4.0 μl 5X M-MLV RT buffer, 1.0 μl 10 mM dNTPs, 0.5 μl RNase inhibitor, 0.8 μl M-

MLV RT (reverse transcriptase (Promega), and 6.7 μl nuclease free H₂O) was added to the PCR tubes. The reverse transcriptase (RT) reaction to make cDNA was carried out in a thermocycler set to 37°C for 1 hour, 85°C for 5 min., and 4°C until samples were removed. cDNA was stored long term at -20°C. 1.0 μl of cDNA was used as a template for the PCR reactions. In addition to the cDNA, 24.0 μl of a master mix (per sample: 0.5

μl 10μM 5’ primer, 0.5 μl 10μM 3’ primer, 10.0 μl 5 Prime Mastermix, 13.0 μl H₂O) was added to each PCR reaction. Table 2 contains a list of primers used for RT PCR.

Samples were placed in a thermocycler for PCR and set to specific temperatures and cycle numbers for each gene. PCR products were analyzed by adding 5.0 μl 6X DNA dye and running samples on a 0.8% agarose gel with 0.5 μg/mL ethidium bromide.

Table 2.2 RT-PCR Primers

Annealing # of PCR Gene Primer Sequence Temperature Cycles Forward 5'-GCCTGGACTCCATGAAAGAC-3' IκBα 55.0°C 25 Reverse 5'-CTTCCATGGTCAGTGCCTTT-3' Forward 5'-ATGCTTTTGCTGTGATGGTG-3' cIAP2 52.5°C 28 Reverse 5'-TGAACTTGACGGATGAACTCC-3' Forward 5'-CTCTCTTGGCAGCCTTCCT-3' IL-8 52.5°C 27 Reverse 5'-AATTTCTGTGTTGGCGCAGT-3' Forward 5'-CCCCAGTCACCTGCTGTTAT-3' MCP1 55.0°C 25 Reverse 5'-TGGAATCCTGAACCCACTTC-3' Forward 5'-GGACTTCGAGCAAGAGATGG-3' β-actin 55.0°C 25 Reverse 5'-AGCACTGTGTTGGCGTACAG-3'

2.10. Real Time RT PCR

RNA was isolated and cDNA was made as described in RT-PCR section. 1.0 μl cDNA was used as a template for quantitative real time RT PCR. In addition to cDNA,

19.0 μl of a master mix (per sample: 0.5 μl 10μM 5’ primer, 0.5 μl 10μM 3’ primer, 10.0

μl SsoFast™ EvaGreen® Spermix, 8.0 μl H₂O) was added to each PCR reaction.

Samples were loaded into a 96 well plate in triplicate. A two-step PCR program was run on realplex² Mastercycler from Eppendorf (Hauppauge, NY) machine and realplex software was used to read the data. Expression levels of genes of interest were normalized to the β-actin control. Ct values were established and used to assess differences in gene expression between samples by determining fold change utilizing the delta delta Ct (ddCt) method: ddCt =dCt of the gene of interest-dCt of the β-actin for that

.relative gene expression normalized to β-actin= ־sample, and 2

2.11. Coimmunoprecipitation (CoIP)

Whole cell extracts were collected from cells lysed with cell lysis buffer (150 mM

Tris-HCl, pH 7.5; 200 mM NaCl, 1% Triton X-100; 10 mM EDTA, βME, PMSF, protease and phosphatase inhibitors). After pipetting up and down with cell lysis buffer, cells were placed on ice for 20-30 min followed by centrifugation at 13,000 rpm for 15 min. The protein concentrations were determined by performing a Bradford Assay.

Equal protein amounts of each sample were used and brought up to 600 μl with cell lysis buffer. Antibody for the immunoprecipitating protein was added in the indicated amount and the samples were rocked on the Nutator at 4°C overnight. The next day 20.0 μl of protein A/G Plus agarose beads (Santa Cruz) were added to the samples, and the samples

were rocked on the Nutator for an hour at 4°C. The beads and immunoprecipitated protiens were washed with 300 μl of cell lysis buffer four times and then 4X SDS-PAGE sample buffer was added (different amounts depending on the experiment). At this point samples could be frozen at -20°C until ready to use or immediately used for Western Blot analysis.

2.12. IKK Kinase Assay

Cell culture plates were put on ice and kept cold while harvesting cells. Media was removed and plates were washed with ice cold PBS two times. Cells were scraped off plates and transferred to microfuge tubes. The tubes were centrifuged at 4000 rpm for 3 min and PBS was removed. The cell pellets were gently resuspended in 3 pellet volumes of cold WCE lysis buffer (20 mM Tris pH 8.0, 0.5 M NaCl, 0.25% TritonX-100, 1 mM

EDTA, 1 mM EGTA, H₂O up to desired volume; add inhibitors fresh: 1mM PMSF, 1mM

DTT, 10 μl/ml protease inhibitor cocktail, 10 μl/ml phosphatase inhibitor). Tubes were rotated on nutator at 4°C for 45 min. Tubes were centrifuged at 13,000 rpm for 15 min at

4°C. Supernatant was transferred to a new tube and the protein concentration was determined by Bradford assay. A precoupling step was done while cells were lysing: A tube was set up for each reaction with 100 μl PD buffer (20 mM Tris pH 8.0, 250m M

NaCl, 0.05% 10% NP-40, 3 mM EDTA, 3 mM EGTA; add inhibitors fresh: 2mM PMSF,

1mM DTT, 10 μl/ml protease inhibitor cocktail, 10 μl/ml phosphatase inhibitor), 7.5 μl

IKKγ antibody, and 20 μl of protein A-Agarose beads. These tubes incubated at 4°C on the Nutator for 60 min. After precoupling, 200 μg of WCE was added to the

PD/antibody/beads tubes. The total volume was brought up to 500 μl with PD buffer.

Samples were incubated at 4°C on the Nutator for at least 4 hours. The samples were then washed five times with PD buffer. One wash was done with Kinase buffer (20 mM

HEPES pH 7.7, 2 mM MgCl₂, 2 mM MnCl₂, 2 mM PMSF, 1 mM DTT, 10 μl/ml protease inhibitor cocktail, 10 μl/ml phosphatase inhibitor) and then as much buffer was removed as possible without disturbing the beads. Then 50 μl of complete kinase buffer

(50 μl/ sample kinase buffer, 20 μl/ml 10 mM ATP, 2.5 μl/ sample GST-IκBα) was added to each set of beads and the samples were incubated in an Eppendorf thermomixer

(source) for 45 min at 30°C set at 350 rpm. Then the samples were put on ice for 2 min and centrifuged at 13,000 rpm for 1 min. The kinase reaction was stopped by adding

12.5 μl 4XSDS-PAGE dye. Samples were separated by SDS-PAGE for Western Blot analysis. Samples were either stored at -20°C or used directly for Western Blot analysis to detect phosphorylated IκBα which would indicate IKK kinase activity.

2.13. Chromatin Immunoprecipitation (ChIP) Assay

Cells were cultured in 150 mm plates and treated with 10 ng/ml of TNFα for the indicated time points. Then formaldehyde was added to the media in the plates at a final concentration of 1% and incubated for 10 min at 37°C to crosslink protein-DNA complexes. Cells were washed with ice cold PBS twice and harvested by scraping and placed into microcentrifuge tubes. The cells were pelleted by centrifugation at 2200 rpm for 4 min at 4°C. 1 ml of Cell Lysis Buffer (5 mM PIPES (KOH) pH 8, 85 mM KCl,

0.5% NP-40, 10 μl/ml protease and phosphatase inhibitor cocktails, 1 mM PMSF) was added to the tubes and samples were incubated on ice for 10 min and then centrifuged at

6000 rpm for 5 min at 4°C to pellet nuclei. The nuclear pellet was resuspended in 500 μl

room temperature Nuclear Lysis Buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, 10

μl/ml protease and phosphatase inhibitor cocktails, 1 mM PMSF) and incubated on ice for 10 min. Then DNA in the lysates was sheared into approximately 500 base pair fragments by a Sonic Dismembrator Model 500 (Fisher Scientific, Pittsburgh, PA) set at

10 sec bursts, 90% duty cycle, 10-20% output ten times. Samples were placed in new tubes and centrifuged at 13,000 rpm for 10 min at 4°C. The supernatant was collected from each sample and placed in a new 2 ml tube. 1.5 ml ChIP Dilution Buffer (0.01%

SDS, 1.1% Triton X100, 1.2 mM EDTA, 16.7 mMTris-HCl pH 8, 167 mM NaCl, 10

μl/ml protease and phosphatase inhibitor cocktails, 1 mM PMSF) was added to dilute the supernatant. A pre-clear was performed to reduce nonspecific binding by adding 30

μl/ml of salmon sperm DNA/Protein A Agarose-50% slurry and 2.5 μg rabbit normal IgG were added to samples, samples were rotated on the Nutator for 30 min at 4°C, then protein A-agarose complexes were pelleted by centrifugation at 1000 rpm for 1 min at

4°C, and the supernatant was collected into a new tube and 20 μl of the supernatant was set aside to use as input control during the PCR step. The immunoprecipitating antibody was added to the samples and rotated on a nutator at 4°C overnight. No antibody samples were set up as a negative control for nonspecific binding to the immunoprecipitation complex. 30 μl Salmon Sperm DNA/Protein A Agarose Slurry was added and samples were rotated for one hour at 4°C. The agarose/antibody/protein complexes were pelleted by centrifugation at 1000 rpm for 1 min at 4°C, and the supernatant with nonspecific material was removed and discarded. The samples were washed with 1 ml of wash buffer, rotated on a nutator at room temperature for 5 min, then centrifuged at 1000 rpm for 1 min at 4°C, and the supernatant was discarded. The 32

wash steps were repeated 5 times with the following wash buffers in this order: Low Salt

Immune Complex (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8,

150 mM NaCl), High Salt Immune Complex (0.1% SDS, 1% Triton X100, 2 mM EDTA,

20 mM Tris-HCl pH 8, 500 mM NaCl), LiCl Immune Complex (0.25 M LiCl, 1% NP-40,

1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl pH 8), 1X TE (10 mM EDTA, 1 mM

Tris-HCl pH 8), and 1X TE again. Then an Elution Buffer (1% SDS, 0.1 M HaHCO3) was freshly prepared and filter-sterilized (0.2 μm). 75 μl elution buffer was added to the samples, briefly vortexed, and incubated at room temperature for 15 min, with rotation, centrifuged as before, and the eluate was moved to a new tube. The elution was repeated and both eluates were combined. 5M NaCl was added to a final concentration 0.3M

NaCl. 100 μl of elution buffer and 5M NaCl (0.3 M final conc.) was added to the input samples (20 μl that was set aside earlier). Samples were cleaned using a PCR clean up kit (Promega) and eluted in 20 μl TE. The final eluted samples were used as the template for PCR.

The primers used for PCR after ChIP Assay are listed in Table 2.3.

Table 2.3 Primer sequences used for PCR to analyze ChIP Assay

Promoter Primer Sequence Forward 5'-GACGACCCCAATTCAAATCG-3' IκBα Reverse 5'-TCAGGCTCGGGGAATTTCC-3' Forward 5'-GGGCCATCAGTTGCAAATC-3' IL-8 Reverse 5'-TTCCTTCCGGTGGTTTCTTC-3' Forward 5'-GTGTGTGTGGTTATTACCGC-3' cIAP2 Reverse 5'-AGCAAGGACAAGCCCAGTCT-3'

2.14. Luciferase Assay and β-Gal Assay

A 3X κB-luc reporter plasmid was used for luciferase assays. This is an artificial reporter derived from MHC I enhancer and contains four κB binding sites. A β-actin-

LacZ reporter plasmid was utilized as a transfection efficiency control. Along with the two reporters, plasmids of interest (HA-IKKα, FLAG-HDAC3) were transfected into

HeLa cells. Cells were plated in 24 well plates with DMEM supplemented with 10%

FBS. Each of the four conditions (just reporters, reporters + IKKα, reporters + HDAC3, reporters + IKKα + HDAC3) was transfected into 6 wells using TannsIT LT1 transfection reagent. Half of the cells (three out of the six repeats) were treated with

TNFα for 6 hours approximately 24 hours after transfection to stimulate the NF-κB pathway. The cells were then harvested in the following manner: The media was removed, wells were washed once with PBS followed by addition of 110 μl of mammalian protein extraction reagent (M-PER, Pierce/Thermo Fisher Scientific Inc.,

Rockford, IL) to each well to lyse the cells. Plates were placed on a rotation platform for

10 min, cell extracts were collected in microfuge tubes and centrifuged at 13,000 rpm for

10 min. Samples were then aliquoted into two different 96 well plates. 50 μl were aliquoted into an opaque plate for the luciferase assay and 50 μl were aliquoted into a clear plate for the β-gal assay.

Reagents were prepared ahead of time for the luciferase assay. Stock solutions included 1 mM D-Luciferin (1mM luciferin, 10 mM DTT, 25 mM Glycylglycine, ddH₂O) stored at -80°C in a light tight container and Assay Buffer (25 mM

Glycylglycine, 4 mM EGTA, 15 mM anhydrous MgSO4, 15 mM K₂HPO4, ddH₂O) stored at 4°C. Working solutions were prepared while harvesting and consisted of 34

Luciferase ATP Assay Buffer (5 ml Assay Buffer, 100 μl 100 mM ATP, 5 μl 1M DTT) and Luciferin Solution (1 ml luciferin stock, 0.5 ml 250 mM glycylglycine, 5 μl 1 M

DTT, 3.5 μl H₂O). The Luciferase ATP Assay Buffer and Luciferin Solution were poured together and a multi-channel pipette was used to add 100 μl of the mixture to each sample in the 96 well plate. The luminescence of the samples in the plate were immediately read by a SpectroMax M5 (Molecular Devices, Sunnyvale, CA) plate reader utilizing SoftMax Pro software.

2X β-Gal Buffer (200 mM NaPO4, 100 mM NaH₂PO4, 2 mM MgCl₂) was prepared ahead of time and stored at 4°C. Right before the assay 200 μl ONPG (aliquots frozen at -20°C, prepared at 1.33 mg/1 ml) and 3.2 μl of β-mercaptoethanol were added for every 1ml of β-Gal Buffer. Enough buffer was made to add 50 μl to each sample in the clear 96 well plate. After β-Gal Buffer was added to the plate it was incubated at

37°C for 1-10 minutes (when reactions start turning yellow). The plate was then read by the SpectroMax plate reader at a wavelength of 414 nm.

The luminescence values were divided by their respective β-gal values to control for transfection efficiency, and the results were expressed in relative light units (RLUs).

Error bars represent the average of the triplicate +/- standard deviation.

2.15. Cell Counting

Cells were plated in equal numbers on 24 well plates (6 wells for each stable cell line: HC, HD1KD, HD2KD, and HD3KD) in DMEM and incubated at 37°C for 48 hours. The media was collected, the plates were washed with PBS, and the PBS was collected. Cells were then harvested using Trypsin EDTA from cellgro® (Mediatech,

Inc., Manassas, VA). A hemacytometer was used to count the cells from each well.

Trypan blue exclusion was used to determine the ration of living cells.

2.16. Statistical Analysis

Experiments were performed at least three times. Quantitative RT PCR was run in triplicate and repeated three times. Error bars on graphs represent +/- standard deviation.

A two-tailed Student’s t-test was performed to determine statistical significance (P>0.05) between data sets.

Chapter 3

Results

3.1. Individual HDAC1, HDAC2, and HDAC3 shRNA knockdown

Several previous studies on HDAC proteins have utilized HDAC inhibitors that target multiple HDAC proteins, so to study the individual roles of HDACs 1, 2, and 3 a lentiviral RNAi system was used to individually knockdown HDACs 1, 2, and 3 in HeLa cells. Plasmids encoding the shRNAs specific to the proteins of interest were transfected along with lentiviral packaging plasmids into HEK293T cells to produce the lentivirus.

The lentiviral media was then used to infect HeLa cells. 24 hours after infection fresh media was added to the cells and puromycin was also added to select for the cells with stably introduced plasmids. Initially, five different shRNAs were tested for each protein of interest (Table 1). The shRNAs selected to go on with experiments were chosen because they showed the most knockdown and cell viability. The shRNAs that were used to make the stable cells lines were shRNA5 for HDAC1, shRNA 1 for HDAC2, and shRNA5 for HDAC3 (Figure 7). The control line (HC) was established by infecting Hela cells with an empty vector (pLKO.1).

Western Blot analysis was performed to confirm protein knockdown in each established cell line. For the HDAC1 knockdown (HDAC1 KD) cell line, HD1sh5 had a 37

decreased amount of HDAC1 protein compared to HC. The blot was also probed for the other proteins of interest (HDAC2 and HDAC3) to make sure that only HDAC1 was knocked down in that cell line. It was confirmed that only HDAC1 was knocked down in the HDAC1 KD cell line. β-actin was used as a loading control. Below the western blot is a graph of relative intensities. This graph is representative of the amount of protein knockdown in the cell line. The intensities of the bands for the protein of interest were measured and divided by the intensities of the β-actin bands. The control results were normalized to one. For the HDAC1 KD the relative intensity for HDAC1 protein is less than 0.3 in the HD1sh5 cell line compared to 1.0 for HC meaning the HDAC1 KD cell line has more than 70% protein knockdown.

In the HDAC2 KD results there is a decrease in HDAC2 protein in the HD2sh1 cell line compared to HC. HDAC1 and HDAC3 are not knocked down, and HDAC1 protein might be increased, suggesting a possible compensation for the lack of HDAC2 protein. The amount of protein knockdown as represented by the relative intensity of the

HDAC2 bands compared to β-actin is more than 65% in the HD2sh1 cell line versus HC.

In the HDAC3 KD results, the HD3sh5 cell line has a decreased amount of

HDAC3 protein compared to the HC cell line,whereas HDAC1 and HDAC2 are not knocked down. HDAC2 protein is increased in the HDAC3 KD cells. The relative intensity of the HDAC3 in HD3sh5 is a little over 0.4 compared to 1.0 for HC, meaning the HDAC3 KD cell line has almost 60% knockdown.

Four stable cell lines were established to aid in studying HDACs 1, 2, and 3. A control cell line was established by infecting HeLa cells with an empty vector and is

3-1 Figure 7. Individual HDAC 1, 2, and 3 Protein Knockdowns in HeLa cells. The top portion of the figure shows Western Blot analysis of the individual HDAC protein knockdown in each cell line compared to control (HC). The blots were probed for the other proetins of interest to establish that only one protein was knocked down in each cell line. The bottom of the figure shows the amount of protein knock down as represented by the relative intensity of the bands on the blots.

referred to as HC. An HDAC1 knockdown cell line was established by infecting HeLa cells with a vector containing shRNA specific to HDAC1 mRNA that effectively knocked down HDAC1 and not HDAC2 or HDAC3. The HDAC1 knockdown cell line is referred to as HD1KD. An HDAC2 knockdown cell line was established by infecting

HeLa cells with a vector containing shRNA specific to HDAC2 mRNA that effectively knocked down HDAC 2 and not HDAC1 or HDAC3. The HDAC2 knockdown cell line is referred to HD2KD. An HDAC3 knockdown cell line was established by infecting

HeLa cells with a vector containing shRNA specific to HDAC3 mRNA that effectively knocked down HDAC 3 and not HDAC1 or HDAC2. The HDAC3 knockdown cell line is referred to HD3KD.

3.2. Nuclear p65 is enhanced with individual HDAC1, HDAC2, and HDAC3 knockdown

Previous studies indicate that HDAC inhibition using TSA results in prolonged nuclear localization of NF- κB after TNFα treatment (Ashburner, B.P., unpublished data).

To determine if individual knockdown of HDAC1, HDAC2 or HDAC3, similar experiments were performed with the four stable cell lines. The cell lines were treated with TNFα for the indicated time points (Figure 8). Cytoplasmic and nuclear fractions were collected from four stable HeLa cell lines: HC (Hela Control), HD1KD (HDAC1 knockdown), HD2KD (HDAC2 knockdown), and HD3KD (HDAC3 knockdown).

Western Blot analysis was performed to detect p65 protein levels in the cytoplasm and nucleus of HeLa cells treated with TNFα and to evaluate differences that occurred with individual HDAC1, 2, and 3 knockdown (Figure 8A). β-actin was used as a cytoplasmic

extract loading/purity control since β-actin is a cytoplasmic protein. Lamin A/C was used as a nuclear loading/purity control since these are nuclear proteins.

In HC cells there is very little p65 protein in the nucleus of untreated (UT) cells, but by the first time point at 15 min p65 is in the nucleus. p65 remains in the nucleus until the 120 min time point and then nuclear p65 protein levels decrease back to UT levels. In HD1KD cells p65 has entered the nucleus by the 15 min time point similar to the HC cells; however, p65 remains in the nucleus all the way out to the last time point at

480 min with no apparent decrease in the level of nuclear p65. Similar results are seen in the HD2KD results with p65 in the nucleus until the 480 min time point, and the p65 signal is very strong. In the HD3KD cell line p65 remains in the nucleus at least until the

240 min time point which is twice as long as the HC cell line.

The nuclear extracts were also used to do an electrophoretic mobility shift assay

(EMSA). A binding reaction was performed with the nuclear extracts and a DNA probe with NF-κB binding sites. The samples were then run on a non-denaturing gel which was exposed to phospho-screens for imaging (Figure 8B). The upper band in the results for all cell lines indicates where proteins were bound to the radioactive DNA probe. This band is absent in untreated (UT) samples in all cell lines since classical NF-κB has not translocated to the nucleus. The top set of results compares nuclear NF-κB in HC to

HD1KD HeLa cells treated with TNFα. There is a typical pattern of NF-κB binding to the DNA probe in the HC cells. NF-κB is present in the nucleus of HC cells at the earliest TNFα treatment time point, peaks at 30 min, and gradually decreases over the subsequent time points. A similar pattern of binding is observed in HD1KD HeLa cells; however, the level of nuclear NF-κB appears to be decreased compared to the HC. 42

3-2 Figure 8. Nuclear NF-κB is affected by individual HDAC1, 2, and 3 knockdown.

A. Cytoplasmic and nuclear fractions were isolated from HC, HD1KD, HD2KD, and

HD3KD cells treated with TNFα. p65 cellular localization was determined by Western

Blot analysis. B. Nuclear extracts from HC, HD1KD, HD2KD, and HD3KD HeLa cells treated with TNFα were used to perform an electrophoretic mobility shift assay (EMSA).

A binding reaction was carried out with the nuclear extracts and a radioactive double stranded DNA probe that has NF-κB ninding sites. Reactions were separated by non- denaturing SDS-PAGE and visualized by exposing the gel to film or a phosphor-screen and the Typhoon Imager.

Similar results are observed in the second data set comparing nuclear NF-κB in HD2KD

HeLa cells to HC (Figure 8B). Despite p65 being in the nucleus until the 480 min time point in the Western Blot (Figure 8A), NF-κB binding to the DNA probe in HD2KD cells was decreased in amount but for a similar length of time compared to HC. In HD3KD

HeLa cells there was enhanced nuclear NF-κB compared to HC when both cell lines were treated with TNFα (Figures 8 A-B). The HD3KD cells had no nuclear NF-κB at the UT time point, similar to HC. In the HC cells nuclear NF-κB peaks at the 30 min time point and decreases throughout the time points, but in the HD3KD cells nuclear NF-κB peaks at the 120 min time point and still has a strong presence at the 240 min time point (Figure

8B). p65 was present in the nucleus of TNFα treated HD3KD cells until at least the 240 min time point compared to the 120 min mark in HC (Figure 8A). The amount of time

NF-κB was present in the nucleus of TNFα treated HD3KD cells (Figure 8B) correlates with the amount of time p65 was in the nucleus of TNFα treated HD3KD cells (Figure

8A). These results indicate a different role for HDAC3 in nuclear NF-κB regulation than

HDAC1 and HDAC2, but all three HDACs increase the amount of time p65 remains in the nucleus.

3.3. IκBα gene expression and protein level with individual HDAC1, HDAC2, and HDAC3 knockdown

IκBα gene expression was analyzed in TNFα treated HeLa cells with individual

HDAC1, 2, and 3 knockdowns. All four HeLa cell lines (HC, HD1KD, HD2KD, and

HD3KD) were treated with TNFα for the indicated time points. RNA was isolated from the cells and used to make cDNA which was used as a template for RT-PCR of IκBα mRNA. For a positive control, the cDNA was also used to perform RT-PCR of β-actin 45

mRNA. The PCR products were visualized after electrophoresis on an ethidium bromide

0.8% agarose gel using UV light and image captured using the Kodak Image Station and

Kodak MI SE software (Figure 9A). The HC cell line shows a typical pattern of IκBα gene expression peaking around the 30 to 60 min time points and gradually decreasing over the remaining time points (Figure 9A). The HD1KD and HD2KD cell lines showed a similar pattern of IκBα gene expression with the peak expression at the 30 min and 60 min time points (Figure 9A). The IκBα expression differed in the HD3KD cell compared to HC, HD1KD, and HD2KD. In the HD3KD HeLa cells IκBα gene expression peaked around the 30 min time point and continued to be expressed at a high level throughout the time course.

To better quantitate IκBα expression, real time RT-PCR (quantitative; qPCR) was performed using the same cDNA for a template as the RT-PCR experiments. The qPCR results supported observations made for the HD3KD cell line in the previous RT-PCR experiment. IκBα gene expression in HD3KD cells peaked around the 30 min treatment point and did not decrease within the 480 min TNFα time course (Figure 9B). None of the stable knockdown cell lines had a higher or lower peak IκBα gene expression than

HC cells. HD1KD and HD2KD HeLa cells had higher IκBα gene expression than HC cells at the 15 min time point, suggesting that decreased HDAC1 and HDAC2 corepressor proteins increase the level of IκBα gene expression in response to TNFα stimuli. HD1KD cells had higher IκBα gene expression than HC and HD2KD at the 480 min time point after all three cell lines had similar decreases in IκBα gene expression at the 120 min and 240 min TNFα treatment time points.

To determine if HDAC knockdown affects IκBα protein levels the HC, HD1KD,

HD2KD, and HD3KD HeLa cells were treated with TNFα and nuclear and cytoplasmic fractions were isolated and used for Western Blot analysis (Figure 9C). In HC cells IκBα protein was present in the cytoplasmic fraction of UT cells and absent at the 15 min time point when IκBα had been degraded and not yet re-synthesized. Low levels of cytoplasimic IκBα were present at the 30 min time point and high levels of IκBα were present by the 60 min time point and seen throughout the rest of the time points (Figure

9C). In HC cells nuclear IκBα was first detected at the 30 min time point and was present throughout the rest of the time course (Figure 9C). In HD1KD and HD2KD cells similar patterns to HC were observed except that nuclear IκBα does not appear until the 60 min time point (Figure 9C). HD3KD cells had very little IκBα protein in either fraction.

HD3KD cells had less IκBα protein in the cytoplasmic fraction in the later TNFα time points than HC, HD1KD, and HD2KD cells (Figure 9C).

IκBα protein levels and phosphorylation were measured by Western Blot analysis.

Whole cell extracts were collected from TNFα treated HC, HD1KD, HD2KD, and

HD3KD HeLa cells (Figure 9D). HD1KD cells had similar levels to HC cells of IκBα protein and IκBα phosphorylation (Figure 9D). HD2KD cells appeared to have increased

IκBα phosphorylation and IκBα protein levels (Figure 9D). Quantitative experiments would need to be performed to confirm this. HD3KD cells contain lower levels of IκBα and phosphorylated IκBα protein than HC, HD1KD, and HD2KD after treatment with

TNFα (Figure 9D).

3-3 Figure 9. Individual HDAC 1, 2, and 3 Knockdown affects IκBα gene expression and protein levels in HeLa cells treated with TNFα. A. RNA was isolated from HC,

HD1KD, HD2KD and HD3KD HeLa cells treated with TNFα and reverse transcribed to make cDNA to use as a template for RT-PCR. IκBα gene expression was visualized on an ethidium bromide agarose gel after RT-PCR. B. Real time (quantitative) RT-PCR results using using cDNA reverse transcribed from RNA isolated from HC, HD1KD,

HD2KD and HD3KD HeLa cells treated with TNFα. C. IκBα protein levels were analyzed from nuclear and cytoplasmic fractions of HC, HD1KD, HD2KD, and HD3KD

HeLa cells treated with TNFα. D. IκBα protein levels and phosphorylation was measured from whole cell extracts collected from TNFα treated HeLa cells.

3.4. Decreased IκBα protein level in HD3KD cells is not due to shorter IκBα half- life

Since IκBα protein levels are decreased in HD3KD cells compared to HC when cells are treated with TNFα, it was important to determine if knockdown of HDAC3 itself was the cause of the decreased IκBα. To assess the half-life of IκBα with HDAC3 knockdown, HC and HD3KD HeLa cells were treated with cycloheximide (CXC) to inhibit translation of newly synthesized IκBα mRNA into protein. Whole cell extracts were collected from the CXC treated cells and used for Western Blot Analysis, and blots were probed with an IκBα antibody. HD3KD samples appreared to have similar IκBα protein levels to HC (Figure 10 A). Blots were also probed for IKKβ since it is an upstream regulator of IκBα in the NF-κB pathway. IKKβ protein bands on the Western

Blot looked similar in HC and HD3KD cells treated with CXC. The blots were probed for β-actin to use as a loading control for quantification of the relative intensities of the bands on the blots. IκBα protein levels were determined by measuring the relative intensities of the bands on the Western Blots for HC and HD3KD HeLa cells treated with

CXC (Blots 10A; Graph of relative intensities 10 B). No significant difference in IκBα protein was detected between HC and HD3KD cells at any CXC time point. This indicates that the lack of IκBα protein in HD3KD cells compared to HC, HD1KD, and

HD2KD (Figure 9C-D) only occurred after the cells were stimulated with TNFα. In the absence of the TNFα treatment, HDAC3 does not affect IκBα protein stability.

3-4 Figure 10. IκBα half-life is not significantly altered by HDAC3 knockdown alone. A. HeLa cells treated with translational inhibitor cycloheximide (CXC) did not show less IκBα protein over time with HDAC3 knockdown compared to control. B.

IκBα protein levels were assessed by measuring the relative intensity of the bands on the

Western Blot (IκBα and β-actin) and normalizing the HC untreated to 1.0.

3.5. Nuclear IKKα is enhanced with individual HDAC1, 2, and 3 knockdown

To assess the effects of HDAC knockdown on IKKα, HC, HD1KD, HD2KD cells were treated with TNFα and cytoplasmic and nuclear extracts were isolated and used to perform Western Blot analysis. IKKα is present in the cytoplasm at similar levels in HC and all three knockdown cell lines (Figure 11). In HC cells IKKα is present in the nucleus at the 60, 120, and 240 min time points. In contrast, IKKα is in the nucleus of

HD1KD cells at the 30, 60, 120, 240, and 480 min time points and IκBα is more abundant. HD2KD cells also have an increase in nuclear IKKα compared to HC cells.

HD2KD cells had a strong nuclear IKKα signal as early as the 30 min time point and the signal was still present at the 480 min time point similar to HD1KD cells. Nuclear IKKα protein was also enhanced in HD3KD cells compared to HC. In HD3KD cells IKKα is in the nucleus at the 60, 120, 240, and 480 min time points. Individual HDAC1, HDAC2, and HDAC3 knockdown caused an increase in amount and duration of IKKα in the nucleus of TNFα treated HeLa cells.

3.6. Ectopically expressed HDAC3 and IKKα play antagonistic roles

To assess the affects of IKKα and HDAC3 and a possible relationship between them a luciferase assay was performed on HeLa cells trandfeced with IKKα and HDAC3 expressing plasmids. HeLa cells were grown in a 24-well plate and transfected with HA-

IKKα and FLAG-HDAC3 plasmids along with κB-LUC and β-actin/LacZ reporters.

TNFα was added to half of the cells to stimulate NF-κB activity. Expression of HA-

IKKα increased κB-LUC reporter activity in TNFα treated cells compared to control

(only reporter plasmids added) (Figure 12). Addition of FLAG-HDAC3 reduced luciferase activity compared to control. Transfecting both HA-IKKα and FLAG-HDAC3 54

3-5 Figure 11. Knockdown of HDACs 1, 2 and 3 enhances nuclear IKKα in TNFα treated HeLa cells. Cytoplasmic and nucear extracts were isolated from HeLa cells treated with TNFα. Individual HDAC1, HDAC2, and HDAC3 knockdown caused an increase in amount and duration of IKKα in the nucleus of TNFα treated HeLa cells.

3-6 Figure 12. Ectopically expressed HDAC 3 and IKKα have antagonistic effects on

κB-luciferase activity in TNFα treated HeLa cells. HeLa cells were transfected with

HA-IKKα and FLAG-HDAC3 plasmids along with κB-LUC and β-actin/LacZ reporters to see the effects of ectopically expressing IKKα and HDAC3 on κB luciferase activity.

Half the cells were treated with TNFα for 6 hours to stimulate NF-κB activity.

caused a return to control levels of luciferase activity in cells treated with TNFα. No significant change in luciferase activity was observed with ectopic expression of IKKα or

HDAC3 in the absence of TNFα treatment. In TNFα treated HeLa cells ectopically expressed IKKα and HDAC3 appear to have antagonistic roles.

3.7. IKK Kinase activity is increased by HDAC2 knockdown but not HDAC1 and

3 knockdown

To assess changes in IKK kinase activity in the individual HDAC1, HDAC2, or

HDAC3 knockdown cells, an IKK kinase assay was performed (Figure 13). Cells were treated with TNFα to stimulate IKK activity. IKKγ antibody was used to immunoprecipitate the IKK complex for the kinase assay. The immunoprecipitated IKK complex was mixed with a substrate, GST-IκBα, and a kinase reaction was performed.

Western Blot analysis was performed with the samples, and blots were probed for p-IκBα to measure kinase activity. The top row of blots show the Western Blot results of the

IKK kinase assay. Kinase activity was measured by phosphorylation of IκBα. HD1KD and HD3KD cells had similar amounts of p-IκBα as HC for the kinase reaction samples.

HD2KD cells had higher levels of p-IκBα than HC for kinase reaction samples. Blots were probed for IKKβ as an IP control since IKKβ should IP with IKKγ. IKKβ present in the kinase assay samples for HD1KD and HD3KD were similar to HC cells. HD2KD cells had slightly more IKKβ than HC cells in the kinase assay samples. The bottom 3 rows of the figure show the Western blot results for the whole cell extracts that were the input for the immunoprecipitation of IKK proteins to perform the assay. Phospho-IκBα and IKKβ protein levels in HD1KD and HD3KD cells were similar to HC cells when

3-7 Figure 13. Knockdown of HDAC 2 affects IKK Kinase activity. The top 2 rows of results show the Western Blots from the IKK kinase assay. Kinase activity was measured by phosphorylation of IκBα. The IKK complex was immunoprecipitated from whole cell extracts of the TNFα treated cells using an IKKγ antibody. Purified GST-

IκBα was added to the immunoprecipitated IKK complex and a kinase assay was performed. The kinase assay samples were used for Western Blot analysis. A phospho-

IκBα antibody was used to probe the blots to assess kinase activity. The bottom 3 rows of the figure show the Western blot results for the whole cell extracts that were the input for the immunoprecipitation of IKK proteins to perform the assay.

treated with TNFα. HD2KD cells had more p-IκBα and IKKβ protein than HC cells when treated with TNFα.

3.8. IκBα phosphorylation and protein levels in HDAC1, 2, and 3 knockdown are comparable to control when proteosomal degradation is blocked

To determine if HDAC knockdown affects IκBα phosphorylation and protein level HC, HD1KD, HD2KD, and HD3KD cells were treated with MG-132 to block proteosomal degradation of IκBα and TNFα to stimulate the NF-κB pathway. Whole cell extracts were collected from the treated cells and used to perform Western Blot analysis.

IκBα protein levels stayed steady across all time points in all four cell lines since IκBα was not being degraded (Figure 14). IκBα phosphorylation occurred in a similar pattern in all four cell lines as well. HD3KD cells had the same pattern of IκBα and p-IκBα protein levels as HC, HD1KD and HD2KD throughout the TNFα time course when proteosomal degradation was blocked, indicating that an increase of phosphorylation signaling for proteosomal degradation is not the cause of decreased IκBα protein levels in

HD3KD cells.

3.9. Knockdown of HDAC3 in HeLa cells treated with TNFα causes changes in NF-

κB regulated gene expression.

To determine the effects of HDAC3 knockdown on NF-κB regulated gene expression, real time RT-PCR was performed. Stable HC and HD3KD HeLa cell lines were treated with TNFα for the indicated time points. RNA was isolated from the cells and reverse transcribed to make cDNA which was used as a template for quantitative

(real time) RT-PCR. Individual HDAC3 knockdown increased IL-8 gene expression in

HeLa cells at the 30 min, 60 min, and 120 min TNFα treatment time points (Figure 15A). 59

3-8 Figure 14. IκBα phosphorylation in HeLa cells treated with TNFα is unchanged with individual HDAC1, HDAC2, and HDAC3 knockdown when proteosomal degradation is blocked. HC, HD1KD, HD2KD, and HD3KD HeLa cells were treated with MG-132 to block proteosomal degradation prior to stimulation with TNFα. Whole cell extracts were isolated from the cells and used to perform Western Blot analysis.

3-9 Figure 15. Knockdown of HDAC3 in HeLa cells treated with TNFα causes changes in NF-κB regulated gene expression. Stable HC and HD3KD HeLa cell lines were treated with TNFα for the indicated time points. RNA was isolated from the cells and reverse transcribed to make cDNA which was used as a template for quantitative

(real time) RT-PCR. A. IL-8 gene expression. B. cIAP2 gene expression. C. MCP1 gene expression.

IL-8 gene expression was lower in HD3KD cells than HC cells at the 15 min time point.

HC and HD3KD HeLa cells had similar IL-8 gene expression at the 240 and 480 min. time points. During peak IL-8 gene expression in both cell types at the 30 min time point

HD3KD had more than 400 fold higher IL-8 gene expression. In contrast to IL-8, cIAP2 gene expression was decreased in HeLa cells treated with TNFα for 15, 30, 60, and 120 min (Figure 15B). HC and HD3KD cells had similar cIAP2 gene expression after 240 minutes of TNFα treatment, and peak cIAP2 expression levels were seen at this time point. HD3KD cells had lower IL-8 gene expression than HC cells at the 480 min. time point. Knockdown of HDAC3 in HeLa cells treated with TNFα decreases MCP1 gene expression at every time point (Figure 15C). Peak MCP1 gene expression at the 120 min. time point is 15 fold higher in HC cells compared to HD3KD cells.

3.10. HDAC3 Knockdown causes changes in protein binding at the promoters of

NF-κB regulated genes

To determine if HDAC3 knockdown changed protein binding at the promoters of

NF-κB regulated genes, chromatin immunoprecipitation assays were performed to analyze p65, p50, and AcH3 protein binding at the promoters of three NF-κB regulated genes: IκBα, IL-8, and cIAP2. HC and HD3KD cells were treated with TNFα to activate the NF-κB pathway, formaldehyde to crosslink proteins to DNA, and harvested. Cells were lysed and extracts were sonicated to sheer the DNA into ~500 base pair fragments.

An immuno-precipitation was performed by adding antibodies for the proteins of interest and protein A agarose beads that bind to the antibody and can be pelleted by centrifugation. Crosslinking of proteins was reversed and a PCR cleanup kit was used to clean up the samples and they were eluted in TE. The eluted samples were used as a 63

3-10 Figure 16. HDAC3 Knockdown changes protein binding at the IκBα promoter.

Chromatin immunoprecipitation assays were performed to analyze changes in protein binding at the promoters of NF-κB regulated genes. Cells were treated with

TNFα to activate the NF-κB pathway. Formaldehyde was used to crosslink promoter bound proteins to the DNA, then cells were lysed, and lysates were sonicated to sheer the

DNA into ~500 base pair fragments. An immunoprecipitation was performed by adding antibodies for the proteins of interest and protein A agarose beads that bind to the antibody. Crosslinking of proteins was reversed and a PCR cleanup kit was used to clean up the samples and they were eluted in TE. The eluted samples were used as a template for PCR. Promoter specific primers for the genes of interest were used for PCR. Semi- quantitative PCR analysis was done by measuring the intensities of bands for the mRNA of interest versus the input on an ethidium bromide agarose gel and normalizing the control untreated to 1.0 (see numbers below the gels and accompanying graphs). A. p65 binding to the IκBα promoter. B. p50 binding to the IκBα promoter. C. AcH3 binding to the IκBα promoter.

template for PCR. Promoter specific primers for the genes of interest were used for PCR.

Figures 16-18).

3.10.1. p65, p50 and AcH3 binding to the IκBα promoter

To analyze the effects of HDAC3 knockdown on p65, p50, and AcH3 binding to the IκBα promoter primers specific for the IκBα promoter were utilized. HD3KD cells had an increase in p65 binding at the 120 and 240 min time points compared to HC

(Figure 16A). p50 binding was increased in HD3KD cells at every time point (Figure

16B). AcH3 binding to the IκBα promoter was increased with HDAC3 knockdown at every time point except the 240 min time point (Figure 16C). Overall, HDAC3 knockdown caused an increase in p65, p50, and AcH3 binding at the promoter of IκBα.

3.10.2. p65, p50, and AcH3 binding to the IL-8 promoter

To analyze the effects of HDAC3 knockdown on p65, p50, and AcH3 binding to the IL-8 promoter, primers specific for the IL-8 promoter were utilized. HD3KD cells had a slight decrease in p65 binding at every time point compared to HC (Figure 17A). p50 binding was increased in HD3KD cells at every time point after UT (Figure 17B).

AcH3 binding to the IL-8 promoter was increased with HDAC3 knockdown compared to

HC at every time point except UT (Figure 17C). Overall, HDAC3 knockdown caused an increase in p50 and AcH3 binding at the promoter of IL-8.

3-11 Figure 17. HDAC3 Knockdown changes protein binding at the IL-8 promoter.

Chromatin immunoprecipitation assays were performed to analyze changes in protein binding at the promoters of NF-κB regulated genes. Cells were treated with

TNFα to activate the NF-κB pathway. Formaldehyde was used to crosslink promoter bound proteins to the DNA, then cells were lysed, and lysates were sonicated to sheer the

DNA into ~500 base pair fragments. An immunoprecipitation was performed by adding antibodies for the proteins of interest and protein A agarose beads that bind to the antibody. Crosslinking of proteins was reversed and a PCR cleanup kit was used to clean up the samples and they were eluted in TE. The eluted samples were used as a template for PCR. Promoter specific primers for the genes of interest were used for PCR. Semi- quantitative PCR analysis was done by measuring the intensities of bands for the mRNA of interest versus the input on an ethidium bromide agarose gel and normalizing the control untreated to 1.0 (see numbers below the gels and accompanying graphs). A. p65 binding to the IL-8 promoter. B. p50 binding to the IL-8 promoter. C. AcH3 binding to the IL-8 promoter.

3-12 Figure 18. HDAC3 Knockdown changes protein binding at the cIAP2 promoter. Chromatin immunoprecipitation assays were performed to analyze changes in protein binding at the promoters of NF-κB regulated genes. Cells were treated with TNFα to activate the NF-κB pathway. Formaldehyde was used to crosslink promoter bound proteins to the DNA, then cells were lysed, and lysates were sonicated to sheer the DNA into ~500 base pair fragments. An immunoprecipitation was performed by adding antibodies for the proteins of interest and protein A agarose beads that bind to the antibody. Crosslinking of proteins was reversed and a PCR cleanup kit was used to clean up the samples and they were eluted in TE. The eluted samples were used as a template for PCR. Promoter specific primers for the genes of interest were used for PCR.

Semi-quantitative PCR analysis was done by measuring the intensities of bands for the mRNA of interest versus the input on an ethidium bromide agarose gel and normalizing the control untreated to 1.0 (see numbers below the gels and accompanying graphs). A. p65 binding to the cIAP2 promoter. B. p50 binding to the cIAP2 promoter. C. AcH3 binding to the cIAP2 promoter.

3.10.3. p65, p50, and AcH3 binding to the cIAP2 promoter

To analyze the effects of HDAC3 knockdown on p65, p50, and AcH3 binding to the cIAP2 promoter primers specific for the cIAP2 promoter were utilized. HD3KD cells had a slight increase in p65 binding at every time point except UT compared to HC

(Figure 18A). p50 binding at the cIAP2 promoter was increased in HD3KD cells at every time point (Figure 18B). AcH3 binding to the cIAP2 promoter was increased with

HDAC3 knockdown compared to HC at every time point (Figure 18C). Overall, HDAC3 knockdown caused an increase in p65, p50, and AcH3 binding at the promoter of cIAP2.

3.11. Individual knockdown of HDAC1, HDAC2, and HDAC3 causes HeLa cells to proliferate slower than vector control cells

To determine if HDAC knockdown affects cell proliferation HC, HD1KD,

HD2KD, and HD3KD cells were seeded at the same density and counted 2 days later.

All four cell lines were seeded at the same density in a 24-well plate. Cells and media were harvested 48 hours later and counted using a hemacytometer. Individual knockdown of HDAC1, HDAC2, and HDAC3 caused a decrease in cell numbers (Figure

19). HD1KD, HD2KD, and HD3KD HeLa cells had lower cell counts than HC cells, but there was no difference in cell numbers between HD1KD, HD2KD and HD3KD cells.

Trypan Blue exclusion was performed to count the dead/dying cells, but so few cells were dead they cannot be visualized on this graph. There was no difference in cell death between the cell lines.

3-13 Figure 19. Individual knockdown of HDAC1, HDAC2, and HDAC3 causes

HeLa cells to proliferate slower than vector control cells. All four cell lines were seeded at the same density in a 24-well plate. Cells and media were harvested 48 hours later and counted using a hemacytometer. Trypan Blue exclusion was performed to count the dead/dying cells, but so few cells were dead they cannot be visualized on this graph.

There was no significant difference in cell death between the cell lines.

Chapter 4

Discussion

NF-κB is a family of inducible transcription factors highly conserved in structure and function from the fruit fly Drosophila melanogaster to mammals. NF-κB activates transcription of genes responsible for inflammation, immune responses, survival, apoptosis, and more. Activation of the NF-κB pathway is induced by inflammatory cytokines (such as TNFα), bacterial toxins (such as lipopolysaccharides), mitogens, phorbol esters, UV light, viruses, and more. Pathways started by these inducers converge at the IκB kinases (IKKs) which phosphorylate IκB proteins. IκBα phosphorylation leads to ubiquitination and proteosomal degradation of IκBα allowing classical NF-κB to translocate to the nucleus and activate transcription. Coregulatory proteins also play an important role regulating NF-κB activity through posttranslational modifications of histones, transcription factors and other coregulatory proteins. Coactivators such as p300/CBP and PCAF enhance NF-κB mediated transcription. Corepressors such as the

HDACs, SMRT, and N-CoR negatively regulate NF-κB transcriptional activation. Class

I HDACs 1, 2, and 3 are the HDACs most responsible for classical NF-κB regulation, and the individual functions of HDAC1, HDAC2, and HDAC3 in regulating NF-κB is the focus of the research described in this dissertation. 73

To study class I histone deacetylases 1, 2, and 3, stable individual HDAC1,

HDAC2, and HDAC3 knockdown HeLa cell lines were created using an RNA interference (RNAi) system. The RNAi system utilized shRNAs specific to hdac1, hdac2, and hdac3 gene expression for knockdown, and an empty vector control cell line was established for comparison to the knockdowns. This system enabled observation of changes in the NF-κB pathway that resulted from the individual knockdown of HDAC1,

HDAC2, and HDAC3. NF-κB dysregulation contributes to many disease states, so learning specific molecular mechanisms that regulate NF-κB activity will help with the identification of targets for treatment.

HDAC inhibitors have been used alone and in combination with other therapies in research and clinical studies with positive results treating various diseases, unfortunately there are negative side effects associated with these treatments. Previous HDAC studies utilized small molecule inhibitors such as Trichostatin A (TSA). When cells are treated with TSA, which inhibits all class I HDAC activity as well as some class II HDAC activity, the overall amount of NF-κB regulated transcription is increased, NF-κB transcriptional activity is prolonged, NF-κB regulated gene expression is increased, nuclear NF-κB binding is enhanced (EMSA), and cytoplasmic reappearance of IκBα in response to treatment with TNFα is delayed, but it is unknown if individual proteins are responsible for any of these phenomenona [36, 53-55]. Determining specific HDACs to inhibit for intended cellular responses could lead to greater specificity in treatment of diseases with fewer negative side effects.

HDACs regulate several aspects of NF-κB activity, and this research discerns similar versus some very specific roles for individual HDAC proteins within the NF-κB 74

pathway. HDAC1, HDAC2, and HDAC3 knockdown resulted in prolonged nuclear p65 and IKKα (see figures 8A and 11). Only HDAC3 knockdown resulted in similar NF-κB binding results when performing an EMSA, indicating that HDAC3 may play a specific role in NF-κB binding to promoters (see figure 8B). This suggests that inhibition of

HDAC3 enhances the ability of NF-κB to bind to promoters which would presumably lead to an increase in NF-κB regulated genes. Knockdown of HDAC3 did cause an increase in IκBα and IL-8 gene expression in HeLa cells treated with TNFα (see Figures

9 and 15) and this correlated with increased p65 and p50 protein binding to the IκBα gene promoter (see Figure 16) but at the IL-8 gene promoter p50 binding was increased whereas p65 binding was decreased. This suggests that binding at the promoters is not the only important factor in determining the level of transcription that takes place. Even more interesting is that knockdown of HDAC3 decreased cIAP2 and MCP-1 gene expression in HeLa cells treated with TNFα (see Figure 15) and even though cIAP2 gene expression was decreased p50 and p65 binding at the cIAP2 promoter was increased (see

Figure 18).

HDAC1, HDAC2, and HDAC3 knockdowns affected IκBα mRNA, but HDAC 3 knockdown was particularly interesting because HDAC3 knockdown resulted in increased IκBα mRNA at later time points of TNFα treatment compared to control cells, but IκBα protein levels were decreased with HDAC3 knockdown (see figure 9).

Treatment with translational inhibitor, cyclohexamide, resulted in similar levels of IκBα protein degradation in control and HDAC3 knockdown cells in the absence of TNFα, therefore the decreased IκBα protein in HDAC3 knockdown cells was not due to the knockdown of HDAC3 alone (see figure 10). Clearly, knockdown of HDAC3 has a 75

major effect on IκBα gene expression and protein levels in response to TNFα treatment, but the mechanism for these effects is unclear.

Both HDAC3 and IKKα shuttle between the nucleus and cytoplasm and play major roles regulating NF-κB transcription [36]. HDAC3 knockdown increases NF-κB

DNA binding in vitro (EMSA Figure 1). HDAC3 knockdown results in a decrease in

IκBα protein after TNFα treatment suggesting a possible role for HDAC3 in the cytoplasm since that is where IκBα is the majority of the time (see figure 9). IKKα functions in an IKK complex with IKKβ and IKKγ in the cytoplasm, but IKKα enters the nucleus independent of the other IKKs [6, 7, 26]. Nuclear IKKα phosphorylates SMRT at the promoters of NF-κB regulated genes causing SMRT and HDAC3 to be exported from the nucleus [28]. It was hypothesized that HDAC3 regulates IKK activity in the cytoplasm after it is exported to the cytoplasm during derepression. It was predicted that lower IκBα protein levels with HDAC3 knockdown were due to increased and/or constitutive phosphorylation brought on by increased IKK kinase activity. However,

IKK kinase activity in HD3KD cells remained the same as HC when cells were treated with TNFα (see Figure 13). When HeLa cells were treated with proteosomal inhibitor

MG-132 and NF-κB was stimulated with TNFα, HD3KD cells showed similar levels of

IκBα phosphorylation and IκBα protein levels as HC supporting the results of the kinase assay and indicating that an increase in IKK kinase activity was not responsible for decreased IκBα protein levels in HD3KD cells (see Figure 14).

The current working hypothesis is that knockdown of HDAC3 causes lysines 218 and 221 on p65 to remain acetylated. Acetylation of lysines 218 and 221on p65 leads to decreased IκBα binding, and unbound IκBα protein is highly unstable and rapidly 76

degraded [35, 36, 74]. HDAC3 is responsible for deacetylating certain residues on p65

[36]. It is possible that in the HDAC3 knockdown cells p65 remains acetylated at lysines

218 and 221 and IκBα binding to p65 is decreased leading to enhanced nuclear NF-κB as demonstrated in Western Blots and EMSA (see Figure 1). If NF-κB stays bound to the promoter and keeps activating transcription, this would explain the increased IκBα gene expression in RT-PCR experiments. The inability of newly synthesized IκBα protein to bind to NF-κB would lead to the unstable IκBα being degraded which would explain the lack of IκBα protein in HDAC3 knockdown cells. When control and HDAC3 knockdown cells were treated with MG-132, blocking proteosomal degradation, HDAC3

Knockdown cells produced IκBα and p-IκBα protein at levels comparable to control cells. This suggests that HDAC3 knockdown cells are capable of translating IκBα mRNA into protein, and possibly, proteosomal degradation is responsible for lower IκBα protein levels in HDAC3 knockdown cells treated with TNFα. When control and

HDAC3 knockown cells were treated with cycloheximide (CXC) to block translation of new protein there was no significant difference in the rate of IκBα degradation between cell lines which suggests that in uninduced cells a loss of HDAC3 does not cause accelerated IκBα degradation. So as long as IκBα is bound to NF-κB it is stable and protein degradation rate in HDAC3 knockdown cells remains similar to control.

Future Work

Future work toward discerning a mechanism for the increased IκBα mRNA and decreased IκBα protein levels in TNFα treated HD3KD cells will include determining if lysines 218 and 221 of p65 remain acetylated in the HD3KD cells causing IκBα to have difficulty binding to p65 to remove it from the promoter. As no antibodies currently exist 77

for acetylated p65 on those specific residues, mutation studies would need to be carried out. Looking for differences between HC and HD3KD cells in other acetylation sites on p65 as well as phosphorylation sites (antibodies available for many of those) would be helpful as well since combinations of posttranslational modifications signal for different protein-protein interactions and protein-DNA binding. It would be interesting to look at binding of proteins such as IKKα, CBP, SMRT, phospho-p65 (specific residues), and

Acetyl-p65 (specific residues when antibodies become available) at the promoter of IκBα to see how HDAC3 knockdown affects protein binding. It would be especially interesting to see how IKKα binding a the IκBα promoter is affected by knockdown of

HDAC3 since previous studies show less IKKα binding at the promoter to be necessary for IκBα translation than other NF-κB regulated genes, and IKKα usually seems to displace HDAC3 at promoters [28, 37].

While doing IKK kinase assays it was observed that knockdown of HDAC2 resulted in increased IKK kinase activity. During the kinase assays it was also observed that HD2KD cell had more IKKβ in both the IP and Input (see Figure 13). It is unclear what either of these observations means, so further research is needed. An increase in

IKKβ might be all the explanation there is for increased IKK kinase activity, but what causes the increased IKKβ? This may or may not have to do with NF-κB activity. It is possible that knocking down HDAC2 increases transcription of IKKβ. This could be investigated by doing real time RT-PCR in HD2KD and HC cells to determine if IKKβ gene expression is increased with knockdown of HDAC2.

Gene expression and promoter binding studies for this project have focused more heavily on knockdown of HDAC3 since the HD3KD cell line had such interesting initial 78

experimental results. Future work will focus on repeating real time RT-PCR and Ch-IP assays in the HD1KD and HD2KD cell lines. This will determine more individual roles for HDAC1, HDAC2, and HDAC3 as well as indicate possible redundancy. The research in this dissertation focuses on the use of individual HDAC knockdown cell lines to determine specific roles of each protein in regulating NF-κB. Future studies could focus on do double and triple knockdowns.

Previous studies in this lab have indicated a possibility of IKK protein acetylation.

It would be interesting to determine if any of the IKK proteins are acetylated and what affect acetylation and deacetylation have on the NF-κB pathway. Acetylation status of

IKK proteins could affect signaling for phosphorylation, recruitment to other proteins, protein-protein interactions, and more.

Summary

To summarize, in the research described in this dissertation, four stable HeLa cell lines were established (HC, HD1KD, HD2KD, and HD3KD) and utilized to study the effects of HDAC1, HDAC2, and HDAC3 knockdown on regulation of the classical NF-

κB pathway. It was concluded that HD3KD Hela cells treated with TNFα expressed higher levels of IκBα mRNA but contained lower IκBα protein levels than HC cells after

120, 240, and 480 min TNFα treatment. Similar changes to IκBα were not observed in

HD1KD or HD2KD cells. It is well established that HDAC3 is localized to the nucleus and cytoplasm whereas HDAC1 and HDAC2 remain in the nucleus. Another protein with cytoplasmic and nuclear roles that has major effects on NF-κB transcription is

IKKα. It was hypothesized that after leaving the nucleus during derepression (by IKKα),

HDAC3 could regulate IKK activity to inhibit the NF-κB pathway. In cells with HDAC3 79

knockdown that would mean that IKK stays active creating a state of constitutive phosphorylation and degradation of IκBα. With IκBα continuously being degraded, NF-

κB would continuously be translocating to the nucleus and activating transcription. This would explain the high levels of IκBα gene expression and low levels of IκBα protein.

To test this theory IKK kinase assays were performed and it was predicted that an increase in IKK kinase activity would be observed with HDAC3 knockdown. However,

IKK kinase levels were not increased in HD3KD cells compared to HC. Interestingly,

HD2KD cells did have increased IKK kinase activity, and this has yet to be explored. To further confirm that IKK kinase activity was not increased with HDAC3 knockdown, cells treated with a proteosomal inhibitor, MG-132, to prevent IκBα degradation, had no increase in IκBα phosphorylation in HD3KD cells compared to HC. It was next hypothesized that HDAC3 played a role in regulating IκBα degradation itself either directly or indirectly. It was also predicted that HD3KD cells would have higher levels of ubiquitination than HC when cells were treated with TNFα. Although experiments were preliminary, no conclusive evidence of increased ubiquitination was observed in

HD3KD cells compared to HC (data not shown).

The current working hypothesis for this project is that HDAC3 knockdown affects deacetylation of lycines 218 and 221 on p65 while p65 is attached to the IκBα gene promoter. Acetylation of lycines 218 and 221 causes decreased IκBα protein binding to p65 and increased κB enhancer binding leading to an increase in NF-κB transcriptional activity. This would explain the increase in IκBα mRNA in HD3KD cells. It could also explain the lack of IκBα protein in HD3KD cells because unbound IκBα is highly unstable, although the exact reasons for this are not fully understood. 80

Other work for this project has included preliminary research on gene expression and protein binding at the promoters of NF-κB regulated genes. Most of this work so far has utilized the HD3KD cell line since it had interesting results in nuclear NF-κB studies and IκBα studies. Previous research with HDAC inhibitor TSA resulted in an overall increase in expression of NF-κB regulated genes in cells treated with TNFα. HDAC3 knockdown resulted in an increase in IL-8 gene expression, an increase in IκBα gene expression at later time points, a decrease in MCP1 gene expression, and a decrease in cIAP2 gene expression at the earlier time points in cells treated with TNFα. HDAC3 knockdown had gene specific effects. HDAC3 knockdown caused a subtle increase in p65, p50 and AcH3 binding to the promoters of IκBα and cIAP2. Since cIAP2 gene expression is decreased with HDAC3 knockdown this suggests that something other than

NF-κB binding and histone H3 acteylation accounts for the decrease in gene expression.

HDAC3 knockdown caused increased binding of p50 and AcH3 at the IL-8 gene promoter but a decrease in p65 binding even though IL-8 gene expression is increased in

HD3KD cells. These results suggest that a highly gene specific/promoter specific system regulates NF-κB transcription.

4-1 Figure 20. Hypothesized HDAC3 effects on the NF-κB pathway.

It was hypothesized that after leaving the nucleus during derepression (by IKKα),

HDAC3 could regulate IKK activity to inhibit the NF-κB pathway. In cells with HDAC3 knockdown that would mean that IKK stays active creating a state of constitutive phosphorylation and degradation of IκBα. With IκBα continuously being degraded,

NF-κB would continuously be translocating to the nucleus and activating transcription.

This would explain the high levels of IκBα gene expression and low levels of IκBα protein. This hypothesis was disproved however, when no increase in IKK kinase activity was observed in HDAC3 knockdown cells. It is unknown if HDAC3 interactions with IκBα in the cytoplasm play a role in the loss of IκBα protein in HDAC3 knockdown cells stimulated with TNFα. The current working hypothesis for this project is that

HDAC3 knockdown affects deacetylation of lycines 218 and 221 on p65 while p65 is attached to the IκBα gene promoter.

References

1. Baldwin, A.S., THE NF-κB AND IκB PROTEINS: New Discoveries and Insights.

Annual Review of Immunology, 1996. 14(1): p. 649-681.

2. Verma, I.M., et al., Rel/NF-kappa B/I kappa B family: intimate tales of

association and dissociation. Genes Dev, 1995. 9(22): p. 2723-35.

3. Ghosh, S., M.J. May, and E.B. Kopp, NF-kappa B and Rel proteins:

evolutionarily conserved mediators of immune responses. Annu Rev Immunol,

1998. 16: p. 225-60.

4. Chen, F.E. and G. Ghosh, Regulation of DNA binding by Rel/NF-kappaB

transcription factors: structural views. Oncogene, 1999. 18(49): p. 6845-52.

5. Karin, M., How NF-kappaB is activated: the role of the IkappaB kinase (IKK)

complex. Oncogene, 1999. 18(49): p. 6867-74.

6. DiDonato, J.A., et al., A cytokine-responsive IkappaB kinase that activates the

transcription factor NF-kappaB. Nature, 1997. 388(6642): p. 548-54.

7. Chen, Z.J., L. Parent, and T. Maniatis, Site-specific phosphorylation of

IkappaBalpha by a novel ubiquitination-dependent protein kinase activity. Cell,

1996. 84(6): p. 853-62.

8. Karin, M. and Y. Ben-Neriah, Phosphorylation meets ubiquitination: the control

of NF-[kappa]B activity. Annu Rev Immunol, 2000. 18: p. 621-63. 84

9. Chen, Z., et al., Genes Dev., 1995. 9: p. 1586.

10. Scherer, D., et al., Proc. Natl. Acad. Sci. USA., 1995. 92: p. 11.

11. Le Bail, O., R. Schmidt-Ullrich, and A. Israel, Promoter analysis of the gene

encoding the I kappa B-alpha/MAD3 inhibitor of NF-kappa B: positive regulation

by members of the rel/NF-kappa B family. EMBO J, 1993. 12(13): p. 5043-9.

12. Sun, S.C., et al., NF-kappa B controls expression of inhibitor I kappa B alpha:

evidence for an inducible autoregulatory pathway. Science, 1993. 259(5103): p.

1912-5.

13. Ghosh, S. and M. Karin, Missing pieces in the NF-kappaB puzzle. Cell, 2002. 109

Suppl: p. S81-96.

14. Chen, L.F. and W.C. Greene, Shaping the nuclear action of NF-kappaB. Nat Rev

Mol Cell Biol, 2004. 5(5): p. 392-401.

15. Sun, S.C., et al., Mol. Cell. Biol., 1994. 14: p. 7377.

16. Davis, N., et al., Science, 1991. 253: p. 1268.

17. Haskill, S., et al., Cell, 1991. 65: p. 1281.

18. Jacobs, M.D. and S.C. Harrison, Structure of an IkappaBalpha/NF-kappaB

complex. Cell, 1998. 95(6): p. 749-58.

19. Brown, K., et al., Mutual regulation of the transcriptional activator NF-kappa B

and its inhibitor, I kappa B-alpha. Proc Natl Acad Sci U S A, 1993. 90(6): p.

2532-6.

20. Huang, T.T., et al., A nuclear export signal in the N-terminal regulatory domain

of IkappaBalpha controls cytoplasmic localization of inactive NF-

kappaB/IkappaBalpha complexes. Proc Natl Acad Sci U S A, 2000. 97(3): p.

1014-9.

21. Yamaoka, S., et al., Complementation cloning of NEMO, a component of the

IkappaB kinase complex essential for NF-kappaB activation. Cell, 1998. 93(7): p.

1231-40.

22. May, M.J., et al., Selective inhibition of NF-kappaB activation by a peptide that

blocks the interaction of NEMO with the IkappaB kinase complex. Science, 2000.

289(5484): p. 1550-4.

23. Deng, L., et al., Activation of the IkappaB kinase complex by TRAF6 requires a

dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain.

Cell, 2000. 103(2): p. 351-61.

24. Mercurio, F., et al., IKK-1 and IKK-2: cytokine-activated IkappaB kinases

essential for NF-kappaB activation. Science, 1997. 278(5339): p. 860-6.

25. Schmitz, M.L., S. Bacher, and M. Kracht, I kappa B-independent control of NF-

kappa B activity by modulatory phosphorylations. Trends Biochem Sci, 2001.

26(3): p. 186-90.

26. Sil, A.K., et al., IkappaB kinase-alpha acts in the epidermis to control skeletal

and craniofacial morphogenesis. Nature, 2004. 428(6983): p. 660-4.

27. Huang, W.C., et al., Phosphorylation of CBP by IKKalpha promotes cell growth

by switching the binding preference of CBP from p53 to NF-kappaB. Mol Cell,

2007. 26(1): p. 75-87.

28. Hoberg, J.E., F. Yeung, and M.W. Mayo, SMRT derepression by the IkappaB

kinase alpha: a prerequisite to NF-kappaB transcription and survival. Mol Cell,

2004. 16(2): p. 245-55.

29. Yamamoto, Y., et al., Histone H3 phosphorylation by IKK-alpha is critical for

cytokine-induced gene expression. Nature, 2003. 423(6940): p. 655-9.

30. Anest, V., et al., A nucleosomal function for IkappaB kinase-alpha in NF-kappaB-

dependent gene expression. Nature, 2003. 423(6940): p. 659-63.

31. Yang, S.R., et al., IKK alpha causes chromatin modification on pro-inflammatory

genes by cigarette smoke in mouse lung. Am J Respir Cell Mol Biol, 2008. 38(6):

p. 689-98.

32. Sizemore, N., et al., Distinct roles of the Ikappa B kinase alpha and beta subunits

in liberating nuclear factor kappa B (NF-kappa B) from Ikappa B and in

phosphorylating the p65 subunit of NF-kappa B. J Biol Chem, 2002. 277(6): p.

3863-9.

33. Chen, L.F., et al., NF-kappaB RelA phosphorylation regulates RelA acetylation.

Mol Cell Biol, 2005. 25(18): p. 7966-75.

34. Vermeulen, L., et al., Regulation of the transcriptional activity of the nuclear

factor-kappaB p65 subunit. Biochem Pharmacol, 2002. 64(5-6): p. 963-70.

35. Chen, L.F., Y. Mu, and W.C. Greene, Acetylation of RelA at discrete sites

regulates distinct nuclear functions of NF-kappaB. EMBO J, 2002. 21(23): p.

6539-48.

36. Chen, L., et al., Duration of nuclear NF-kappaB action regulated by reversible

acetylation. Science, 2001. 293(5535): p. 1653-7. 87

37. Gloire, G., et al., Promoter-dependent effect of IKKalpha on NF-kappaB/p65

DNA binding. J Biol Chem, 2007. 282(29): p. 21308-18.

38. Janknecht, R. and T. Hunter, Transcription. A growing coactivator network.

Nature, 1996. 383(6595): p. 22-3.

39. Gerritsen, M.E., et al., CREB-binding protein/p300 are transcriptional

coactivators of p65. Proc Natl Acad Sci U S A, 1997. 94(7): p. 2927-32.

40. Perkins, N.D., et al., Regulation of NF-kappaB by cyclin-dependent kinases

associated with the p300 coactivator. Science, 1997. 275(5299): p. 523-7.

41. Horn, P.J. and C.L. Peterson, Molecular biology. Chromatin higher order folding-

-wrapping up transcription. Science, 2002. 297(5588): p. 1824-7.

42. Adams, C.C. and J.L. Workman, Nucleosome displacement in transcription. Cell,

1993. 72(3): p. 305-8.

43. Imhof, A. and A.P. Wolffe, Transcription: gene control by targeted histone

acetylation. Curr Biol, 1998. 8(12): p. R422-4.

44. Kuo, M.H. and C.D. Allis, Roles of histone acetyltransferases and deacetylases in

gene regulation. Bioessays, 1998. 20(8): p. 615-26.

45. Sterner, D.E. and S.L. Berger, Acetylation of histones and transcription-related

factors. Microbiol Mol Biol Rev, 2000. 64(2): p. 435-59.

46. Zhong, H., R.E. Voll, and S. Ghosh, Phosphorylation of NF-kappa B p65 by PKA

stimulates transcriptional activity by promoting a novel bivalent interaction with

the coactivator CBP/p300. Mol Cell, 1998. 1(5): p. 661-71.

47. Guenther, M.G., et al., A core SMRT corepressor complex containing HDAC3

and TBL1, a WD40-repeat protein linked to deafness. Genes Dev, 2000. 14(9): p.

1048-57.

48. Li, J., et al., Both corepressor proteins SMRT and N-CoR exist in large protein

complexes containing HDAC3. EMBO J, 2000. 19(16): p. 4342-50.

49. Wen, Y.D., et al., The histone deacetylase-3 complex contains nuclear receptor

corepressors. Proc Natl Acad Sci U S A, 2000. 97(13): p. 7202-7.

50. Yoon, H.G., et al., Purification and functional characterization of the human N-

CoR complex: the roles of HDAC3, TBL1 and TBLR1. EMBO J, 2003. 22(6): p.

1336-46.

51. Zhang, J., et al., The N-CoR-HDAC3 nuclear receptor corepressor complex

inhibits the JNK pathway through the integral subunit GPS2. Mol Cell, 2002.

9(3): p. 611-23.

52. Sengupta, N. and E. Seto, Regulation of histone deacetylase activities. J Cell

Biochem, 2004. 93(1): p. 57-67.

53. de Ruijter, A.J., et al., Histone deacetylases (HDACs): characterization of the

classical HDAC family. Biochem J, 2003. 370(Pt 3): p. 737-49.

54. Ashburner, B.P., S.D. Westerheide, and A.S. Baldwin, Jr., The p65 (RelA) subunit

of NF-kappaB interacts with the histone deacetylase (HDAC) corepressors

HDAC1 and HDAC2 to negatively regulate gene expression. Mol Cell Biol, 2001.

21(20): p. 7065-77.

55. Adam, E., et al., Potentiation of tumor necrosis factor-induced NF-kappa B

activation by deacetylase inhibitors is associated with a delayed cytoplasmic

reappearance of I kappa B alpha. Mol Cell Biol, 2003. 23(17): p. 6200-9.

56. Baldwin, A.S., Jr., The NF-kappa B and I kappa B proteins: new discoveries and

insights. Annu Rev Immunol, 1996. 14: p. 649-83.

57. May, M.J. and S. Ghosh, Rel/NF-kappa B and I kappa B proteins: an overview.

Semin Cancer Biol, 1997. 8(2): p. 63-73.

58. Saccani, S., S. Pantano, and G. Natoli, p38-Dependent marking of inflammatory

genes for increased NF-kappa B recruitment. Nat Immunol, 2002. 3(1): p. 69-75.

59. Salvador, L.M., et al., Follicle-stimulating hormone stimulates protein kinase A-

mediated histone H3 phosphorylation and acetylation leading to select gene

activation in ovarian granulosa cells. J Biol Chem, 2001. 276(43): p. 40146-55.

60. Soloaga, A., et al., MSK2 and MSK1 mediate the mitogen- and stress-induced

phosphorylation of histone H3 and HMG-14. EMBO J, 2003. 22(11): p. 2788-97.

61. Ganchi, P.A., et al., A novel NF-kappa B complex containing p65 homodimers:

implications for transcriptional control at the level of subunit dimerization. Mol

Cell Biol, 1993. 13(12): p. 7826-35.

62. Mosialos, G. and T.D. Gilmore, v-Rel and c-Rel are differentially affected by

mutations at a consensus protein kinase recognition sequence. Oncogene, 1993.

8(3): p. 721-30.

63. Duran, A., M.T. Diaz-Meco, and J. Moscat, Essential role of RelA Ser311

phosphorylation by zetaPKC in NF-kappaB transcriptional activation. EMBO J,

2003. 22(15): p. 3910-8. 90

64. Leitges, M., et al., Targeted disruption of the zetaPKC gene results in the

impairment of the NF-kappaB pathway. Mol Cell, 2001. 8(4): p. 771-80.

65. Bird, T.A., et al., Activation of nuclear transcription factor NF-kappaB by

interleukin-1 is accompanied by casein kinase II-mediated phosphorylation of the

p65 subunit. J Biol Chem, 1997. 272(51): p. 32606-12.

66. Wang, D. and A.S. Baldwin, Jr., Activation of nuclear factor-kappaB-dependent

transcription by tumor necrosis factor-alpha is mediated through phosphorylation

of RelA/p65 on serine 529. J Biol Chem, 1998. 273(45): p. 29411-6.

67. Wang, D., et al., Tumor necrosis factor alpha-induced phosphorylation of

RelA/p65 on Ser529 is controlled by casein kinase II. J Biol Chem, 2000. 275(42):

p. 32592-7.

68. Sakurai, H., et al., IkappaB kinases phosphorylate NF-kappaB p65 subunit on

serine 536 in the transactivation domain. J Biol Chem, 1999. 274(43): p. 30353-

69. Sakurai, H., et al., Tumor necrosis factor-alpha-induced IKK phosphorylation of

NF-kappaB p65 on serine 536 is mediated through the TRAF2, TRAF5, and TAK1

signaling pathway. J Biol Chem, 2003. 278(38): p. 36916-23.

70. Saccani, S. and G. Natoli, Dynamic changes in histone H3 Lys 9 methylation

occurring at tightly regulated inducible inflammatory genes. Genes Dev, 2002.

16(17): p. 2219-24.

71. Saccani, S., S. Pantano, and G. Natoli, Two waves of nuclear factor kappaB

recruitment to target promoters. J Exp Med, 2001. 193(12): p. 1351-9.

72. Kiernan, R., et al., Post-activation turn-off of NF-kappa B-dependent

transcription is regulated by acetylation of p65. J Biol Chem, 2003. 278(4): p.

2758-66.

73. Dignam, J.D., R.M. Lebovitz, and R.G. Roeder, Accurate transcription initiation

by RNA polymerase II in a soluble extract from isolated mammalian nuclei.

Nucleic Acids Res, 1983. 11(5): p. 1475-89.

74. Chen, H., M. Tini, and R.M. Evans, HATs on and beyond chromatin. Curr Opin

Cell Biol, 2001. 13(2): p. 218-24.