DOCSLIB.ORG

Supplementary Information Captureseq: Capture-Based

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Information Captureseq: Capture-Based Supplementary information CaptureSeq: Capture-based enrichment of cpn60 gene fragments empowers pan- Domain profiling of microbial communities without universal PCR. Matthew G. Links 1,2, Tim J. Dumonceaux 3,4, Luke McCarthy 5, Sean M. Hemmingsen 5, Edward Topp 6, Alexia Comte 3, Jennifer R. Town 3* 1Department of Animal and Poultry Science, University of Saskatchewan, Saskatoon, SK, Canada 2Department of Computer Science, University of Saskatchewan, Saskatoon, SK, Canada 3Agriculture and Agri-Food Canada, Saskatoon Research and Development Centre, Saskatoon, SK, Canada 4Department of Veterinary Microbiology, University of Saskatchewan, Saskatoon, SK, Canada 5National Research Council of Canada, Saskatoon, SK, Canada 6Agriculture and Agri-Food Canada, London Research and Development Centre, London, ON, Canada *author for correspondence: [email protected] Supplemental Figure S1: Principal coordinate analysis of Bray-Curtis dissimilarity between soil samples profiled using CaptureSeq (square), shotgun metagenomic (triangle), or amplicon (circle) approaches and clustered using reference type I chaperonin sequences. Both inter- technique (A) and intra-technique (B, C, D) distances were evaluated. Supplemental Figure S2: Alpha diversity metrics for samples profiled using amplicon (red), CaptureSeq (blue), or shotgun metagenomic (green) approaches. Metrics were calculated using libraries that were downsampled from 250-2750 reads and were averaged across 100 bootstrapped datasets. The shaded area corresponds to the standard deviation of the three replicate soil plots for each antibiotic treatment condition. Supplemental Figure S3: The number of cpn60 gene copies for selected organisms from the synthetic community were quantified using species-specific quantitative PCR assays before (A) and after (B) CaptureSeq hybridization. Supplemental Figure S4: The number of mapped reads for each microorganism relative to the mean within each spiked synthetic community sample. Plasmids containing cpn60 UT sequences for all 20 microorganisms were mixed at an equimolar concentration for sequencing library preparation. A smaller deviation from the mean reflects reduced bias in the profiling method. Supplemental Information: Pseudocode describing the procedure used to retrieve reference cpn60 sequences from GenBank. GetNucleotideSequence($protein): for each $feature in $protein- >get_features_by_tag(“CDS”): if $feature->has_tag(“coded_by”): return $feature->get_tag_value(“coded_by”) for each $record in $protein->get_dblinks(“GenBank”): for each $feature in $record- >get_features_by_tag(“CDS”): if $feature->get_tag_value(“protein_id”) == $protein->id or $feature->get_tag_value(“locus_tag”) == $protein->locus_tag or $feature->get_tag_value(“gene”) == $protein- >gene_names: return $feature->get_sequence() for each $record in $protein->get_dblinks(“GenPept”): GetNucleotideSequence($record) Supplemental Table S1: Summary of sequencing output for soil sample libraries processed using amplicon, CaptureSeq and metagenomic profiling methods. Profiling Treatment Sequencing Reference Plot method (mg kg-1) reads Mapped reads 0 1 254,145 94.9% 0 7 34,221 95.8% 0 12 39,603 94.5% Amplicon 10 4 161,181 94.3% 10 8 65,299 95.1% 10 11 29,014 94.4% 0 1 1,226,019 16.4% 0 7 1,172,125 18.1% 0 12 1,158,656 15.9% CaptureSeq 10 4 1,025,680 17.0% 10 8 827,129 16.4% 10 11 765,101 16.7% 0 1 6,116,268 0.070% 0 7 7,306,386 0.071% Shotgun 0 12 6,953,220 0.070% metagenomic 10 4 4,232,651 0.067% 10 8 4,794,243 0.067% 10 11 4,287,559 0.069% Supplemental Table S2: Sequencing read abundance for seed wash samples spiked with a synthetic community of 20 bacteria in 10-fold decreasing dilutions were compared for samples using UT amplification or CaptureSeq profiling methods. Amplicon and CaptureSeq libraries were downsampled to 30,091 and 506,247 sequencing reads respectively and mapped to the reference chaperonin UT sequences for the 20 bacteria in the panel. Amplicon CaptureSeq High Medium Low High Medium Low Atopobium 171 133 10 943 87 10 vaginae Bifidobacteri 10 9 14 827 15 29 um bifidum Bifidobacteri 95 57 20 527 35 4 um infantis Gardnerella 1,096 974 120 1,369 92 11 vaginalis Lactobacillus 193 86 11 295 15 4 sp. N27 Lactobacillus 859 616 94 741 66 8 iners Lactobacillus 684 356 60 731 55 15 crispatus Lactobacillus 2,090 1,373 143 1,020 92 11 jensenii Lactobacillus 529 281 33 946 79 17 vaginalis Lactobacillus 2,330 1,079 135 827 69 12 gasseri Lactobacillus 1,554 1,254 126 874 63 2 salivarius Lactobacillus 652 324 39 803 65 10 sp. L6 Lactobacillus 2,756 1,864 229 889 83 9 sp. N19 Lactobacillus 426 317 43 297 20 3 johnsonii Lactobacillus 4,142 3,382 416 2,466 244 29 sp. N20 Peptostrepto coccus 2,468 1,681 107 1,416 124 18 anaerobius Prevotella 817 357 50 959 83 11 bivia Streptococcu s gallolyticus 3,789 2,153 173 1,010 89 12 Streptococcu s lutetiensis 1,048 623 46 769 66 10 Lactobacillus 1,291 729 126 1,332 120 18 plantarum Supplemental Table S3: Sequencing libraries prepared using amplicon or CaptureSeq approaches were down-sampled to 27,389 mapped reads and taxonomic clusters that were at least 10-fold less abundant in the amplicon libraries compared to the CaptureSeq libraries were considered. Of the top 25 most under-represented Bacteria in the amplicon libraries, 22 were identified as high G/C gram positive Actinobacteria and all had a cpn60 G/C content ≥ 64%. Amplicon CaptureSeq G/C Genbank Accession Name Mapped Mapped (%) Reads Reads WP_028636473.1 68 Nocardioides sp. URHA0032 25 658 ACC65036.1 66 uncultured soil bacterium 26 614 ACC65181.1 65 uncultured soil bacterium 31 597 WP_028651308.1 70 Nocardioides halotolerans 18 609 WP_030528625.1 68 Phycicoccus jejuensis 15 444 WP_027861271.1 67 Marmoricola sp. URHB0036 24 375 WP_028707293.1 69 Propionicicella superfundia 31 320 EON25274.1 68 Nocardioides sp. CF8 12 325 AEO79019.1 68 Tetrasphaera duodecadis 6 305 ACC65055.1 66 uncultured soil bacterium 21 284 WP_028929632.1 70 Pseudonocardia asaccharolytica 19 282 WP_028644730.1 67 Nocardioides sp. URHA0020 18 245 WP_022889903.1 68 Agromyces italicus 12 249 WP_030482905.1 70 Marmoricola aequoreus 7 242 AEO79020.1 66 Tetrasphaera elongata 11 234 WP_028635614.1 69 Nocardioides sp. URHA0032 20 217 WP_027860415.1 69 Marmoricola sp. URHB0036 2 226 WP_028925406.1 68 Pseudonocardia acaciae 15 210 WP_028643070.1 69 Nocardioides sp. URHA0020 7 179 WP_028660685.1 68 Nocardioides insulae 6 145 WP_019180227.1 67 Microbacterium yannicii 11 123 WP_036332750.1 69 Microbispora sp. PTA-5024 6 125 WP_026857066.1 71 Geodermatophilaceae 2 121 WP_024366553.1 64 Arthrobacter sp. TB 26 10 102 WP_028472535.1 69 Nocardioides alkalitolerans 4 87 Supplemental Table S4: ddPCR primer sets and conditions OTU Domain cpnDB nearest primer/probe name sequence (5'-3') product ddPCR amplification neighbor size, bp conditions D0498 CATCCCCATGTTGGAAAC 108 94°C, 10 min; 50x 94°C, 30 XP002901426 Eurkarya Phytophthora D0499 CCACGGATCTTGTTGATG sec; 55°C, 1:00 (ramp 2°C/sec); DN2_c0_g1_i1 (type I) infestans Pinf-cpn60 5'-FAM-CGTCCGCTT/ZEN/CTCATCATCGC-3'-IB 98°C, 10 min D0321 ACCATTGGTGACCTGATC 124 94°C, 10 min; 50x 94°C, 30 WP036300323 Bacteria Microbacterium D0322 CCTTGTCGAAACGCATAC sec; 55°C, 1:00 (ramp 2°C/sec); DN4_c3_g1_i2 (type I) sp. C448 C448 5'-FAM-AACACGTTC/ZEN/GGCACCGAGCT-3'-IB 98°C, 10 min D0516 AGGATGGTCACACCGTCGTT 173 94°C, 10 min; 50x 94°C, 30 KUL05486 Archaea Methanoculleus D0517 CTGAAAGAGGGTAGCCAGCG sec; 59°C, 1:00 (ramp 2°C/sec); DN0_c0_g1_i1 (type II) marisnigri Methanoculleus_c0g1i1 5'-FAM-ATGTTGCCC/ZEN/GACTGAGCGTCACGA-3'-IB 98°C, 10 min.
Load more

Recommended publications
  • Corynebacterium Sp.|NML98-0116
    1 Limnochorda_pilosa~GCF_001544015.1@NZ_AP014924=Bacteria-Firmicutes-Limnochordia-Limnochordales-Limnochordaceae-Limnochorda-Limnochorda_pilosa 0,9635 Ammonifex_degensii|KC4~GCF_000024605.1@NC_013385=Bacteria-Firmicutes-Clostridia-Thermoanaerobacterales-Thermoanaerobacteraceae-Ammonifex-Ammonifex_degensii 0,985 Symbiobacterium_thermophilum|IAM14863~GCF_000009905.1@NC_006177=Bacteria-Firmicutes-Clostridia-Clostridiales-Symbiobacteriaceae-Symbiobacterium-Symbiobacterium_thermophilum Varibaculum_timonense~GCF_900169515.1@NZ_LT827020=Bacteria-Actinobacteria-Actinobacteria-Actinomycetales-Actinomycetaceae-Varibaculum-Varibaculum_timonense 1 Rubrobacter_aplysinae~GCF_001029505.1@NZ_LEKH01000003=Bacteria-Actinobacteria-Rubrobacteria-Rubrobacterales-Rubrobacteraceae-Rubrobacter-Rubrobacter_aplysinae 0,975 Rubrobacter_xylanophilus|DSM9941~GCF_000014185.1@NC_008148=Bacteria-Actinobacteria-Rubrobacteria-Rubrobacterales-Rubrobacteraceae-Rubrobacter-Rubrobacter_xylanophilus 1 Rubrobacter_radiotolerans~GCF_000661895.1@NZ_CP007514=Bacteria-Actinobacteria-Rubrobacteria-Rubrobacterales-Rubrobacteraceae-Rubrobacter-Rubrobacter_radiotolerans Actinobacteria_bacterium_rbg_16_64_13~GCA_001768675.1@MELN01000053=Bacteria-Actinobacteria-unknown_class-unknown_order-unknown_family-unknown_genus-Actinobacteria_bacterium_rbg_16_64_13 1 Actinobacteria_bacterium_13_2_20cm_68_14~GCA_001914705.1@MNDB01000040=Bacteria-Actinobacteria-unknown_class-unknown_order-unknown_family-unknown_genus-Actinobacteria_bacterium_13_2_20cm_68_14 1 0,9803 Thermoleophilum_album~GCF_900108055.1@NZ_FNWJ01000001=Bacteria-Actinobacteria-Thermoleophilia-Thermoleophilales-Thermoleophilaceae-Thermoleophilum-Thermoleophilum_album
    [Show full text]
  • Raineyella Antarctica Gen. Nov., Sp. Nov., a Psychrotolerant, D-Amino
    International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5529–5536 DOI 10.1099/ijsem.0.001552 Raineyella antarctica gen. nov., sp. nov., a psychrotolerant, D-amino-acid-utilizing anaerobe isolated from two geographic locations of the Southern Hemisphere Elena Vladimirovna Pikuta,1 Rodolfo Javier Menes,2 Alisa Michelle Bruce,3† Zhe Lyu,4 Nisha B. Patel,5 Yuchen Liu,6 Richard Brice Hoover,1 Hans-Jürgen Busse,7 Paul Alexander Lawson5 and William Barney Whitman4 Correspondence 1Department of Mathematical, Computer and Natural Sciences, Athens State University, Athens, Elena Vladimirovna Pikuta AL 35611, USA [email protected] 2Catedra de Microbiología, Facultad de Química y Facultad de Ciencias, UDELAR, 11800 or Montevideo, Uruguay [email protected] 3Biology Department, University of Alabama in Huntsville, Huntsville, AL 35899, USA 4Microbiology Department, University of Georgia in Athens, Athens, GA 30602, USA 5Department of Microbiology and Plant Biology, University of Oklahoma, Norman, OK 73019, USA 6Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA 7Institut für Mikrobiologie - Veterinarmedizinische€ Universitat€ Wien, A-1210 Wien, Austria A Gram-stain-positive bacterium, strain LZ-22T, was isolated from a rhizosphere of moss Leptobryum sp. collected at the shore of Lake Zub in Antarctica. Cells were motile, straight or pleomorphic rods with sizes of 0.6–1.0Â3.5–10 µm. The novel isolate was a facultatively anaerobic, catalase-positive, psychrotolerant mesophile. Growth was observed at 3–41 C (optimum 24–28 C), with 0–7 % (w/v) NaCl (optimum 0.25 %) and at pH 4.0–9.0 (optimum pH 7.8). The quinone system of strain LZ-22T possessed predominately menaquinone MK-9(H4).
    [Show full text]
  • Propionicicella Superfundia Gen. Nov., Sp. Nov., a Chlorosolvent-Tolerant Propionate-Forming, Facultative Anaerobic Bacterium Is
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Estudo Geral ARTICLE IN PRESS Systematic and Applied Microbiology 29 (2006) 404–413 www.elsevier.de/syapm Propionicicella superfundia gen. nov., sp. nov., a chlorosolvent-tolerant propionate-forming, facultative anaerobic bacterium isolated from contaminated groundwater Hee-Sung Baea, William M. Moeb,Ã, Jun Yanb, Igor Tiagoc, Milton S. da Costad, Fred A. Raineya aDepartment of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA bDepartment of Civil and Environmental Engineering, Louisiana State University, Baton Rouge, LA 70803, USA cDepartamento de Zoologia and Centro de Neurocieˆncias, Universidade de Coimbra, 3004-517 Coimbra, Portugal dDepartamento de Bioquı´mica and Centro de Neurocieˆncias, Universidade de Coimbra, 3001-401 Coimbra, Portugal Received 5 October 2005 Abstract A novel strain, designated as BL-10T, was characterized using a polyphasic approach after isolation from groundwater contaminated by a mixture of chlorosolvents that included 1,1,2-trichloroethane, 1,2-dichloroethane, and vinyl chloride. Stain BL-10T is a facultatively anaerobic bacterium able to ferment glucose to form propionate, acetate, formate, lactate, and succinate. Fermentation occurred in the presence of 1,2-dichloroethane and 1,1,2-trichloroethane at concentrations to at least 9.8 and 5.9 mM, respectively. Cells are Gram-positive, rod-shaped, non-motile, and do not form spores. Oxidase and catalase are not produced and nitrate reduction did not occur in PYG medium. Menaquinone MK-9 is the predominant respiratory quinone and meso-diaminopimelic acid is present in the cell wall peptidoglycan layer. Major cellular fatty acids are C15:0, iso C16:0, and anteiso C15:0.
    [Show full text]
  • Mitigating Biofouling on Reverse Osmosis Membranes Via Greener Preservatives
    Mitigating biofouling on reverse osmosis membranes via greener preservatives by Anna Curtin Biology (BSc), Le Moyne College, 2017 A Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of MASTER OF APPLIED SCIENCE in the Department of Civil Engineering, University of Victoria © Anna Curtin, 2020 University of Victoria All rights reserved. This Thesis may not be reproduced in whole or in part, by photocopy or other means, without the permission of the author. Supervisory Committee Mitigating biofouling on reverse osmosis membranes via greener preservatives by Anna Curtin Biology (BSc), Le Moyne College, 2017 Supervisory Committee Heather Buckley, Department of Civil Engineering Supervisor Caetano Dorea, Department of Civil Engineering, Civil Engineering Departmental Member ii Abstract Water scarcity is an issue faced across the globe that is only expected to worsen in the coming years. We are therefore in need of methods for treating non-traditional sources of water. One promising method is desalination of brackish and seawater via reverse osmosis (RO). RO, however, is limited by biofouling, which is the buildup of organisms at the water-membrane interface. Biofouling causes the RO membrane to clog over time, which increases the energy requirement of the system. Eventually, the RO membrane must be treated, which tends to damage the membrane, reducing its lifespan. Additionally, antifoulant chemicals have the potential to create antimicrobial resistance, especially if they remain undegraded in the concentrate water. Finally, the hazard of chemicals used to treat biofouling must be acknowledged because although unlikely, smaller molecules run the risk of passing through the membrane and negatively impacting humans and the environment.
    [Show full text]
  • INVESTIGATING the ACTINOMYCETE DIVERSITY INSIDE the HINDGUT of an INDIGENOUS TERMITE, Microhodotermes Viator
    INVESTIGATING THE ACTINOMYCETE DIVERSITY INSIDE THE HINDGUT OF AN INDIGENOUS TERMITE, Microhodotermes viator by Jeffrey Rohland Thesis presented for the degree of Doctor of Philosophy in the Department of Molecular and Cell Biology, Faculty of Science, University of Cape Town, South Africa. April 2010 ACKNOWLEDGEMENTS Firstly and most importantly, I would like to thank my supervisor, Dr Paul Meyers. I have been in his lab since my Honours year, and he has always been a constant source of guidance, help and encouragement during all my years at UCT. His serious discussion of project related matters and also his lighter side and sense of humour have made the work that I have done a growing and learning experience, but also one that has been really enjoyable. I look up to him as a role model and mentor and acknowledge his contribution to making me the best possible researcher that I can be. Thank-you to all the members of Lab 202, past and present (especially to Gareth Everest – who was with me from the start), for all their help and advice and for making the lab a home away from home and generally a great place to work. I would also like to thank Di James and Bruna Galvão for all their help with the vast quantities of sequencing done during this project, and Dr Bronwyn Kirby for her help with the statistical analyses. Also, I must acknowledge Miranda Waldron and Mohammed Jaffer of the Electron Microsope Unit at the University of Cape Town for their help with scanning electron microscopy and transmission electron microscopy related matters, respectively.
    [Show full text]
  • Comparison of Methods to Identify Pathogens and Associated Virulence Functional Genes in Biosolids from Two Different Wastewater Treatment Facilities in Canada
    RESEARCH ARTICLE Comparison of Methods to Identify Pathogens and Associated Virulence Functional Genes in Biosolids from Two Different Wastewater Treatment Facilities in Canada Etienne Yergeau1*, Luke Masson2, Miria Elias1, Shurong Xiang3, Ewa Madey4, a11111 Hongsheng Huang5, Brian Brooks5, Lee A. Beaudette3 1 National Research Council Canada, Energy Mining and Environment, Montreal, Qc, Canada, 2 National Research Council Canada, Human Health Therapeutics, Montreal, Qc, Canada, 3 Environment Canada, Biological Assessment and Standardization Section, Ottawa, On, Canada, 4 Canadian Food Inspection Agency, Fertilizer Safety Office, Plant Health & Biosecurity Directorate, Ottawa, On, Canada, 5 Canadian Food Inspection Agency, Ottawa Laboratory – Fallowfield, Ottawa, On, Canada OPEN ACCESS * [email protected] Citation: Yergeau E, Masson L, Elias M, Xiang S, Madey E, Huang H, et al. (2016) Comparison of Methods to Identify Pathogens and Associated Abstract Virulence Functional Genes in Biosolids from Two Different Wastewater Treatment Facilities in Canada. The use of treated municipal wastewater residues (biosolids) as fertilizers is an attractive, PLoS ONE 11(4): e0153554. doi:10.1371/journal. inexpensive option for growers and farmers. Various regulatory bodies typically employ pone.0153554 indicator organisms (fecal coliforms, E. coli and Salmonella) to assess the adequacy and Editor: Leonard Simon van Overbeek, Wageningen efficiency of the wastewater treatment process in reducing pathogen loads in the final University and Research Centre, NETHERLANDS product. Molecular detection approaches can offer some advantages over culture-based Received: October 28, 2015 methods as they can simultaneously detect a wider microbial species range, including Accepted: March 31, 2016 non-cultivable microorganisms. However, they cannot directly assess the viability of the Published: April 18, 2016 pathogens.
    [Show full text]
  • Isolation and Characterization of Bacteria in a Toluene-Producing Enrichment Culture Derived from Contaminated Groundwater at a Louisiana Superfund Site
    Louisiana State University LSU Digital Commons LSU Master's Theses Graduate School August 2020 Isolation and Characterization of Bacteria in a Toluene-Producing Enrichment Culture Derived from Contaminated Groundwater at a Louisiana Superfund Site Madison Mikes Louisiana State University and Agricultural and Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_theses Part of the Civil and Environmental Engineering Commons, and the Microbiology Commons Recommended Citation Mikes, Madison, "Isolation and Characterization of Bacteria in a Toluene-Producing Enrichment Culture Derived from Contaminated Groundwater at a Louisiana Superfund Site" (2020). LSU Master's Theses. 5206. https://digitalcommons.lsu.edu/gradschool_theses/5206 This Thesis is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Master's Theses by an authorized graduate school editor of LSU Digital Commons. For more information, please contact [email protected]. ISOLATION AND CHARACTERIZATION OF BACTERIA IN A TOLUENE- PRODUCING ENRICHMENT CULTURE DERIVED FROM CONTAMINATED GROUNDWATER AT A LOUISIANA SUPERFUND SITE A Thesis Submitted to the Graduate Faculty of the Louisiana State University and Agriculture and Mechanical College in partial fulfillment of the requirements for the degree of Master of Science in The Department of Civil and Environmental Engineering by Madison Colleen Mikes B.S., Louisiana State University, 2018 December 2020 1 ACKNOWLEDGEMENTS I would like to take the time to thank all of those who have supported and assisted me during my graduate program. First and foremost, I would like to thank Dr. Bill Moe for all of the time he has spent teaching me and mentoring me through my thesis work.
    [Show full text]
  • Characterising Antibiotic Susceptibility and Resistance in Human Commensal Gut Bacteria
    Characterising antibiotic susceptibility and resistance in human commensal gut bacteria Lindsay Jacqueline Pike Gonville and Caius College, University of Cambridge Wellcome Sanger Institute August 2019 This dissertation is submitted for the degree of Doctor of Philosophy Supervised by Dr Trevor Lawley, Host-Microbiota Interactions Laboratory Funded by the Medical Research Council and the Wellcome Sanger Institute i ii Declaration This dissertation is the result of my own work and includes nothing that is the outcome of work done in collaboration except as declared in the Preface and specified in the text. It is not substantially the same as any that I have submitted, or, is being concurrently submitted for a degree or diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. I further state that no substantial part of my dissertation has already been submitted, or, is being concurrently submitted for any such degree, diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. It does not exceed the word limit of 60,000 words (excluding bibliography, figures, and appendixes) as prescribed by the Degree Committee for the Faculty of Biology at the University of Cambridge. Mr Mark Stares assisted with phenotyping gut bacteria against antibiotics and extracting DNA for whole genome sequencing. Mr Matthew Dorman assisted with cloning of candidate novel antibiotic resistance genes. Dr Simon Clare and members of his team looked after the mice used in this study and collected mouse faecal pellets.
    [Show full text]
  • Metabolic Roles of Uncultivated Bacterioplankton Lineages in the Northern Gulf of Mexico 2 “Dead Zone” 3 4 J
    bioRxiv preprint doi: https://doi.org/10.1101/095471; this version posted June 12, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Metabolic roles of uncultivated bacterioplankton lineages in the northern Gulf of Mexico 2 “Dead Zone” 3 4 J. Cameron Thrash1*, Kiley W. Seitz2, Brett J. Baker2*, Ben Temperton3, Lauren E. Gillies4, 5 Nancy N. Rabalais5,6, Bernard Henrissat7,8,9, and Olivia U. Mason4 6 7 8 1. Department of Biological Sciences, Louisiana State University, Baton Rouge, LA, USA 9 2. Department of Marine Science, Marine Science Institute, University of Texas at Austin, Port 10 Aransas, TX, USA 11 3. School of Biosciences, University of Exeter, Exeter, UK 12 4. Department of Earth, Ocean, and Atmospheric Science, Florida State University, Tallahassee, 13 FL, USA 14 5. Department of Oceanography and Coastal Sciences, Louisiana State University, Baton Rouge, 15 LA, USA 16 6. Louisiana Universities Marine Consortium, Chauvin, LA USA 17 7. Architecture et Fonction des Macromolécules Biologiques, CNRS, Aix-Marseille Université, 18 13288 Marseille, France 19 8. INRA, USC 1408 AFMB, F-13288 Marseille, France 20 9. Department of Biological Sciences, King Abdulaziz University, Jeddah, Saudi Arabia 21 22 *Correspondence: 23 JCT [email protected] 24 BJB [email protected] 25 26 27 28 Running title: Decoding microbes of the Dead Zone 29 30 31 Abstract word count: 250 32 Text word count: XXXX 33 34 Page 1 of 31 bioRxiv preprint doi: https://doi.org/10.1101/095471; this version posted June 12, 2017.
    [Show full text]
  • Microbially Enhanced Oil Recovery Through Stimulation of Indigenous Oil Field Microflora with Nitrate Or Introduction of Rhamnolipid Producers
    University of Calgary PRISM: University of Calgary's Digital Repository Graduate Studies The Vault: Electronic Theses and Dissertations 2013-01-03 Microbially enhanced oil recovery through stimulation of indigenous oil field microflora with nitrate or introduction of rhamnolipid producers Kryachko, Yuriy Kryachko, Y. (2013). Microbially enhanced oil recovery through stimulation of indigenous oil field microflora with nitrate or introduction of rhamnolipid producers (Unpublished doctoral thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/26902 http://hdl.handle.net/11023/380 doctoral thesis University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY Microbially enhanced oil recovery through stimulation of indigenous oil field microflora with nitrate or introduction of rhamnolipid producers by Yuriy Kryachko A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES CALGARY, ALBERTA DECEMBER, 2012 © Yuriy Kryachko 2012 Abstract Sandpack model columns filled with two kinds of heavy oil were used to study the influence of nitrate injections on oil production. Columns containing trapped oil and nitrate consistently produced more oil than columns without nitrate in anaerobic conditions under counter-diffusion-induced gas drive. The presence of nitrate likely led to an increase of biomass and amounts of produced biosurfactants, allowing a reduction of oil-water interfacial tension.
    [Show full text]
  • Propionicicella Superfundia Gen. Nov., Sp. Nov., a Chlorosolvent-Tolerant Propionate-Forming, Facultative Anaerobic Bacterium Is
    ARTICLE IN PRESS Systematic and Applied Microbiology 29 (2006) 404–413 www.elsevier.de/syapm Propionicicella superfundia gen. nov., sp. nov., a chlorosolvent-tolerant propionate-forming, facultative anaerobic bacterium isolated from contaminated groundwater Hee-Sung Baea, William M. Moeb,Ã, Jun Yanb, Igor Tiagoc, Milton S. da Costad, Fred A. Raineya aDepartment of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA bDepartment of Civil and Environmental Engineering, Louisiana State University, Baton Rouge, LA 70803, USA cDepartamento de Zoologia and Centro de Neurocieˆncias, Universidade de Coimbra, 3004-517 Coimbra, Portugal dDepartamento de Bioquı´mica and Centro de Neurocieˆncias, Universidade de Coimbra, 3001-401 Coimbra, Portugal Received 5 October 2005 Abstract A novel strain, designated as BL-10T, was characterized using a polyphasic approach after isolation from groundwater contaminated by a mixture of chlorosolvents that included 1,1,2-trichloroethane, 1,2-dichloroethane, and vinyl chloride. Stain BL-10T is a facultatively anaerobic bacterium able to ferment glucose to form propionate, acetate, formate, lactate, and succinate. Fermentation occurred in the presence of 1,2-dichloroethane and 1,1,2-trichloroethane at concentrations to at least 9.8 and 5.9 mM, respectively. Cells are Gram-positive, rod-shaped, non-motile, and do not form spores. Oxidase and catalase are not produced and nitrate reduction did not occur in PYG medium. Menaquinone MK-9 is the predominant respiratory quinone and meso-diaminopimelic acid is present in the cell wall peptidoglycan layer. Major cellular fatty acids are C15:0, iso C16:0, and anteiso C15:0. Genomic DNA G+C content is 69.9 mol%.
    [Show full text]
  • Raineyella Antarctica Gen. Nov., Sp. Nov., a Psychrotolerant, D-Amino-Acid-Utilizing Anaerobe Isolated from Two Geographic Locat
    International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5529–5536 DOI 10.1099/ijsem.0.001552 Raineyella antarctica gen. nov., sp. nov., a psychrotolerant, D-amino-acid-utilizing anaerobe isolated from two geographic locations of the Southern Hemisphere Elena Vladimirovna Pikuta,1 Rodolfo Javier Menes,2 Alisa Michelle Bruce,3† Zhe Lyu,4 Nisha B. Patel,5 Yuchen Liu,6 Richard Brice Hoover,1 Hans-Jürgen Busse,7 Paul Alexander Lawson5 and William Barney Whitman4 Correspondence 1Department of Mathematical, Computer and Natural Sciences, Athens State University, Athens, Elena Vladimirovna Pikuta AL 35611, USA [email protected] 2Catedra de Microbiología, Facultad de Química y Facultad de Ciencias, UDELAR, 11800 or Montevideo, Uruguay [email protected] 3Biology Department, University of Alabama in Huntsville, Huntsville, AL 35899, USA 4Microbiology Department, University of Georgia in Athens, Athens, GA 30602, USA 5Department of Microbiology and Plant Biology, University of Oklahoma, Norman, OK 73019, USA 6Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA 7Institut für Mikrobiologie - Veterinarmedizinische€ Universitat€ Wien, A-1210 Wien, Austria A Gram-stain-positive bacterium, strain LZ-22T, was isolated from a rhizosphere of moss Leptobryum sp. collected at the shore of Lake Zub in Antarctica. Cells were motile, straight or pleomorphic rods with sizes of 0.6–1.0Â3.5–10 µm. The novel isolate was a facultatively anaerobic, catalase-positive, psychrotolerant mesophile. Growth was observed at 3–41 C (optimum 24–28 C), with 0–7 % (w/v) NaCl (optimum 0.25 %) and at pH 4.0–9.0 (optimum pH 7.8). The quinone system of strain LZ-22T possessed predominately menaquinone MK-9(H4).
    [Show full text]