DOCSLIB.ORG

Overexpressing PLOD Family Genes Predict Poor Prognosis in Gastric Cancer Shan-Shan Li1*, Yi-Fan Lian2*, Yan-Lin Huang3, Yue-Hua Huang2,3, Jian Xiao1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Overexpressing PLOD Family Genes Predict Poor Prognosis in Gastric Cancer Shan-Shan Li1*, Yi-Fan Lian2*, Yan-Lin Huang3, Yue-Hua Huang2,3, Jian Xiao1 Journal of Cancer 2020, Vol. 11 121 Ivyspring International Publisher Journal of Cancer 2020; 11(1): 121-131. doi: 10.7150/jca.35763 Research Paper Overexpressing PLOD family genes predict poor prognosis in gastric cancer Shan-Shan Li1*, Yi-Fan Lian2*, Yan-Lin Huang3, Yue-Hua Huang2,3, Jian Xiao1 1. Department of Medical Oncology, the Sixth Affiliated Hospital of Sun Yat-sen University, Guangzhou, China 2. Guangdong Provincial Key Laboratory of Liver Disease Research, the Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China 3. Department of Infectious Diseases, the Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China *These authors contributed equally to this work Corresponding authors: Jian Xiao, MD, PhD, Department of Medical Oncology, the Sixth Affiliated Hospital of Sun Yat-sen University, 26 Yuancun Erheng Road, Guangzhou, China, 510655, Tel: 8620-38285497, Email: [email protected]; Yue-Hua Huang, MD, PhD, Guangdong Provincial Key Laboratory of Liver Disease Research & Department of Infectious Diseases, the Third Affiliated Hospital of Sun Yat-sen University, 600 Tian He Rd. Guangzhou, China, 510630, Tel: 8620-85252702, Fax: 8620-85253305, Email: [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2019.04.15; Accepted: 2019.09.20; Published: 2020.01.01 Abstract Procollagen-lysine, 2-oxoglutarate 5-dioxygenases (PLODs) are a set of enzymes involved in the hydroxylation of lysine and stabilization of collagen by crosslinks. Previous studies have highlighted that overexpressing PLOD genes were related to the progression, migration and progression of different human cancers. However, the diverse expression patterns and prognostic values of PLOD genes remain to be elucidated in gastric cancer (GC). In this study, we mined the expression and survival data in GC patients through ONCOMINE, UALCAN and Kaplan-Meier Plotter database. STRING portal couple with DAVID was used to establish a functional protein interaction network of PLOD family genes and analyze the GO and KEGG enriched pathways. Differential gene expression correlated with PLOD family genes was identified with LinkedOmics. We found that PLOD1, 2 and 3 were up-regulated in GC patients compared with normal tissues. High expression levels of PLOD1 and PLOD3 were associated with shorter overall survival (OS), first progression (FP) and post progression survival (PPS) while high expression level of PLOD2 was only associated with shorter FP in all GC patients. Specifically, only high PLOD2 expression had significant correlation with shorter OS, FP and PPS in the diffuse type GC patients. Furthermore, combinatorial use of expressions of all PLOD genes was a superior prognostic indicator for GC patients. Pathway analysis confirmed that PLOD family genes mainly participate in regulating the collagen metabolism and extracellular matrix constitution, and the cellular adaptor protein SHC1, which helps to transduce an extracellular signal into an intracellular signal, could be the regulatory module mediating PLOD’s effect on GC. Therefore, we propose that individual PLOD genes or PLOD family genes as a whole could be potential prognostic biomarkers for GC. Key words: PLOD; gastric cancer; prognosis; bioinformatics Introduction As a major component of tumor micro- the balance of ECM signal will no doubt cause effect environment, extracellular matrix (ECM) plays an on cancer cell functions [3, 4]. Thus, identifying important role in cancer development and molecules correlated with ECM regulation would progression, which consists of structural proteins, help to develop novel diagnostic and therapeutic glycoproteins and proteoglycans. ECM proteins strategies for cancer treatment. deposition and crosslink provides necessary Among the various ECM components, collagens biochemical and biophysical supports for cancer cell are the most abundant proteins, which were reported proliferation, migration and invasion [1, 2]. Aberrant to modulate cancer cell migration, invasion [5], expression of ECM-related molecules and alteration of proliferation [6] and patient survival [7]. The collagen http://www.jcancer.org Journal of Cancer 2020, Vol. 11 122 family contains 28 members and can be divided into GC is generally poor due to the fact that many two groups: fibrillar collagen (type I, II, III, V, XI) and patients had metastasis by the time of diagnosis and non-fibrillar collagen (type IV, VIII, X, IX, XII, XIV, nearly inevitable tumor progression in spite of good XV, XVIII, XIX, XXI) [8]. After synthesis in the rough initial treatment response, resulting in a five-year endoplasmic reticulum, the collagen precursor went survival rate less than 10% [28]. Recently, increased through a process of modifications including lysine collagen deposition was found in GC compared to hydroxylation for maturation. Hydroxylysine residue non-neoplastic tissues, and collagen width was usually occurs in the Y position of the repeating demonstrated to be a powerful parameter for Gly-X-Y (X and Y represent proline or hydroxyl- predicting 5-year overall survival of GC [29]. Further proline) motif [9], and is critical for the formation of studies of collagen related oncogenes would collagen crosslink and glycosylation, stabilizing the contribute to identifying novel molecular markers of newly formed collagen fibers and enhancing the GC progression and help develop new diagnostic and stiffness of the matrix [10]. Abnormal lysyl therapeutic strategies. With respect to PLOD family hydroxylation contributes to the progression of many genes, the expression pattern and its relation with collagen-related diseases, such as fibrosis and cancer patient prognosis of individual PLODs in GC have [11]. Therefore, modification events of maturation and recently been reported. High PLOD1 mRNA the corresponding enzymes are important for proper expression level was observed in gastric cancer and function of collagen and related cancer cell biology. was associated with poor patient prognosis [18]. Procollagen-lysine, 2-oxoglutarate 5-dioxygen- PLOD2 was reported to promote cell invasiveness and ase (PLOD) is the lysyl hydroxylase responsible for migration in GC under hypoxia condition and lead to the lysyl hydroxylation of collagen [12]. In human peritoneal dissemination and poor prognosis [30]. genome, three PLODs, namely PLOD1, 2 and 3, are PLOD3 mRNA was also up-regulated in GC tissues identified and share high homology with an overall and cell lines, which was significantly correlated with identity being 47% in protein sequences [9]. PLOD1 larger tumor size and poor patient prognosis [31]. In and PLOD3 hydroxylate lysyl residues in the collagen the current study, we investigated on the PLOD triple helix, whereas PLOD2 hydroxylates lysyl family genes based on different online databases. residues in the telopeptides of collagen. In addition, Study of individual PLOD family genes would be PLOD3 has glycosylation activity towards mono- included, and we also highlight the prognostic values saccharide or disaccharide attaching to collagen of co-expression of three PLOD genes for GC patients, hydroxylysines [13]. Mounting evidences are suggest- and prediction of PLODs-related signaling pathways ing that increased collagen deposition and cross- in GC. linking can promote cancer progression by enhancing cancer cell proliferation, invasion and migration Methods [14-17], and overexpression of each PLOD gene has ONCOMINE analysis been reported in different human cancers. Higher expression level of PLOD1 was observed in The mRNA expressions of PLOD1, 2 and 3 in gastrointestinal carcinoma, and was related to different cancer types were analyzed using carcinogenesis and clinical outcome [18]. PLOD1 and ONCOMINE gene expression array database [32] PLOD2 were reportedly up-regulated in esophageal (www.oncomine.org), which is publicly accessible squamous-cell carcinoma and were associated with online. In this study, Student’s t test was used to cell apoptosis, cell cycle and metastasis regulation [19, generate the P-value for expression differences of 20]. Additionally, PLOD2 has been shown to promote PLOD family genes between cancer specimens and metastasis in lung cancer, renal cell carcinoma and normal controls. The fold change was defined as > 1 glioma [21-23]. Overexpression of PLOD3 was and the P-value was set up at 0.05. observed in lung cancer and glioma, and was also UALCAN analysis associated with tumor progression and metastasis [24, UALCAN [33] is an interactive web-portal to 25]. RNA interfering mediated down regulation of perform in-depth analyses of level 3 RNA-seq and PLOD2 expression inhibited proliferation and clinical data from 31 cancer type of The Cancer invasion of bladder cancer cells [26]. Therefore, the Genome Atlas (TCGA) database and it is publicly PLOD family genes could not only act as prognostic available at http://ualcan.path.uab.edu. We use it to signatures but also become druggable targets for analyze the relative expression of PLOD family genes cancer therapy. between GC and normal samples and to compare the Gastric cancer (GC) is the fifth leading expression differences among various sub-groups malignancy and the third leading cause of based on cancer stage. The expression level was cancer-related deaths globally [27]. The prognosis of normalized as transcripts
Load more

Recommended publications
  • PLOD3 Suppression Exerts an Anti-Tumor Effect on Human Lung
    Baek et al. Cell Death and Disease (2019) 10:156 https://doi.org/10.1038/s41419-019-1405-8 Cell Death & Disease ARTICLE Open Access PLOD3 suppression exerts an anti-tumor effect on human lung cancer cells by modulating the PKC-delta signaling pathway Jeong-Hwa Baek1,2, Hong Shik Yun1,GyooTaikKwon1,JanetLee1,Ju-YoungKim1,YunhuiJo1,Jae-MinCho1, Chang-Woo Lee2, Jie-Young Song1,JiyeonAhn 1,Jae-SungKim 1,EunHoKim1 and Sang-Gu Hwang1 Abstract Current lung cancer treatments are far from satisfactory; thus, finding novel treatment targets is crucial. We recently identified procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3), which is involved in fibrosis and tissue remodeling as a radioresistance-related protein in lung cancer cells; however, its mechanism is unclear. In this study, we designed human PLOD3-specific short interfering (si)RNAs and tested their effects on tumor growth inhibition in vitro and in vivo. PLOD3 knockdown overcame chemoresistance and decreased radioresistance by inducing caspase-3-dependent apoptosis in lung cancer cells. Furthermore, PLOD3 interacted with PKCδ to activate caspase-2, 4-dependent apoptosis through ER-stress-induced IRE1α activation and the downstream unfolded-protein response pathway. In a mouse xenograft model, PLOD3 knockdown promoted radiation-induced tumor growth inhibition, without side effects. Moreover, lung cancer patients with high PLOD3 expression showed poorer prognosis than those 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; with low PLOD3 expression upon radiotherapy, suggesting that PLOD3 promotes tumor growth. Therefore, PLOD3 siRNA suppresses radioresistance and chemoresistance by inducing apoptosis and renders PLOD3 as a candidate lung cancer biomarker. PLOD3 gene therapy might enhance the efficacy of radiotherapy or chemotherapy in lung cancer patients.
    [Show full text]
  • Downloaded from the Gene 4.286) Were Significantly Up-Regulated Compared with Expression Omnibus (GEO) Database
    2724 Original Article Bioinformatic analysis of PLOD family member expression and prognostic value in non-small cell lung cancer Qi Qi1,2,3,4,5#, Wuhao Huang1,2,3,4,5#, Hua Zhang1,2,3,4,5, Bin Zhang1,2,3,4,5, Xiaoyan Sun1,2,3,4,5, Jun Ma1,2,3,4,5, Chaonan Zhu1,2,3,4,5, Changli Wang1,2,3,4,5 1Department of Lung Cancer, Tianjin Medical University Cancer Institute and Hospital, Tianjin, China; 2National Clinical Research Center for Cancer, Tianjin, China; 3Key Laboratory of Cancer Prevention and Therapy, Tianjin, China; 4Tianjin’s Clinical Research Center for Cancer, Tianjin, China; 5Tianjin Lung Cancer Center, Tianjin, China Contributions: (I) Conception and design: C Wang, Q Qi, W Huang; (II) Administrative support: None; (III) Provision of study materials: Q Qi, W Huang; (IV) Collection and assembly of data: H Zhang, X Sun; (V) Data analysis and interpretation: Q Qi, W Huang, J Ma, C Zhu; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Changli Wang, MD. Huanhuxi Road, Hexi District, Tianjin 300202, China. Email: [email protected]. Background: Procollagen-lysine, 2-oxoglutarate 5-dioxygenases (PLODs) are a group of enzymes that can mediate the hydroxylation of lysyl to hydroxylysine and participate in the formation of stabilized collagen. Evidence has demonstrated that PLODs are involved in the steps of tumor progression, including proliferation, invasion, and metastasis. However, limited information is available on the function of PLOD1/2/3 in lung cancer. In this study, we investigated the expression patterns and prognostic values of PLODs in patients with lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC).
    [Show full text]
  • Computational Drug Repositioning for Gastric Cancer Using Reversal
    www.nature.com/scientificreports OPEN Computational Drug Repositioning for Gastric Cancer using Reversal Gene Expression Profles Received: 17 September 2018 In-Wha Kim1, Hayoung Jang1, Jae Hyun Kim1, Myeong Gyu Kim2, Sangsoo Kim3 & Jung Mi Oh 1 Accepted: 21 January 2019 Treatment of gastric cancer (GC) often produces poor outcomes. Moreover, predicting which GC Published: xx xx xxxx treatments will be efective remains challenging. Computational drug repositioning using public databases is a promising and efcient tool for discovering new uses for existing drugs. Here we used a computational reversal of gene expression approach based on efects on gene expression signatures by GC disease and drugs to explore new GC drug candidates. Gene expression profles for individual GC tumoral and normal gastric tissue samples were downloaded from the Gene Expression Omnibus (GEO) and diferentially expressed genes (DEGs) in GC were determined with a meta-signature analysis. Profles drug activity and drug-induced gene expression were downloaded from the ChEMBL and the LINCS databases, respectively. Candidate drugs to treat GC were predicted using reversal gene expression score (RGES). Drug candidates including sorafenib, olaparib, elesclomol, tanespimycin, selumetinib, and ponatinib were predicted to be active for treatment of GC. Meanwhile, GC-related genes such as PLOD3, COL4A1, UBE2C, MIF, and PRPF5 were identifed as having gene expression profles that can be reversed by drugs. These fndings support the use of a computational reversal gene expression approach to identify new drug candidates that can be used to treat GC. Gastric cancer (GC) is the ffh most common cancer worldwide and the third leading cause of cancer death, with 1.3 million incident cases and 819,000 deaths occurring globally in 20151.
    [Show full text]
  • PLOD3 (NM 001084) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC203445L3 PLOD3 (NM_001084) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: PLOD3 (NM_001084) Human Tagged ORF Clone Tag: Myc-DDK Symbol: PLOD3 Synonyms: LH3 Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(RC203445). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_001084 ORF Size: 2214 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 PLOD3 (NM_001084) Human Tagged ORF Clone – RC203445L3 OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at [email protected] or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g.
    [Show full text]
  • Supporting Information for Proteomics DOI 10.1002/Pmic.200800646
    Supporting Information for Proteomics DOI 10.1002/pmic.200800646 Jian Ren, Xinjiao Gao, Changjiang Jin, Mei Zhu, Xiwei Wang, Andrew Shaw, Longping Wen, Xuebiao Yao and Yu Xue Systematic study of protein sumoylation: Development of a site-specific predictor of SUMOsp 2.0 & 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com Supporting Information Technical Brief Systematic study of protein sumoylation: development of a site-specific predictor of SUMOsp 2.0 Jian Ren1, Xinjiao Gao1, Changjiang Jin1, Mei Zhu1, Xiwei Wang1, Andrew Shaw2, Longping Wen1, Xuebiao Yao1** and Yu Xue1* 1Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science & Technology of China, Hefei, Anhui 230027, China 2Department of Physiology and Cancer Biology Program, Morehouse School of Medicine, Atlanta, GA 30310, USA Running title: Prediction of sumoylation sites *Correspondence: Professor Yu Xue, Life Science School, USTC, Hefei 230027, China E-mail: [email protected] Tel: +86-551-3607821; **Additional corresponding author: Professor Xuebiao Yao, Email: [email protected] Abbreviations: GPS, Group-based Phosphorylation Scoring; PSP, potential sumoylation peptide; MaM, Matrix Mutation; MS, Mass Spectrometry; OS, Operating System; JRE, Java Runtime Environment; Ac, accuracy; Sn, sensitivity; Sp, specificity; MCC, Mathew correlation coefficient; ROC, Receiver Operating Characteristic; SUMO-CS, SUMO consensus sequence; SVMs, Support Vector Machines; eNOS, endothelial nitric oxide synthase; ISE, intronic splicing enhancer; VEGF, vascular endothelial growth factor Supporting Information – Materials and Methods Data preparation Previously, we searched the PubMed with keywords of “SUMO” and “sumoylation”, and manually collected 239 experimentally verified sumoylation sites in 144 proteins [1]. This data set was used for SUMOsp 1.0 and SUMOsp 2.0 for performance comparison.
    [Show full text]
  • Prognostic and Therapeutic Implications of Extracellular Matrix Associated Gene Signature in Renal Clear Cell Carcinoma
    www.nature.com/scientificreports OPEN Prognostic and therapeutic implications of extracellular matrix associated gene signature in renal clear cell carcinoma Pankaj Ahluwalia1, Meenakshi Ahluwalia1, Ashis K. Mondal1, Nikhil Sahajpal1, Vamsi Kota2, Mumtaz V. Rojiani1, Amyn M. Rojiani1 & Ravindra Kolhe1* Complex interactions in tumor microenvironment between ECM (extra-cellular matrix) and cancer cell plays a central role in the generation of tumor supportive microenvironment. In this study, the expression of ECM-related genes was explored for prognostic and immunological implication in clear cell renal clear cell carcinoma (ccRCC). Out of 964 ECM genes, higher expression (z-score > 2) of 35 genes showed signifcant association with overall survival (OS), progression-free survival (PFS) and disease-specifc survival (DSS). On comparison to normal tissue, 12 genes (NUDT1, SIGLEC1, LRP1, LOXL2, SERPINE1, PLOD3, ZP3, RARRES2, TGM2, COL3A1, ANXA4, and POSTN) showed elevated expression in kidney tumor (n = 523) compared to normal (n = 100). Further, Cox proportional hazard model was utilized to develop 12 genes ECM signature that showed signifcant association with overall survival in TCGA dataset (HR = 2.45; 95% CI [1.78–3.38]; p < 0.01). This gene signature was further validated in 3 independent datasets from GEO database. Kaplan–Meier log-rank test signifcantly associated patients with elevated expression of this gene signature with a higher risk of mortality. Further, diferential gene expression analysis using DESeq2 and principal component analysis (PCA) identifed genes with the highest fold change forming distinct clusters between ECM-rich high-risk and ECM-poor low-risk patients. Geneset enrichment analysis (GSEA) identifed signifcant perturbations in homeostatic kidney functions in the high-risk group.
    [Show full text]
  • Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands That Promote Axonal Growth
    Research Article: New Research Development Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands that Promote Axonal Growth Jeremy S. Toma,1 Konstantina Karamboulas,1,ª Matthew J. Carr,1,2,ª Adelaida Kolaj,1,3 Scott A. Yuzwa,1 Neemat Mahmud,1,3 Mekayla A. Storer,1 David R. Kaplan,1,2,4 and Freda D. Miller1,2,3,4 https://doi.org/10.1523/ENEURO.0066-20.2020 1Program in Neurosciences and Mental Health, Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada, 2Institute of Medical Sciences University of Toronto, Toronto, Ontario M5G 1A8, Canada, 3Department of Physiology, University of Toronto, Toronto, Ontario M5G 1A8, Canada, and 4Department of Molecular Genetics, University of Toronto, Toronto, Ontario M5G 1A8, Canada Abstract Peripheral nerves provide a supportive growth environment for developing and regenerating axons and are es- sential for maintenance and repair of many non-neural tissues. This capacity has largely been ascribed to paracrine factors secreted by nerve-resident Schwann cells. Here, we used single-cell transcriptional profiling to identify ligands made by different injured rodent nerve cell types and have combined this with cell-surface mass spectrometry to computationally model potential paracrine interactions with peripheral neurons. These analyses show that peripheral nerves make many ligands predicted to act on peripheral and CNS neurons, in- cluding known and previously uncharacterized ligands. While Schwann cells are an important ligand source within injured nerves, more than half of the predicted ligands are made by nerve-resident mesenchymal cells, including the endoneurial cells most closely associated with peripheral axons. At least three of these mesen- chymal ligands, ANGPT1, CCL11, and VEGFC, promote growth when locally applied on sympathetic axons.
    [Show full text]
  • Network Analysis of Micrornas, Transcription Factors, Target Genes and Host Genes in Human Anaplastic Astrocytoma
    EXPERIMENTAL AND THERAPEUTIC MEDICINE 12: 437-444, 2016 Network analysis of microRNAs, transcription factors, target genes and host genes in human anaplastic astrocytoma LUCHEN XUE1,2, ZHIWEN XU2,3, KUNHAO WANG2,3, NING WANG2,3, XIAOXU ZHANG1,2 and SHANG WANG2,3 1Department of Software Engineering; 2Key Laboratory of Symbol Computation and Knowledge Engineering of the Ministry of Education; 3Department of Computer Science and Technology, Jilin University, Changchun, Jilin 130012, P.R. China Received December 2, 2014; Accepted January 29, 2016 DOI: 10.3892/etm.2016.3272 Abstract. Numerous studies have investigated the roles TP53. PTEN and miR-21 have been observed to form feedback played by various genes and microRNAs (miRNAs) in loops. Furthermore, by comparing and analyzing the pathway neoplasms, including anaplastic astrocytoma (AA). However, predecessors and successors of abnormally expressed genes the specific regulatory mechanisms involving these genes and miRNAs in three networks, similarities and differences and miRNAs remain unclear. In the present study, associated of regulatory pathways may be identified and proposed. In biological factors (miRNAs, transcription factors, target genes summary, the present study aids in elucidating the occurrence, and host genes) from existing studies of human AA were mechanism, prevention and treatment of AA. These results combined methodically through the interactions between may aid further investigation into therapeutic approaches for genes and miRNAs, as opposed to studying one or several. this disease. Three regulatory networks, including abnormally expressed, related and global networks were constructed with the aim Introduction of identifying significant gene and miRNA pathways. Each network is composed of three associations between miRNAs Astrocytoma is a tumor of the astrocytic glial cells and the targeted at genes, transcription factors (TFs) regulating most common type of central nervous system (CNS) neoplasm, miRNAs and miRNAs located on their host genes.
    [Show full text]
  • Inbred Mouse Strains Expression in Primary Immunocytes Across
    Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021 Daphne is online at: average * The Journal of Immunology published online 29 September 2014 from submission to initial decision 4 weeks from acceptance to publication Sara Mostafavi, Adriana Ortiz-Lopez, Molly A. Bogue, Kimie Hattori, Cristina Pop, Daphne Koller, Diane Mathis, Christophe Benoist, The Immunological Genome Consortium, David A. Blair, Michael L. Dustin, Susan A. Shinton, Richard R. Hardy, Tal Shay, Aviv Regev, Nadia Cohen, Patrick Brennan, Michael Brenner, Francis Kim, Tata Nageswara Rao, Amy Wagers, Tracy Heng, Jeffrey Ericson, Katherine Rothamel, Adriana Ortiz-Lopez, Diane Mathis, Christophe Benoist, Taras Kreslavsky, Anne Fletcher, Kutlu Elpek, Angelique Bellemare-Pelletier, Deepali Malhotra, Shannon Turley, Jennifer Miller, Brian Brown, Miriam Merad, Emmanuel L. Gautier, Claudia Jakubzick, Gwendalyn J. Randolph, Paul Monach, Adam J. Best, Jamie Knell, Ananda Goldrath, Vladimir Jojic, J Immunol http://www.jimmunol.org/content/early/2014/09/28/jimmun ol.1401280 Koller, David Laidlaw, Jim Collins, Roi Gazit, Derrick J. Rossi, Nidhi Malhotra, Katelyn Sylvia, Joonsoo Kang, Natalie A. Bezman, Joseph C. Sun, Gundula Min-Oo, Charlie C. Kim and Lewis L. Lanier Variation and Genetic Control of Gene Expression in Primary Immunocytes across Inbred Mouse Strains Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2014/09/28/jimmunol.140128 0.DCSupplemental Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2014 by The American Association of Immunologists, Inc.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 Gene Symbol Plod3 Organism Mouse Gene Summary Description Not Available Gene Aliases AI414586, LH3 RefSeq Accession No. NC_000071.6, NT_039314.8 UniGene ID Mm.251003 Ensembl Gene ID ENSMUSG00000004846 Entrez Gene ID 26433 Assay Information Unique Assay ID qMmuCID0023401 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000004968 Amplicon Context Sequence CTTCGGCCACACCATGACTCGTCCACCTTCACTCTCAATGTCGCCCTCAACCACA AGGGTGTAGATTATGAGGGAGGCGGCTGCCGCTTCCTGCGTTACGACTGCAGA ATCTCCTCTCCGAG Amplicon Length (bp) 92 Chromosome Location 5:136994987-136996155 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9995 cDNA Cq 19.66 cDNA Tm (Celsius) 84.5 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Plod3, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • Targeting Multiple Genes Containing Long Mononucleotide A-T Repeats In
    Bhummaphan et al. J Transl Med (2021) 19:231 https://doi.org/10.1186/s12967-021-02902-6 Journal of Translational Medicine RESEARCH Open Access Targeting multiple genes containing long mononucleotide A-T repeats in lung cancer stem cells Narumol Bhummaphan1,2, Piyapat Pin‑on1,6,7, Preeyaporn Plaimee Phiboonchaiyanan2, Jirattha Siriluksana1, Chatchawit Aporntewan3,4, Pithi Chanvorachote2,5* and Apiwat Mutirangura1* Abstract Background: Intratumour heterogeneous gene expression among cancer and cancer stem cells (CSCs) can cause failure of current targeted therapies because each drug aims to target the function of a single gene. Long mononu‑ cleotide A‑T repeats are cis‑regulatory transcriptional elements that control many genes, increasing the expression of numerous genes in various cancers, including lung cancer. Therefore, targeting A‑T repeats may dysregulate many genes driving cancer development. Here, we tested a peptide nucleic acid (PNA) oligo containing a long A‑repeat sequence [A(15)] to disrupt the transcriptional control of the A‑T repeat in lung cancer and CSCs. Methods: First, we separated CSCs from parental lung cancer cell lines. Then, we evaluated the role of A‑T repeat gene regulation by counting the number of repeats in diferentially regulated genes between CSCs and the parental cells of the CSCs. After testing the dosage and efect of PNA‑A15 on normal and cancer cell toxicity and CSC pheno‑ types, we analysed genome‑wide expression to identify dysregulated genes in CSCs. Results: The number of A‑T repeats in genes diferentially regulated between CSCs and parental cells difered. PNA‑ A15 was toxic to lung cancer cells and CSCs but not to noncancer cells.
    [Show full text]
  • Universidad Autónoma De Madrid
    Universidad Autónoma de Madrid Departamento de Bioquímica Identification of the substrates of the protease MT1-MMP in TNFα- stimulated endothelial cells by quantitative proteomics. Analysis of their potential use as biomarkers in inflammatory bowel disease. Agnieszka A. Koziol Tesis doctoral Madrid, 2013 2 Departamento de Bioquímica Facultad de Medicina Universidad Autónoma de Madrid Identification of the substrates of the protease MT1-MMP in TNFα- stimulated endothelial cells by quantitative proteomics. Analysis of their potential use as biomarkers in inflammatory bowel disease. Memoria presentada por Agnieszka A. Koziol licenciada en Ciencias Biológicas para optar al grado de Doctor. Directora: Dra Alicia García Arroyo Centro Nacional de Investigaciones Cardiovasculares (CNIC) Madrid, 2013 3 4 ACKNOWLEDGEMENTS - ACKNOWLEDGEMENTS - First and foremost I would like to express my sincere gratitude to my supervisor Dr. Alicia García Arroyo for giving me the great opportunity to study under her direction. Her encouragement, guidance and support from the beginning to the end, enabled me to develop and understand the subject. Her feedback to this manuscript, critical reading and corrections was inappreciable to finish this dissertation. Next, I would like to express my gratitude to those who helped me substantially along the way. To all members of MMPs’ lab, for their interest in the project, teaching me during al these years and valuable contribution at the seminary discussion. Without your help it would have not been possible to do some of those experiments. Thank you all for creating a nice atmosphere at work and for being so good friends in private. I would like to also thank all of the collaborators and technical units for their support and professionalism.
    [Show full text]