Had1 Is Required for Cell Wall Integrity and Fungal Virulence in Cryptococcus Neoformans

Home , Calcineurin, Hydrolase

G3: Genes|Genomes|Genetics Early Online, published on December 12, 2017 as doi:10.1534/g3.117.300444

1 Had1 is Required for Cell Wall Integrity and Fungal Virulence in

2 Cryptococcus neoformans

4 Won-Hee Jung1, Ye-Eun Son1, Sang-Hun Oh2, Ci Fu3, Hye Shin Kim2, Jin-Hwan Kwak2,

5 Maria E. Cardenas3, Joseph Heitman3, and Hee-Soo Park1*

8 1 School of Food Science and Biotechnology, Institute of Agricultural Science and

9 Technology, Kyungpook National University, Daegu, Republic of Korea; 2 School of Life

10 Science, Handong Global University, Pohang, Republic of Korea; 3 Department of

11 Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North

12 Carolina, USA

16 * Corresponding Author:

17 Hee-Soo Park

18 School of Food Science and Biotechnology

19 80 Daehak-ro, Buk-gu, Daegu, 41566, South Korea

20 Tel: +82-53-950-5751

21 Fax: +82-53-950-6750

22 Email: [email protected]

24 Running title: The role of Had1 in C. neoformans. 1

26 Calcineurin modulates environmental stress survival and virulence of the human fungal

27 pathogen Cryptococcus neoformans. Previously, we identified 44 putative calcineurin

28 substrates and proposed that the calcineurin pathway is branched to regulate targets

29 including Crz1, Pbp1, and Puf4 in C. neoformans. In this study we characterized Had1,

30 which is one of the putative calcineurin substrates and belongs to a ubiquitously

31 conserved haloacid dehalogenase β-phosphoglucomutase protein super-family. Growth

32 of the had1∆ mutant was found to be compromised at 38C or higher. In addition, the

33 had1∆ mutant exhibited increased sensitivity to cell wall perturbing agents including

34 Congo Red, and Calcofluor White, and to an ER stress inducer DTT. Virulence studies

35 revealed that the had1 mutation results in attenuated virulence compared to the wild

36 type strain in a murine inhalation infection model. Genetic epistasis analysis revealed

37 that Had1 and the zinc finger transcription factor Crz1 play roles in parallel pathways

38 that orchestrate stress survival and fungal virulence. Overall, our results demonstrate

39 that Had1 is a key regulator of thermotolerance, cell wall integrity, and virulence of C.

40 neoformans.

49 INTRODUCTION

50 Calcineurin is a highly conserved serine/threonine protein phosphatase, which is

51 activated by Ca2+/calmodulin in eukaryotic organisms, and plays diverse roles in

52 controlling gene expression and cellular processes (STEWART et al. 1982; RUSNAK AND

2+ 53 MERTZ 2000; ARAMBURU et al. 2004). Increased intracellular Ca levels in response to

54 internal or external cues bind to calmodulin, and in turn, the Ca2+-calmodulin complex

55 interacts with the calcineurin catalytic subunit and activates the phosphatase (CRABTREE

56 2001). Activated calcineurin dephosphorylates target proteins that then orchestrate the

57 response and adaptation to stress (KISSINGER et al. 1995; ARAMBURU et al. 2000). A key

58 substrate of calcineurin is NFAT (nuclear factor of activated T cell), a transcription factor

59 that regulates the expression of genes which are associated with T cell activation, and

60 the development of the nervous and cardiac systems (NORTHROP et al. 1994; FESKE et

61 al. 2003; HOGAN et al. 2003; ARAMBURU et al. 2004). The calcineurin signaling pathway

62 is inhibited by the immunosuppressive and antifungal compounds FK506 and

63 cyclosporin A (CsA), which bind to FK506-binding protein 12 (FKBP12) and cyclophilin A,

64 respectively, forming stable complexes. The FK506-FKBP12 and cyclosporine A-

65 cyclophilin A complexes interact with calcineurin and thereby inhibit the phosphatase

66 activity (O'KEEFE et al. 1992; SCHREIBER AND CRABTREE 1992; SIEKIERKA AND SIGAL 1992;

67 SIGAL AND DUMONT 1992; KISSINGER et al. 1995).

68 While calcineurin is highly conserved in eukaryotes, the functions and biological

69 roles regulated by calcineurin are distinct in mammals and fungi (STEINBACH et al.

70 2007b). In the model yeast Saccharomyces cerevisiae, calcineurin is essential for stress

71 responses, bud emergence, and cell cycle regulation (MIYAKAWA AND MIZUNUMA 2007). In

72 yeast, Crz1 (calcineurin responsive zinc finger 1) is a prominent calcineurin substrate

73 that transcriptionally regulates mRNA expression of target genes associated with cell-

74 wall synthesis, ion transport, and vesicle transport (YOSHIMOTO et al. 2002; CYERT 2003).

75 In the major pathogenic fungi, including Candida albicans and Aspergillus fumigatus,

76 the calcineurin signaling pathway plays crucial roles in virulence and stress responses

77 (BADER et al. 2003; BLANKENSHIP et al. 2003; STEINBACH et al. 2006; STEINBACH et al.

78 2007a; STEINBACH et al. 2007b; LEE et al. 2013). Loss of calcineurin causes increased

79 cell sensitivity to stresses including high temperature, salt, cell wall stress, and also

80 results in attenuated or loss of virulence in human pathogenic fungi. Therefore,

81 calcineurin is considered a target for anti-fungal drug discovery and in fact, the

82 immunosuppressants FK506 and cyclosporine A show anti-fungal activity (BRIZUELA et

83 al. 1991; ODOM et al. 1997a). A series of studies also demonstrated that the Crz1

84 orthologs are prominent calcineurin downstream targets in pathogenic fungi (ONYEWU et

85 al. 2004; CRAMER et al. 2008; SCHUMACHER et al. 2008; SORIANI et al. 2008; MIYAZAKI et

86 al. 2010).

87 Cryptococcus neoformans is a ubiquitous fungus that is widespread in the

88 environment including associations with trees, soil, and bird guano (MONARI et al. 1999;

89 IDNURM et al. 2005; CHANG et al. 2014). This fungus is a basidiomycetous fungus and

90 both its spores and desiccated yeast cells serve as infectious propagules (HUNG AND

91 SCHREIBER 1992; KWON-CHUNG et al. 2014). C. neoformans is an opportunistic

92 pathogenic fungus that causes meningoencephalitis in patients who have weakened

93 immune systems, including HIV/AIDS and organ transplant patients, leading to high

94 mortality (KIDD et al. 2004; PARK et al. 2009). In this human pathogenic fungus,

95 calcineurin is a key virulence factor that is required for adaptation to stressful host

96 environments including elevated temperature (ODOM et al. 1997b; FOX et al. 2001). In

97 addition, calcineurin is essential for stress adaptation, sexual reproduction, and

98 virulence of C. neoformans (FOX et al. 2001; DANIELSEN et al. 2013). During thermal and

99 other stress conditions, calcineurin co-localizes with components of P-bodies/stress

100 granules (KOZUBOWSKI et al. 2011a; KOZUBOWSKI et al. 2011b) (PBs/SGs) which consist

101 of aggregates of RNA binding proteins, mRNA decay machinery, and translation

102 initiation factors (BUCHAN AND PARKER 2009; MITCHELL et al. 2013; BUCHAN 2014).

103 Recently, our phosphoproteomic analysis identified forty-four putative calcineurin

104 targets in C. neoformans (PARK et al. 2016). We demonstrated that the Crz1 ortholog is

105 a bona fide calcineurin target in C. neoformans. Under thermal stress conditions,

106 calcineurin controls the transcriptional activity and nuclear translocation of Crz1 through

107 dephosphorylation (PARK et al. 2016). In addition, we proposed that several RNA

108 binding proteins including Pbp1 (PAB1-binding protein 1), Puf4 (PUmilio-homology

109 domain Family 4), and Lhp1 are potential calcineurin targets. Pbp1 is involved in fungal

110 virulence and sexual reproduction (PARK et al. 2016). Both Puf4 and Lhp1 are required

111 for heat stress survival (PARK et al. 2016). Employing epistasis analyses, we

112 demonstrated that two downstream branches of the calcineurin pathway govern cell

113 viability at high temperature, sexual reproduction, and fungal virulence (PARK et al.

114 2016).

115 Although we characterized several calcineurin targets, including Crz1 and RNA

116 binding proteins, in our previous study (PARK et al. 2016), many putative targets await

117 characterization. To further characterize the remaining calcineurin targets revealed by

118 the above study, we examined stress responses of 13 putative calcineurin-target

119 mutants from a systematic deletion mutant library of C. neoformans (LIU et al. 2008).

120 Among them, the CNAG_01744∆ mutant showed increased sensitivity to cell wall stress

121 in comparison to the WT. Based on BLAST analysis, CNAG_01744 shares considerable

122 homology with the S. cerevisiae Had1 protein. Had1 contains a HAD domain (Haloacid

123 dehalogenase proteins) and is a member of the beta-phosphoglucomutase family of

124 proteins that is highly conserved in most organisms (BURROUGHS et al. 2006;

125 KUZNETSOVA et al. 2015). In yeast, several beta-phosphoglucomutase family proteins,

126 including two 2-deoxyglucose-6-phosphatase (Dog1 and Dog2) and two glycerol-1-

127 phosphate phospohydrolases (Rhr2/Gpp1 and Hor2/Gpp2), are well characterized and

128 are required for cellular responses to environmental stresses such as osmotic and

129 oxidative stresses (RANDEZ-GIL et al. 1995a; RANDEZ-GIL et al. 1995b; NORBECK et al.

130 1996; KUZNETSOVA et al. 2015). Given the relevance of haloacid dehalogenase in stress

131 responses, we were prompted to characterize the role of Had1 in the calcineurin

132 pathway functions in C. neoformans. Our results demonstrate that loss of Had1 causes

133 increased sensitivity to thermal or cell wall stresses and attenuated virulence. To dissect

134 the link between Had1 and Crz1 in calcineurin-related functions, we tested the impact of

135 the had1∆ crz1∆ double mutation. The results show that Crz1 and Had1 play additive

136 roles in thermoresistance and virulence. However, whether Had1 is a direct calcineurin

137 substrate remains to be established.

138

139 MATERIAL AND METHODS

140 Strains, media and culture conditions. Fungal strains used in this study are listed in

141 Table 1. Liquid and solid yeast extract-peptone-dextrose (YPD, Difco, Sparks, MD, USA)

142 media were used for general cultures of C. neoformans. To assay thermo-tolerance,

143 fungal cells grown overnight at 30 C were ten-fold diluted, spotted on YPD plates, and

144 then cultured at distinct temperatures (30, 37, 38, and 39C). To examine other stresses

145 susceptibility, 2.5 to 5 μL of cultured cells grown in liquid YPD medium overnight were

146 ten-fold serially diluted and spotted on YPD medium containing the indicated

147 concentration of the following compounds; Congo red (CR, Sigma, St. Louis, MO, USA)

148 and sodium dodecyl sulfate (SDS, Fisher, Fair Lawn, NJ, USA) for membrane

149 destabilizing stress, dithiothreitol (DTT, Sigma) for reducing stress, calcofluor white

150 (Sigma) for chitin synthesis inhibition that results in cell wall stress, NaCl (Fisher) and

151 KCl (Fisher) for salt stresses. Fungal cells were incubated at 30C and photographed

152 post-treatment from day 2 to day 3.

153

154 Generation of mutant strains. The oligonucleotides used in this study are listed in

155 Table 2. To generate deletion mutant, gene deletion cassettes were generated using a

156 double-joint PCR (DJ-PCR) as described (YU et al. 2004). The 5’ and 3’-flanking region

157 of the HAD1 gene were amplified using primer pairs JOHE42780;JOHE42782 and

158 JOHE42781;JOHE42783, respectively, from the C. neoformans serotype A H99

159 (PERFECT et al. 1993; JANBON et al. 2014) genomic DNA as a template. The selectable

160 markers, NAT or NEO (FRASER et al. 2003), were amplified with the primer pair

161 JOHE40706;JOHE40707 by using pAI3 and pJAF1, respectively. The final deletion

162 cassettes were generated by means of DJ-PCR performed using primer pair

163 JOHE42784;JOHE42785 and the 5’ and 3’-franking regions and markers as templates. 7

164 The amplified gene deletion cassettes were purified, combined with 0.6 μm gold

165 microcarrier beads (Bio-Rad) using the QIAquick Gel Extraction kit (Qiagen), and then

166 introduced into the wild type (H99 or KN99a) mutant strains using the biolistic

167 transformation methods (DAVIDSON et al. 2002).

168 To generate the double deletion mutants, 5’ and 3’-flanking regions for CRZ1

169 (JOHE41391;JOHE41393 and JOHE41392;JOHE41394) were amplified. The NAT

170 marker was used for the disruption cassettes. After the fusion by DJ-PCR, crz1

171 disruption constructs were amplified using JOHE41395;JOHE41396, and introduced

172 into HPC24 (had1∆ mutant). Multiple stable transformants were isolated from

173 independent experiments, and were selected on YPD medium containing nourseothricin

174 sulfate or G418, and then confirmed by diagnostic PCR for the 5’ and 3’ junctions

175 followed by restriction enzyme digestion.

176 To express the Had1-FLAG fusion protein, the HAD1 gene region including its

177 predicted promoter but lacking its termination codon was amplified using the primers

178 JOHE42786 and JOHE42787. The PCR product was then digested with NotI and

179 cloned into pHP2 (PARK et al. 2016), which contains a 4x FLAG tag, the HOG1

180 terminator, and the hygromycin B-resistant gene. The resulting plasmid pHSP1 was

181 then introduced into the recipient had1∆ strains. Multiple transformants were selected

182 on YPD medium containing hygromycin B (Sigma), and then confirmed by PCR and

183 Western blot analyses.

184

185 Had1 mobility assay. Had1 mobility assay was conducted as described previously

186 (PARK et al. 2016). The strains expressing Had1-FLAG was grown in YPD at 25°C to an

187 optical density OD600 0.6–0.8 and the cultures were grown at 25°C or shifted from 25°C

188 to 37°C for 1 hour with or without FK506 (2 μg/ml). Cells were collected and disrupted in

189 lysis buffer (50 mM Tris-HCl pH = 7.5, 150 NaCl, 0.5mM EDTA, 0.5% Triton X-100

190 supplemented with protease inhibitor tablet (Roche) and phosphatase inhibitor cocktails

191 (Thermo) using a bead beater for 10 cycles (60 sec homogenization with 60 sec rest).

192 Cell lysates were centrifuged for 15 min at 14.000×g, the supernatant was recovered

193 and protein concentration was determined by employing the Bio-Rad Bradford reagent.

194 The supernatant was subjected to SDS-PAGE and transferred to PVDF membranes

195 (Bio-Rad). For western blot analysis, we employed mouse monoclonal anti-FLAG M2

196 antibodies (Sigma), anti-mouse antibody conjugated to horseradish peroxidase

197 (Thermo), and ECL western blotting detection reagent (GE healthcare).

198

199 Virulence assay. Cryptococcus strains were cultured overnight in liquid YPD medium at

200 30C. The resulting fungal cells were collected, washed with sterile PBS, counted with a

201 hemocytometer, and the final density was adjusted to 1107 CFU/mL. Six- to seven-

202 week-old female BALB/c mice were purchased from the Daehan BioLink Co., Ltd.,

203 Korea and used for infection and fungal burden assays. Intranasal infection was

204 performed as previously described (COX et al. 2000). Fourteen mice were anesthetized,

205 and infected intranasally with 5  105 CFU in a volume of 50 μL as previously described

206 (COX et al. 2000).

207 For survival tests, groups of ten mice were used. Survival was monitored daily,

208 and moribund mice were sacrificed with CO2. Survival curve were generated using the

209 Kaplan-Meier method by the Prism 4.0 (GraphPad software) and statistical significance 9

210 (p values) assessed with the log-rank test.

211 For fungal burden assays, infected mice (three to four) were sacrificed by

212 exposure to CO2. Lung and brain tissues were isolated, placed in saline, and then

213 homogenized. The suspension was serially diluted with saline, plated onto YPD agar

214 supplemented with antibiotics (kanamycin, ampicillin, and spectromycin), and incubated

215 at 30C for 3 days. Colony counts were performed and adjusted to reflect the total lung

216 or brain colony-forming unit. To assess statistically significant differences between the

217 samples, statistical analysis was performed using the Student’s t-test.

218

219 Ethics statement. Animal care and all experiments were conducted in accordance with

220 the ethical guidelines of the Ethics Review Committee for Animal Experimentation

221 (ERCAE) of Handong Global University (HGU). The HGU ERCAE approved the entire

222 vertebrate animal protocol (protocol #HGU-20160616-009).

223

224 Data availability. All the strains and plasmids used in this study are available upon

225 request. The authors state that all data necessary for confirming the conclusions

226 presented in the article are represented fully within the article.

227

228 RESULTS

229 CNAG_01744 encodes a haloacid dehalogenase-like hydrolase protein (Had1)

230 Previously, we performed phosphoproteomic analyses and identified 44 putative

231 calcineurin targets. Among these targets, we generated deletion mutants for eight, and

232 characterized these as authentic calcineurin targets (PARK et al. 2016). In the present 10

233 study, for 13 additional putative calcineurin targets identified by the above

234 phosphoproteomic analysis mutants were available in a systematic deletion mutant

235 library of C. neoformans (LIU et al. 2008), (Figure 1A-B) and these were selected and

236 analyzed for calcineurin-related phenotypes. Because calcineurin is essential for

237 responses to stress, these mutants were subjected to phenotypic analyses under

238 several of stress conditions. The CNAG_01744∆ and CNAG_03841∆ mutants exhibited

239 increased sensitivity to cell wall stress (SDS and Congo red) as compared to the WT

240 (Figure 1C). CNAG_03841 encodes a hypothetical protein and CNAG_01744 encodes

241 a haloacid dehalogenase-like hydrolase protein. In this study, we focused on

242 characterizing the functions of CNAG_01744.

243 The protein sequence of the CNAG_01744 ORF was blasted against the S.

244 cerevisiae S288 genome database and found that this ORF bears identity to six

245 haloacid dehalogenase β-phosphoglucomutase family proteins (Figure S1A).

246 Furthermore, in the C. neoformans genome blast searches revealed a total of four

247 ORFs that feature HAD (Haloacid dehalogenase proteins) domains including,

248 CNAG_01744, CNAG_06122, CNAG_06132, and CNAG_06698 (Figure S1B).

249 CNAG_01744 showed the highest homology (Score 110, identity 32%) to the S.

250 cerevisiae Gpp2. However, we found that CNAG_06122 shows much higher homology

251 (Score 119, identity 33%) to S. cerevisiae Gpp2 (a glycerol-1-phosphatase, which is

252 induced in response to osmotic and oxidative stress) than CNAG_01744. Therefore,

253 CNAG_01744 was named Had1 instead of Gpp2.

254

255 Had1 is essential for appropriate stress response and may function

256 independently of calcineurin

257 To test the functions of Had1, we generated the had1 deletion (had1∆) mutant

258 and complemented strains, and examined their phenotypes under a variety of

259 temperature conditions. As mentioned above, we confirmed that the had1∆ mutant

260 exhibited increased sensitivity to high temperatures when compared to the WT strain

261 (Figure 2A). To further examine the role of Had1, we tested the growth phenotypes of

262 had1 mutants on solid media containing various cell stressors agents including Congo

263 red (CR), calcofluor white (CFW), SDS, DTT, and KCl. As shown Figure 2B, the had1∆

264 mutant showed increased sensitivity to cell wall perturbing agents, in particular to SDS,

265 as compared to the WT strain, suggesting that Had1 may be involved in controlling

266 stress response.

267 Because Had1 is a potential calcineurin target identified from the

268 phosphoproteomics results (PARK et al. 2016), we examined the migration of Had1

269 under both heat or high salt osmotic stress conditions. Cultures of yeast cells

270 expressing FLAG tagged Had1 were cultured at 25C and shifted or not to either 37C

271 for 1 hr, or to media containing 1 M NaCl and incubated at 25C for 1hr. For both stress

272 conditions cultures were treated or not with FK506 for 1 hr. Interestingly, The Had1-

273 FLAG protein displayed reduced gel migration when isolated from cells shifted from

274 25C to 37C or from cells exposed to high salt osmotic stress, as compared to that

275 isolated from cultures grown at 25C (Figure S2A). However, FK506 did not affect the

276 gel migration of Had1 under either stress condition (Figure S2). These results suggest

277 that the stress-induced posttranslational modification resulting in altered Had1 gel

278 mobility is independent of calcineurin, but do not rule out the possibility that Had1 is a 12

279 substrate of calcineurin that cannot be detected by gel mobility shift assay.

280

281 Had1 and Crz1 play an additive role in stress response and virulence

282 Previously, our study demonstrated that calcineurin regulates high temperature

283 growth and virulence via transcriptional and post-transcriptional processes (ODOM et al.

284 1997b; CRUZ et al. 2001). Among the characterized calcineurin targets, Crz1 is the only

285 known target involved in cell wall integrity. To examine whether Crz1 and Had1 function

286 in a single pathway or in parallel pathways within the signaling cascades governing cell

287 wall integrity, we generated had1 crz1 double deletion mutants and examined their

288 phenotypes during stress responses. As shown Figure 3, the had1∆ crz1∆ double

289 mutant strains exhibited increased sensitivity to various stresses compared to either the

290 crz∆1 or had1∆ single deletion mutant. These results demonstrate that Had1 and Crz1

291 play an additive role in thermotolerance and cell wall stresses, and suggest they

292 operate in parallel pathways.

293

294 Had1 is involved in fungal pathogenicity

295 Because of hyper-susceptibility to heat and other stress conditions, we

296 hypothesized that Had1 would be required for pathogenicity of C. neoformans. To

297 examine virulence of these mutants, we conducted virulence animal studies using a

298 murine inhalation model. As shown in Figure 4A, the had1∆ mutant exhibited

299 attenuated virulence compared to the WT strains. Virulence was restored to nearly WT

300 levels when the had1∆ mutant was complemented by reintroduction of the wild-type

301 HAD1 gene in the had1∆ + HAD1 strain. The had1∆ crz1∆ double mutant strains were

302 more attenuated in virulence as compared with either the had1∆ or the crz1∆ single

303 mutant (Figure 4A). These results demonstrate that Had1 significantly contributes to C.

304 neoformans virulence.

305 To further examine the virulence defect conferred by the had1∆ mutation, fungal

306 burden in the lungs and brain of mice infected with WT and had1∆ mutant strains was

307 analyzed at day 14 post infection (Figure 4B). The cna1∆ mutant exhibited an

308 undetectable fungal burden in both the lung and brain tissues. By comparison, the

309 had1∆ and crz1∆ single mutant strains showed reduced fungal burden in the lung

310 compared with the WT strain. Moreover, the had1∆ crz1∆ double mutant strains

311 exhibited significantly reduced fungal burden in the lung compared with either single

312 deletion mutant strain. While we recovered WT and mutant strains from the lung, we did

313 not recover any yeast cells from brain tissue 14 days after infection for both WT and

314 mutant strains (data not shown). Collectively, these findings demonstrate that Had1 is

315 required for full virulence and that Had1 and Crz1 function in parallel pathways

316 controlling virulence.

317

318 DISCUSSION

319 Given that calcineurin is a key pathway regulating stress responses, mating, and

320 fungal virulence, identification and characterization of calcineurin targets is crucial for

321 understanding the calcineurin signaling network (ARAMBURU et al. 2004; STEINBACH et al.

322 2006; GOLDMAN et al. 2014). In a previous study, we identified Had1 as a potential

323 target of calcineurin in C. neoformans (PARK et al. 2016). In the present study, although

324 we were unable to confirm that Had1 is a calcineurin target, had1 mutation resulted in

325 hypersensitivity to thermal and other stresses and attenuated virulence, suggesting that

326 Had1 is important for stress responses and virulence. Moreover, double deletion mutant

327 analysis suggests that Had1 and Crz1 function in parallel pathways controlling fungal

328 pathogenicity and cell wall stress responses (Figure 5). However, we could not

329 determine if Had1 functions dependently or independently of calcineurin. The

330 preliminary results of our Had1 gel mobility analysis showed that while both thermal and

331 osmolarity stresses seem to affect Had1 mobility, in both cases, this is not altered by

332 FK506, and thus it seems to be independent of calcineurin (Figure S2). Our previous

333 phosphoproteomic screen revealed only one calcineurin-dependent phosphorylation site

334 in Had1 (PARK et al. 2016). Therefore, it is likely that this single site could not be

335 detected by our mobility shift assay (Figure S2), which is more suitable to detect

336 multiple phosphorylation sites on a protein. Thus, the present study does not rule out

337 the possibility that Had1 function is controlled by calcineurin and testing this model will

338 require more sensitive assays and further analysis.

339 Haloacid dehalogenase (HAD)-like hydrolases are large superfamilies of

340 enzymes that exhibit phosphatase, ATPase, phosphonatase and phosphomutase

341 activity, and are conserved in both prokaryotic and eukaryotic organisms (BURROUGHS

342 et al. 2006; KUZNETSOVA et al. 2015). Forty-five genes encoding HAD-like hydrolases

343 are found in the yeast genome and 15 of their protein products have been biochemically

344 characterized for this enzymatic activity (RANDEZ-GIL et al. 1995a; RANDEZ-GIL et al.

345 1995b; NORBECK et al. 1996; KUZNETSOVA et al. 2015). Among these, the beta-

346 phosphoglucomutase family proteins, such as Dog1, Dog2, Gpp1 and Gpp2, are well

347 characterized in yeast. These proteins are required for cellular responses to

348 environmental stresses. The expression of Gpp1, Gpp2, and Dog2 is induced by

349 environmental stresses, including osmotic or oxidative stresses, and by glucose

350 starvation (TSUJIMOTO et al. 2000; PAHLMAN et al. 2001). Interestingly, the expression of

351 these genes is controlled by either the HOG (High Osmolality Glycerol) or the Snf1

352 kinase pathways (TSUJIMOTO et al. 2000; PAHLMAN et al. 2001). In addition, loss of both

353 the GPP1 and GPP2 genes results in hyper sensitivity to oxidative stress (PAHLMAN et al.

354 2001). However, gpp1Δ, gpp2Δ, and dog2Δ single mutants did not show an increased

355 susceptibility to osmotic or oxidative stresses. Our study establishes that Had1 is

356 required for proper responses to heat and osmotic stresses, and this finding is in accord

357 with previous studies suggesting this function. Previous microarray analyses shown that

358 the expression of HAD1 (formerly GPP1) was induced in response to osmotic stress

359 and this microarray data was confirmed by our qRT-PCR analysis (Figure S3A). Ko et

360 al. also demonstrated that induction of HAD1 in response to osmotic stress was

361 decreased in hog1 and ssk1 mutants (KO et al. 2009), suggesting that the expression of

362 HAD1 is controlled by the stress-activated Hog1 signaling pathway in C. neoformans

363 (KO et al. 2009). These results suggest that the regulatory mechanism of HAD1 mRNA

364 expression in response to osmotic stress is conserved in S. cerevisiae and C.

365 neoformans. We demonstrate here that upon thermal stress, the expression of HAD1

366 slightly increases (Figure S3B). To examine whether the HAD1 expression is regulated

367 by the calcineurin-Crz1 pathway, we searched our published transcriptome analysis

368 (CHOW et al. 2017) and found that the HAD1 expression is independently regulated of

369 calcineurin or Crz1 under thermal stress.

370 Previously our phosphoproteomic screen revealed that Had1 is a potential

371 calcineurin substrate in C. neoformans. The single calcineurin-dependent

372 phosphorylated peptide (RRAS376QSGQAGVTLDAFRR) in Had1 was increased more

373 than two-fold in abundance in the calcineurin cna1Δ mutant compared to wild-type cells

374 (PARK et al. 2016). In addition, the Had1 protein contains two predicted calcineurin

375 substrate docking sites PxIxIT motifs (P[^PG][IVLF][^PG]) (PARK et al. 2016). However,

376 as we discussed earlier in this section, whether Had1 is a bona fide calcineurin target

377 remains to be characterized. Previous studies identified 13 phosphorylation sites

378 located in the Had1 C-terminal region and some of these residues were proposed to be

379 phosphorylated by the PKA signaling cascade in C. neoformans (SELVAN et al. 2014;

380 GEDDES et al. 2016). These results indicate that phosphorylation of Had1 is important

381 for Had1 activation and the detailed mechanisms await further characterization to better

382 understand Had1 roles in stress responses and environmental adaptation. Based on the

383 transcriptomic (KO et al. 2009; CHOW et al. 2017) and phosphoproteomic (SELVAN et al.

384 2014; GEDDES et al. 2016; PARK et al. 2016) studies from our lab and other labs, we

385 propose that the expression of HAD1 mRNA is induced by the HOG signaling pathway

386 in response to environmental stresses (KO et al. 2009), and in turn phosphorylation of

387 the Had1 protein may be regulated by the PKA signaling cascade (GEDDES et al. 2016),

388 and possibly by the calcineurin pathway (PARK et al. 2016). Activated Had1 is required

389 for appropriate stress responses; however, the detailed mechanisms controlling Had1

390 function should be further studied to better understand the roles of the (HAD)-like

391 hydrolase superfamily in stress responses, environmental adaptation, and virulence.

392

393 ACKNOWLEDGEMENTS

394 We thank Anna Averette and Shelly Clancey for technical support and Hiten Madhani

395 and the Fungal Genetics Stock Center for making the gene deletion collection available.

396 This research by HSP was supported by Kyungpook National University Research Fund,

397 2016. The work at Duke University was supported by NIH/NIAID R01 AI50438-10 to JH

398 and MEC, AI112595-03 to JH, and NIH/NCI R01 CA154499 to MEC.

399

400 REFERENCES

401 Aramburu, J., J. Heitman and G. R. Crabtree, 2004 Calcineurin: a central controller of 402 signalling in eukaryotes. EMBO Rep 5: 343-348. 403 Aramburu, J., A. Rao and C. B. Klee, 2000 Calcineurin: from structure to function. Curr 404 Top Cell Regul 36: 237-295. 405 Bader, T., B. Bodendorfer, K. Schroppel and J. Morschhauser, 2003 Calcineurin is 406 essential for virulence in Candida albicans. Infect Immun 71: 5344-5354. 407 Blankenship, J. R., F. L. Wormley, M. K. Boyce, W. A. Schell, S. G. Filler et al., 2003 408 Calcineurin is essential for Candida albicans survival in serum and virulence. 409 Eukaryot Cell 2: 422-430. 410 Brizuela, L., G. Chrebet, K. A. Bostian and S. A. Parent, 1991 Antifungal properties of 411 the immunosuppressant FK-506: identification of an FK-506-responsive yeast 412 gene distinct from FKB1. Mol Cell Biol 11: 4616-4626. 413 Buchan, J. R., 2014 mRNP granules. Assembly, function, and connections with disease. 414 RNA Biol 11: 1019-1030. 415 Buchan, J. R., and R. Parker, 2009 Eukaryotic stress granules: the ins and outs of 416 translation. Mol Cell 36: 932-941. 417 Burroughs, A. M., K. N. Allen, D. Dunaway-Mariano and L. Aravind, 2006 Evolutionary 418 genomics of the HAD superfamily: Understanding the structural adaptations and 419 catalytic diversity in a superfamily of phosphoesterases and allied enzymes. 420 Journal of Molecular Biology 361: 1003-1034. 421 Chang, Y. C., A. Khanal Lamichhane, H. M. Garraffo, P. J. Walter, M. Leerkes et al., 18

422 2014 Molecular mechanisms of hypoxic responses via unique roles of Ras1, 423 Cdc24 and Ptp3 in a human fungal pathogen Cryptococcus neoformans. PLoS 424 Genet 10: e1004292. 425 Chow, E. W., S. A. Clancey, R. B. Billmyre, A. F. Averette, J. A. Granek et al., 2017 426 Elucidation of the calcineurin-Crz1 stress response transcriptional network in the 427 human fungal pathogen Cryptococcus neoformans. PLoS Genet 13: e1006667. 428 Cox, G. M., J. Mukherjee, G. T. Cole, A. Casadevall and J. R. Perfect, 2000 Urease as a 429 virulence factor in experimental cryptococcosis. Infect Immun 68: 443-448. 430 Crabtree, G. R., 2001 Calcium, calcineurin, and the control of transcription. J Biol Chem 431 276: 2313-2316. 432 Cramer, R. A., Jr., B. Z. Perfect, N. Pinchai, S. Park, D. S. Perlin et al., 2008 Calcineurin 433 target CrzA regulates conidial germination, hyphal growth, and pathogenesis of 434 Aspergillus fumigatus. Eukaryot Cell 7: 1085-1097. 435 Cruz, M. C., D. S. Fox and J. Heitman, 2001 Calcineurin is required for hyphal 436 elongation during mating and haploid fruiting in Cryptococcus neoformans. 437 EMBO J 20: 1020-1032. 438 Cyert, M. S., 2003 Calcineurin signaling in Saccharomyces cerevisiae: how yeast go 439 crazy in response to stress. Biochem Biophys Res Commun 311: 1143-1150. 440 Danielsen, A. A., M. D. Parker, S. Lee, W. F. Boron, C. Aalkjaer et al., 2013 Splice 441 cassette II of Na+,HCO3(-) cotransporter NBCn1 (slc4a7) interacts with 442 calcineurin A: implications for transporter activity and intracellular pH control 443 during rat artery contractions. J Biol Chem 288: 8146-8155. 444 Davidson, R. C., J. R. Blankenship, P. R. Kraus, M. de Jesus Berrios, C. M. Hull et al., 445 2002 A PCR-based strategy to generate integrative targeting alleles with large 446 regions of homology. Microbiology 148: 2607-2615. 447 Feske, S., H. Okamura, P. G. Hogan and A. Rao, 2003 Ca2+/calcineurin signalling in 448 cells of the immune system. Biochem Biophys Res Commun 311: 1117-1132. 449 Fox, D. S., M. C. Cruz, R. A. Sia, H. Ke, G. M. Cox et al., 2001 Calcineurin regulatory 450 subunit is essential for virulence and mediates interactions with FKBP12-FK506 451 in Cryptococcus neoformans. Mol Microbiol 39: 835-849.

452 Fraser, J. A., R. L. Subaran, C. B. Nichols and J. Heitman, 2003 Recapitulation of the 453 sexual cycle of the primary fungal pathogen Cryptococcus neoformans var. gattii: 454 implications for an outbreak on Vancouver Island, Canada. Eukaryot Cell 2: 455 1036-1045. 456 Geddes, J. M., M. Caza, D. Croll, N. Stoynov, L. J. Foster et al., 2016 Analysis of the 457 protein kinase A-regulated proteome of Cryptococcus neoformans identifies a 458 role for the ubiquitin-proteasome pathway in capsule formation. mBio 7: e01862- 459 01815. 460 Goldman, A., J. Roy, B. Bodenmiller, S. Wanka, C. R. Landry et al., 2014 The 461 calcineurin signaling network evolves via conserved kinase-phosphatase 462 modules that transcend substrate identity. Mol Cell 55: 422-435. 463 Hogan, P. G., L. Chen, J. Nardone and A. Rao, 2003 Transcriptional regulation by 464 calcium, calcineurin, and NFAT. Genes Dev 17: 2205-2232. 465 Hung, D. T., and S. L. Schreiber, 1992 cDNA cloning of a human 25 kDa FK506 and 466 rapamycin binding protein. Biochem Biophys Res Commun 184: 733-738. 467 Idnurm, A., Y. S. Bahn, K. Nielsen, X. Lin, J. A. Fraser et al., 2005 Deciphering the 468 model pathogenic fungus Cryptococcus neoformans. Nat Rev Microbiol 3: 753- 469 764. 470 Janbon, G., K. L. Ormerod, D. Paulet, E. J. Byrnes, 3rd, V. Yadav et al., 2014 Analysis 471 of the genome and transcriptome of Cryptococcus neoformans var. grubii reveals 472 complex RNA expression and microevolution leading to virulence attenuation. 473 PLoS Genet 10: e1004261. 474 Kidd, S. E., F. Hagen, R. L. Tscharke, M. Huynh, K. H. Bartlett et al., 2004 A rare 475 genotype of Cryptococcus gattii caused the cryptococcosis outbreak on 476 Vancouver Island (British Columbia, Canada). Proc Natl Acad Sci U S A 101: 477 17258-17263. 478 Kissinger, C. R., H. E. Parge, D. R. Knighton, C. T. Lewis, L. A. Pelletier et al., 1995 479 Crystal structures of human calcineurin and the human FKBP12-FK506- 480 calcineurin complex. Nature 378: 641-644. 481 Ko, Y. J., Y. M. Yu, G. B. Kim, G. W. Lee, P. J. Maeng et al., 2009 Remodeling of global

482 transcription patterns of genes mediated by the stress-activated HOG signaling 483 pathways. Eukaryot Cell 8: 1197-1217. 484 Kozubowski, L., E. F. Aboobakar, M. E. Cardenas and J. Heitman, 2011a Calcineurin 485 colocalizes with P-bodies and stress granules during thermal stress in 486 Cryptococcus neoformans. Eukaryot Cell 10: 1396-1402. 487 Kozubowski, L., J. W. Thompson, M. E. Cardenas, M. A. Moseley and J. Heitman, 488 2011b Association of calcineurin with the COPI protein Sec28 and the COPII 489 protein Sec13 revealed by quantitative proteomics. PLoS One 6: e25280. 490 Kuznetsova, E., B. Nocek, G. Brown, K. S. Makarova, R. Flick et al., 2015 Functional 491 diversity of haloacid dehalogenase superfamily phosphatases from 492 Saccharomyces cerevisiae: Biochemica, struetural and evolutionary insights. J 493 Biol Chem 290: 18678-18698. 494 Kwon-Chung, K. J., J. A. Fraser, T. L. Doering, Z. Wang, G. Janbon et al., 2014 495 Cryptococcus neoformans and Cryptococcus gattii, the etiologic agents of 496 cryptococcosis. Cold Spring Harb Perspect Med 4: a019760. 497 Lee, S. C., A. Li, S. Calo and J. Heitman, 2013 Calcineurin plays key roles in the 498 dimorphic transition and virulence of the human pathogenic zygomycete Mucor 499 circinelloides. PLoS Pathog 9: e1003625. 500 Liu, O. W., C. D. Chun, E. D. Chow, C. Chen, H. D. Madhani et al., 2008 Systematic 501 genetic analysis of virulence in the human fungal pathogen Cryptococcus 502 neoformans. Cell 135: 174-188. 503 Mitchell, S. F., S. Jain, M. She and R. Parker, 2013 Global analysis of yeast mRNPs. 504 Nat Struct Mol Biol 20: 127-133. 505 Miyakawa, T., and M. Mizunuma, 2007 Physiological roles of calcineurin in 506 Saccharomyces cerevisiae with special emphasis on its roles in G2/M cell-cycle 507 regulation. Biosci Biotechnol Biochem 71: 633-645. 508 Miyazaki, T., S. Yamauchi, T. Inamine, Y. Nagayoshi, T. Saijo et al., 2010 Roles of 509 calcineurin and Crz1 in antifungal susceptibility and virulence of Candida glabrata. 510 Antimicrob Agents Chemother 54: 1639-1643. 511 Monari, C., A. Casadevall, C. Retini, F. Baldelli, F. Bistoni et al., 1999 Antibody to

512 capsular polysaccharide enhances the function of neutrophils from patients with 513 AIDS against Cryptococcus neoformans. AIDS 13: 653-660. 514 Nielsen, K., G. M. Cox, P. Wang, D. L. Toffaletti, J. R. Perfect et al., 2003 Sexual cycle 515 of Cryptococcus neoformans var. grubii and virulence of congenic a and alpha 516 isolates. Infect Immun 71: 4831-4841. 517 Norbeck, J., A. K. Pahlman, N. Akhtar, A. Blomberg and L. Adler, 1996 Purification and 518 characterization of two isoenzymes of DL-glycerol-3-phosphatase from 519 Saccharomyces cerevisiae. Identification of the corresponding GPP1 and GPP2 520 genes and evidence for osmotic regulation of Gpp2p expression by the 521 osmosensing mitogen-activated protein kinase signal transduction pathway. J 522 Biol Chem 271: 13875-13881. 523 Northrop, J. P., S. N. Ho, L. Chen, D. J. Thomas, L. A. Timmerman et al., 1994 NF-AT 524 components define a family of transcription factors targeted in T-cell activation. 525 Nature 369: 497-502. 526 O'Keefe, S. J., J. Tamura, R. L. Kincaid, M. J. Tocci and E. A. O'Neill, 1992 FK-506- and 527 CsA-sensitive activation of the interleukin-2 promoter by calcineurin. Nature 357: 528 692-694. 529 Odom, A., M. Del Poeta, J. Perfect and J. Heitman, 1997a The immunosuppressant 530 FK506 and its nonimmunosuppressive analog L-685,818 are toxic to 531 Cryptococcus neoformans by inhibition of a common target protein. Antimicrob 532 Agents Chemother 41: 156-161. 533 Odom, A., S. Muir, E. Lim, D. L. Toffaletti, J. Perfect et al., 1997b Calcineurin is required 534 for virulence of Cryptococcus neoformans. EMBO J 16: 2576-2589. 535 Onyewu, C., F. L. Wormley, Jr., J. R. Perfect and J. Heitman, 2004 The calcineurin 536 target, Crz1, functions in azole tolerance but is not required for virulence of 537 Candida albicans. Infect Immun 72: 7330-7333. 538 Pahlman, A. K., K. Granath, R. Ansell, S. Hohmann and L. Adler, 2001 The yeast 539 glycerol 3-phosphatases Gpp1p and Gpp2p are required for glycerol biosynthesis 540 and differentially involved in the cellular responses to osmotic, anaerobic, and 541 oxidative stress. J Biol Chem 276: 3555-3563.

542 Park, B. J., K. A. Wannemuehler, B. J. Marston, N. Govender, P. G. Pappas et al., 2009 543 Estimation of the current global burden of cryptococcal meningitis among 544 persons living with HIV/AIDS. AIDS 23: 525-530. 545 Park, H.-S., E. W. Chow, C. Fu, E. J. Soderblom, M. A. Moseley et al., 2016 Calcineurin 546 targets involved in stress survival and fungal virulence. PLoS Pathog 12: 547 e1005873. 548 Perfect, J. R., S. D. Lang and D. T. Durack, 1980 Chronic cryptococcal meningitis: a 549 new experimental model in rabbits. Am J Pathol 101: 177-194. 550 Perfect, J. R., D. L. Toffaletti and T. H. Rude, 1993 The gene encoding 551 phosphoribosylaminoimidazole carboxylase (ADE2) is essential for growth of 552 Cryptococcus neoformans in cerebrospinal fluid. Infect Immun 61: 4446-4451. 553 Randez-Gil, F., A. Blasco, J. A. Prieto and P. Sanz, 1995a DOGR1 and DOGR2: two 554 genes from Saccharomyces cerevisiae that confer 2-deoxyglucose resistance 555 when overexpressed. Yeast 11: 1233-1240. 556 Randez-Gil, F., J. A. Prieto and P. Sanz, 1995b The expression of a specific 2- 557 deoxyglucose-6P phosphatase prevents catabolite repression mediated by 2- 558 deoxyglucose in yeast. Curr Genet 28: 101-107. 559 Rusnak, F., and P. Mertz, 2000 Calcineurin: form and function. Physiol Rev 80: 1483- 560 1521. 561 Schreiber, S. L., and G. R. Crabtree, 1992 The mechanism of action of cyclosporin A 562 and FK506. Immunol Today 13: 136-142. 563 Schumacher, J., I. F. de Larrinoa and B. Tudzynski, 2008 Calcineurin-responsive zinc 564 finger transcription factor CRZ1 of Botrytis cinerea is required for growth, 565 development, and full virulence on bean plants. Eukaryot Cell 7: 584-601. 566 Selvan, L. D., S. Renuse, J. E. Kaviyil, J. Sharma, S. M. Pinto et al., 2014 567 Phosphoproteome of Cryptococcus neoformans. J Proteomics 97: 287-295. 568 Siekierka, J. J., and N. H. Sigal, 1992 FK-506 and cyclosporin A: immunosuppressive 569 mechanism of action and beyond. Curr Opin Immunol 4: 548-552. 570 Sigal, N. H., and F. J. Dumont, 1992 Cyclosporin A, FK-506, and rapamycin: 571 pharmacologic probes of lymphocyte signal transduction. Annu Rev Immunol 10:

572 519-560. 573 Soriani, F. M., I. Malavazi, M. E. da Silva Ferreira, M. Savoldi, M. R. Von Zeska Kress et 574 al., 2008 Functional characterization of the Aspergillus fumigatus CRZ1 575 homologue, CrzA. Mol Microbiol 67: 1274-1291. 576 Steinbach, W. J., R. A. Cramer, Jr., B. Z. Perfect, Y. G. Asfaw, T. C. Sauer et al., 2006 577 Calcineurin controls growth, morphology, and pathogenicity in Aspergillus 578 fumigatus. Eukaryot Cell 5: 1091-1103. 579 Steinbach, W. J., R. A. Cramer, Jr., B. Z. Perfect, C. Henn, K. Nielsen et al., 2007a 580 Calcineurin inhibition or mutation enhances cell wall inhibitors against Aspergillus 581 fumigatus. Antimicrob Agents Chemother 51: 2979-2981. 582 Steinbach, W. J., J. L. Reedy, R. A. Cramer, Jr., J. R. Perfect and J. Heitman, 2007b 583 Harnessing calcineurin as a novel anti-infective agent against invasive fungal 584 infections. Nat Rev Microbiol 5: 418-430. 585 Stewart, A. A., T. S. Ingebritsen, A. Manalan, C. B. Klee and P. Cohen, 1982 Discovery 586 of a Ca2+- and calmodulin-dependent protein phosphatase: probable identity 587 with calcineurin (CaM-BP80). FEBS Lett 137: 80-84. 588 Tsujimoto, Y., S. Izawa and Y. Inoue, 2000 Cooperative regulation of DOG2, encoding 2- 589 deoxyglucose-6-phosphate phosphatase, by Snf1 kinase and the high-osmolarity 590 glycerol-mitogen-activated protein kinase cascade in stress responses of 591 Saccharomyces cerevisiae. J Bacteriol 182: 5121-5126. 592 Yoshimoto, H., K. Saltsman, A. P. Gasch, H. X. Li, N. Ogawa et al., 2002 Genome-wide 593 analysis of gene expression regulated by the calcineurin/Crz1p signaling 594 pathway in Saccharomyces cerevisiae. J Biol Chem 277: 31079-31088. 595 Yu, J. H., Z. Hamari, K. H. Han, J. A. Seo, Y. Reyes-Dominguez et al., 2004 Double-joint 596 PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. 597 Fungal Genet Biol 41: 973-981. 598

599

600

601

602 Table 1. Cryptococcus neoformans strains used in this study

Strains Relevant genotype References H99 MATalpha, Wild type (PERFECT et al. 1980) HP235 MATalpha crz1∆::NEO (PARK et al. 2016) HP242 MATalpha cna1∆::NEO (PARK et al. 2016) HPC23 MATalpha had1∆::NEO This study HPC24 MATalpha had1∆::NEO This study HPC27 MATalpha had1∆::NEO HAD1_4xFLAG::HYG This study HPC28 MATalpha had1∆::NEO HAD1_4xFLAG::HYG This study HPC29 MATalpha crz1∆::NAT had1∆::NEO This study HPC30 MATalpha crz1∆::NAT had1∆::NEO This study HPC25 MATa had1∆::NAT This study HPC26 MATa had1∆::NAT This study KN99 MATa, Wild type (NIELSEN et al. 2003) HP243 MATa cna1∆::NEO (PARK et al. 2016) 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 25

626 Table 2. Oligonucleotides used in this study

Name Sequence (5’-3’)a, b, c Purpose JOHE40706 GTAAAACGACGGCCAG NAT, NEO, HYG markers (M13F) JOHE40707 CAGGAAACAGCTATGAC NAT, NEO, HYG markers (M13R) JOHE42780 GCAGGTGAGCAGTTGTGGCAAG HAD1 disruption (5F) JOHE42781 GACATCCAAATCCCACAATGCC HAD1 disruption (3R) JOHE42782 TCACTGGCCGTCGTTTTAC TTTGGATAATTACTTGGGGGTCTATG HAD1 disruption with marker (5R) JOHE42783 CATGGTCATAGCTGTTTCCTG AATGTGTTAAATGTAGCGATAGGC HAD1 disruption with marker (3F) JOHE42784 GACGGCTCGTTACTGTGTTAGATTG HAD1 disruption (NF_Nested) JOHE42785 CAAGATCCCAGTGTCGTGGAG HAD1 disruption (NR_Nested) JOHE42786 aatt GCGGCCGC CTATTGTGAGCTACTGGCCTGGTG 5’ HAD1 with promoter and NotI JOHE42787 aatt GCGGCCGC CTCGTCCTGAGACATTTCGCCTTG 3’ HAD1 with NotI JOHE41391 GGTACTCACAACTGAGCCAGCAG CRZ1 disruption (5F) JOHE41392 TCATCGTCGTCGAAGTCGAGGC CRZ1 disruption (3R) JOHE41393 TCACTGGCCGTCGTTTTAC GTGGATTATAGGGGTGACTGATAGA CRZ1 disruption with marker (5R) JOHE41394 CATGGTCATAGCTGTTTCCTG CGATGGTCATAGGGCGCTGTGAG CRZ1 disruption with marker (3F) JOHE41395 GGTTCGTTAGTCGGGTCAACTG CRZ1 disruption (NF) JOHE41396 TTAGGGGAGGTTGGGATCGG CRZ1 disruption (NR) 627 a Underlined sequence is homologous to vector or cassette sequence. 628 b Lowercase indicates linker sequence. 629 c Bold sequence denotes restriction site sequence. 630 . 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647

648

649 Figure legends

650 651 Figure 1. Phenotypes of the potential calcineurin target mutants exposed to 652 various stresses. (A) Targets in the Venn diagram labelled red were characterized in

653 the previous study (PARK et al. 2016). Targets labelled blue were either deleted in our

654 lab or obtained from a C. neoformans deletion mutant library (LIU et al. 2008) and tested 655 in this study. Cna1 (green) is the calcineurin A catalytic subunit. (B) Functional 656 categories ascribed to the potential calcineurin targets tested in this study. (C) Spot 657 dilution assays with WT (H99), cna1Δ (HP242), and 13 mutants from a systematic gene 658 deletion library were performed under several stress conditions as indicated. Strain 659 cultures were incubated overnight, serially diluted 10-fold, and plated on YPD medium 660 without or with Congo red (CR) and sodium dodecyl sulfate (SDS). Cells were incubated 661 for 2 to 3 days at 30°C, or 37°C as indicated, and all cultures containing stressor 662 compounds (SDS and CR) were incubated at 30°C. 663 664 Figure 2. Deletion of had1 results in hypersensitivity to various stresses. Spot 665 dilution assays with WT (H99), cna1Δ (HP242) and had1Δ mutants (HPC23 and 666 HPC24), and had1∆ + HAD1 complemented strains (HPC27 and HPC28) were 667 performed under several stress conditions as indicated. (A) Cell cultures in liquid YPD 668 media were grown overnight at 30°C and serially diluted 10-fold. Equal aliquots were 669 spotted on solid YPD medium supplemented or not with the stressor compounds as 670 indicated in panel B. (A) For thermotolerance, cells were incubated on solid medium for 671 2 days at 30°C, 37°C, or 38°C as indicated. (B) For cell wall, ER, or osmolarity stress, 672 the solid YPD culture media was supplemented with Congo red (CR), calcofluor white 673 (CFW), dithiothreitol (DTT), sodium dodecyl sulfate (SDS), or KCl at the indicated 674 concentrations and the cultures were incubated at 30°C. Results shown are 675 representative of two independent experimental replicates. 676 677 Figure 3. Had1 and Crz1 orchestrate for stress response. Stress tolerances of WT 678 (H99), the single cna1Δ (HP242), crz1Δ (HP235), and had1Δ (HPC24) mutants, and the

679 had1∆ crz1Δ + HAD1 complemented strains (HPC29 and HPC30). Cells were grown 680 overnight at 30°C, serially diluted 10-fold, and plated on YPD medium. Plates were 681 incubated for 2 days at 30°C, 37°C, 38°C, or 39°C as indicated. 682 683 Figure 4. Had1 is required for virulence. (A) Virulence was tested for the WT (H99), 684 cna1Δ (HP242), crz1Δ (HP235), had1Δ (HPC24), had1∆ + HAD1 (HPC28) and had1∆ 685 crz1Δ (HPC29 and HPC30) deletion mutant and complemented strains. Yeasts cells 686 were grown overnight in YPD liquid medium at 30°C, collected, washed with PBS, and 5 687 × 105 cells were inoculated into female BALB/c mice via intranasal instillation. Animal 688 survival was monitored for 60 days post infection. (B) Mice (n = 3~4) were inoculated 689 intranasally with 5 × 105 CFU of the indicated strains. Lungs were isolated at 14 days 690 post-infection. Results are expressed as mean colony forming unit (CFU) per lung ± 691 standard error of the mean. ND: not detected. 692 693 Figure 5. The calcineurin-Crz1 pathway and Had1 control growth at high 694 temperature, stress response, and virulence via parallel pathways. The calcineurin 695 signaling network acts via Crz1 to control Cryptococcus thermotolerance, cell wall 696 integrity, and virulence. Had1 also contributes to these functions in a pathway parallel to 697 Crz1 and possibly regulated by calcineurin. Dotted line arrow and question mark denote 698 a pathway step not as yet well defined as it remains to be determined whether Had1 is 699 an authentic calcineurin target. 700 701 702 703 704 705 706 707

708

709 Supplemental Figure List

710

711 Figure S1. Haloacid dehalogenase proteins in C. neoformans and S. cerevisiae. (A) 712 Domain architecture of beta-phosphoglucomutase family proteins in C. neoformans and 713 S. cerevisiae. (B) A phylogenetic tree of HAD proteins in C. neoformans and S. 714 cerevisiae was generated by MEGA 5 software (http://www.megasoftware.net/) using 715 the alignment data from ClustalW2. The tree results were submitted to iTOL 716 (http://itol.embl.de/) to generate the figure. 717 718 Figure S2. Had1-FLAG gel migration mobility under stress conditions. (A) Had1 719 mobility is altered under the thermal stress conditions. Cultures of the had1Δ HAD1- 720 4xFLAG complemented strain (HPC27) in YPD medium were grown to log phase at 721 25°C or shifted from 25°C to 37°C for 1 hour in the presence or absence of 2 μg/mL 722 FK506. (B) Cultures of HPC27 were grown to log phase at 25°C as indicated in panel A, 723 or shifted to YPD medium containing 1 M NaCl with or without 2 μg/mL FK506 and 724 incubation was continued at 25°C for 1 hour. Whole cell protein extracts were prepared 725 and analyzed by western blot as indicated in the materials and methods section. 726 727 Figure S3. Expression of HAD1. Expression of HAD1 in WT (H99) strain under 728 osmotic (A) or thermal (B) stresses. RNA was isolated from WT strain (H99) and the 729 expression of HAD1 was assessed by real-time PCR. Error bars depict the standard 730 errors from the mean of three independent experiments. 731 732

733 30

734 31

735 32

736 33

737 34