Synthetic Biology in cyanobacteria Expression of [FeFe] hydrogenases, their maturation systems and construction of broad-host-range vectors
Ingólfur Bragi Gunnarsson
Degree project in applied biotechnology, Master of Science (2 years), 2011 Examensarbete i tillämpad bioteknik 30 hp till masterexamen, 2011 Biology Education Centre and Department of Photochemistry and Molecular Science, Uppsala University Supervisors: Prof. Peter Lindblad and Dr. Thorsten Heidorn
Index
1 Introduction 1
1.1 Energy and environment 1
1.2 Current hydrogen production processes 2
1.3 Cyanobacteria 2
1.4 Hydrogenases 3
1.4.1 Cyanobacterial [NiFe] hydrogenases 4 1.4.2 Chlamydomonas reinhardtii [FeFe] hydrogenases 4
1.5 Synthetic biology 5
1.5.1 Standardized biological parts - BioBricks 7
1.6 Synthetic biology in cyanobacteria 9
1.7 Project aims and goals 10 2 Results 11
2.1 Gas chromatography measurements 11
2.2 Test hydrogen electrode measurements 12
2.3 Growth characterization and hydrogen evolution measurement in hydrogen electrode 13
2.4 Protein extraction, separation and Western Blotting 14
2.5 Discovering damage to broad-host-range vector pPMQAC1 15
2.6 Construction of new broad-host-range vectors 16 3 Discussion 20
3.1 [FeFe] hydrogenase expression in E. coli and characterization of consequent hydrogen production. 20
3.2 Conformation of [FeFe] hydrogenase expression in E. coli 20
3.3 Construction of broad-host-range vectors 21
4 Materials and methods 23
4.1 Bacterial strains, plasmids and primers 23
4.2 Growth media 24
4.3 Plasmid purification and cloning 25
4.4 Hydrogen measurements 26 4.4.1 Hydrogen electrode setup 26 4.4.2 Gas chromatography measurements 27 4.4.3 Test hydrogen electrode measurements 28
4.4.4 Growth characterization and hydrogen evolution measurement using hydrogen electrode 28
4.5 SDS-PAGE 29
4.6 Western blotting 30
4.7 Protein staining 30
4.8 Polymerase chain reactions (PCR) 31
4.9 Construction of new broad-host-range vectors 32 5 Acknowlegements 34 References 35
Summary
Mankind's consumption of fossil fuels is so excessive that we will most likely run out of fossil fuels this century. The depletion of fossil fuels is already causing serious con licts and effecting the worlds economy. Global warming is already causing Earth’s climate to change fast, but the consumption of fossil fuels still increases. It is of great importance that fossil fuels are replaced by renewable energy sources so more damage to Earth’s biosphere can be prevented. There is though one source of energy that dwarfs all other energy sources on Earth, the sun. Nature has for a long time been able to convert sunlight into energy very elegantly via photosynthesis. Mankind has not yet been able to capture the suns energy in an economical and ef icient way. Synthetic biology de initely has the future potential of developing photobiological systems able to produce renewable energy sources from sunlight. Photosynthetic microorganisms e.g. cyanobacteria are able to harness sunlight and produce hydrogen in small amounts.
This project was mainly focused on two things. First, to characterize the hydrogen production of already available [FeFe ]hydrogenase constructs (hydA2 and hydA2+fd) and their maturation systems in E. coli using gas chromatography and a Clark type electrode. Second, I was also involved in the construction of broad-host-range vectors that are able to replicate in cyanobacterial strains for the purpose of expressing productive [FeFe] hydrogenases and their maturation systems in cyanobacteria for increased hydrogen production. 1 Introduction
1.1 Energy and environment Earth’s fossil fuel resources will run out in the not so distant future, and the release of green house gases from burning fossil fuel are causing global warming, which in turn is causing climates changes [1, 2]. The use of renewable energy sources needs to increase drastically and new ways in producing renewable energy need to be realized as soon as possible. Some renewable energy sources in use today are e.g. wind-, solar-, geothermal-, hydropower and biofuels such as bioethanol, biodiesel, biohydrogen. It’s important to continue ongoing research in all ields of renewable energy because there is still no single renewable energy source that can totally replace fossil fuels, at least not when using current technologies [3]. Out of all energy sources being explored, one will eventually be able to replace fossil fuels inde initely, this energy source is the sun. The sunlight that hits Earth’s surface contains about 103 times more energy than mankind's energy consumption [4]. Current technologies are however not able to capture this energy and transfer it into a renewable energy carriers such as electricity, hydrogen or ethanol in an economical and ef icient way [5, 6]. Nature, on the other hand is able to do this in a very elegant way via photosynthesis. Plants, algae and some bacterial species use photosynthesis to convert sunlight into energy [7]. In the search for a way to capture sunlight and convert it into an energy carrier that can be commercially used, many possibilities are being explored. Hydrogen production using biological systems such as cyanobacteria are an interesting alternative, since they are able to naturally produce molecular hydrogen (in small amounts) from only water and sunlight via photosynthesis [8]. Molecular hydrogen contains the highest amount of energy per weight unit of all gaseous fuels and since it’s a carbon free compound, no carbon is emitted from its combustion. In fact, the combustion of hydrogen has only one combustion product, water [9]. Because of these positive attributes many believe that hydrogen will become Earth’s primary energy carrier in the future, but how that becomes reality is still unknown [5]. If biological systems like cyanobacteria are to be used for large
1 scale hydrogen production in the future, genetic engineering is needed to increase the production [10].
1.2 Current hydrogen production processes Today as much as 96% of all hydrogen being produced in the world is produced directly from fossil fuels. About 4% is produced by electrolysis, where electricity generated in most cases from fossil fuels is used [10]. Steam methane reforming (SMR) is the most abundant method, as well as the cheapest way of producing hydrogen. The biggest drawback of using SMR is that the process emits large
amounts of CO2 [11]. Other widely used methods for hydrogen production are e.g. coal gasi ication, biomass pyrolysis/gasi ication, electrolysis, photocatalytic water splitting and biological [12]. By using biological systems, hydrogen can be produced in a renewable and carbon neutral way. Biological hydrogen can be produced via photosynthesis, fermentation and microbial electrolysis cells [13]. This project was focused on hydrogen production using biological processes connected to photosynthesis.
1.3 Cyanobacteria Cyanobacteria are photosynthetic organisms that were Earth’s irst primary producers, and as such they play an important role in Earth’s carbon and nitrogen cycles, since many of them can ix nitrogen from the atmosphere[14]. The mechanism of oxygenic photosynthesis is found in the thylakoid membrane. It absorbs light with antenna complexes and Photosystem II uses the energy in the photons to split water into molecular oxygen, protons and electrons. The electrons are transferred through the electron transport chain (plastoquinone, b6f cytochrome and plastocyanin) to Photosystem I that catalyzes the membrane charge separation. This process is driving the reduction of NADP+ to NADPH (through ferrodoxin-NADP+ reductase) as well as providing the proton gradient necessary for producing ATP [15, 16]. The ability to split water and harvest it’s electrons via photosynthesis is a biochemical capacity that can be traced back at least 2320-2450 million years, when molecular oxygen was irst found in the atmosphere. Some even believe photosynthetic microorganisms to have existed as early as 3800 million years
2 ago (Ma) [17, 18]. These ancient photosynthetic organisms were predecessors to currently existing cyanobacteria [19]. When oxygen became abundant in Earth’s atmosphere a new chapter in life on Earth began, aerobic organisms evolved and cellular respiration became possible [19]. Taxonomic classi ication based on morphology and development usually divides cyanobacteria into ive principal groups: Chroococcales, Pleurocapsales, Oscillatoriales, Nostocales and Stigonematales. These groups are then divided into numerous sub-groups [8]. Cyanobacteria are found in a wide variety of habitats e.g. aquatic and terrestrial environments as well as under extreme conditions in hot springs, deserts, hydersaline alkaline lakes and polar regions [20]. Apart from the fact that cyanobacteria can grow in harsh environments, they also have some other attributes that can be bene icial for bioindustrial processes such as simple nutrition requirements, rapid genetics and naturally
produce molecular hydrogen [10].
1.4 Hydrogenases Hydrogenases are metalloenzymes that catalyze the reversible oxidation of molecular hydrogen from protons and electrons according to this reaction:
+ − H2⇔2H +2e . Hydrogenases are found in many different microorganisms and are important for their energy metabolism [21]. There are three classes of hydrogenases, [NiFe] hydrogenase, [FeFe] hydrogenase and [Fe] hydrogenase. These classes indicate what type of active site the enzyme has. Three types of Fe-S clusters are found in proximity to the active site, [2Fe–2S], [3Fe–4S], and [4Fe–4S]. The Fe-S clusters supply electrons to the active site from the enzymes redox partners (NAD, cytochrome, coenzyme F420 and ferrodoxin). In the case of uptake hydrogenase the Fe-S clusters guide the electrons away from the active site [22]. The enzymes however vary between species e.g. [NiFe] hydrogenases are found across a variety of organisms including cyanobacteria, while [FeFe]hydrogenases
are mostly found in green algae and some anaerobic prokaryotes [23].
3 1.4.1 Cyanobacterial [NiFe] hydrogenases In the hydrogen metabolism of nitrogen- ixing cyanobacteria, there are three enzymes that are of high importance: 1. Nitrogenase, which produces hydrogen as a byproduct while ixing nitrogen (will not be discussed further). 2. Uptake hydrogenase (encoded by hupSL), recycles hydrogen that is produced by the nitrogenase. 3. Bidirectional hydrogenase (encoded by hoxEFUYH), produces and consumes hydrogen [8]. Non-nitrogen ixing cyanobacteria, such as Synechocystis PCC 6803 only possess the bidirectional hydrogenase [24]. In cyanobacteria all of these enzymes have [NiFe] reaction centers and are sensitive to the presence of oxygen, which will render them inactive under aerobic conditions. The inactivation of these enzymes by oxygen can however be reversed by introducing anaerobic conditions [25]. The oxygen sensitivity, and the fact that the overall productivity of the hydrogen metabolism is low means that wildtype cyanobacterial strains are not feasible for commercial hydrogen production [26]. If one would want to use cyanobacteria for industrial hydrogen production, genetic modi ications need to be done on the hydrogen metabolism in some way e.g. by introducing more productive [FeFe] hydrogenases from green algae into cyanobacteria [27]. The cyanobacterial strain Synechocystis PCC 6803 is potentially suitable for the heterologous expression of [FeFe] hydrogenases due to its unicellular appearance, natural transformability and relatively fast growth [8]. Here is where the application of synthetic biology becomes useful.
1.4.2 Chlamydomonas reinhardtii [FeFe] hydrogenases C. reinhardtii is a soil-dwelling unicellular photosynthetic green algae that possesses many different fermentation pathways [28]. Its metabolic lexibility can be used to produce useful metabolites such as hydrogen, ethanol and organic acids. C. reinhardtii possesses very productive [FeFe] hydrogenases that could potentially be used for large scale hydrogen production, whether using C. reinhardtii or some other host e.g. cyanobacteria. [FeFe] hydrogenases are more productive than [NiFe] hydrogenases when it comes to hydrogen production. This makes them more desirable for hydrogen production technologies [29]. The active site of these highly productive enzymes
4 is called the H cluster. The H cluster has a complex structure that consists of a FeFe subcluster coordinated by carbon monoxide (CO) and cyanide (CN) ligands as well as a dithiol bridge. The active site is linked to the [4Fe-4S] cluster by a cysteine residue [30]. [FeFe] hydrogenases are very sensitive to the presence of oxygen and very easily irreversibly inactivated [31]. Oxygen is believed to bind to the active site of the [FeFe] hydrogenases, more speci ically at a free coordination site of the Fe atom distal to the [4Fe-4S] cluster Figure 1 - Chemical structure of the [FeFe]-hydrogenase H-cluster[31]. (marked as Fe2 in igure 1)[32]. In C. reinhardtii there are two genes, hydA1 and hydA2 that encode for [FeFe] hydrogenases, HydA1 and HydA2. The transcription of these genes is induced at anaerobic conditions. Due to the complexity of the enzyme’s active site H-cluster, additional maturation enzymes (HydEF and HydG) are needed for its biosynthesis and assembly [33]. These maturation enzymes are encoded by hydEF and hydG genes and when transcribed the gene products are involved in numerous reactions, such as the coupling of radical S-adenosyl-L-methionine (SAM) chemistry, nucleotide binding, ligand synthesis, H-cluster assembly as well as cluster insertion [34]. The inal product is an active and mature [FeFe] hydrogenase. However the details of how the [FeFe] hydrogenase maturation process works are currently unknown [30]. It is of great importance to understand the synthesis of the H-cluster since it could contribute signi icant information which can help with improving genetic engineering of microorganisms used for hydrogen production as well as with the creation of hydrogen producing biomimetic catalysts [34].
1.5 Synthetic biology With the rapidly growing knowledge of biological systems and the enormous advancements made in different ields useful for engineering biological systems, a new multidisciplinary ield within biology has emerged, synthetic biology. Synthetic biology is a ield that ties together biological science and engineering. Different research areas within biology come together in synthetic biology: e.g.
5 protein engineering, systems biology, computational biology, metabolic engineering and bioinformatics. Using the knowledge from all these different ields, scientists are now able to design, synthesize and combine genetic material to in luence and manipulate the cellular metabolism of unicellular and even multicellular organisms [35]. The tools and technologies that enable synthetic biology to prevail are standardized cloning, DNA synthesis and work that is being done on minimizing genomes [36]. Traditional cloning is an important tool when conducting synthetic biology, but because people use different techniques, materials and standards to conduct their cloning it is often laborious and inef icient [37]. By using a standardized form of cloning e.g. the “BioBrick assembly standard”, where standardized cloning vectors (BioBrick vectors) and standardized genetic elements (BioBrick standard biological parts, BioBricks) are employed, the cloning process can be automated and both functionally and time optimized [37]. DNA synthesis and genome minimization both got world wide publicity at the same time in May 2010 when J. Craig Venter and his colleagues at the J. Craig Venter Institute published an article in Science [38] about the creation of a synthetic organism. Big media discussion about synthetic life and the ethical issues related to this topic followed. In the article Venter et al. announced that they were successful in designing, synthesizing and assembling a 1.08 mega-bp Mycoplasma mycoides genome and creating M. mycoides cells containing only the synthetic chromosome [38]. This is the irst step in creating organisms that can be truly optimized to produce valuable compounds e.g. bioethanol, biohydrogen or pharmaceuticals. Scientists will be able to maximize the yield of their target products by creating the ideal synthetic organism for the production of that speci ic product [39]. The synthetic genome is kept at minimum size and includes only genes that are essential for the growth of the microorganism as well as genes that are necessary for producing the target product. In this way the production of unwanted metabolites and bi-products can be minimized, which in turn will allow increased production of the target product [37].
6 1.5.1 Standardized biological parts - BioBricks By adopting inventions and taking note of developments taking place in different ields of engineering, the process of engineering biology is constantly being made easier. As the goal of synthetic biology is to design and build new biological systems by assembling biological parts (or biological building blocks), challenges like the characterization and standardization of the design and assembly of these biological parts need to be overcome to make the process more ef icient [40]. Biological parts and standard biological parts can be de ined in the following way: “We de ine a biological part to be a natural nucleic acid sequence that encodes a de inable biological function, and a standard biological part to be a biological part that has been re ined in order to conform to one or more de ined technical standards” [41]. In 2003, the original BioBrick assembly standard was proposed by Thomas F. Knight Jr. in a technical report that he wrote at MIT. In this technical report he introduces a sequence standard that requires each BioBrick component to consist of a double stranded DNA vector. The vector bears four standardized restriction sites. Two sites, EcoRI (E) and XbaI (X) are positioned upstream and the other two restriction sites, SpeI (S) and PstI (P) are positioned at the downstream end of the vector. No other copies of these restriction sites are allowed to exist on the vector. A so called pre ix region is between the E and X restriction sites and a suf ix region is between the S and P restriction sites. In- between the restriction site pairs is the “insert” region [42]. Enzymatic digestion with X and S results in compatible sticky ends, so that they can be ligated together, the same thing applies for the ligation of the same type of sticky ends e.g. E and E sticky ends. As shown in igure 2, BioBricks can be excised from one BioBrick vector and integrated into another BioBrick vector via ligation. A BioBrick part (blue) is removed from its vector by cutting with E and S. In a separate reaction a gap is induced in the vector Figure 2-BioBrick standard assembly example
7 containing the green BioBrick part, by cutting with E and X. The blue BioBrick part and the cut vector containing the green part are then puri ied via gel electrophoresis. The two parts are then mixed together so that compatible sticky (E-E and S-X) ends can come together. When this is done the parts can be ligated together to form one vector containing a blue-green part. The restriction sites (S- X) between two parts form a so called “scar” sequence that is not recognized by any of the four restriction enzymes, which facilitates further assembly of BioBrick parts. The resulting vector is then transformed into E. coli cells, which are then grown to produce the desired amount of the BioBrick vector [43]. After the initial proposition of the assembly standard it has been modi ied numerous times to adapt it to new techniques. The Registry of Biological Parts was founded in the same year as Tomas F. Knight Jr. proposed the BioBrick assembly standard. The Registry is a growing collection of standardized biological parts that can be used by scientists to design and assemble biological circuits. The standard facilitates the exchange and assembly of biological parts. The smallest unit of engineering is the part, which is represented by a DNA sequence that encodes for different functions. These parts include several thousands of genetic elements such as: promoters, repressors, activators, terminators and ribosome binding sites (RBS). Parts can then be assembled into a “device” that performs a certain task or function with certain input and output [44]. The BioBricks Foundation is a non-pro it organization that works on improving and de ining the standards of the BioBrick assembly standard and the standardized biological parts. The foundation strives to help and support synthetic biologists by providing them with practical and theoretical knowledge through organizing workshops [45]. OpenWetWare is another example of an effort to help synthetic biologists in conducting their research by sharing information, know-how and wisdom to scientists to make their work easier. At their website (www.openwetware.org) one can e.g. view, download and upload protocols for all kinds of methods and experiments used in synthetic biology, as well as see the composition of numerous materials used.
8 1.6 Synthetic biology in cyanobacteria Cyanobacteria have become target organisms for some scientists due to their photosynthetic abilities. To be able to apply synthetic biology in cyanobacteria, the molecular tools to do so need to be developed. It is necessary because molecular tools such as vectors that were developed for E. coli will often not work properly in cyanobacteria. This is the reason why scientists at the Department of Photochemistry and Molecular Science at Uppsala University constructed a BioBrick compatible broad-host-range shuttle vector optimized for replication in cyanobacteria [46]. The broad-host-range vector constructed is called pPMQAK1. The vector contains a RSF1010 replicon that enables replication in cyanobacteria, two antibiotic cassettes (A=Ampicillin and K=Kanamycin) and a BioBrick interface with the four standard BioBrick restriction sites (EcoRI, XbaI, SpeI and PstI). A BioBrick, BBa_P1010 was inserted into the BioBrick insertion site using the BioBrick assembly standard [46]. Figure 3-Construction of pPMQAK1-BBa_P1010 [46] BBa_P1010 is the BioBrick name for the ccdB cell death gene, which codes for the CcdB protein that kills most E. coli strains, some strains are however resistant. By having BBa_P1010 on the vector the process of inserting other BioBricks into the vector is made easier. The ccdB gene is used for positive selection of successful ligations into the BioBrick site, since all cells carrying plasmids containing BBa_P1010 will die. [43]. The RSF1010 replicon is from the broad-host-range plasmid RSF1010. It is of IncQ group and has been shown to replicate in a wide range of gram-negative bacteria as well as some gram-positive bacteria [47]. Former master students Thiyagarajan Gnanasekaran and Sean M. Gibbons at the Department of Photochemistry and Molecular Science, Uppsala University built genetic constructs e.g. hydA1 and hydA2 under PTrc1O synthetic promoter as well
9 as maturation system construct under PTrc2O synthetic promoter. They also made pPMQAC1, a modi ied version of pPMQAK1, containing a chloramphenicol cassette instead of a kanamycin cassette. The hydrogenase constructs were inserted into pPMQAK1 and the maturation system construct into pPMQAC1 for expression in cyanobacteria.
1.7 Project aims and goals Originally the main project goal was to ind out why expression of already available [FeFe] hydrogenase and maturation system constructs in the cyanobacterial strain Synechocystis PCC 6803 did not result in hydrogen evolution. After that, the aim was to adjust growth conditions for Synechocystis PCC 6803 in order to optimize the hydrogen production. The above strategy was however abandoned when discovering that one of two shuttle vectors (pPMQAC1) was not functioning properly. A new strategy, involving the creation of new and optimized broad-host-range shuttle vectors was formed. The goal of the new strategy was to combine the RSF1010 replicon with different antibiotic cassettes and ligate it into a new and optimized BioBrick base vector obtained from The Registry of Biological Parts. If this goal was to be achieved the aim was to use the new broad-host-range shuttle vectors to express [FeFe] hydrogenases and maturation systems in Synechocystis PCC 6803.
10 2 Results
2.1 Gas chromatography measurements Hydrogen measurements were tested using already available [FeFe] hydrogenase and maturation system constructs. Hydrogen evolution from E. coli BL-21 (DE3) wildtype, E. coli BL-21 (DE3) cells carrying hydA2-pPMQAK1 and MatCr-pSB1AC3 as well as E. coli BL-21 (DE3) cells carrying hydA2+fd-pPMQAK1 and MatCr-pSB1AC3 was measured using gas chromatography.
(-' !"#$%&')' !"#$%&'(' 0### (,' !"#$%&')' ./ (+' ,- + ()' (*' !"#$%&'(' -'
!"#$%&'()*# ,' +' )' *' ./%0'12$&' 3204)5$67849(' 3204)>?05$67849(' 7"1:;5$!<(4:=' 7"1:;5$!<(4:=' 1'2*34563*# Figure 4-Column chart showing the rate of hydrogen evolution (μmoles⋅ OD-1) when expressing HydA2 and HydA2+fd with pPMQAK1 and correct maturation system with pSB1AC3 in E. coli BL21 (DE3)cells.
No hydrogen evolution was detected from the wildtype strain. However E. coli BL-21 (DE3) cells carrying hydrogenase and maturation system constructs produced hydrogen. Cells carrying the hydA2 construct and maturation system produced 8.2 μmoles⋅OD-1 (sample 1) and 15.7 μmoles⋅OD-1 (sample 2), an average of 11.96 μmoles⋅OD-1 hydrogen was produced from cells carrying the hydA2 construct and maturation system. Cells carrying the hydA2+fd construct and maturation system produced 15.2 μmoles⋅OD-1 (sample 1) and 14.8 μmoles⋅OD-1 (sample 2), which is an average hydrogen production 15 μmoles⋅OD-1.
11 2.2 Test hydrogen electrode measurements Directly after measuring the hydrogen in the gas phase of the above cultures containing hydA2 or hydA2+fd constructs on the pPMQAK1 plasmid and maturation system construct on pSB1AC3 with the GC, the hydrogen production was measured using a hydrogen electrode. 100 μL of culture was added to 900 μL of LB medium in the electrode chamber. The medium contained 20 mM glucose, 1 mM IPTG, 50 μg/ml kanamycin and 50 μg/ml chloramphenicol. The hydrogen production of each culture was measured for 8 minutes in the hydrogen electrode.
Figure 5a-Hydrogen production rate of E. coli Figure 5b-Hydrogen production rate of E. coli BL-21 (DE3) cells carrying hydA2-pPMQAK1 BL-21 (DE3) cells carrying hydA2+fd-pPMQAK1 and MatCr-pSB1AC3. and MatCr-pSB1AC3.
The above igures show the recorded output from the hydrogen electrode. The hydrogen production rate was calculated from the slopes (colored red) of increasing hydrogen concentration. Other artifacts in the igures, such as decreasing hydrogen concentration, sharp peaks of signal and large deviations in signal are to be disregarded since they are the result of calibration, removal and addition of sample or signal noise. Figure 5a shows that E. coli BL-21 (DE3) carrying hydA2-pPMQAK1 and MatCr-
-1 -1 pSB1AC3 produced 2.95 H2[nmoles]⋅min (sample 1) and 7.13 H2[nmoles]⋅min
-1 (sample 2), an average of 5.04 H2[nmoles]⋅min .
12 Figure 5b shows that E. coli BL-21 (DE3) carrying hydA2+fd-pPMQAK1 and
-1 MatCr-pSB1AC3 produced 6.72 H2[nmoles]⋅min (sample 1) and 4.13 H2
-1 -1 [nmoles]⋅min (sample 2), an average of 5.43 H2[nmoles]⋅min .
2.3 Growth characterization and hydrogen evolution measurement using hydrogen electrode This experiment was designed to provide more information about the hydrogen production as well as how the environmental conditions change during growth. The pH in the medium was measured at the beginning and end of inoculation. OD and glucose concentration was measured every 30 minutes. All this information was combined with the recorded output from the hydrogen electrode and illustrated in igure 6.
Figure 6-The igure shows how hydrogen is produced during cell growth, as well as showing how glucose is consumed.
The above igure ( igure 6) shows how the hydrogen concentration in the medium starts to increase after about 45 minutes. Hydrogen is then steadily produced and the hydrogen concentration increases as the culture grows, this phase is clearly seen in the igure as almost a linear slope, where 2.21 H2 [μmoles]⋅OD -1 ⋅min -1 is produced. There is a steady increase in hydrogen
13 concentration for about 100 minutes, until the increase in concentration slows down very quickly, lattens out and then decreases. The concentration of glucose decrease steadily through the whole experiment, but at the end of the experiment there are still about 8-9 mM glucose left. During this experiment the culture grew from OD=0.1 to OD≤1.3 in 270 minutes and in that time the pH changed from 6.5 to 5.25.
2.4 Protein extraction, separation and Western Blotting For verifying the presence of HydA2 proteins in E.coli BL-21 (DE3) cells carrying hydA2-pPMQAK1 or hydA2+fd-pPMQAK1 and MatCr-pSB1AC3 the proteins were extracted from the cells . The extracted proteins were then separated by SDS- PAGE and then stained using Coomassie Blue or used for Western Blotting.
Figure 7-This SDS-PAGE gel shows the separation of proteins from E. coli BL-21 (DE3) cultures containing two different [FeFe] hydrogenase constructs.
The coomassie stained SDS-PAGE gel seen above shows that the amount of protein is similar for all samples containing the different constructs. Two strong bands are observed between 35-55 kDa, one band ≈50 kDa and the other ≈40 kDa. However in the E. coli BL-21 (DE3) wildtype sample small bands are found at similar position in the gel as the bands observed from cells containing the constructs.
14 Figure 8-Western Blot analysis of protein extract from E. coli BL-21 (DE3) carrying hydA2, hydA2+f and MatCr constructs as well as wildtype.
The Western Blot analysis shows a ≈27 kDa band in all samples, even the wildtype sample and is therefore considered to be a result of some unspeci ic binding of antibodies. One sample containing hydA2 and MatCr constructs gave only very faint bands at ≈50 kDa and ≈40kDa, while all other three samples gave strong bands at ≈50 kDa and ≈40kDa. Samples containing hydA2+fd construct showed faint bands at ≈60 kDa. Expected size of HydA2 is 49 kDa and the expected size of HydA2+fd is 59 kDa (49+10 kDa).
2.5 Discovering damage to broad-host-range vector pPMQAC1 For successful expression of [FeFe] hydrogenase and maturation system constructs with plasmids in cyanobacterial strains such as Synechocystis PCC 6803 broad host-range-vectors are needed. [FeFe] hydrogenase and maturation system constructs have to date, not been combined on one single vector due to the size of the resulting vector (>12-13 kb). Two broad-host-range vectors are therefore needed to express [FeFe] hydrogenase and maturation system constructs, pPMQAK1 and pPMQAC1. However, when starting to work with the pPMQAC1 vector, an observation was made after running an agarose gel where the digestion pattern of pPMQAC1 carrying MatCr construct was analyzed. The size of pPMQAC1 was a long way from being correct. The expected size of pPMQAC1 is ≈7,5 kb without any insert in the BioBrick site and with the maturation system construct (MatCr) in the BioBrick site ( igure 7) the total size should be ≈13 kb.
15 As shown in igure 7 the total size of pPMQAC1 carrying MatCr when linearized with EcoRI is only ≈5 kb. When the insert is cut out of the BioBrick site using XbaI and SpeI one band of ≈3,5 kb and one ≈1,75 kb are observed. All available physical DNA constructs and glycerol stocks containing pPMQAC1 were analyzed in the same way. All pPMQAC1 vectors gave a similar digestion result as shown in igure 7. After analyzing all sources of pPMQAC1 the use of this vector was stopped.
Figure 9-Middle: MatCr- pPMQAC1 linearized with EcoRI to see total size. Right: Insert cut out of pPMQAC1 using XbaI and SpeI.
2.6 Construction of new broad-host-range vectors After making sure that pPMQAC1 was not working properly, the project strategy was changed. The main project goal now became to build new and improved broad-host-range vectors. The new vectors should have only one antibiotic resistance cassette, kanamycin, chloramphenicol or ampicillin (instead of two on pPMQAK1 and pPMQAC1). The new vectors should all contain the RSF1010 replicon for replication in a wide range of bacterial hosts. The construction of the new vectors was at irst done in BioBrick vectors (pSB1A3, pSB1K3, pSB1AC3 and pSB1AK3), and later in a BioBrick base vector (BBa_I51020). The following broad-host-range vectors were to be constructed:
Table 4-Broad-host-range BioBrick shuttle vectors to be constructed Constructs Parts
pPMQA1 RSF1010 replicon, BBa_P1002 (Ampr), BBa_I51020
pPMQK1 RSF1010 replicon, BBa_P1003 (Kanr), BBa_I51020
pPMQC1 RSF1010 replicon, BBa_P1004 (Cmr), BBa_I51020
16 The RSF1010 replicon was obtained by PCR using PrimeSTAR HS DNA Polymerase with RSF1010-BB-f and RSF1010-BB-r primers containing the pre ix and suf ix (BioBrick restrictions sites). For the PCR pPMQAK1 was used as template, since it contains the RSF1010 replicon.
Figure 10-PCR reactions containing RSF1010-f and RSF1010-r speci ic primers do not give any product. However using RSF1010-BB-f and RSF1010-BB-r primers give the right sized product (5,3 kb).
Only when using RSF1010-BB primers PCR product of the right size of 5,3 kb is observed. At irst, after amplifying the replicon, PCR reactions were pooled together and digested with EcoRI and PstI (allowing ligation into BioBrick vectors later). The digestion reaction was then loaded on a 0.8% agarose gel and puri ied with electrophoresis. The band corresponding to the RSF1010 replicon was cut out of the gel and the DNA puri ied using a gel extraction kit. This process however always resulted in very low concentrations of DNA (<6 ng/μL) which made its application for ligation reactions dif icult. Numerous attempts were made to ligate the RSF1010 replicon into BioBrick vectors (pSB1A3, pSB1K3, pSB1AC3 and pSB1AK3) with/without an additional antibiotic cassette ligated to the RSF1010 replicon (for better selection of positive colonies) but all trials failed, or resulted in false positives. False positives would after PCR give bands of the wrong size or faint bands, which when the restriction pattern was analyzed gave wrong fragment sizes, or even showed that restriction sites were missing.
17 Figure 11-Examples of false positives digested with EcoRI and PstI. Left: One thick band (≈8,5 kb) means one restriction site is missing. Middle: Shows the pSB1A3 backbone (2,2 kb) and chloramphenicol cassette (769 bp), RSF1010 not present. Right: Shows the pSB1AC3 backbone (3 kb) and kanamycin cassette (967 bp), RSF1010 not present.
After being unsuccessful with ligating the RSF1010 replicon into BioBrick vectors the strategy was changed. Instead of trying to ligate the replicon irst into pSB1_3 BioBrick vectors, the RSF1010 replicon was to be ligated straight into the BioBrick base vector (BBa_I51020). The ampicillin cassette already present on the base vector sits in between two NheI restriction sites and can therefore be replaced. The ampicillin was replaced with a chloramphenicol cassette. This step was necessary, as the RSF1010 replicon PCR products (containing pPMQAK1 as template) had to be used directly (after restriction with appropriate enzymes) for ligation reactions due to low recovery of RSF1010 replicon DNA after gel puri ication. When the RSF1010 replicon was ligated into the BioBrick site of the base vector it replaced the high copy number replicon and ccdb “death gene” (BBa_P1010) originally sitting together in the BioBrick site of the base vector for facilitating selection of positive clones.
18 This strategy however also only resulted in false positives, where colony PCR showed that the insert present in the BioBrick site of the base vector was not the size of the RSF1010 replicon (Figure 10). Restriction analysis also showed incorrect fragment size (Figure 11).
Figure 13-Restriction (cut with EcoRI and PstI)
analysis of plasmids from false positives. Restriction Figure 12-Colony PCR results. All pattern was the same for all plasmids, ≈3 kb and observed bands are ≈1,3kb but expected 850bp bands. size was ≈5,3 kb.
19 3 Discussion
3.1 [FeFe] hydrogenase expression in E. coli and characterization of consequent hydrogen production. Genetic constructs containing [FeFe] hydrogenases, hydA2 and hydA2+fd (linked with ferrodoxin) and their maturation system from C. reinhardtii were expressed in E. coli BL-21 (DE3). The broad-host-range vector pPMQAK1 was used to express hydrogenase constructs while pSB1AC3 was used to express the maturation system. Hydrogen measurements were done using gas chromatography and Clark type hydrogen electrode. The measurements clearly showed that the [FeFe] hydrogenase constructs were working. No hydrogen production was measured coming from E. coli BL-21 (DE3) wildtype, while cells containing the hydrogenase and maturation system constructs were able to produce hydrogen. There was a slight difference in average hydrogen production between cells containing hydA2 and those containing hydA2+fd constructs, where cells containing hydA2+fd produced more hydrogen. This was the case when measured with GC as well as with hydrogen electrode. The difference is however not big enough to draw any conclusions about the hydA2+fd construct being more productive when it comes to hydrogen production. The fact that there was a large difference in hydrogen production between the cultures that contained hydA2 constructs suggests that the cultures did not grow similarly. The other cultures containing hydA2+fd construct however produced similar amounts of hydrogen. Higher number of replicates should have been done to ensure that these large deviations could have been avoided.
3.2 Conformation of [FeFe] hydrogenase expression in E. coli When analyzing the Western Blot results, bands corresponding to the expected sizes were observed. From samples containing hydA2 constructs a band was observed at ≈50 kDa which corresponds well to the expected size of HydA2, 49 kDa. This band was however also observed in samples containing hydA2+fd constructs which was unexpected since the expected size of hydA2+fd is 59 kDa. Faint bands corresponding to the right size of 59 kDa were though also observed in these samples. Though having observed bands corresponding to the expected
20 sizes, the result is far from being optimal. The low strength of bands in one of the samples containing hydA2 construct suggests that the amount of [FeFe] hydrogenase enzyme is less than in the other samples. The lesser amount of enzyme would then explain the lower production of hydrogen that was observed from this culture when measured with GC and hydrogen electrode. A strong signal is seen at ≈27 kDa in all samples, including the wildtype sample not containing any hydrogenase constructs. This strong signal in wildtype is most likely due to unspeci ic binding of the antibody to some other protein that is found in the E. coli BL-21 (DE3) wildtype stain.
3.3 Construction of broad-host-range vectors Probably the most important and at the same time inconvenient observation that was made during this project was inding out that one of the broad-host-range vectors was “damaged”. This observation could possibly explain why the expression of [FeFe] hydrogenase constructs (on pPMQAK1) and maturation systems (on pPMQAC1) in cyanobacteria e.g. Synechocystis PCC 6803 did not resulted in hydrogen production. The “damaged” pPMQAC1 vector might not be able to express the maturation system as it should, and therefore the [FeFe] hydrogenase not be matured, and as a result of that no hydrogen is produced. Why pPMQAC1 was “damaged” is unknown, it possible that a recombination event (due to homologous promotor sequences) happened somewhere in the construction process of the vector, and as a result a part of the vector was lost. The construction of new broad-host-range vectors was initiated so that hydrogenase constructs and maturation systems constructs could be expressed on two different vectors. The goal was to construct three broad-host-range vectors under the working names: pPMQA1, pPMQK1 and pPMQC1. The new vectors should consist of the RSF1010 replicon (ampli ied from pPMQAK1), one of three antibiotic cassettes available (ampicillin, kanamycin or chloramphenicol) and a BioBrick base vector (BBa_I51020). Since the RSF1010 replicon is quite large (5,3 kb) and has high GC-content, it took some time before good PCR products were obtained. The RSF1010-f and -r speci ic primers designed for amplifying the RSF1010 replicon did not work. The reason why the primers did not work is unknown, but it could be that the wrong
21 sequences were synthesized, though that must be considered highly unlikely. The RSF1010-BB-f and -r primers however worked well and gave the right sized product. The ligation of the RSF1010 replicon into BioBrick vectors with/ without antibiotic cassettes proved to be highly problematic and did not result in a successful construct. When the insertion of RSF1010 replicon with antibiotic cassettes into BioBrick vectors failed, the strategy was changed. The reason for this to fail might be that it is problematic to have two replicons (one high copy number and one low copy number) on the same plasmid. Instead of ligating the RSF1010 replicon and antibiotic cassettes together inside BioBrick vectors, an attempt was made to irst ligate the RSF1010 replicon directly into the BioBrick base vector. That however only resulted in false positives though measures such as exchanging the ampicillin cassette out for a chloramphenicol cassette were taken to prevent that from happening. The false positives are however most likely due to the ligation of the wrong fragment into the BioBrick site, because RSF1010 replicon PCR product (cut with E & P) was used for the ligation reaction. This unknown fragment could have been ampli ied in the PCR reaction (though it was not detected on agarose gels) and since the vector is able to replicate in E. coli, it must contain at least a part of the RSF1010 replicon.
Though I was unable to inish the construction of these broad-host-range vectors this work will hopefully be continued.
22 4 Materials and methods
4.1 Bacterial strains, plasmids and primers The bacterial strains that were used in this project are listed in table 1. Table 1-Bacterial strains Strain Genotype Supplier
– - Escherichia coli BL21 F ompT gal dcm lon hsdSB(rB - New England Biolabs (DE3) mB ) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) - Escherichia coli DH5-α F endA1 glnV44 thi-1 recA1 Invitrogen relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF) - + U169, hsdR17(rK mK ), λ– Escherichia coli NEB5-α huA2 Δ(argF-lacZ)U169 phoA New England Biolabs glnV44 Φ80Δ (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 - - - Escherichia coli HB101 F mcrB mrr hsdS20(rB mB ) Promega recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20 (SmR) glnV44 λ- Synechocystis sp. PCC Wildtype Pasteur Culture 6803 Collection
Plasmids used in this project are listed in table 2.
Table 2-Plasmids Strain Relevant characteristics Reference or supplier
pSB1A1 Derived from pUC19, Ampr, carrying antibiotic resistance [48] coding BioBricks: BBa_P1002(ampicillin), BBa_P1003 (kanamycin) and BBa_P1004 (chloramphenicol)
pSB1A3 Derived from pUC19, high copy number BioBrick assembly Registry of Standard plasmid, Ampr Biological Parts
pSB1K3 Derived from pUC19, high copy number BioBrick assembly Registry of Standard plasmid, Kanr Biological Parts
pSB1C3 Derived from pUC19, high copy number BioBrick assembly Registry of Standard plasmid, Cmr Biological Parts
pSB1AK3 Derived from pUC19, high copy number BioBrick assembly Registry of Standard plasmid, Ampr, Kanr Biological Parts
pSB1AC3 Derived from pUC19, high copy number BioBrick assembly Registry of Standard plasmid, Ampr, Cmr Biological Parts
BBa_I51020 BioBrick base vector used to construct new BioBrick vectors Registry of Standard from BioBrick parts, derived from pMB1, Ampr, carries Biological Parts BBa_I512002 BioBrick.
pPMQAK1 Broad-host-range vector derived from pAWG1.1, RSF1010 [46] replicon, Ampr, Kanr
23 Primers used in this project are found in table 3. Table 3-Primers Name Sequence (5´ to 3´) Description
VF2 TGCCACCTGACGTCTAAGAA Forward primer to amplify BioBrick plasmid inserts
VR ATTACCGCCTTTGAGTGAGC Reverse primer to amplify BioBrick plasmid inserts
RSF1010-f GAACCCCTGCAATAACTGTCACGC Forward primer for ampli ication of RSF1010 replicon
RSF1010-r CCTGCTAATTGGTAATACCATGGT Reverse primer for ACCG ampli ication of RSF1010 replicon
RSF1010- TATGAATTCGCGGCCGCTTCTAG Forward primer for BB-f AGGAACCCCTGCAATAACTGTCAC ampli ication of RSF1010 GC replicon that adds BioBrick pre ix and suf ix (in bold)
RSF1010- CCTGCTAATTGGTAATACCATGGT Reverse primer for BB-r ACCGTACTAGTAGCGGCCGCTGC ampli ication of RSF1010 AGTAT replicon that adds BioBrick pre ix and suf ix (in bold)
4.2 Growth media LB and SOC medium were used for E. coli cultivation. LB was prepared in the
following way: 1L = 10 g Bacto-tryptone, 5 g Bacto-yeast extract, 10 g NaCl, dH20 to 1L. For making LB agar 10g of agar is added to the LB medium recipe above. SOC medium was prepared in the following way: 1L = 20 g Bacto-tryptone, 5 g
Bacto-yeast extract, 0.584 g NaCl, 0.186 g KCl, 1.9 g MgCl2, 1.2 g MgSO4, dH20 to 1L. LB and SOC medium were autoclaved at 121°C for 20min. Before cultivation, glucose is added to 20mM and amount antibiotics used were as follows: 50 μg/ mL Kanamycin, 50 μg/mL Chloramphinicol and 100 μg/mL Ampicillin depending on the strains antibiotic resistance. Synechocystis cultures were grown on BG11 medium. BG11 was prepared in the
following way: 1.5 g NaNO3, 0.04 g K2HPO4, 0.075 g MgSO4·7H2O, 0.036 g
CaCl2·2H2O, 0.006 g citric acid, 0.006 g ferric ammonium citrate, 0.001 g EDTA,
0.02 g NaCO3, 1.0 mL trace metal mix and dH20 to 1L. For making BG11 agar 10g of agar is added to the BG11 medium recipe above. The trace metal mix was
24 prepared in the following way: 2.86 g H3BO3, 1.81 g MnCl2·4H2O, 0.222 g
ZnSO4·7H2O, 0.39 g NaMoO4·2H2O, 0.079 g CuSO4·5H2O, 49.4 mg Co(NO3)2·6H2O. BG11 medium was autoclaved at 121° C for 20 minutes.
4.3 Plasmid purification and cloning E. coli cultures used for plasmid isolation were grown overnight at 37°C and 250 rpm shaking. Puri ication and isolation of plasmids was normally done with GeneJETTM Plasmid Miniprep Kit (Fermentas), and the instruction protocol followed. After isolating plasmid the DNA concentration was measured with Cary 100 UV-Vis spectrophotometer (Varian Inc., now known as Agilent Technologies). Plasmid digestion was done at 37°C for 60min using FastDigestTM restriction enzymes (Fermentas). The restriction enzyme instruction protocols were followed in all steps other than concerning incubation time. The prolongation of incubation time was done to ensure total digestion of plasmid DNA. After digestion with restriction enzymes the digested DNA fragments were either puri ied with GeneJETTM PCR Puri ication Kit (Fermentas) or agarose gel electrophoresis using 0.8% agarose gels. If the kit is used, the instruction protocol is followed. The agarose gels were run in 1X sodium borate buffer (SB buffer) at 200 Volts for 20minutes. 1X SB buffer was prepared as follows: 1L SB buffer = 1.65 g boric acid, 1.9 g sodium borate decahydrate and dH20 up to 1L. After the separation of DNA fragments on a agarose gel the fragment of interest was cut out and puri ied using GeneJETTM Gel Extraction Kit (Fermentas) and the instruction protocol followed. The ligation of DNA fragments was carried out using Quick LigationTM Kit (New England Biolabs) and the instruction protocol followed. Methods used for ligation reactions were the conventional way of ligation and 3A assembly (three antibiotic assembly, is a very useful tool to ligate two inserts into a vector in one reaction, shown in igure 14). Figure 14-3A assembly [43].
25 When the ligation reaction is inished, the ligated construct is transformed into competent E. coli cells (DH5α). The competent cells were prepared according to OpenWetWare’s protocol on how to prepare TOP10 chemically competent cells. The CCMB 80 buffer needed for making competent cells was prepared in the
following way: 10 mM KOAc pH 7.0, 80 mM CaCl2·2H2O (11.8 g/L), 20 mM
MnCl2·4H2O (4.0 g/L), 10 mM MgCl2·6H2O (2.0 g/L), 10% glycerol (100 ml/L), the pH is then inally adjusted down to 6.4 and stored at 4°C. After making competent cells they are divided into 2 mL Eppendorf tubes, 100 μL of cells are aliquoted into each tube and than stored at -80°C. Ligated constructs were transformed into competent E. coli cells in the following way: 100 μL of competent cells were thawed on ice for 5 minutes. Than 2-5 μL of ligation reaction were mixed with competent cells and cooled on ice for another 30 minutes. Next the cells cells are heat shocked for 50 seconds at 42°C, then immediately cooled down on ice for 5 minutes. 900 μL of room temperate LB medium was then added to the tube and incubated for 1 hour at 37°C and 250 rpm. After incubation the cells were centrifuged for 5 minutes at 5000 x g. 900 μL of the supernatant was than discarded and the cell pellet resuspended in the medium that’s left in the tube. The cells are then plate on to LB agar plate that contains the appropriate antibiotic (50μg/ml Kanamycin or/and 50μg/ml Chloramphenicol or/and 100μg/ml Ampicillin) and incubated at 37°C overnight.
4.4 Hydrogen measurements Hydrogen evolution of available constructs in E.coli BL-21 (DE3) were measured using gas chromatography and hydrogen electrode.
4.4.1 Hydrogen electrode setup The electrode used for hydrogen measurements consisted of a CB1-D control box and a S1 electrode disc (Hansatech). The control box was set to “HYDROGEN” setting, then the platinum and silver electrodes were electroplated. Before electroplating the platinum electrode it was cleaned for 10 minutes with a drop of Aqua Regia solution (4 parts H2O, 3 parts 12 M HCl and 1 part 16 M HNO3) and then washed of with deionized water. A platinum-tipped wire connected to the electroplating device was used for electroplating the platinum electrode. The
26 device was set to “platinum” setting and 0.3V ). A drop of 2 M H2SO4 was pipetted on top of the platinum electrode and the platinum-tipped wire inserted into the
drop. The electroplating was then turned on for 10 minutes. The H2SO4 drop was gently washed of with deionized water. A drop of 2 % chloroplatinic acid was pipetted on top of the platinum electrode and the platinum-tipped wire inserted into the drop. Electroplating device was than switched on for 1 hour. After inishing this step the platinum electrode was gently washed with deionized water and carefully dried to not disrupt the platinum black layer that had been created. The instruction manual for electrode preparation and maintenance provided by Hansatech was followed after completing the above steps.
4.4.2 Gas chromatography measurements Hydrogen production measurements using Gas Chromatography were done using E.coli BL-21 carrying [FeFe] hydrogenase (hydA2) constructs from C. reinhardtii, with and without a coupled ferrodoxin (fd) and the C. reinhardtii hydrogenase maturation system, MatCr (hydEF and hydG). The hydrogenase constructs were expressed in the broad-host-range vector pPMQAK1 under Trc1 promoter and maturation system constructs expressed in a high copy number BioBrick plasmid, pSB1AC3 under Trc2 promoter. These constructs had already been constructed by former master students, Thiyagarajan Gnanasekaran and Sean M. Gibbons. The following constructs were tested of hydrogen production:
Table 2-Constructs used for hydrogen measurements with GC E. coli strain Hydroganase construct Maturation system construct in pPMQAK1 in pSB1AC3
BL-21 (DE3) wt
BL-21 (DE3) Trc1HydA2 Trc2MatCr
BL-21 (DE3) Trc1HydA2+fd Trc2MatCr
Cells carrying the above constructs were picked from available glycerol stocks and grown overnight in 6 mL of LB medium containing 20mM glucose, 50μg/ml kanamycin and 50μg/ml chloramphenicol for selection of both plasmids. The wild type strain was grown overnight in 6 mL of LB medium containing 20mM glucose. After overnight cultivation the optical density (OD) of cultures was
27 measured at 595 nm using Cary 100 UV-Vis spectrophotometer (Agilent Technologies). The initial OD was then adjusted to 0.1 by diluting cultures in LB medium containing 20mM glucose, 1mM IPTG, 50μg/ml kanamycin and 50μg/ml chloramphenicol. Duplicates of each culture were made. 5mL of each culture was transferred into a sterile gas tight glass vials and sealed with rubber septa (Chromacol Ltd). Cultures were made anaerobic by lushing them with argon for 10 minutes. The anaerobic cultures were then incubated in 37°C at 250 rpm for 3 hours. After three hours of incubation the OD of the culture was measured and the amount of hydrogen in the gas phase measured using Clarus 500 Gas Chromatograph (Perkin Elmer). 50 μL sample was taken from the gas phase with a gas tight syringe and injected into the GC. The GC signal output was recorded by LCI-100 Computing Integrator (Perkin Elmer).
4.4.3 Test hydrogen electrode measurements The Directly after measuring the hydrogen evolution of the cultures on the GC, they were inoculated in the hydrogen electrode chamber to measure the real time hydrogen evolution. 900 μL of LB medium containing 20 mM glucose, 1mM IPTG, 50μg/ml kanamycin and 50μg/ml chloramphenicol was pipetted into the electrode chamber. Before adding culture to the medium in the chamber one had to wait until voltage deviation stopped and the output graph had reached a steady baseline. When a steady baseline was reached 100μL of culture was added to the medium and inoculated in the hydrogen electrode chamber for 8 minutes. During the incubation time the output from the hydrogen electron was recorded.
4.4.4 Growth characterization and hydrogen evolution measurement using hydrogen electrode For this experiment E.coli BL-21 (DE3) carrying the hydA2 [FeFe] hydrogenase construct on pPMQAK1 and the maturation system (MatCr) on pSB1AC3 was used. Cells were picked form glycerol stock, inoculated and grown overnight in LB medium containing 20 mM glucose, 50μg/ml kanamycin and 50μg/ml chloramphenicol. After growing the culture overnight, 900 μL of LB medium containing 20 mM glucose, 1mM IPTG, 50μg/ml kanamycin and 50μg/ml
28 chloramphenicol was pipetted into the hydrogen electrode chamber and lushed with argon for 10 minutes. After lushing the medium 100 μL of culture was added to the medium. The incubated culture was lushed for additional 5 minutes to ensure anaerobic conditions. Initial OD was measured using spectrophotometer, initial pH was measured with pH electrode and initial glucose concentration was measured with a glucose meter (Accu-chek Aviva, Roche). The culture was grown in the hydrogen electrode chamber for 270 minutes. During the time of incubation OD and glucose concentration was measured every 30 minutes, hydrogen concentration was recorded once every minute and the pH of culture at the end of cultivation measured.
4.5 SDS-PAGE First proteins were extracted from bacterial cultures. Cultures were pipetted into eppendorf tubes centrifuged for 5minutes at 12.000 x g (equal amounts of cell from each culture). The supernatant was discarded and 100 μL 1X SDS- loading buffer used to resuspend the cell pellet. Tubes were then vortexed for 1 minute and incubated at 95°C for 10 minutes to lyse the cells. Protein extract samples were run in SDS-PAGE (Sodium dodecyl sulfate polyacrylamide gel electrophoresis). A 12% acrylamide separating gel was used
and prepared in the following way: 3.35 mL dH20, 2.5 mL 1.5 M Tris-HCl pH 8.8, 100 μL 10% SDS, 4.0 mL acrylamide/bis mix (37.5:1), 50 μL 10% ammonium persulfate and 5 μL TEMED. The separating gel was added to the trey and allowed to polymerize. A 4% stacking gel was then prepared in the following way: 3.05 mL dH20, 1.25 mL 0.5M Tris- HCl pH 6.8, 50 μl 10% (w/v) SDS, 665 μL acrylamide/bis mix (37.5:1), 25 μL 10% ammonium persulfate, and 5 μL TEMED. The stacking gel was added to the trey, on top of the separating gel, a 10 well comb inserted and allowed to polymerize. 4X SDS sample loading buffer was
prepared in the following way: 3.8 mL dH20, 1.0 mL 0.5 M Tris-HCl pH 6.8, 0.8 mL glycerol, 1.6 mL 10% (w/v) SDS, 0.4 mL 2-mercaptoethanol, and 0.4 mL 1% (w/v) bromophenol blue. 5X running buffer stock was prepared in the following way: 9 g Tris base, 43.2 g glycine, 3 g SDS and dH20 up to 600 mL. 1X running buffer was added into the gel electrophoresis trey.
29 10 μL of sample-SDS loading buffer mixture was added to each well and 4 μL of PageRuler™ Plus pre-stained protein ladder (Fermentas) was added on both ends of the gel. Gels were run at 45mA for 1 hour or until the loading dye reached the bottom of the gel.
4.6 Western blotting When the SDS-PAGE was inished the proteins in the gel were blotted onto Amersham™ Hybond™ ECL membrane (GE Healtcare). The blotting was done overnight at 60mA or 17V in a TE 22 tranfer tank (GE Healthcare) containing 1X transfer buffer. 1X transfer buffer was prepared in the following way: 3.03 g Tris
base, 14.41 g glycine, 800 mL dH20 and 200 mL methanol. Membrane blocking was done by using 1X Tween (0.1%) TBS (50 mM Tris-HCl pH 7.4, 150 mM NaCl) mixed with 5% skim milk powder (Sigma) for 2 hours. After membrane blocking, primary antibody hybridization was done by adding polyclonal rabbit anti-hydA2 antibodies (Agrisera) diluted 1:5000 in 1X Tween- TBS and shaken for 1.5 hours. The membrane was than washed three times with T-TBS for 10 minutes each time. Secondary antibodies, anti-rabbit -IgG antibodies conjugated to horseradish peroxide, HRP (GE Healthcare) diluted 1:5000 in T-TBS were added and shaken for 1.5 hours. After blotting the membrane it was placed on a plastic ilm and developed with Immun-Star™ HRP Chemiluminescence Kit (Bio-Rad) and instuctions followed. The blot was visualized by using Chemidoc instrument (Bio-Rad) with Quantify One software (Bio-Rad). First instrument was set to “Epi White” setting and a picture taken of the pre-stained ladder. Then the instrument was set to “Chemiluminescence” setting with exposure time set to 30 minutes to record the luorescence emitted from HRP. Pictures were then superimposed using the software.
4.7 Protein staining SDS-PAGE gels were stained using 1X Coomassie blue staining solution that was prepared as follows: 2.5 g Coomassie dye, 500 mL methanol, 400 mL dH20 and 100 mL glacial acetic acid. The gel was put in an empty pipette box, soaked in 1X Coomassie staining solution, heated to almost boiling in a microwave and put on
30 a rocker for 10 min. The heating in microwave and rocking was repeated 3 times.
The gel was then rinsed with dH20 and destained in dH20 for 2 hours.
4.8 Polymerase chain reactions (PCR) Colony PCR reactions (20 μL) were prepared in the following way: 2 μL Dream Taq buffer (Fermentas), 0.4 μL dNTP Mixture (10 mM of each) (Fermentas), 0.2 μL Dream Taq Polymerase (Fermentas), 1 μL forward primer (10mM), 1 μL
reverse primer (10mM), 1 μL template and 14.4 μL dH20. When preparing the template, one colony was picked from LB agar plate and resuspended in 10 μL of LB medium. The program used for running the PCR thermocycler was as follows: 1) Initial denaturation of DNA, 95°C for 3 minutes. 2) Denaturation, 95°C for 30 seconds. 3) Anealing, 55°C for 30 seconds. 4) Elongation, 72°C for 1min/kb. 5) Steps 2-4 were repeated 30-35 times. 6) Final elongation, 72°C for 5-15 minutes. 7) Hold at 4°C forever. Plasmid DNA (0.01-1 ng) can also be used as template for this PCR reaction. Colonies that gave positive results were grown overnight in SOC medium supplemented with appropriate antibiotics. After cultivation, plasmid was isolated from cell with GeneJETTM Plasmid Miniprep Kit (Fermentas). When amplifying the RSF1010 replicon from pPMQAK1 plasmid, the PCR reaction (50 μL) was prepared in the following way: 10 μL 5X PrimeSTAR Buffer (Mg2+Plus) (Takara), 1 μL dNTP Mixture (10mM of each) (Takara), 0.5 μL PrimeSTAR HS DNA Polymerase, 1 μL forward primer (RSF1010-BB-f, 10mM), 1 μL reverse primer (RSF1010-BB-r, 10mM), 2 μL pPMQAK1 plasmid as template and 34.5 μL dH20. The following thermocycler program was used: 1) Initial denaturation of DNA, 98°C for 3.5 minutes. 2)Denaturation, 98°C for 10 seconds. 3) Elongation, 68°C for 6 minutes. 4) Steps 2-3 were repeated 35 times. 5) inal elongation, 68°C for 10 minutes. 6) Hold at 4°C forever. When the PCR reactions were inished the result was analyzed on a 0.8% agarose gel by loading 2 μL of reaction mixture and 1 μL 10X Fast Digest Green Buffer (Fermentas) together. For determining band sizes, 1 kb DNA ladder (Fermentas) was used. The band was cut out from the gel and the fragment isolated using GeneJETTM Gel Extraction Kit (Fermentas).
31 4.9 Construction of new broad-host-range vectors The RSF1010 replicon PCR product with added BioBrick pre ix and suf ix restriction sites was digested with XbaI (X) and PstI (P) restriction enzyme to enable ligation into different BioBrick vectors and with different antibiotic resistance cassettes. The RSF1010 replicon was ligated with pSB1AK3-P1010 that had been digested with the same restriction enzymes. The resulting construct, pSB1AK3-RSF1010 was transformed into competent E. coli cells (DH5α) and grown overnight on a LB agar plate containing 50 μg/mL kanamycin for selection of positive clones. 3A assembly was used to ligate pSB1A1-BBa_P1002, pSB1A1-BBa_P1003 or pSB1A1-BBa_P1004 (cut with E and S), RSF1010 replicon (cut with X and P) and pSB1K3-P1010, pSB1AC3-P1010 or pSB1AK3 (cut with E and P). The resulting constructs, pSB1K3-BBa_P1002-RSF1010, pSB1AC3-BBa_P1003-RSF1010 and pSB1AK3-BBa_P1004-RSF1010 were transformed into competent E. coli cells (DH5α) and grown overnight on a LB agar plates containing two kinds of antibiotics, depending on the construct. Kanamycin (25 μg/mL) and ampicillin (100 μg/mL) were used to select for pSB1K3-BBa_P1002-RSF1010. Kanamycin (25 μg/mL) and chloramphenicol (25 μg/mL) were used to select for pSB1AC3- BBa_P1003-RSF1010. Kanamycin (25 μg/mL) and chloramphenicol (25 μg/mL) were used to select for pSB1AK3-BBa_P1004-RSF1010. Colony PCR was done on positive colonies to verify the presence of the right construct, restriction analysis was also done for seeing fragment sizes and if restriction sites were working properly. When the above measures did not result in correct constructs the BioBrick base vector, BBa_I51020 was digested with NheI restriction enzymes to remove the ampicillin cassette found on the vector. The fragments were separated with electrophoresis in a 0.8% agarose gel for 20 minutes at 200V. The fragment corresponding to the vector backbone was then cut out from the gel and puri ied with gel extraction. The BioBrick base Figure 15-BBa_I51020, BioBrick base vector [43].
32 vector backbone was ligated with a puri ied chloramphenicol cassette that had been cut with XbaI and SpeI (which leave sticky ends complementary to those formed by NheI (N) restriction). The ligation reaction was transformed into E. coli cells (DH5α) and grown overnight on LB agar plate containing 50 μg/mL chloramphenicol. After overnight incubation colonies were picked, inoculated in SOC medium containing 50 μg/mL chloramphenicol and grown overnight. After overnight incubation the modi ied BioBrick base vector was puri ied from the culture using a Plasmid miniprep kit. Now instead of ligating the RSF1010 replicon into any of the BioBrick vector previously used, an attempt was made to ligate RSF1010 replicon PCR product that have been digested with EcoRI and PstI directly into the BioBrick site of the modi ied BioBrick base vector (contains chloramphenicol cassette). The modi ied BioBrick base vector was digested EcoRI and PstI, which removes the BBa_I512002 BioBrick (high copy replicon and ccdB gene) found in the BioBrick site. The ligation reaction was transformed into E. coli cells (DH5α) and grown overnight on LB agar plate containing 50 μg/mL chloramphenicol. Colony PCR was done on positive colonies to verify the presence of the right construct, restriction analysis was also done for seeing fragment sizes and if restriction sites were working properly.
33 5 Acknowlegements
First I would like to give special thanks to Professor Peter Lindblad and Dr. Thorsten Heidorn for giving me the opportunity to conduct exciting research and be apart of their research group at the Department of Photochemistry and Molecular Science, Uppsala University.
I would also like to give special thanks to PhD students Daniel Camsund and Hsinho Huang, as well as Dr. Paulo Olivera for always providing good advise and for inspiring me with their competence.
My classmate, co-worker and friend Johan Andersen-Ranberg I want to thank for his input, advise and hard work throughout this project. I also want to wish him good luck with his PhD studies in Denmark.
Finally I would like to thank the whole Cyano group for providing me with a good working environment. It was a real pleasure being apart of the group!
34 References
1.! Kleiner, K., Peak energy: promise or peril? 2009(0903): p. 31-33. 2.! Meinshausen, M., et al., Greenhouse-gas emission targets for limiting global warming to 2°C. Nature, 2009. 458(7242): p. 1158-1162. 3.! IEA, World Energy Lookout 2010. World Energy lookout2010, Paris: International Energy Agency. 650. 4.! Makarieva, A.M., V.G. Gorshkov, and B.-L. Li, Energy budget of the biosphere and civilization: Rethinking environmental security of global renewable and non-renewable resources. Ecological Complexity, 2008. 5(4): p. 281-288. 5.! Züttel, A., et al., Hydrogen: the future energy carrier. Philosophical Transactions of the Royal Society A: Mathematical, Physical and Engineering Sciences, 2010. 368(1923): p. 3329-3342. 6.! Lior, N., Energy resources and use: The present (2008) situation and possible sustainable paths to the future. Energy. 35(6): p. 2631-2638. 7.! Nelson, N., Photosystems and global effects of oxygenic photosynthesis. Biochimica et Biophysica Acta (BBA) - Bioenergetics. In Press, Corrected Proof. 8.! Tamagnini, P., et al., Hydrogenases and Hydrogen Metabolism of Cyanobacteria. Microbiol. Mol. Biol. Rev., 2002. 66(1): p. 1-20. 9.! Meher Kotay, S. and D. Das, Biohydrogen as a renewable energy resource--Prospects and potentials. International Journal of Hydrogen Energy, 2008. 33(1): p. 258-263. 10.! Ducat, D.C., J.C. Way, and P.A. Silver, Engineering cyanobacteria to generate high-value products. Trends in biotechnology, 2011. 29(2): p. 95-103. 11.! Ding, Y. and E. Alpay, Adsorption-enhanced steam-methane reforming. Chemical Engineering Science, 2000. 55(18): p. 3929-3940. 12.! McHugh, K., Hydrogen Production Methods, 2005, MPR. p. 1-41. 13.! Lee, H.-S., W.F.J. Vermaas, and B.E. Rittmann, Biological hydrogen production: prospects and challenges. Trends in biotechnology, 2010. 28(5): p. 262-271. 14.! Godfrey, L.V. and P.G. Falkowski, The cycling and redox state of nitrogen in the Archaean ocean. Nature Geosci, 2009. 2(10): p. 725-729. 15.! Kurisu, G., et al., Structure of the Cytochrome b6f Complex of Oxygenic Photosynthesis: Tuning the Cavity. Science, 2003. 302 (5647): p. 1009-1014. 16.! Cooke, D.T., Oxygenic Photosynthesis: The Light Reactions. Edited by Donald R. Ort and Charles F. Yocum. Plant Growth Regulation, 1998. 25(1): p. 73-73. 17.! Bekker, A., et al., Dating the rise of atmospheric oxygen. Nature, 2004. 427(6970): p. 117-120. 18.!Holland, H.D., The oxygenation of the atmosphere and oceans. Philosophical Transactions of the Royal Society B: Biological Sciences, 2006. 361(1470): p. 903-915.
35 19.! Herrero, A., E. Flores, and F.G. Flores, The Cyanobacteria: Molecular biology, Genomics and Evolution, ed. A. Herrero and E. Flores2008, Norfolk, UK: Caister Academic Press. 20.! Tomitani, A., et al., The evolutionary diversification of cyanobacteria: Molecular–phylogenetic and paleontological perspectives. Proceedings of the National Academy of Sciences, 2006. 103(14): p. 5442-5447. 21.! Vignais, P.M., B. Billoud, and J. Meyer, Classification and phylogeny of hydrogenases1. FEMS Microbiology Reviews, 2001. 25(4): p. 455-501. 22.! Shima, S. and R.K. Thauer, A third type of hydrogenase catalyzing H2 activation. The Chemical Record, 2007. 7(1): p. 37-46. 23.! Ducat, D.C., G. Sachdeva, and P.A. Silver, Rewiring hydrogenase- dependent redox circuits in cyanobacteria. Proceedings of the National Academy of Sciences. 24.! Tamagnini, P., et al., Cyanobacterial hydrogenases: diversity, regulation and applications. FEMS Microbiology Reviews, 2007. 31(6): p. 692-720. 25.! Bothe, H., Schmitz, O., Yates, M. G., Newton, W. E., Nitrogen Fixation and Hydrogen Metabolism in Cyanobacteria. Microbiology and Molecular Biology Reviews, 2010. 74(4): p. 529-551. 26.! Pinto, F.A.L., Troshina, O., Lindblad, P., A brief look at three decades of reshearch on cyanobacterial hydrogen evolution. International Journal of Hydrogen Energy, 2002. 27: p. 1209-1215. 27.! Ducat, D.C., J.C. Way, and P.A. Silver, Engineering cyanobacteria to generate high-value products. Trends in biotechnology. 29(2): p. 95-103. 28.! Merchant, S.S., et al., The Chlamydomonas Genome Reveals the Evolution of Key Animal and Plant Functions. Science, 2007. 318 (5848): p. 245-250. 29.! Kuchenreuther, J.M., et al., High-Yield Expression of Heterologous [FeFe] Hydrogenases in Escherichia coli. PLoS ONE. 5(11): p. e15491. 30.! Shepard, E.M., et al., Synthesis of the 2Fe subcluster of the [FeFe]- hydrogenase H cluster on the HydF scaffold. Proceedings of the National Academy of Sciences. 31.! Ghirardi, M.L., et al., Hydrogenases and Hydrogen Photoproduction in Oxygenic Photosynthetic Organisms*. Annual Review of Plant Biology, 2007. 58(1): p. 71-91. 32.! Stripp, S.T., et al., How oxygen attacks [FeFe] hydrogenases from photosynthetic organisms. Proceedings of the National Academy of Sciences, 2009. 106(41): p. 17331-17336. 33.! Dubini, A., et al., Flexibility in Anaerobic Metabolism as Revealed in a Mutant of Chlamydomonas reinhardtii Lacking Hydrogenase Activity. Journal of Biological Chemistry, 2009. 284(11): p. 7201-7213. 34.! Mulder, D.W., et al., Stepwise [lsqb]FeFe[rsqb]-hydrogenase H-cluster assembly revealed in the structure of HydA[Dgr]EFG. Nature. 465 (7295): p. 248-251. 35.! Picataggio, S., Potential impact of synthetic biology on the development of microbial systems for the production of renewable fuels
36 and chemicals. Current Opinion in Biotechnology, 2009. 20(3): p. 325ö329. 36.! Tavassoli, A., Synthetic biology. Organic & Biomolecular Chemistry, 2010. 8(1): p. 24-28. 37.! Heinemann, M., Panke, S., Synthetic biology—putting engineering into bio. Bioinformatics, 2006. 22(22): p. 2790-2799. 38.! Gibson, D.G., et al., Creation of a bacterial cell controlled by a chemically synthesized genome. Science, 2010. 2(329): p. 52-56. 39.! SyntheticGenomics. Next generation fuels and chemicals. 2009 [cited 2011 11 January 2001]; Available from: http:// www.syntheticgenomics.com/what/renewablefuels.html#1. 40.! Matsuoka, Y., Ghosh, S., Kitano, H., Consistent design schematics for biological systems: standardization of representation in biological engineering. J. R. Soc. Interface, 2009. 6: p. 393-404. 41.! Shetty, R.P., Endy, D., Knight, T. F. Jr., Engineering BioBrick vectors from BioBrick parts. Journal of Biological Engineering, 2008. 2(5). 42.! Knight Jr., T.F., Idempotent Vector Design for Standard Assembly of Biobricks, 2003, MIT. p. 1-11. 43.! parts, T.R.o.S.B. Assembly:Standard assembly. 2011 [cited 2011 18 January]; Available from: http://partsregistry.org/ Assembly:Standard_assembly. 44.! Grünberg, R., Ferrar, T. S., Sloot, A. M. v. d., Constante, M., Serrano, L., Building blocks for protein interaction devices. Nucleic Acids Research, 2010. 38(8): p. 2645-2662. 45.! OpenWetware. The BioBricks Foundation. 2011; Available from: http:// bbf.openwetware.org/. 46.! Huang, H.-H., et al., Design and characterization of molecular tools for a Synthetic Biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research, 2010. 38(8): p. 2577-2593. 47.! Frey, J., M.M. Bagdasarian, and M. Bagdasarian, Replication and copy number control of the broad-host-range plasmid RSF1010. Gene, 1992. 113(1): p. 101-106. 48.! Constantinou, A., Size-reduction of the RSF1010-derived broad-host- range Bio Brick cloning vector pPMQAK1, in Deparment of Photochemistry and Molecular Science2010, Uppsala University: Uppsala, Sweden. p. 27.
37