US 2002O136708A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2002/0136708 A1 Graham et al. (43) Pub. Date: Sep. 26, 2002
(54) SYSTEM FOR PRODUCTION OF HELPER filed on May 31, 1994, now Pat. No. 6,140,087, which DEPENDENT ADENOVIRUS VECTORS is a continuation-in-part of application No. 08/080, BASED ON USE OF ENDONUCLEASES 727, filed on Jun. 24, 1993, now abandoned. (76) Inventors: Frank L. Graham, Hamilton (CA); Publication Classification Philip Ng, Caledonia (CA); Robin Parks, Ottawa (CA); Silvia Bacchetti, (51) Int. Cl." ...... A61K 48/00; CO7H 21/04; Hamilton (CA); Mauro Anglana, Paris C12N 7/00; C12N 15/861 Cedex (FR) (52) U.S. Cl...... 424/93.21; 435/457; 435/235.1; 536/23.72 Correspondence Address: VAN DYKE & ASSOCIATES, PA. (57) ABSTRACT 1630 HILLCREST STREET The present invention relates to methods for efficient and ORLANDO, FL 32803 (US) reliable construction of adenovirus vectors which contain (21) Appl. No.: 09/883,649 and express foreign DNA and are useful for gene transfer into mammalian cells, for vaccines and for gene therapy. The (22) Filed: Jun. 19, 2001 invention provides for the growth and purification of aden ovirus vectors (helper dependent vectors or HDVs) from Related U.S. Application Data which all or most of the viral genes have been removed. The (63) Continuation of application No. 09/475,813, filed on vector System described herein is a new method designed to Dec. 30, 1999, now abandoned, which is a continu eliminate helper viruses from the final HDV preparation by ation-in-part of application No. 09/250,929, filed on cleavage of the helper virus DNA with an endonuclease, Feb. 18, 1999, now abandoned, which is a continu alone or in combination with other methods known to limit ation-in-part of application No. 08/473,168, filed on the level of helper virus contamination of helper dependent Jun. 7, 1995, now Pat. No. 5,919,676, which is a vector preparations. The disclosed methods and composi continuation-in-part of application No. 08/250,885, tions also provide for regulated control of gene expression. Patent Application Publication Sep. 26, 2002 Sheet 1 of 38 US 2002/0136708 A1 Sce I cleavage of Ad DNA: a new method for producing helper free helper dependent vectors
AdScecut
293 Sce cells
Sce cleavage
Internal ITR gets repaired and becomes functional with high efficiency by annealing with right ITR
Fig. 1
Patent Application Publication Sep. 26, 2002 Sheet 3 of 38 US 2002/0136708 A1
Combining the Cre/lox system with the Sce system for improved removal of helper from HDV preparations
Strategy: place Sce site between loxP sites.
DNA replicates but is not packaged v I-Sce? R
P ck
DNA replicates but is not packaged
Fig. 3 Patent Application Publication Sep. 26, 2002 Sheet 4 of 38 US 2002/0136708 A1 Construction of shuttle plasmids containing an Scel site and internal ITR for the generation of new helper viruses
pAE1sp 1A
Insert I-Sce recognition site into EcoRV site
R
-- y Sce ER
Insert TR into EcoRIA Sal site
Patent Application Publication Sep. 26, 2002 Sheet 5 of 38 US 2002/0136708 A1
SEQUENCE OF SYNTHETICOLIGONUCLEOTIDES USED IN VARIOUS CLONING PROCEDURES.
Scel site:
AB14265 5'- ACT TAA GCT AGG GAT AAC AGG GTA ATA TAG-3' AB14270 3'- TGA ATT CGA TCC CTA TTG TCC CAT TAT ATC-5'
Primers:
AB 1536 5'-CGG ATC CAA GCTTGC GAG ATC GAATTC-3'
AB 1537 5'- GCC TAG GTC GAC ACT CCG CCC TAA AAC-3'.
AB505 5'- GGA TAT CTG CAG ATC TAC TCC GCC CTA AAA C-3'
ABSO52 5". CCT CGA GTC GAC GCGAGA TCG AATTC-3'
AB 14905 5'- GGG GGG TCATGAAAAAGC CTGAACTC-3'
AB 4906 5'- GGG GGG GTC GAC CAG ACC CCA CGC AAC G-3'
Fig. 4a Patent Application Publication Sep. 26, 2002 Sheet 6 of 38 US 2002/0136708 A1
PCR AMPLIFICATIONS OF ADENOVIRUS INVERTED TERMINAL REPEATS
Pac (140) EcoRI (144)
Sal I (158) Acci (159)
AB505 HincII (160) --S- R XhoI (163)
EcoRV (5) s--- Pst I (12) 168 bp AB15052 Bgli (12)
B - Pac (136) --- Wam----- EcdRI (140) --- Hirad III (154) ABs37 s Bani I (160)
Avri (3) rs--- Sat (8) AB15136 AccI (9) 1.65 bp HincII (10)
Fiat 5 Patent Application Publication Sep. 26, 2002 Sheet 7 of 38 US 2002/0136708 A1 Construction of shuttle plasmids containing a floxed packaging signal, an Sce site, and internal ITR for the generation of new helper viruses
Replace Swal fragment with I-Sce recognition site
Insert TR into HincLPst site
Rs - is
pNG1.5ITR
Fig. 6 Patent Application Publication Sep. 26, 2002 Sheet 8 of 38 US 2002/0136708 A1 New Helper Viruses
8s: BE {{39) SW40 polyA Bisa BR 8820) Ba B (20468, ori " o s V | HCMV portioter Ad-C8cluc “...
- Psa Bi (1099)
R ox -Sce oxf y psa Bl ( 29) AcNG15
R lox -S ax R \ a Bf i3.
TR i-Scel TF y p 8 (302) AdNG20 TR
Fig. 7 Patent Application Publication Sep. 26, 2002 Sheet 9 of 38 US 2002/0136708A1
A Probe B
MCMV |-Sce SV40 polyA Bst XI (305) Bst 1107I (41.72) 1 AdMScel
4172 bp -
Probe B
loxP -Sce loxP Bst XI (1674) Bst 1071 (2830) arAll--- AdNG15 2398 bp H- - 2830 bp
B AdMSce -- a AdMSce AdNG15 AdNG 15
> 3 6 12 24 48 3 6 12 24 48 3 6 12 24 48 hrp.i.
m 5.0 4.2 m a 4.O 2.8 - a 3.0 2.4 m 2.0
Fig. 8 Patent Application Publication Sep. 26, 2002 Sheet 10 of 38 US 2002/0136708A1
CONSTRUCTION OF A PLASMID EXPRESSING -Sce AND HYGROMYCIN RESISTANCE FORTRANSFORMATION OF CELLS
-Sce at () - Sv4.0 polyA
- Ad Xiba (6535 Ad pMH4Scel 7927 bp Arnp
y Xba/Sal Klenow
A406 KpolyA hygromycin ApH1405)
Sir PCR product AS405 app 1415 bp
Noo/Sal Y BspHI/Sall Sal (8) ligate Bism B (14)
McMvpromotor Sat1 (1346)
TK polyA
-Sce -hygromycin Byn B1 (7850) pCEP4 Bim B (7534) 10410 bp Bsm B1 (2797) - EMCWRES Y or pal (24.47) of
hygromycin amp
Safi (3374). TK polyA BsmBI/Sali Y Y BsmBI/Sall ligate
MCMWptorolor
-Sesh
pNG19-1F 646 bp - EMCWRES
sab (2047)
sal (S2a) KpolyA rig.9 Patent Application Publication Sep. 26, 2002 Sheet 11 of 38 US 2002/0136708 A1 Construction of EMCV IRES cloning shuttle Saci (659) iSaci (666)
six (667) Amp Sal (4092).
Nico (3823).
Nco I (3748)
Psi (701) insert &Y-N-EcoRNCS-EcoRI (99) SNHindIII (21) NCS)\\Sal:35 NAcc (737) Hinc (738) Ncoi (2926) rule WXha (2) EMCWRESA y EcoRI (2334) WESWS-887)Aral Avri (2493) Kipri (761) Sall-EcoR digest Salt-EcoR digest get purity 1.8 kb fragment
Avr (94)
SmaiPsi (4689.(4688) EMCV IRES
Xnia (4678), r Nico (528) Banih I (4672) f : SE w EcoRi (1) EcoR1Sai (563)(550) SacEagl (46.53EN w f Art (60) Sac (46.40. EMCWS
inset Arnpr Avril-Sadigest gel purify 3.1kb fragment
Nde i (3529) Avril-Sail digest Bst XI (3530)
sai (1759) Xia (765) gel purify 470 bp fragment i EcoRV (536) i; ; Banih I (3540) EcoR (3546) Sac (3556) Sail (1) HindIII (3163) E.cc (2)(3) Avri (309q} \ ()
SnaiEcoRI (2922). (2932) Bdin (29 EMCWRES
EagNor (2895)(2895.2/ 3 BXI 2890 Sac (288 pEM2 Sac (2882) 3558 bp
ampr Fig. 9a Patent Application Publication Sep. 26, 2002 Sheet 12 of 38 US 2002/0136708A1
Rescue and propagation of AdLC8ApIXSceI ge V-- R AEI ApiX Stuffer is TR ores 2 oxP i lar AdLC8ApIXSce? Vector ce 36-37 kb 27-35 kb M 293CreSce Reamplify in 293CreScel +Helper Virus SR V K AEI/Apix Stuffer loxP 90% v. Packaged Packaging signal excised, Vector unable to package <=TR y K RAE/ApIX Stuffer c)TR loxP s Sce 10% y-- - Too large to package in a piX virion OR (following Sce cleavage and ITR repair) TR AE1 1AplX Stuffer TR lf o/AO) Packaging signal removed, unable to package Fig. 10 Patent Application Publication Sep. 26, 2002 Sheet 13 of 38 US 2002/0136708A1 CORRECTION AND OPTIMIZATION OF THE I-Scel GENE nls Ndel A HA epitope MCMV promotor EcoRI. / |-Scel SV40 polyA -)-AGATG AG)- u-- --- Kozak MetGlySerSerSerAspAsp....ProProLysLysAsnGlulys A gaattcagatc.cgccgccataTGiggatcatcatcagacgac...... ccaccaaaaaaaaacgaaaagtagaa EcoRI. Ndel f | C. C C, CCA. A. ... i & GAA AA GTAGA. 3. 91, Kozak MetGlySerSerSerAspAsp....ProProLysLysLysArgLysValGlu... B gaatticgcc.gccgctATGggatcatcatcagacgac...... ccaccAaaaaaaaaacgaaaagtagaa EcoRI FIGURE ll Patent Application Publication Sep. 26, 2002 Sheet 14 of 38 US 2002/0136708 A1 EcoR HCMV promotor Nde -Sce kozak nls HA epitope phCMV-1 I-Scel -- . AB 1675 + AB 6752 pknlsHA-Scel 5281 bp MCMV Clone EcoRI/Sal Y promotor fragment into pMH4 EcoR nis HA epitope I-SceI SV40 polyA Insert intron MMY. into ECOR A EcoRI A1 - Intron - - - - EcoRI. nds y HA epitope \ I-Scel w SV40 poly A FIGURE 12A Patent Application Publication Sep. 26, 2002 Sheet 15 of 38 US 2002/0136708 A1 XhoI + Clal, Xba Klenow, ligate pGEM7-NG14b.ITRA BStBI, insert 3286 bp 1560 bp DNA na pCEM7-NGUS 14b ITR1 4846 bp Xba BamHI, ligate ITR as Aval N SceAf ... lambda Stufffer Xba Ava - Af, f TR Klenow, ligate - BamHI Xba na lambda stuffer Patent Application Publication Sep. 26, 2002 Sheet 16 of 38 US 2002/0136708A1 Development of cell lines expressing I-Sce ampR HA epitope -Sce - EMCV IRES A 3 mutant hygro TK polyA 293Cre Select for Hygro resistance Hygro # clones Screened 200 g/ml 12 400 lug/ml 12 600 ug/ml 3 Screen for functional Scel activity by 800 ug/ml 8 Southerns and Westerns FIGURE 13 Patent Application Publication Sep. 26, 2002. Sheet 17 of 38 US 2002/0136708A1 Analysis of I-Sce activity in 293Cre4 cells transformed with pNG26i Probe B I-Sce ITR Bst] 107 AdNGUS2OTR2 36959 bp ------4363 bp I-Sce cleavage ITR St 107 - 4.0 - 3.0 - 2.0 - FIGURE 14 Patent Application Publication US 2002/0136708 A1 ?ITRIQ?IH #IÇIZIII068L9S7? Patent Application Publication Sep. 26, 2002 Sheet 19 of 38 US 2002/0136708A1 Modifications to the ends of Ad DNA by panhandle formation Sce Sce Sce Sce Sce etC. FIGURE 16 Patent Application Publication Sep. 26, 2002 Sheet 20 of 38 US 2002/0136708A1 Left end structures after duplications of DNA segments by panhandle formation - 2803 bp 293 Sce cells Sce BX Bf 107 { - plications during ation in 293 cells Bst XI Bst 107 Bst X Byt 107 Bst X Bf 107 FIGURE 17 Patent Application Publication Sep. 26, 2002. Sheet 21 of 38 US 2002/0136708A1 Use of a "stuffer" to block packaging of viral variants with duplications of left end sequences (Scel helper) -- F -- a) AdNG2OTR m unu 35399 bp (98.5%) I-Sce -- -Cu AdNGUS20ITR2 Stuffer (1.5 kb) I-Scel 36959 bp (101.8%) -Hank am H.-- HO-He Stuffer I-Sce I-Sce Stuffer 38947 bp (108.4%) FIGURE 18 Patent Application Publication Sep. 26, 2002 Sheet 22 of 38 US 2002/0136708A1 Use of a "stuffer" to block packaging of viral variants with duplications of left end sequences (Scel-lox helper) -(- - -- m). AdNG1.5ITR 35570 bp (99%) loxP Sce lox P AdNGUS 14 - 37130 bp (103.3%) lox P Stuffer (1.5 kb) Scel lox P loxP Sce Stuffer (1.5 kb) oxP 39271 bp (109.3%) Too large to package FIGURE 19 Patent Application Publication Sep. 26, 2002 Sheet 23 of 38 US 2002/0136708 A1 & 6, 8 a 2 = 3 + O D P D aO 3 2 9 5 9 isC . . rt. re.. Us. 8.0 - 7.0 - 3. e. 6.0 - s: & 5.0 - 4.0 - 3.0 - 2.0 - 1.6 - FIGURE 20 Patent Application Publication Sep. 26, 2002 Sheet 24 of 38 US 2002/0136708A1 Helper viruses with I-Sce recognition sites Probe B Sce T A stuffer ITR is 107 TR AdNGUSTOITR236959 bp w(HKSK-- -)A 4.4 kb t A B 9 kb 2.5 kb Probe B Sce Sce TR stuffer ITR st1107 ITR AdNGUS4137057 bp ? A -)A 4.5 kb -- - A B C 0.2 kb 1.8 kb 2.5 kb Probe B Sce ITR A stuffe ITR st 107I ITR AdNGUS43 t y C A ? A 37012 bp H -) 4.4 kb -- A B 0.2 kb 4.2 kb FIGURE 21 Patent Application Publication Sep. 26, 2002. Sheet 25 of 38 US 2002/0136708 A1 Construction of shuttle plasmids for helper Virus rescue toxP. Xba Y fSwa - -CO Swal N toxP YXbal Af Sce pLC8 5 ACTTAAGCTAGGGATAACAGGGTAATATAG 3 ' AB14265 23318 bp 3 * TGAATTCGATCCCTATTGTCCCATTATATC 5 AB 14270 pNG14 22090 bp PSGEM7(f S. ) ABSO51i TR HincII PSt pGEMT-NG14b al AB15052 3168 bp PCR product 168 bp Y Pst Hinc Y Xba Pst , ITR ; , HincII // lox P Sce Xba NG4b ITR 33 12 bp FIGURE 22A Patent Application Publication Sep. 26, 2002 Sheet 26 of 38 US 2002/0136708 A1 Construction of shuttle plasmids for helper virus rescue (Cont'd) XhoI -- Ca, Xbal Klenow, ligate pGEM7-NG14biTRA BstBI, insert 3286 bp 1560 bp 2. DNA na Xba BamHI, ligate ITR s: Aval NS Scel is Aff lambda pNG29 Stufffer 4792 bp Ava -- Af, Klenow, ligate - Banh Xba na lambda Stuffer N Xbal ' BamHI FIGURE 22B Patent Application Publication Sep. 26, 2002 Sheet 27 of 38 US 2002/0136708 A1 Construction of shuttle plasmids for helper virus rescue (cont'd) Bam H. lf BamHI, insert SceI oligo AB14265 & AB 14270 Scel y Xba lambda stuffer pNG27-2 21903 bp -Xba Y in A \ Sce Xbal lambda stuffer S4 - ITR Xbal 23721 bp FIGURE 220 Patent Application Publication Sep. 26, 2002 Sheet 28 of 38 US 2002/0136708 A1 Construction of shuttle plasmids for helper virus rescue (cont'd) oxP Xbal oxP N. Sce Xbal pNG15 22090 bp pNG15ITR 22234 bp Xbal loxP lambda stuffer Scel N NERXba pNGUS 14-1 23794 bp FIGURE 22D Patent Application Publication Sep. 26, 2002 Sheet 29 of 38 US 2002/0136708 A1 Construction of shuttle plasmid for rescue of Scel helper virus pAESP1A 6409 bp EcoRV, insert I-Sce oligo AB14265 & AB 4270 4 PCR product AB 15052 165 bp Y." + Sal f pNG20ITR 6559 bp Insert 1560 bp A DNA into Cla lambda KY stuffer pNGUS2OITR2 I-Sce 8) 19 bp ITR FIGURE 23 Patent Application Publication Sep. 26, 2002 Sheet 30 of 38 US 2002/0136708A1 s Helper virus $3 Q S. Y s CS S CS w S w S w S r r S CellC line 5 On Cn r CN on r N CN r segg. sess sa 0.0 9.0 C 8.0 - 7.0 - 6.0 - 5.0 - 4.0 - 3.0 - 2.0 - 1.6 FIGURE24 Patent Application Publication Sep. 26, 2002 Sheet 31 of 38 US 2002/0136708A1 In vivo I-Scel cleavage and rearrangement of AdNGUS20ITR2 Probe B Scel " ITR \f A stufferHis ETR--A Bf 107 4.4 kb - A B 1.9 kb 2.5 kb I-Sce cleavage stuffer ITR Bs 1107 Repair using internal ITR ITR is 1 107 (H- 2.4 kb FIGURE 25 Patent Application Publication Sep. 26, 2002. Sheet 32 of 38 US 2002/0136708 A1 loiingº I#SnONpyJoqueueñueJJeº.Ipue35eAbºIOIOOS-IOA?AUI J?j?msY Patent Application Publication Sep. 26, 2002 Sheet 33 of 38 OA?AUI93bAbºIOIOOS-IqueueñueJIBQJpubg#SQONpvJo Patent Application Publication Sep. 26, 2002 Sheet 34 of 38 US 2002/0136708A1 Ad vectors expressing genes controlled by Scel-mediated excision and double strand break repair ITR A E1 A E3 TR r --- r 1. --- - Sce Sce "R U HCMV E Pr spacer Lac2. SW40 An AdScefac: DEFECTIVE VIRAL WECTOR EXPRESSING LACZ UNDER CONTROL OF A MOLECULAR SWITCH spacer i TR NJ HCMV E pr Lac2. SW40 A f gal expression FIGURE 28 Patent Application Publication Sep. 26, 2002 Sheet 35 of 38 US 2002/0136708 A1 GENE EXPRESSION CONTROLLED BY A MOLECULAR SWITCH Sce Sce Pr f spacer Lac2. An OFF OR Sce Sce Pr Lac2. An TRANSGENCS CONTAINING GENES CONTROLLED BY AMOLECULAR SWITCH OR Sce Pr i An M2WS/7 A2V1 OFF EXPRESSION (ON OR OFF) OF B-Gal, Rb, P53, Neu ETC. FIGURE 29 Patent Application Publication Sep. 26, 2002 Sheet 36 of 38 US 2002/0136708 A1 A helper dependent vector system based on Switching off plX expression Sce Scc R y TR TR y R 4- -> <- Stuffer Foreign Gene Stuffer c> oxP loxP Vector Helper virus with 27-35 kb a pIX gene regulated by Scel or Cre 293Cre O 293Sce1 St. Rast Reamplify in 293Cre or 293Scel A ge + Helper Virus Sce y V apix Its 0xP pIX gene excised, genome too large to package in a pX- vion FICJRE 30 Patent Application Publication Sep. 26, 2002 Sheet 37 of 38 US 2002/0136708 A1 Amplification of a hleper dependent vector using AdNGUS20ITR2 helper virus in 293 Scel cells 10' O 1. O6 T P1 P2 P3 P4 Serial Passage Number 293Cre4+ AdLC8cluc 2-16 + AdNGUS2OITR2 4-7 + AdNGUS2OITR2 6-3 + AdNG US2OITR2 FGURE 31 Patent Application Publication Sep. 26, 2002 Sheet 38 of 38 US 2002/0136708A1 S E. Kauto ~ 2 kb ------. . . ki B Advisiel Adi (1.3 M); 2 S.C. ic kh 3 s. FIGURE 32 US 2002/0136708 A1 Sep. 26, 2002 SYSTEM FOR PRODUCTION OF HELPER by the system disclosed and claimed herein. In the WO98/ DEPENDENT ADENOVIRUS VECTORS BASED ON 13510 system, a helper adenovirus was described wherein USE OF ENDONUCLEASES the pX gene was deleted or disabled. In such a modified adenovirus, a genome greater than about 35 kb is not CROSS REFERENCES TO RELATED efficiently packaged, irrespective of the presence or absence APPLICATIONS of a functional packaging Signal, p, unless the helper virus is propagated in a cell which complements the pX defi 0001. This application is a continuation of application ciency. In combination with the present invention, a doubly Ser. No. 09/475,813, filed on Dec. 30, 1999, pending, which or triply disabled helper virus is produced, if the Cre/loxP is a continuation-in-part of application Ser. No. 09/250,929, recombination System is also used, which is still capable of filed on Feb. 18, 1999, pending, which was a continuation providing, in trans, all of the functions necessary to Support in-part of Application Ser. No. 08/473,168, filed Jun. 7, replication of a helper-dependent adenovirus vector (HDV). 1995, now U.S. Pat. No. 5,919,676, which was a continu ation-in-part of application Ser. No. 08/250,885, filed on 0005 Those skilled in the art are familiar with endonu May 31, 1994, pending, which was a continuation-in-part of cleases and the use of Such compositions, whether expressed application Ser. No.08/080,727, filed on Jun. 24, 1993, endogenously or introduced from an external Source, in the abandoned. Priority of each of these applications is claimed cleavage of Specific target Sequences in a Segment of nucleic herein, and the disclosure of each of these applications is acid. hereby incorporated by reference. 0006 Those skilled in the art will also appreciate that adenoviruses contain inverted terminal repeats (ITRS) at FIELD OF THE INVENTION each end of the genome, which are essential to replication of 0002 The invention is a new method of producing helper adenoviruses. The ITRS (representing the most terminal adenoviruses and helper-dependent adenovirus vectors approximately 100-200 bp of the viral genome) are the only (HDVs) in which helper virus is eliminated from HDV Ad DNA sequences needed in cis for viral DNA replication, preparations by cleavage of the helper virus DNA with an and the packaging signal (P), which is needed for packaging endonuclease. The invention can be used independently of of viral DNA into virion capsids, is the only additional cis Cre/lox, or other helper virus containment Systems, or in acting Sequence needed for production of virions. Thus, combination with Cre/lox, or other helper virus containment appropriate helper viruses may be used to provide, in trans, Systems, to minimize the level of helper virus contamination all other factors required for replication of the HDV. Fur of HDV preparations. thermore, it is known that adenoviruses containing an ITR embedded within the genome are capable of replicating, BACKGROUND OF THE INVENTION through a repair process, even though an external ITR is eliminated (see, for example, Haj-Ahmad and Graham, 0003) In U.S. patent application Ser. No. 08/473,168, (the Virology 153:22-34, 1986). What has not been previously 168 application), published as WO96/40955, now U.S. Pat. demonstrated, however, is the application of this observation No. 5,919,676, hereby incorporated by reference, a system in the production of helper viruses and helper dependent for making helper-dependent adenovirus vectors and helper Virus preparations Substantially free of helper virus contami andenoviruses was disclosed. That System employed a nation. recombinase, Such as Cre, expressed by a cell into which a helper virus, comprising loXP Sites flanking the adenovirus SUMMARY OF THE INVENTION packaging signal, was introduced, (i.e. the packaging sequence was “floxed’). By virtue of the recombinase 0007. The present invention relates to methods for effi expressed by the host cell, the helper adenovirus packaging cient and reliable construction of adenovirus vectors that Signal was excised, thereby restricting the packaging of the contain and express foreign DNA and are useful for gene helper virus. Co-introduction of a helper-dependent, recom transfer into mammalian cells, for vaccines and for gene binant adenovirus vector (HDV) containing a packaging therapy. The invention provides for the growth and purifi Signal permitted isolation of efficiently packaged helper cation of adenovirus vectors (helper dependent vectors or dependent Virus. However, as may be appreciated by those HDVs) from which all or most of the viral genes have been skilled in the art, any “leakage' of that System results in the removed. The vector system described herein is a new contamination of helper-dependent adenovirus vector prepa method designed to eliminate helper viruses from the final rations with helper virus. The present invention is directed to HDV preparation by cleavage of the helper virus DNA with methods and helper virus constructs which result in produc an endonuclease. tion of HDV preparations wherein the level of packaged 0008 Accordingly, it is one object of this invention to helper virus contamination is reduced by an endonuclease. provide a simple and useful System whereby helper depen The constructs and techniques taught herein may be dent adenovirus vectors may be propagated and purified and employed independently from the Cre-loxP system wherein contamination with helper virus is significantly described according to the WO96/40955 publication, or the reduced or eliminated. techniques taught herein may be used to augment the effectiveness of that System. 0009. Another object of this invention is to provide a method whereby reduction of helper adenovirus contamina 0004 Furthermore, those skilled in the art will appreci tion of helper-dependent adenovirus vector preparations is ate, based on the disclosure provided herein, that a System achieved or augmented. such as that disclosed in parent application Ser. No. 08/719, 217, a foreign equivalent of which published as WO98/ 0010 Another object of this invention is to provide a 13510, hereby incorporated by reference, may be augmented preparation of helper-dependent adenovirus vector Substan US 2002/0136708 A1 Sep. 26, 2002 tially free of helper virus, Such that the helper-dependent copending patent application Ser. No. 08/719,217, (hereby vector preparation is Substantially free of Virus capable of incorporated by reference, entitled “Improved Adenovirus replicating in host cells into which the vector is introduced. Vectors Generated from Helper Viruses and Helper Depen 0.011) Another object of this invention is to provide dent Vectors”), published as WO98/13510, and the endonu methods and compositions of enhanced utility for vaccine clease System of the present invention, for production of a and gene therapeutic applications. helper dependent vector Substantially free of helper virus. 0025 FIG. 11. Correction and optimization of the I-SceI 0012. Other objects of this invention will be apparent gene. The plasmid pMH4SceI (a gift from M. Anglana and from a review of the complete disclosure and from the S. Bacchetti) was constructed by cloning the 853 bp EcoRI/ appended claims. Sal fragment containing the I-Sce gene from a plasmid containing the Sce I gene, pCMV-I-SceI (Rouet P. Smith F, BRIEF DESCRIPTION OF THE DRAWINGS Jasin M Expression of a Site-specific endonuclease Stimu 0013 FIG. 1 is a diagrammatic representation of a helper lates homologous recombination in mammalian cells. Proc adenovirus containing an endonuclease recognition cleavage Natl Acad Sci U S A Jun. 21, 1994;91 (13):6064-6068), into site (Scel) near the left end of the viral genome and the EcoRI/SalI sites of pMH4 (available from Microbix positioned to the right of the adenovirus packaging Signal, p, Biosystems).) Sequence analysis (A) showed that the I-SceI illustrating the effects of endonuclease cleavage and ITR gene in pMH4SceI contained a single base pair deletion repair. (nine A's between 173 and 181 instead often) in the nuclear localization signal (see inset for Sequence ladder, SEQ ID 0.014 FIG. 2 is a diagrammatic representation showing a NO: 9 and SEO ID NO: 10 for nucleic acids and SEO ID method for propagation of a helper dependent Ad Vector NO: 11 and SEQ ID NO: 12 for peptide sequence) resulting (HDV) from which all or most of the viral genes have been in premature termination of translation at an immediately deleted and substituted with foreign DNA. downstream TAG. The position of the Kozak consensus 0015 FIG. 3 illustrates a method for combining the Sequence relative to the Start codon for I-Sce was also not Cre/lox System and the Sce System to produce a helper virus optimal. Therefore, the sequence of the 5' end of the I-Sce for improved production of helper free helper dependent coding sequence was corrected and optimized (new VectOrS. Sequence shown in (B). This modification was accomplished using synthetic oligonucleotides AB16751 and AB16752 0016 FIG. 4 illustrates the construction of a shuttle (respectively, SEQ ID NO: 13 and SEQ ID NO: 14 for the plasmid derived from p.a. 1SP1A wherein an SceI recogni nucleic acids and SEQ ID NO: 15 and SEQ ID NO: 16 for tion site is introduced adjacent to the packaging Signal the peptide sequences) as described in FIG. 12A. followed by insertion of an ITR sequence. 0026 FIG. 12. Construction of a plasmid for generation 0017 FIG. 4a illustrates the sequences of oligonucle of cell lines stably expressing I-SceI. (A) An oligonucleotide otides used in various cloning procedures. (AB16751: 5' AATTCGCCGCCGCCATGGGATCATCAT. 0018 FIG. 5 illustrates the use of PCR to amplify CAGACGACGAAGCAACAGCAGACGCA adenovirus ITRs from the plasmid padHV1 HelperpX. CAACACGCAGCACCACCAAAAAAAAAC GAAAAGTAGAAGACCCACGATTTATGTACCCATAC 0019 FIG. 6 illustrates the construction of a shuttle GATGTTCCTGACTATGCGGG 3' (SEQ ID NO: 17)+ plasmid derived from pl. C8 wherein an Scel recognition site AB1675:5'TACCCGCATAGTCAGGAACATCGTATGGG is introduced adjacent to the floxed packaging Signal fol TACATAAATCGTGGGTCTTC lowed by insertion of an ITR sequence to the right of the TACTTTTCGTTTTTTTTTTGGTGGTGCT Second lox Site. GCGTGTTGTGCGTCTGCTGTTGCT 0020 FIG. 7 illustrates the structure of new helper TCGTCGTCTGATGATGATCCCATGGCGGCGGCG 3 viruses derived by cotransfection of 293 cells with (SEQ ID NO: 18) bearing a Kozak consensus sequence, a pBHG10luc and the shuttle plasmids of FIGS. 4 and 6. nuclear localization signal (nls) and an influenza hemagglu tinin (HA) epitope was inserted into the EcoRI and NdeI 0021 FIG. 8 shows a Southern blot hybridization analy sites of phOMV-1 I-SceI (Choulika et al., 1995 MCB sis of cleavage products generated by coinfection of A549 15:1968) replacing the hCMV promotor to generate cells with a virus containing an Scel Site near the left end of pkn1sHA-SceI. The 849 bp EcoRI/SalI fragment from the genome (AdNG15) and a second virus, AdMSceI, pkn1sHA-Sce was inserted into the EcoRI/SalI sites of expressing the Sce endonuclease. pMH4 (Addison et al., 1997) to generate pNG24. The 269 bp EcoRI fragment from pMH4(I), bearing an intron (Mathews 0022 FIG. 9 illustrates construction of a plasmid et al., 1999), was inserted into the EcoRI site of pNG24 to expressing Scel and hygromycin resistance for transforma generate pNG24i. The virus AdNGUS24i was generated by tion of cells. in vivo homologous recombination between pNG24i and 0023 FIG. 9a illustrates construction of a plasmid con pjM17 following their cotransfection into 293 cells. (B) The taining an EMCV IRES sequence for use in construction of 980 bp PacI/BstEII fragment from pNG24i was cloned into the plasmid of FIG. 9. the PacI and BstEII sites of pNG19 to generate pNG26i. Cell 0024 FIG. 10 illustrates a method for combining the lines Stably expressing I-Sce were generated by transfection Cre/loxP System of copending patent application Ser. No. of 293Cre4 cells with pNG26i. 08/473,168 (hereby incorporated by reference, entitled 0027 FIG. 13. Development of cell lines expressing “Adenoviral Vector System Comprising Cre-LoxP Recom I-SceI. 100 mm dishes of semiconfluent monolayers of bination”), published as WO96/40955, the pIX system of 293Cre4 cells (Chen, L., Anton, M. and Graham, F. L. US 2002/0136708 A1 Sep. 26, 2002 Production and characterization of human 293 cell lines cannot be packaged into virions owing to the loSS of the expressing the Site-specific recombinase Cre. Somat. Cell packaging signal () thus representing an ideal helper and Molec. Genet. 22: 477-488, 1996.) were transfected genome. If the viral DNA bears a Sce-I site between the with 5 lug of pNG26i (FIG. 12B) by calcium phosphate leftmost ITR and the internal ITR, as depicted in (A), then coprecipitation (Graham, F. L. and van der Eb., A. J. A new this species can also be generated by I-Sce cleavage fol technique for the assay of infectivity of human adenovirus 5 lowed by panhandle formation and repair. In contrast, the DNA. Virology 52, 456-467, 1973.). Three days post-trans Species bearing four ITRS (C) can replicate as well as be fection, hygromycin was added to the culture media at packaged. This species can undergo further rearrangements concentrations of 200, 400, 600 or 800 tug/ml. Following through panhandle formation of any two ITRS during rep Selection, individual hygromycin resistant colonies were lication to generate a plethora of different Species. Propa isolated, expanded and analyzed for I-Sce expression by gation of these variants is limited only by their size. Southern (FIG. 14) and Western blot hybridization (FIG. 0031 FIG. 17. Left end structures after duplication of 15). DNA segments by panhandle formation. The left end of 0028 FIG. 14. Analysis of I-SceI activity in 293Cre4 AdNG20ITR is present on a 2.8 kb Bst1107I fragment. cells transformed with pNG26i. 35 mm dishes of the indi Cleavage by I-Sce followed by repair using the internal ITR cated transformed cell line were infected with results in a 2.4 kb fragment. In the absence of I-Sce AdNGUS20ITR2 (described in FIG. 21) at an moi of 1.48 cleavage, the genome of AdNG20ITR may undergo rear hrs post-infection, viral DNA was extracted and subjected to rangements mediated by the internal ITR as depicted in FIG. Southern blot hybridization with probe fragment B follow 16. These rearrangements can extend the left end of the ing digestion with Bst1107I. In the presence of I-Sce genome by multiples of 428 bp resulting in Bst1107I frag cleavage, the 4.4 kb Bst1107I fragment of AdNGUS20ITR2 ments of 3.2 kb, 3.7 kb, etc. Similarly, the right end of the is expected to be converted to a 2.4 kb Bst1107I fragment. genome can also be extended (not shown). 0029 FIG. 15. I-SceI expression in 293Cre4 cells trans 0032 FIG. 18. Strategy to block propagation of rear formed with pNG26i determined by Western blot analysis. ranged viruses bearing an internal ITR. A simple Strategy to The Western shows I-SceI protein (31 kDa) in 293 cells 24 block propagation of rearranged virus due to the presence of hrs after infection with AdNGUS24i at an moi of 5 for (lane the internal ITR is to render the rearranged products too 1) or in various 293Cre4 cells stably transformed with large to be packageable. To this end, a Stuffer Segment can pNG26i (lanes 3 to 14). Lane 2 contains 293Cre4 cell extract be introduced into the viral genome between the leftmost as a negative control. Total protein was extracted by incu and internal ITR as depicted. While this modification will bating cells with Radioimmunoprecipitation assay buffer for not prevent rearrangement, it will prevent the rearranged 30' on ice. Samples were centrifuged and total protein of the products from being propagated Since the genomes of these Supernatant was determined using a quantitative colormetric Viral variants will exceed the upper packaging limit. assay (Micro BCA assay reagent kit, Pierce). 2.5 lug of protein was fractionated on a 10% SDS-polyacrylamide gel 0033 FIG. 19. Strategy to block propagation of rear and transferred to Immobilon P polyvinylidene difluoride ranged viruses bearing an internal ITR. As in FIG. 18 except membrane (Millipore) using a Transblot cell (Bio-Rad). The for the presence of loxPSites in the viral genome as depicted. HA-tagged I-Sce protein is expected to be ~30.7 kDa and 0034 FIG. 20. Effectiveness of stuffer in eliminating was detected using Anti-HA high affinity Rat monoclonal propagation of internal ITR-mediated rearranged genomes. antibody clone 3F10; 100 ng/ml in PBS-buffered skim 35 mm dishes of 293 cells were infected with the indicated milk(5%); Roche and a peroxidase conjugated affinipure virus at an moi of 1. At 48 hrs post-infection, viral DNA was Donkey Anti-Rat IgG (H+L) 160 ng/ml in PBS-buffered extracted and analyzed by Southern blot hybridization with skim milk(5%); Jackson Immuno Research Laboratories). probe fragment B following digestion with Bst1107I. As Chemiluminescence using an ECL Western Blotting Detec shown, a 2.8 kb Bst1107I fragment (black triangle in lane 2) tion Kit (Amersham) and XAR5 film (Eastman Kodak is expected from the unrearranged genome of AdNG20ITR Company) was used to monitor the peroxidase reaction. depicted in FIG. 17. However, additional bands at higher Molecular weights (kDa, Rainbow Marker; Amersham) are molecular sizes (white triangles in lane 2) are also observed. shown to the right. The band in lane 1 between 66 kDa and These correspond to the internal ITR-mediated rearrange 97.4 kDa is specific to adenovirus infected cells and may ment products depicted in FIG. 17. The intensity of these represent a viral protein that binds to one of the AbS used in bands Suggests that the rearranged Species can propagate and the hybridization. may be expected to contribute to further rearrangements. Lane 3 shows the results of Similar analysis for a Second 0030 FIG. 16. Modifications to the ends of Ad DNA by helper virus, AdNG15ITR indicating that formation of vari panhandle formation and various repair modes. An interme ant viruses is a general phenomenon for viruses with internal diate Step in adenoviral DNA replication occurs though ITRS. Propagation of Such rearranged viruses is virtually pairing of the terminal ITRs of single stranded DNA to eliminated by inclusion of a Stuffer Segment as in the case of generate a panhandle Structure. For viruses bearing an AdNGUS20ITR2 (lane 4) as only the expected 4.4 kb internal ITR as depicted in (A), two possible ITR pairings Bst1107I fragment from the parental virus is observed. may occur: pairing between the two terminal ITRS or pairing Similarly, propagation of the rearrangement products of of the internal ITR with the rightmost ITR. In the former case, DNA replication will result in a progeny molecule that AdNG15ITR was observed (white triangles in lane 3), but is identical to the parental DNA. In the latter case, two virtually eliminated by inclusion of a stuffer as shown for possible progenies, both different from the parental mol AdNGUS 14-1 in lanes 5 and 6. ecule may result: one bearing four ITRS and one bearing two 0035 FIG. 21. Helper viruses with one or two SceI ITRs. The molecule bearing two ITRs (B) can replicate but recognition sites. The helper viruses AdNGUS20ITR2, US 2002/0136708 A1 Sep. 26, 2002 AdNGUS41 and AdNGUS43 are identical except for the constructed by replacing the 312 bp Xbal fragment in number and position of the I-Sce recognition site(s). Essen pNG1.5ITR with the 1872 bp Xbal fragment from pCEM7 tial features common to these viruses include an internal ITR NGUS1.4b.ITR1 (FIG.22B). The helper virus AdNGUS14-1 to permit viral DNA replication of I-Sce cleaved helper (FIG. 19) was generated by in vivo homologous recombi genome DNA and a 1560 bp fragment of bacteriophage 2 nation between pNGUS14-1 and puMA71 following their DNA inserted between the two left end ITRs to prevent cotransfection into 293 cells. packaging of rearranged viral genomes that are generated by 0037 FIG. 23. Construction of the shuttle plasmid for panhandle formation using the internal ITR during DNA rescue of helper viruses bearing an I-Sce Site. An oligo replication. AdNGUS20ITR2 contains a single Scel site nucleotide bearing the SceI site (SEQ. ID. NO.1, AB located between the 2. DNA Stuffer and the packaging Signal 14265+SEQ. ID. NO.:2, AB14270) was inserted into the (p). AdNGUS41 contains two SceI sites flanking up and the EcoRV site of pAE1SP1A to generate pNG20. An ITR was 2. DNA. AdNGUS43 contains a single Scel site located PCR amplified from pAdHV1 pIX- with primers AB 15051 between the leftmost ITR and the DNA stuffer. and AB 15052. The PCR product was digested with Sal and 0.036 FIG. 22. Construction of shuttle plasmids for res EcoRI and the 165bp fragment was cloned into the SalI and cue of helper viruses bearing sites. (A) An oligonucleotide EcoRI sites of pNG20 to generate pNG20ITR. The 1560 bp bearing the I-SceI recognition sequence (SEQ. ID. NO.1, BSaHI fragment from lambda DNA was inserted into the AB14265+SEO. ID. NO.:2, AB14270, SEQ ID NO: 19 and ClaI site of pNG20ITR to generate pNGUS20ITR2. The SEQ ID NO: 20) was inserted into the Swal sites of pI C8 helper virus AdNGUS20ITR2 was generated by in vivo (Parks et al., 1996) replacing the neomycin phosphotrans homologous recombination between pNGUS20ITR2 and ferase gene to generate pNG14. The 168 bp Xbal fragment pUMA71 following their cotransfection into 293 cells. bearing the SceI and loxPsites from pNG14 was cloned into 0038 FIG. 24. Southern analysis of viral DNA extracted the Xbal site of pCEM7(f) (Promega) to generate pGEM7 from 293SceI cells infected with various helper viruses NG 14b. An ITR was PCR amplified from pAdH1 pIX-(gift illustrating the efficiency of I-Sce cleavage in Vivo and from Andy Bett) with primers AB15051 (5' GGATATCTG generation of variant viral DNA molecules. Cultures of the CAGATCTACTCCGCCCTAAAAC3', SEQ ID NO:5) and indicated cell lines (the parental 293Cre4 cell line and the AB15052 (5' CCTCGAGTCGACGCGAGATCGAATTC3", I-SceI expressing 293Cre4 derivatives, 2-16 and 4-7) in 35 SEQ ID NO: 6). The PCR product was disgested with PstI mm dishes were infected with the various helper viruses and HincII and the 168bp fragment was cloned into the Pst bearing Sce recognition sites as illustrated in FIG. 21 at an and HincII sites of pCEM7-NG14b to generate pGEM7 moi of 1. At 48 hrs post-infection, viral DNA was extracted NG14b|TR. (B) The plasmid pCEM7-NG14b.ITR was and analyzed by Southern blot hybridization with probe digested with XhoI and ClaI, Klenow end modified and self ligated to generate pGEM7-NG14bTRA which bears a fragment B (see FIG. 21) following digestion with unique BstBI site. The 1560 bp Bsall fragment from Bst1107I. For the viruses AdNGUS2OITR2, AdNGUS41 lambda DNA was inserted into the BstBI site of pCEM7 and AdNGUS43, Bst1107I cleavage is expected to generate NG14b.ITRA to generate pGEM7-NGUS1.4b.ITR1. The loxP fragments with molecular weights 4.4 kb, 4.5 kb and 4.4 kb, site was removed from pCEM7-NGUS14b|TR1 by BamHI respectively, in the absence of I-SceI cleavage (FIG. 21). digestion followed by ligation to generate pNG29. The Sce Following I-Sce cleavage, these fragments are all expected site was removed from pNG29 by Aval and AflII digestion, to be converted to a 2.4 kb Bst1107I fragment (indicated by Klenow end modification, followed by Self ligation to gen the black triangles) as a result of panhandle repair using the erate pNG42. (C) The plasmid pNG27-2 was generated by internal ITR during DNA replication. However, in the case inserting an oligonucleotide bearing the Scel Site (SEQ. ID. of AdNGUS41 and AdNGUS43, but not AdNGUS2OITR2, NO.1, AB14265+SEQ. ID, NO.:2, AB14270) into the an unexpected band of -8.4 to 8.6 kb (indicated by the white BamHI site of plC4. The plasmid pNG41 was generated by circles) is present following infection of I-Sce expressing inserting the 1818 bp Xbal fragment from pNG29 into the cells. One feature common to both AdNGUS41 and AdN Xbal site of pNG27-2. pNG41 was used to generate the GUS43, but not AdNGUS20ITR2, is the presence of an SceI helper virus AdNGUS41 by in vivo homologous recombi site to the left of p. As illustrated in FIGS. 26 and 27, this nation following cotransfection into 293 cells with puMA71 feature may account for the presence of the novel -8.4 to 8.6 (Parks et al., 1996).The plasmid pNG43 was generated by kb band. Furthermore, in the case of AdNGUS41, an unex inserting the 1773 bp Xbal fragment from pNG42 into the pected band of ~2.7 kb is also present (indicated by the white Xbal site of pNG27-2. pNG43 was used to generate the triangle). A possible mechanism responsible for the presence helper virus AdNGUS43 by in vivo homologous recombi of this band is presented in FIG. 26. nation following cotransfection into 293 cells with 0039 FIG. 25. Illustration of in vivo I-SceI cleavage and pUMA71. (D) The plasmid pNG1.5ITR was constructed by rearrangement of AdNGUS2OITR helper virus genome fol replacing the 168 bp Xbal fragment in pNG15 with the 312 lowing infection of 293Cre cells expressing Sce. I-Sce bp Xbal fragment from pCEM7-NG15bITR. The plasmid cleavage of AdNGUS20ITR2 renders the genome unpack pNG15 was constructed in the same way as pNG14 (see agable due to the removal of . The resulting genome can FIG.22A) and differs from pNG14 only in the orientation Still replicate, and hence provide helper functions, by pan of the SceI oligo. The plasmid pCEM7-NG15b.ITR was handle formation using the internal ITR. This process results constructed in the same way as pGEM7-NG14bTR (see in a viral genome that, following Bst1107I digestion and FIG.22A) and differs from pCEM7-NG14b.ITR only in the Southern blot hybridization, produces the fragment indi orientation of the Scel oligo. The helper virus AdNG15ITR cated by the black triangle in FIG. 12. It can be seen that (FIG. 19) was generated by in vivo homologous recombi cleavage by I-Sce and use of an internal ITR to generate a nation between pNG1.5ITR and pUMA71 following their replicating viral DNA is highly efficient as there is relatively cotransfection into 293 cells. The plasmid pNGUS14-1 was little of the parental 4.4 kb band remaining. US 2002/0136708 A1 Sep. 26, 2002 0040 FIG. 26. Illustration of in vivo I-SceI cleavage and 0043 FIG. 29. Illustration of control of gene expression rearrangement of AdNGUS41 helper virus genome follow in cells of a transgenic animal by an I-Sce dependent ing infection of 293Cre cells expressing I-Sce. I-Sce molecular Switch. Expression cassettes can be readily engi cleavage of AdNGUS41 results in three fragments. Pan neered in cells or in transgenic animals. Such that gene handle repair using the internal ITR allows the genome to expression from Said cassettes can be regulated by I-Sce replicate and provide helper functions but the resulting mediate DNA cleavage and Subsequent double Strand break genome is unable to be packaged due to the absence of up repair. Such "molecular Switches' can be designed Such that (right part of Figure). Bst1107I digestion results in a 2.4 kb gene expression is Switched on or Switched off depending on fragment (black triangle in FIG. 24). The unexpected 2.7 kb the placement of the I-Sce recognition Sites. For example an band shown in lanes 5 and 6 of FIG. 24 (indicated by the expression cassette can be introduced into cells or animals white triangles) can arise as a consequence of the joining of Such that expression of a protein encoding, for example, fragments A and C following I-Sce cleavage. An Scel Site B-galactosidase, is blocked by positioning a Spacer DNA is unlikely to be recreated by this joining due to the between a promoter and the coding Sequences for Said incompatibility of the two half-sites, rendering this Species protein. I-Sce mediated excision and Subsequent double resistant to recleavage by I-Sce which may account for the Strand break repair results in excision of the Spacer and a relatively high intensity of the 2.7 kb band. The unexpected Switch on of expression. Alternatively, the cDNA encoding, ~8.6 kb band seen in FIG. 24 (indicated by the white circles for example B-galactosidase, could be flanked by Scel Sites in lanes 5 and 6) can be generated by the joining of so that Sce mediated DNA cleavage and double strand fragments B and C of one genome to the same fragments of break repair results in a Switch off of expression. Not meant another genome. The relatively high intensity of this band to be limiting as there are many ways to introduce Scel Sites Suggests that it does not contain any Scel Sites. Because into cellular DNA such that Sce mediated cleavage and repair of double Strand breaks, which this process exempli DNA fragment rejoining will result in rearrangements of fies, frequently results in loSS of a few nucleotides, loss of DNA that regulate gene expression. For example endog the Scel sites is not unexpected. The resulting DNA mol enous genes Such as those encoding oncogenes, tumor ecule indicated at the bottom of the Figure, can replicate and Suppressor genes, genes encoding Various proteins. Such as thus provide helper functions, but, while it retains up, it is not cytokines, enzymes and the like may be regulated by the expected to be packageable due to the distance of up from the methods described herein. genome terminus. I-Sce cleavage and fragment rejoining is Surprisingly efficient as can be seen from the intensities of 0044 FIG. 30. Use of SceI cleavage and double strand the various bands on the Southern blot. It can be seen that break repair or Cre-lox mediated excision for production of there is almost no parental, unprocessed viral DNA in lanes helper dependent vectors in a pX based System. In this 5 and 6 (no band at 4.4-4.5 kb), indicating that packageable example pX coding Sequences of a helper virus are flanked parental viral genomes have been virtually 100% eliminated. by either Scel sites or lox sites such that upon infection of Thus a helper virus with a packaging Signal flanked by Sce cells expressing I-Sce or Cre recombinase, respectively, the sites and optionally with an internal ITR may be a preferred pIX gene is excised resulting in abolition of pX expression. embodiment. A consequence is that the packaging capacity of the resulting virions (lacking pX) is diminished so that the helper virus 0041 FIG. 27. Illustration of in vivo I-SceI cleavage and genome is unable to package into virions. In contrast, the rearrangement of AdNGUS43 helper virus genome follow helper dependent vector genome is designed to be Suffi ing infection of 293Cre cells expressing I-Sce. I-Sce ciently Small that it is readily packaged in pX-Virions cleavage of AdNGUS43 renders it noninfectious due to its resulting in Virus preparations enriched for the helper depen inability to replicate in the absence of a terminal left end dent vector. ITR. Viral DNA replication, but not packaging, can be restored following panhandle formation using the internal 004.5 FIG. 31. Amplification kinetics of the helper ITR. The unexpected band of -8.4 kb shown in FIG. 24 dependent vector AdR-P1050. Amplification of AdRP 1050 (indicated by the white circles in lanes 8 and 9) can be using the indicated combination of cell line and helper virus generated by joining of fragment B of one cleaved genome was performed as described (Parks et al., 1996). Bfu, blue with the same fragment from another cleaved genome. This forming units, T, transfection, P1, passage 1, P2, passage 2, species likely lacks an Sce site. The viral DNA molecule P3 passage 3, P4, passage 4. generated by head to head joining can replicate but, as with the similar species illustrated in FIG. 26, is unable to 0046 FIG. 32. AdMSceI-encoded I-SceI can efficiently package because only packaging Signals located near the cleave an intrachromosomal recognition site in Vivo in ends of viral DNA molecules are functional. replication-permissive cells. Genomic DNA, extracted from AdMSceI-infected 293.1 cells, Add 170-3-infected cells or 0042 FIG. 28. Illustration of I-SceI cleavage and double mock-infected cells at 22 hours after infection were digested Strand break repair to regulate gene expression from a with HindIII and analysed by Southern hybridization with a molecular Switch in an Ad Vector. An Ad Vector can be neo probe. (A) Structure of integrated mMA2. Solid bars readily constructed wherein a cDNA is separated from a represent plasmid DNA with the region detected by the neo promoter by a spacer DNA that blocks expression of the probe in black. Thin lines represent chromosomal Sequences cassette and wherein the spacer DNA is flanked by Sce and arrows indicate the telomeric array in its orientation. Sites. I-Sce mediated cleavage and joining of the left and The products of cleavage with HindIII (H) and I-SceI (S) (2 right fragments of the viral DNA as illustrated effectively kb) or (H) alone (3 kb) are shown. (B) MOI and molecular results in excision of the Spacer and a Switch on of expres weights (in kb) are indicated. The cleavage activity in Sion, of B-galactosidase in the example shown here. percent cleaved molecules is shown below each lane. Mock US 2002/0136708 A1 Sep. 26, 2002 refers to DNA from mock-infected cells digested with (H), different tissueS (breast epithelium, colon, lymphocytes, while mock+ refers to the same DNA digested with (H) and etc.) or different species (human, mouse, etc.) are also useful commercial I-Sce. in the present invention. 0051. It is important in this invention to detect the DETAILED DESCRIPTION OF THE generation and expression of recombinant nucleic acids and PREFERRED EMBODIMENTS their encoded gene products. The detection methods used 0047 Any publications referenced herein are hereby herein include, for example, cloning and Sequencing, liga incorporated by reference in this application in order to more tion of oligonucleotides, use of the polymerase chain reac fully describe the state of the art to which the present tion and variations thereof (e.g., a PCR that uses 7-deaza invention pertains. It is important to an understanding of the GTP), use of Single nucleotide primer-guided extension present invention to note that all technical and Scientific assays, hybridization techniques using target-Specific oligo terms used herein, unless otherwise defined, are intended to nucleotides that can be shown to preferentially bind to have the same meaning as commonly understood by one of complementary Sequences under given Stringency condi ordinary skill in the art. The techniques employed herein are tions, and Sandwich hybridization methods. also those that are known to one of ordinary skill in the art, 0052 Sequencing may be carried out with commercially unless Stated otherwise. available automated Sequencers utilizing labeled primers or 0.048 Reference to particular buffers, media, reagents, terminators, or using Sequencing gel-based methods. cells, culture conditions and the like, or to Some Subclass of Sequence analysis is also carried out by methods based on Same, is not intended to be limiting, but should be read to ligation of oligonucleotide Sequences which anneal imme include all Such related materials that one of ordinary skill diately adjacent to each other on a target DNA or RNA in the art would recognize as being of interest or value in the molecule (Wu and Wallace, Genomics 4: 560-569 (1989); particular context in which that discussion is presented. For Landren et al., Proc. Natl. Acad. Sci. 87: 8923-8927 (1990); example, it is often possible to Substitute one buffer System Barany, F., Proc. Natl. Acad. Sci. 88: 189-193 (1991)). or culture medium for another, Such that a different but Ligase-mediated covalent attachment occurs only when the known way is used to achieve the same goals as those to oligonucleotides are correctly base-paired. The Ligase which the use of a Suggested method, material or composi Chain Reaction (LCR), which utilizes the thermostable Taq tion is directed. ligase for target amplification, is particularly useful for 0049. The terms used herein are not intended to be interrogating late onset diabetes mutation loci. The elevated limiting of the invention. For example, the term "gene’ reaction temperatures permits the ligation reaction to be includes cDNAs, RNA, or other polynucleotides that encode conducted with high Stringency (Barany, F., PCR Methods gene products. "Foreign gene’ denotes a gene that has been and Applications 1: 5-16 (1991)). obtained from an organism or cell type other than the 0053. The hybridization reactions may be carried out in a organism or cell type in which it is expressed; it also refers filter-based format, in which the target nucleic acids are to a gene from the same organism that has been translocated immobilized on nitrocellulose or nylon membranes and from its normal Situs in the genome. In using the terms probed with oligonucleotide probes. Any of the known “nucleic acid”, “RNA”, “DNA, etc., we do not mean to hybridization formats may be used, including Southern limit the chemical Structures that can be used in particular blots, slot blots, “reverse” dot blots, solution hybridization, StepS. For example, it is well known to those skilled in the Solid Support based Sandwich hybridization, bead-based, art that RNA can generally be substituted for DNA, and as silicon chip-based and microtiter well-based hybridization Such, the use of the term “DNA” should be read to include formats. this substitution. In addition, it is known that a variety of 0054 The detection oligonucleotide probes range in size nucleic acid analogues and derivatives is also within the between 10-1,000 bases. In order to obtain the required Scope of the present invention. "Expression' of a gene or target discrimination using the detection oligonucleotide nucleic acid encompasses not only cellular gene expression, probes, the hybridization reactions are generally run but also the transcription and translation of nucleic acid(s) in between 20°-60° C., and most preferably between 30-50 cloning Systems and in any other context. The term “recom C. AS known to those skilled in the art, optimal discrimi binase' encompasses enzymes that induce, mediate or facili nation between perfect and mismatched duplexes is obtained tate recombination, and other nucleic acid modifying by manipulating the temperature and/or Salt concentrations enzymes that cause, mediate or facilitate the rearrangement or inclusion of formamide in the Stringency washes. of a nucleic acid Sequence, or the excision or insertion of a 0055. The cloning and expression vectors described first nucleic acid Sequence from or into a Second nucleic acid herein are introduced into cells or tissues by any one of a Sequence. The “target site' of a recombinase is the nucleic variety of known methods within the art. Such methods are acid Sequence or region that is recognized (e.g., Specifically described for example in Sambrook et al., Molecular Clon binds to) and/or acted upon (excised, cut or induced to ing: A Laboratory Manual, Cold Spring Harbor Laboratory, recombine) by the recombinase. The term “gene product” New York (1992), which is hereby incorporated by refer refers primarily to proteins and polypeptides encoded by ences, and in Ausubel et al., Current Protocols in Molecular other nucleic acids (e.g., non-coding and regulatory RNAS Biology, John Wiley and Sons, Baltimore, Md. (1989), such as tRNA, sRNPs). The term “regulation of expression” which is also hereby incorporated by reference. The methods refers to events or molecules that increase or decrease the include, for example, Stable or transient transfection, lipo Synthesis, degradation, availability or activity of a given fection, electroporation and infection with recombinant viral gene product. VectOrS. 0050. The present invention is also not limited to the use 0056. The protein products of recombined and unrecom of the cell types and cell lines used herein. Cells from bined coding Sequences may be analyzed using immune US 2002/0136708 A1 Sep. 26, 2002 techniques. For example, a protein, or a fragment thereof is 0062. In addition to microorganisms, mammalian tissue injected into a host animal along with an adjuvant So as to cell culture is used to express and produce the polypeptides generate an immune response. Immunoglobulins which bind of the present invention. Eukaryotic cells are preferred, the recombinant fragment are harvested as an antiserum, and because a number of Suitable host cell lines capable of are optionally further purified by affinity chromatography or Secreting intact human proteins have been developed in the other means. Additionally, Spleen cells may be harvested art, and include the CHO cell lines, various COS cell lines, from an immunized mouse host and fused to myeloma cells HeLa cells, myeloma cell lines, Jurkat cells, and So forth. to produce a bank of antibody-Secreting hybridoma cells. Expression vectors for these cells include expression control The bank of hybridomas is screened for clones that secrete Sequences, Such as an origin of replication, a promoter, an immunoglobulins which bind to the variant polypeptides but enhancer, and necessary information processing sites, Such poorly or not at all to wild-type polypeptides are Selected, as ribosome binding sites, RNA splice Sites, polyadenylation either by pre-absorption with wild-type proteins or by Sites, and transcriptional terminator Sequences. Preferred Screening of hybridoma cell lines for Specific idiotypes that expression control Sequences are promoters derived from bind the variant, but not wild-type, polypeptides. immunoglobin genes, SV40, Adenovirus, Bovine Papilloma Virus, Herpes Virus, and so forth. The vectors containing the 0057 Nucleic acid sequences capable of ultimately DNA segments of interest (e.g., polypeptides encoding a expressing the desired variant polypeptides are formed from variant polypeptide) are transferred into the host cell by a variety of different polynucleotides (genomic or cDNA, well-known methods, which vary depending on the type of RNA, Synthetic olignucleotides, etc.) as well as by a variety cellular host. For example, calcium chloride transfection is of different techniques. commonly utilized for prokaryotic cells, whereas calcium 0.058. The DNA sequences are expressed in hosts after phosphate treatment or electroporation is useful for other the Sequences have been operably linked to (i.e., positioned cellular hosts. to ensure the functioning of) an expression control sequence. 0063. The method lends itself readily to the formulation These expression vectors are typically replicable in the host of test kits for use in diagnosis. Such a kit comprises a carrier organisms either as episomes or as an integral part of the compartmentalized to receive in close confinement one or host chromosomal DNA. Commonly, expression vectors more containers wherein a first container contains reagents contain selection markers (e.g., markers based on tetracy useful in the localization of the labeled probes, Such as cline resistance or hygromycin resistance) to permit detec enzyme Substrates. Still other containers contain restriction tion and/or selection of those cells transformed with the enzymes, buffers etc., together with instructions for use. desired DNA sequences. Further details can be found in U.S. 0064. The recombinant Ad vectors described herein are Pat. No. 4,704,362. Significantly different from previously described constructs. 0059 Polynucleotides encoding a variant polypeptide They combine the use of vectors having deletions of all or include Sequences that facilitate transcription (expression most of the viral genes with helper viruses that are designed Sequences) and translation of the coding sequences Such that So that, when used in coinfections with vector viruses, Said the encoded polypeptide product is produced. Construction helper Viruses are able to complement the growth of the of such polynucleotides is well known in the art. For vectors but are unable to package their viral DNA into example, Such polynucleotides include a promoter, a tran infectious virions. Thus vector viruses can be prepared Scription termination site (polyadenylation site in eukaryotic substantially free of helper virus. expression hosts), a ribosome binding site, and, optionally, 0065 For viral DNA replication and packaging of viral an enhancer for use in eukaryotic expression hosts, and DNA into virion particles, only three regions of the viral optionally, Sequences necessary for replication of a vector. DNA are known to be required in cis. These are the left inverted terminal repeat, or ITR, (bp 1 to approximately 0060 E. coli is one prokaryotic host useful particularly 103) the packaging signals (approximately 194 to 358 bp) for cloning DNA sequences of the present invention. Other (Hearing and Shenk, 1983, Cell 33: 695-703; Grable and microbial hosts Suitable for use include bacilli, Such as Hearing 1992, J. Virol. 64; 2047-2056) and the right ITR. All Bacillus Subtilus, and other enterobacteriaceae, Such as other regions of the Viral genome appear to be required only Salmonella, Serratia, and various Pseudomonas Species. to produce viral products that act in trans to allow viral Expression vectors are made in these prokaryotic hosts replication and production of infectious viruses. Thus if all which will typically contain expression control Sequences essential viral proteins and RNA could be provided by a compatible with the host cell (e.g., an origin of replication). helper virus, a vector could be designed and constructed that In addition, any number of a variety of well-known promot could have most of the viral DNA deleted save for those erS are used, Such as the lactose promoter System, a tryp Sequences mentioned above that are required in cis for viral tophan (Trp) promoter System, a beta-lactamase promoter DNA replication and packaging. System, or a promoter System from phage lambda. The promoters typically control expression, optionally with an 0066. It will be appreciated that the specific advance operator Sequence, and have ribosome binding site ments provided by the present invention have Significance in the limitation of the level helper adenovirus contamination Sequences, for example, for initiating and completing tran of helper dependent adenovirus vector preparations. To this Scription and translation. end, those skilled in the art will recognize that there exist 0061. Other microbes, such as yeast, are used for expres endonucleases, Such as the meganuclease I-Sce (Omega Sion. Saccharomyces is a Suitable host, with Suitable vectors nuclease, commercially available from BOEHRINGER having expression control Sequences, Such a promoters, MANNHEIM, catalog numbers 1497235 and 1362399), including 3-phosphoglycerate kinase or other glycolytic hereinafter referred to as SceI or I-SceI, which recognize and enzymes, and an origin of replication, termination Specifically cleave DNA sequences that are not represented Sequences, etc. as desired. in the Ad genome and which are Sufficiently long that Said US 2002/0136708 A1 Sep. 26, 2002 Sequences would not be predicted to exist in the human 0070. In a further embodiment of this invention, the genome, or would appear infrequently in the human endonuclease System described above is combined with the genome. Therefore Said nuclease may be expressed consti Cre/lox system disclosed according to U.S. Pat. No. 5,919, tutively in human cells without deleterious effects. Existence 676, in order to further reduce the degree of helper virus of a few sites in the human genome is non-lethal to cells contamination in HDV preparations. Cells expressing both expressing a nuclease Such as Sce, because repair of Cre and an appropriate endonuclease, Such as 293 cells that double-strand breaks in mammalian cell DNA is very effi express both Cre and Sce, are preferably employed for this cient. Therefore double strand breaks induced by SceI are purpose. According to this embodiment of the invention, a “healed' and Surviving cells that continue to express Sce helper virus is constructed wherein a lox site is positioned on endonuclease or like endonucleases may be isolated. Those either Side of the packaging Signal. An embedded ITR is skilled in the art will appreciate that Scel is merely an placed to the right of the innermost loX Site. An appropriate example not meant to be limiting. Other endonucleases exist endonuclease recognition Site is placed to the right of the which meet the criteria of having long and infrequently packaging Signal, either between the two lox sites, or to the expressed recognition sites. Furthermore, new endonu right of the innermost lox site, but to the left of the cleases continue to be discovered, and Such endonucleases embedded ITR. Alternatively, both the Scel site and adjacent and their specific recognition sites could likewise be internal ITR are placed between the packaging Signal and employed according to the present invention. the innermost loxPsite. In this manner, if the Cre/lox system 0067 Because of the processes by which the adenovirus “leaks” and helper virus containing packaging Signal would genome is replicated in mammalian cells, inverted terminal otherwise contaminate the HDV preparation, the presence of Sequences, ITRS, can be inserted at internal Sites within the the endonuclease recognition Site provides a “fail-Safe” Ad genome and Such internal ITRS can be used in a “repair” mechanism by which residual helper virus containing pack proceSS during Ad DNA replication Such that the internal aging Signal is prevented from forming virions. An example ITR becomes a true terminus or functional ITR used in of a Suitable helper virus for use in Such a combination is initiation of Ad DNA replication, (see FIG. 6 of “Charac illustrated in FIG. 3. In this embodiment of the invention, an terization of an adenovirus type 5 mutant carrying embedded SceI site is located between the loXPSites which in turn flank inverted terminal repeats,” Haj-Ahmad, Y. and Graham, F. the packaging Signal. Helper virus genomes in which the L. Virology. 153, 22-34, 1986, hereby incorporated by ref packaging Signal has not been excised through the action of erence for this purpose). The invention described herein Cre are Susceptible to Sce cleavage as shown in the lower combines the properties of rare cutting endonucleases, Such right of the illustration. Therefore the low number of helper as Sce I, and the above mentioned properties of the aden Virus genomes that escape Cre mediated excision of up is ovirus to provide a novel system for production of HDV further reduced in number by Scel cleavage. preparations Substantially free of helper virus contamina 0071. Because of the surprisingly high efficiency with tion. which we have found DNA fragments generated by Sce cleavage can be joined in various ways, it will be appreci 0068 The essential elements of this invention may be ated by those skilled in the art, based on the present best understood with reference to FIGS. 1 and 2. A helper disclosure, that a number of possible uses for Sce cleavage Virus, referred to herein as AdSceIcut, is constructed Such become possible. First, it will be seen that since the viral that an Scel or like endonuclease recognition site is disposed DNA species formed by joining of fragments A and C in to the right of the helper virus packaging Signal (up). An FIG. 26 is an abundant species, and since this molecule internal ITR Sequence is inserted to the right of the endo lacks a packaging Signal, a helper Virus containing a pack nuclease recognition site, as shown in FIG. 1. Preferably, the aging Signal flanked by Scel Sites is a preferred embodiment helper virus, AdSceIcut, includes a deletion of E1 of the invention. The helper virus may optionally carry an Sequences. This would facilitate helper virus propagation in internal ITR So that in the absence of A/C joining, panhandle 293 cells or any other host cells which support the replica formation and repair illustrated on the right portion of FIG. tion of E1 deleted viruses. Optionally, the helper virus may 26, can generate a DNA molecule that is able to replicate. retain E1 to the right of the Sce site and the internal ITR. Second, it will be seen that any DNA fragment in a viral 0069. Infection of cells expressing Sce, such as 293Sce genome can be flanked by Scel Sites and the process of Sce cells, results in cleavage by Sce endonuclease at the Sce cleavage followed by double Strand break repair resulting in site. The result would be inactivation of the DNA molecule rejoining of viral DNA fragments from the left and the right with respect to DNA replication, Since replication requires of the fragment that was flanked by Scel sites effectively ITRs at each end of the molecule. However, by virtue of the results in excision of the flanked fragment. Consequently it insertion of an internal ITR to the right of the endonuclease is possible to create a molecular Switch for regulation of recognition Site, the helper virus is repaired by annealing of gene expression that is operationally virtually identical to said internal ITR to an external ITR at the right end of the that based on Cre-lox recombination described by Anton and DNA, resulting in the formation of a functional ITR at the Graham (Anton, M. and Graham, F. L. Site-specific recom left end of the molecule. Thus a DNA molecule competent bination mediated by an adenovirus Vector expressing the for viral DNA replication is efficiently generated. While the Cre recombinase protein: a molecular Switch for control of resulting molecule is capable of replicating, it lacks the gene expression. J. Virol. 69:4600-4606, 1995.) and in U.S. packaging Signal needed for production of Virions. There application Ser. No. 08/486,549 Filed Jun. 7, 1995, but fore, as illustrated in FIG. 2, a helper adenovirus (e.g. which is dependent on Sce mediated rather than Cre-lox AdScelcut) containing an appropriate endonuclease recog mediated excision. An example not meant to be limiting is nition site, Such as an Scel Site Serves as a useful helper virus illustrated in FIG. 28. In this example I-Sce mediated for production of Substantially helper-free helper dependent cleavage followed by rejoining of the left-most and right adenovirus vectors (HDVs). most Viral DNA fragments results in a viral genome con US 2002/0136708 A1 Sep. 26, 2002 taining a functional expression cassette for production of Coinfection of 293SceI cells with the vector and helper B-galactosidase. Such a cassette need not be located in the results in SceI mediated cleavage of the helper virus DNA as E1 region but could equally be engineered in E3 or else shown. The internal ITR positioned to the right of the Sce where in the viral genome. Other viruses Such as herpes Site is repaired, resulting in a DNA molecule that is repli Viruses, papilloma viruses, pox viruses and the like could be cated and amplified. However, due to the lack of a packaging Similarly engineered. Signal, the helper viral DNA cannot be packaged into 0.072 Furthermore, an adenovirus or other virus or a Virions. The replicating but non-packageable helper virus plasmid DNA expressing I-Sce could be delivered to cells DNA provides all of the trans-acting functions necessary for or to an animal whose genome contains Scel Susceptible replication of the vector (which lacks all or most Viral genes Sites and expression of I-Sce will result in cleavage of Said but retains those viral DNA sequences necessary in cis for Sites. Repair by joining of DNA ends can result in a DNA replication and packaging) and for formation of virion chromosome with the structure illustrated in FIG. 29 particles. Subsequent rounds of amplification of the vector wherein the Sce cleavage followed by double strand break in 293SceI cells coinfected with AdSce helper virus result repair effectively results in excision of a DNA fragment and, in production of large amounts of helper free helper depen in the example shown, Switches expression of a gene, Such dent vector. as B-galactosidase or any other gene, on or off. Because the double Strand break repair mechanism is imperfect, the Sce Example 3 cleavage Site would only rarely be regenerated and conse Combined Cre/LOX Endonuclease System for quently the reaction would be essentially irreversible. Production of Helper Dependent Adenovirus 0073. It will be appreciated by those skilled in the art, Vectors based on the present disclosure, that wherever we use I-Sce endonuclease or Scel Sites we could use any other site 0.077 FIG. 3 illustrates the use of a helper virus which Specific endonuclease that could be expressed in mammalian includes the Cre/lox System in combination with an endo cells and that can be used to cut Specific Sequences in a nuclease, an endonuclease target Sequence and an embedded DNA. Thus, the examples with I-Sce are not meant to be ITR for production of helper free helper dependent vectors. limiting. Similarly where we use Cre-lox we could equally To construct this virus an Scel or like endonuclease recog use FLP-FRT or like site specific recombinase systems. nition site is placed between loX sites flanking the packaging signal and an internal ITR is inserted to the right of the 0.074 Having generally described this invention, the fol Second lox site. In a preferred embodiment, the Scel Site is lowing examples are included herein to provide additional placed to the right of the packaging signal, but to the left of written description and enablement for Specific embodi the Second loxPSite. Alternatively, the endonuclease recog ments of the disclosed invention. The invention, however, nition site is placed to the right of the internal lox Site but to should not be interpreted as being limited to the Specifics of the left of the internal ITR, or both the SceI site and the these examples. Rather, the Scope of this invention is to be embedded ITR are positioned between the packaging Signal determined from the complete disclosure and the claims and the rightmost loxP site. Infection of 293Cre cells which appended hereto. results in efficient but incomplete excision of the packaging Signal provides a Small but Significant number of helper EXAMPLES viruses that “escape” Cre mediated excision. Use of 293 cells expressing both Cre and Scel minimizes the number of Example 1 residual helper Viruses that can be packaged through the action of the Sce endonuclease. Endonuclease Cleavage of Helper Virus 0075 FIG. 1 shows an adenovirus containing an Scel site Example 4 near the left end of the viral genome and positioned to the right of the packaging Signal, , illustrating the effects of Construction of Shuttle Plasmids Containing Sce cleavage and ITR repair. Infection of 293SceI cells Endonuclease Recognition Sites and Embedded results in a double strand break in the DNA as a result of ITR Sites Scel endonuclease activity. Because the adjacent, embedded ITR is repaired by panhandle formation (annealing with the 0078 FIG. 4 illustrates the construction of a shuttle right ITR) a functional DNA molecule is formed that is plasmid derived from p.a. 1SP1A wherein an SceI recogni capable of replicating but which lacks the packaging Signal tion site is introduced adjacent to the packaging Signal followed by insertion of an ITR sequence. PAE1SP1A and consequently cannot be packaged into virions. (commercially available from Microbix Biosystems) is a Shuttle plasmid that contains Ad Sequences from the left end Example 2 of the genome (approximately nts 1 to 354 including the left Propagation of Helper Dependent Adenovirus ITR and the packaging signal) a polycloning site including EcoRV, EcoRI and Sall sites, and additional Ad sequences Vector and Elimination of Helper Virus from nts approximately 3540 to 5790 and is useful for rescue Contamination via Endonuclease Cleavage of genes or mutations into the left end of the Ad genome. A 0.076 FIG. 2 illustrates propagation of a helper depen Synthetic oligonucleotide containing an Sce recognition site dent Advector from which all or most of the viral genes have (FIG. 4a) was inserted into the EcoRV site to generate been deleted and substituted with foreign DNA and “stuffer” pNG20, as illustrated. Subsequently pNG20ITR was con DNA. The stuffer DNA is used to maintain an optimal size structed by inserting a PCR amplified ITR (FIG. 5) into the of the vector's genome to maximize efficiency of packaging. EcoRI/Sal Site. US 2002/0136708 A1 Sep. 26, 2002 Example 5 Anton, M., Sankar, U., Rudnicki, M. A. and Graham, F. L. A new helper-dependent adenovirus vector System: removal Oligonucleotides Useful in Constructing Helper of helper virus by Cre-mediated excision of the viral pack Viruses According to this invention aging signal. Proc. Natl. Acad. Sci. U.S. 93:13565-13570, 007.9 FIG. 4a illustrates the sequence of oligonucle 1996, hereby incorporated by reference for this purpose). otides used to generate the Sce recognition Site in pNG15 The Swal fragment of pDC8 bearing the neogene was (FIG. 6) and pNG20 (FIG. 4), the sequence of oligonucle replaced with an oligonucleotide containing the Sce recog otides used for PCR amplification of adenovirus ITRs (FIG. nition site by ligation of oligo AB14265/AB14270 (FIG. 5) and the sequence of oligonucleotides used for PCR 4a), SEQ ID Nos. land 2, into Swal digested pLC8 to amplification of a hygromycin resistance gene (FIG. 9). The generate pNG15. The plasmid pNG15ITR was then obtained oligonucleotides AB 14265, SEQ ID NO. 1, and AB 14270, by inserting a PCR amplified ITR (FIG. 5) into the HincII/ SEQ ID NO. 2, were hybridized to create an Sce recogni PstI site of pNG15. tion site indicated in bold. An AflI site (5'CTTAAG3), Example 8 indicated in italics, was included to facilitate Screening for recombinant plasmids bearing the Sce recognition site. Construction of Helper Virus Using Shuttle Oligonucleotides AB15136, SEQ ID NO.3, and AB15137, Plasmids Containing Endonuclease Recognition SEQ ID NO. 4, were used to produce an ITR (FIG. 5) for Sites and Embedded ITR Sites cloning into pNG20 (FIG. 4). Oligonucleotides AB15051, SEQ ID NO. 5, and AB15052, SEQ ID NO. 6, were used to 0084 FIG. 7 illustrates the structure of new helper produce an ITR (FIG. 5) for cloning into pNG15 (FIG. 6). viruses derived by cotransfection of 293 cells with Oligonucleotides AB14905, SEQ ID NO. 7, and AB14906, pBHG10luc and the shuttle plasmids of FIGS. 4 and 6. The SEQ ID NO. 8, were used for PCR amplification of a helper virus AdLC8cluc was generated by cotransfection of hygromycin resistance gene (FIG. 9). 293 cells with the shuttle plasmid pLC8c and the Ad genomic plasmid pBHG10luc and has been described in Example 6 detail elsewhere (Parks et al., 1996). The packaging signal (p) in AdLC8cluc is flanked by loxP sites. The helper virus PCR Production of ITR for Embedded Insertion AdNG15 was generated by cotransfection of 293 cells with into a Helper Adenovirus the shuttle plasmid pNG15 and p3HG10luc. The structure of AdNG15 is identical to AdLC8cluc except for the presence 0080 FIG. 5 illustrates the use of PCR to amplify of an Sce recognition Site immediately to the right of the adenovirus ITRs from the plasmid padh1 HelperpX packaging Signal. The helper Virus AdNG15ITR was gen 0081 (A) PCR was used to amplify a complete wild type erated by cotransfection of 293 cells with the shuttle plasmid ITR from the plasmid padHV1 HelperpX with primers pNG1.5ITR and pBHG10luc. The structure of AdNG15ITR AB15136 (5'-CGGATCCAAGCTTGCGAGATCGAATTC is identical to AdNG15 except for the presence of an ITR 3), SEQ ID NO.3, and AB15137 (5'-GCCTAGGTCGA immediately 3' of the rightward loxP site. The helper virus CACTCCGCCCTAAAAC-3), SEQ ID NO.4. The plasmid AdNG20ITR was generated by cotransfection of 293 cells pAdHV1 HelperpX is an Ad genomic plasmid that is with pNG20ITR and pBHG10luc. An I-SceI recognition deleted of EI, pIX and E3 with ITRs that can be liberated by site, followed by an ITR, reside immediately downstream of PacI digestion (constructed by Andy Bett, Merck Inc.). One the packaging signal in AdNG20ITR. skilled in the art will appreciate that any plasmid carrying a complete ITR could equally serve as a source of an ITR for Example 9 PCR amplification or adenovirus DNA could equally be used. The 165bp PCR product was digested with EcoRI and Demonstration that Endonuclease Recognition SalI and cloned into the EcoRI/SalI sites of the plasmid System is Operative pNG20 to generate pNG20ITR (FIG. 4). 0085 FIG. 8 Provides an Analysis of I-SceI cleavage of 0082 (B) Primers AB15051 (5'-GGATATCTGCA AdNG15 in A549 cells: GATCTACTCCGCCCTAAAAC-3), SEQ ID NO.5, and 0086) (A) AdMSceI is an Ad vector that expresses the AB15052 (5'-CCTCGAGTCGACGCGAGATCGAATTC endonuclease Sce. AdNG15 is a helper virus bearing an 3"), SEQ ID NO.6, were used to produce a 168 bp PCR Scel recognition site adjacent to the packaging signal (up), product that was subsequently digested with Pst and HincII both of which are flanked by loxPsites (FIG. 7). The left end and cloned into the Pst/HincII sites of the plasmid pNG15 of the AdMSceI genome is included in a 4172 bp Bst1107I to generate pNG1.5ITR (FIG. 6). fragment. The left end of the AdNG15 genome is included in a 2830 bp Bst1107I fragment which is easily separable Example 7 from the corresponding left end fragment of AdMSceI by agarose gel electrophoresis. Construction of Helper Virus Containing a Floxed Packaging Signal, an Endonuclease Recognition 0.087 (B) To determine whether the SceI recognition site Site and an Embedded ITR in the AdNG15 genome was susceptible to cleavage by Sce in vivo, semiconfluent monolayers of A549 cells were 0083 FIG. 6 illustrates the construction of a shuttle infected with AdMSceI at an moi=10. Twenty four hours plasmid derived from pl. C8 wherein an Scel recognition site later (designated as 0 hr in FIG. 8), the monolayers were is introduced adjacent to the floxed packaging Signal fol infected with AdNG15 at an moi=10. A549 cells were also lowed by insertion of an ITR sequence to the right of the infected with either AdMSceI or AdNG15 alone to serve as second lox site. (pLC8 is described in Parks, R. J., Chen, L., controls. At the indicated times post infection, viral DNA US 2002/0136708 A1 Sep. 26, 2002 was extracted from the infected cells, digested with Vectors Generated from Helper Viruses and Helper Depen Bst1107I and analyzed by Southern blotting with probe dent Vectors”), published as WO98/13510, and the endonu fragment B (a 1157 bp BstXI/Bst1107I fragment from clease System of the present invention, for production of a pXCJL1 (Microbix Biosystems)) to determine whether helper dependent vector Substantially free of helper virus. AdNG15 had been cleaved by SceI. Cleavage of AdNG15 by Sce, is expected to convert the 2.8 kb Bst1107I to a 2.4 0091. According to this aspect of the invention, a helper kb I-SceI/Bst1107I fragment. The expected 2.4 kb fragment Virus, named AdLC8ApIXSceI, comprising a genome of is clearly visible even at the earliest time after AdNG15 greater than about 35 kb and less than about 37 kb is infection of cells previously infected with AdMSce, but is produced, (if need be by insertion of “stuffer" DNA as not present in DNA from singly infected cells. Thus Sce I shown), including an SceI endonuclease recognition site, expressed by the virus AdMSceI is clearly capable of which is inserted 3' to the adenoviral packaging Signal, as cleaving the Sce I site in AdNG15. described in the foregoing examples and written description. On either side of Said packaging Signal and Said endonu Example 10 clease recognition site is inserted a loxP recognition site for the Cre recombinase, as described in the foregoing examples Construction of a Plasmid Expressing Sce and in WO96/40955. As described above, an embedded ITR Endonuclease and Hygromycin Resistance for is inserted on the 3' side of the internal loxp Site, to permit Transformation of Cells repair following excision of the packaging Signal and left 0088 As illustrated in FIG. 9, the plasmid pEM2 was hand ITR. In addition, a deletion in the adenovirus gene constructed by cloning an EcoRI/Sal fragment containing encoding the pX gene product is introduced into the helper the EMCV IRES into the EcoRI/Sall sites of pBluescript adenoviral genome, as described in WO98/13510. (Stratagene; see FIG. 9a). The plasmid pMH4SceI was 0092. A cell which expresses pX and E1 is produced, to constructed by cloning the 853 bp EcoRI/Sall fragment complement the deficiency in the helper virus, Such that a containing the I-Sce gene from a plasmid containing the helper virus having a genome of greater than 35 kb may be Sce I gene, pCMV-I-Sce (Rouet P. Smih F, Jasin M Expres efficiently packaged, in Spite of the absence of a functional Sion of a Site-specific endonuclease Stimulates homologous pIX gene in Said adenovirus genome. 293 cells are known to recombination in mammalian cells. Proc Natl Acad Sci US complement E1 deficiencies in adenoviruses. In addition, A Jun. 21, 1994;91 (13):6064-6068), into the EcoRI/SalI cells such as the VK2-20(pIX+) cell line have been produced sites of pMH4 (available from Microbix Biosystems).) The and shown to complement pIX deficiency. Such cells are plasmid pNG18 was constructed by cloning the Klenow used for the propagation and rescue of the helper adenovirus, treated 1393 bp Xbal/Sal fragment from pMH4SceI into the constructed as described herein. SmaI site of peM2. The hygromycin coding Sequence and TK polyA was amplified by PCR using the primers 0093. The AdLC8ApIXSceI helper virus is co-infected or AB14905 (5'-GGGGGGTCATGAAAAAGCCTGAACTC transfected, in plasmid form, into 293CreSceI(pIX-) cells, 3), SEQ ID NO. 7, and AB14906 (5'-GGGGGGGTCGAC along with a helper dependent adenovirus vector having a CAGACCCCACGCAACG-3"), SEQ ID NO. 8, to obtain a genome of between about 20-35kb. Such cells are produced 1415bp product from pCEP4 (Invitrogen). The PCR product from 293 cells by transfection of a plasmid encoding the Cre was cloned into the NcoI/SalI sites of pNG18 following recombinase, and drug resistance, followed by Selection of digestion with BspHI/SalI to generate pNG 19. The plasmid drug resistant cells and Screening for cells which stably pNG19-1F was constructed by replacing the 1327 bp express the Cre recombinase. An identical Strategy is BsmBI/SalI fragment from pNG19 with the 1481 bpBSnBII/ employed to develop a cell line which stably expresses the Sall fragment from pCEP4. Sce endonuclease. 0089 FIG. 9a. Construction of an EMCV IRES cloning 0094. The co-infected or co-transfected or electroporated shuttle plasmid. PEM2 (used in the cloning illustrated in cells excise packaging Sequence from the helper virus at an FIG. 9) was constructed from the Blue script plasmid efficiency of about 90%, preventing that percentage of pBSKS-(Statagene) and the EMCV IRES (Encephalomyo helper virus from being packaged into virions. The helper carditis Virus Internal Ribosome Entry Site) containing dependent vector is unaffected, due to the absence of loxP plasmids pCITE-1 and pCITE-2a (Novagen, U.S. Pat. No. Sites flanking its packaging Signal. 4.937,190) as shown. 0095) Any helper virus which escapes Cre-mediated Example 11 excision of the packaging Signal is prevented from being packaged, due to the excessive size of the helper adenovirus Preparation of A Helper Dependent Adenovirus genome, and the absence of available pX gene product, Vector Substantially Free of Helper Virus either from the viral genome or from the cell. Contamination Due to Concurrent Limitation of Helper Virus Packaging by Three Mechanisms 0096 Finally, any helper virus which escapes Cre-medi ated excision and which might otherwise be packaged, Such 0090 FIG. 10 illustrates a method for combining the as through genomic deletions which produce a genome of Cre/loxP System of copending patent application Ser. No. less than about 35 kb in length, are Subject to Sce cleavage 08/473,168 (hereby incorporated by reference, entitled of the packaging Signal, and ITR repair for continued trans “Adenoviral Vector System Comprising Cre-LoxP Recom provision of functions necessary for replication and pack bination”), published as WO96/40955, the pIX system of aging of the helper dependent vector. Thus, the only virions copending patent application Ser. No. 08/719,217, (hereby that are produced, including through reamplification in the incorporated by reference, entitled “Improved Adenovirus 293CreSceI cells, are helper dependent vector constructs. US 2002/0136708 A1 Sep. 26, 2002 Example 12 tions of pMH4SceI and the sequence of the region in question are shown in FIG. 11. The plasmid pCMV-I-Sce Production and USE of Helper Adenovirus Having obtained from M. Jasin, Sloane-Kettering, was found to Transposed Packaging Signals contain the same frame shift mutation (a missing A in a String of 10 A's in the nuclear localization signal (nls) that 0097. Following the procedures of Hearing, P., and Jasin and coworkers had engineered at the 5' end of the Shenk, T., Cell 33:695-703, (1983), helper adenovirus is I-Sce coding Sequences). That we obtained any activity at produced wherein the packaging Signal, an endonuclease all was probably due to either reinitiation of translation at a recognition Signal as described herein, and any loXP, FRT, or downstream ATG or to ribosome slippage during translation like recognition sites for Cre, FLP, or like recombinases, through the String of A's in the nls. In any case, we respectively, are transposed to the right end or another concluded that we might be able to improve the levels of location in the helper adenoviral genome. By maintaining I-Sce activity in transformed cell lines if we corrected the the relative orientation of these elements, Similar activity of mutation, and at the Same time we decided to improve the the endonuclease, recombinase and pX helper virus pack Kozak sequence Since that in the original Jasin construct was aging control Systems described herein is expected, based on not an optimal Kozak sequence. The resulting plasmid, the methods and helper adenoviral constructs disclosed pNG26i (FIG. 12A), was used to transform 293Cre4 cells herein. Accordingly, those skilled in the art of adenoviral (U.S. Pat. No. 5,919,676 and Chen, L., Anton, M. and vector preparation will appreciate that, based on the instant Graham, F. L. Production and characterization of human 293 disclosure, various modifications in the precise location of cell lines expressing the Site-specific recombinase Cre. the various elements that comprise the helper adenovirus Somat. Cell and Molec. Genet. 22: 477-488, 1996.), and may be made without adversely affecting the functionality of hygromycin resistant cell lines were isolated (FIG. 13) and the methods taught herein for production of helper depen analyzed for I-Sce expression in a functional assay that dent adenoviral vector preparations, Substantially free of measured I-Sce mediated cleavage of Viral DNA containing packaged helper adenovirus. an SceI site (FIG. 14) and directly for I-SceI protein Example 13 production by Western blot hybridization (FIG. 15). Several transformed cell lines expressed Satisfactory levels of I-Sce, and two of these, 2-16 and 4-7, were selected for further Production of Cells Expressing Endonuclease experiments. We also rescued the I-Sce gene with the 0.098 Those skilled in the art will appreciate that a corrected DNA sequence and the optimized Kozak sequence number of techniques are available for production of cells into an Ad expression vector (AdNG24i) by cotransfection expressing appropriate endonucleases for use according to of 293 cells with pNG24i (FIG. 12A) and pBHG10. Both this invention. Such methods may depend on use of an the cell lines and the vector expressed much higher levels of antibiotic or other resistance marker. We have found that it functional I-Sce than did their counterparts that carried the may be desirable to use a mutated or attenuated resistance frame shifted mutant I-Sce construct. marker gene in order to drive up the copy number of the vector encoding, and therefore the level of expression of Example 15 Sce. It should also be appreciated that cells used according to this invention are not limited to 293 cells. 293Cre cells, Helper Viruses may be used, as may any other cell which complements, for example, E1. Cells known in the art that may be used 0100 FIG. 7 herein illustrates the structure of several according to this invention, upon introduction of expressible helper virus genomes containing Scel Sites at the left end. endonuclease coding Sequences, include, but are not limited These were shown to be susceptible to I-Sce cleavage and to PER-C6 cells (see Fallaux, et al., “New Helper Cells and the internal ITRS of AdNG1.5ITR and AdNG2OITR were Matched Early Region 1-Deleted Adenovirus Vectors Pre shown to produce functional ends after I-Sce cleavage by vent Generation of Replication-Competent Adenoviruses,” panhandle formation (ITR annealing) and ITR repair (FIG. Hum. Gene Ther. Sept. 1, 1998;9(13):1909-1917), and 911 1). However, during propagation of these helpers in 293 cells, (Fallaux, et al., “Characterization of 911: A New cells we found that the internal ITR also resulted in rear Helper Cell Line for the Titration and Propagation of Early rangements that resulted in tandem amplification of the DNA segment between the extreme end of the parental Region 1-Deleted Adenoviral Vectors,” Hum. Gene Ther. genome and the internal ITR. This could occur via mecha Jan. 20, 1997;7(2):215-222). nisms illustrated in FIG. 16 resulting in variant viral Example 14 genomes of the kind illustrated in FIG. 17 wherein the helper virus AdNG20ITR is propagated in 293 cells and Successive rounds of panhandle formation and extension of Cell Lines Expressing I-Sce the sort illustrated in FIG. 16 results in viruses with various 0099. After constructing pNG19-1F and using it to trans tandem repetitions of the DNA segment containing an ITR, form 293 and 293Cre cells and after establishing and char a packaging Signal, and an Scel Site. Similar repeats are acterizing a number of transformed cell lines, we discovered present at the right end of the genome but are not illustrated that I-Sce activity in Said lines, though detectable, was low. in the Figure. Formation of variant viruses with multiple To determine the reasons for this we sequenced the I-Sce copies of the packaging Signal and I-Sce Site and internal expression cassette in pNG19-1F and its parent pMH4Sce ITR was deemed undesirable because it would result in a (FIG. 9) and discovered that the I-SceI construct had a requirement for increased levels of I-Sce enzyme to ensure mutation in the 5' end that introduced a frame shift and a complete digestion of helper virus DNA. Therefore, we termination mutation that resulted in lower than desired redesigned the helper viruses to prevent duplication of I-Sce expression levels. The structure of the relevant por terminal DNA segments. This was accomplished by intro US 2002/0136708 A1 Sep. 26, 2002 duction of “stuffer' DNA sequences between up and the parental 4.4 kb fragment. However, two additional frag internal ITR Such that duplication of the resulting DNA ments of approximately 2.7 kb and 8.6 kb are Seen in lanes Segment would result in a viral genome which is too large to 5 and 6 that were not expected and an additional fragment be packaged into virions (examples not meant to be limiting of about 8.4 kb was present in lanes 8 and 9. FIGS. 26 and are illustrated in FIGS. 18 and 19). The experiment illus 27 illustrate the mechanisms that generate these novel trated in FIG. 20 provides evidence for the tandem repeti fragments in helper virus infected cells that express I-Sce. tions diagramed in FIG. 17 and provides evidence that the It can be seen that joining of viral DNA ends (a form of use of a Stuffer Sequence is a Successful Strategy, as the double strand break repair that is known to be highly helper viruses AdNGUS20ITR2 and AdNGUS14-1 did not efficient in vertebrate cells) after SceI cleavage results in produce variant progeny. Therefore, helper viruses with Structures that can give rise to the observed fragments. In stuffer sequences between the leftmost ITR and the internal FIG. 26 it can be seen that joining of fragments A and C ITR are a preferred embodiment of the invention as they results in a virus DNA with a deleted packaging Signal and tend not to undergo rearrangement of the kind illustrated in a left end Bst11071 I fragment of 2.7 kb. From the Southern FIGS. 16 and 17 during propagation in 293 cells or more blot hybridization results of FIG. 24 it can be seen from the accurately, any viral DNA molecules that have undergone intensity of this band in lanes 5 and 6 that this rejoining Such rearrangements are not packaged and hence are not reaction is highly efficient. Since there is little parental DNA propagated. visible in these lanes, i.e. little or no 4.5 kb fragment, it will be appreciated by those skilled in the art, based on the 0101 Various helper viruses used in these and subsequent present disclosure, that flanking the packaging Signal with experiments are illustrated in FIG.21 and methods for their Scel Sites and infecting I-Sce expressing host cells is an construction are diagramed in FIG. 22. We examined the effective method for eliminating packageable helper virus effect of placing the Sce recognition site at a number of DNA while retaining ability of the helper virus genome to different locations: between the DNA stuffer and the replicate. The large fragments of 8.4-8.6 kb Seen in lanes 5 internal ITR (AdNGUS20ITR2), flanking p and the 2. DNA and 6 and 8 and 9 of FIG. 24 also represent unpackageable stuffer with 2 SceI sites, or placing the SceI site between the Viral DNA Since in the Species that give rise to these bands, external ITR and the packaging Signal. These examples are illustrated at the bottom of FIGS. 26 and 27, the packaging not meant to be limiting as one could readily make other Signal is internal and consequently nonfunctional. Also the constructs, for example, by placing the Scel Site between up Viral genomes formed by this head to tail joining are too and the Stuffer or by flanking only the packaging Signal with large to be packaged even were they to contain functional Scel sites. The shuttle ptasmids containing the modified left packaging Signals. ends illustrated in FIG. 21 were constructed by Standard methods as illustrated in FIGS. 22 and 23 and rescued into 0103) The breakage rejoining reaction illustrated in FIG. virus by cotransfection with an Ad genomic plasmid (Bett, 26 that results in deletion of the DNA segment comprising A. J., Haddara, W., Prevec, L. and Graham, F. L. An efficient the packaging Signal and ). DNA Stuffer is operationally very and flexible System for construction of adenovirus vectors similar to the result of infecting a 293Cre cell line with a with insertions or deletions in early regions 1 and 3. Proc. virus in which a comparable DNA segment is flanked by lox Natl. Acad. Sci. US 91: 8802-8806, 1994, Parks, R. J., sites, as described in U.S. Pat. No. 5,919,676, and in Parks, Chen, L., Anton, M., Sankar, U., Rudnicki, M. A. and R. J., Chen, L., Anton, M., Sankar, U., Rudnicki, M.A. and Graham, F. L. A new helper-dependent adenovirus vector Graham, F. L. A new helper-dependent adenovirus vector system: removal of helper virus by Cre-mediated excision of system: removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc. Natl. Acad. Sci. U.S. 93: the viral packaging signal. Proc. Natl. Acad. Sci. U.S. 93: 13565-13570, 1996. One major difference is that the break 13565-13570, 1996.) age rejoining reaction is effectively irreversible, whereas excision mediated by Cre recombinase is, in principle, a Example 16 reversible reaction. The reason the Sce-double strand break repair pathway is effectively unidirectional is that double I-Sce Mediated Cleavage of Helper Virus DNA Strand break repair is error prone and results in Small 0102) An To test the effectiveness of I-Sce constitutively deletions at the Site of rejoining. Furthermore, although this expressed by transformed 293Cre4 cell lines 2-16 and 4-7 in is not necessarily essential, the Sce sites in AdNGUS41 are cleaving Scel sites in helper virus DNA, we infected these oriented in opposite orientation (the Scel recognition cells and parental 293Cre4 cells with helper viruses Sequence is nonpalindromic), So that rejoining of the Sites is AdNGUS2OITR2, AdNGUS41 and AdNGUS43 and ana not through a simple Sticky end ligation reaction, but rather lyzed the left end DNA structures by Southern blot hybrid requires classic double Strand break repair which inevitably ization analysis using a probe that hybridized to Ad DNA will result in a junction that does not contain an Sce sequences between the internal ITR and a Bst11071 I site, as recognition Site. shown in FIG. 21. The results are presented in FIG. 24. 0104. A further illustration of the effectiveness of I-Sce Parental viruses contain a left end Bst11071 I fragment of mediated cleavage in elimination of helper virus from cells about 4.4-4.5 kb and this is readily seen in lanes 1, 4, and 7 infected with helper viruses of the sort illustrated in FIG. 21 containing DNA from infected 293Cre4 cells. In contrast is provided by the results shown in Table I wherein cells Sce cleavage followed by panhandle formation and ITR expressing I-Sce were used to titrate viruses in a plaque repair would be expected to produce Smaller fragments of forming assay. The reduction in titre on I-Sce expressing about 2.4 kb as diagramed for AdNGUS20ITR2 in FIG. 25. cells relative to 293 cells is illustrative of the effectiveness Fragments of the expected size are indeed generated at high by which helper virus DNA is prevented from being pack efficiency in infected 2-16 and 4-7 cells that express I-Sce aged into virions. Interestingly, the reduction in titre (over and there is a concomitant reduction in the amount of the 800 fold) was greatest for the AdNGUS41 virus that con US 2002/0136708 A1 Sep. 26, 2002 14 tains a packaging Signal flanked by two Scel Sites, consistent vectors or with any system for delivery of DNA to mam with the results of the Southern blot hybridization analysis malian cells such as transfection with plasmid DNA. presented in FIG. 24 wherein little or no detectable parental helper virus DNA was evident. Importantly, the Sce 0106 The enzyme I-Sce need not be constitutively expressing cell lines 2-14, 4-3, 4-4, 6-3 and 8-4 that were expressed by the host cell described hereinabove. A vector derived from 293Cre4 cells still express Cre recombinase, as Such as AdMH4SceI and AdNG24i, can be used to deliver indicated by the reduction in titre of AdLC8luc virus which an I-Sce expression cassette to mammalian cells for expres contains a floxed packaging Signal. Furthermore it can be Sion of the enzyme therein. The enzyme could also be Seen that the reduction of titre for helper viruses containing expressed from plasmid DNA that can be delivered to Scel Sites is as great as or greater than the reduction due to mammalian cells by a variety of means or could be action of Cre on AdLC8cluc virus in 293Cre4 cells relative expressed from other viral vectors. It should also be noted to 293 cells, indicating that this new system for prevention that the examples provided herein are not limited to mam of packaging of helper viruses is at least as effective as the malian cells as the double Strand break repair proceSS is Cre-lox system of U.S. Pat. No. 5,919,676. From the fact highly efficient in other vertebrate cells. that the new cell lines disclosed herein containing and 0107 The expression cassette illustrated in FIG. 28 need expressing I-Sce also continue to express Cre, it will be not be located on a viral genome for the Scel dependent appreciated by those skilled in the art that one can readily molecular Switch to be operational. Such a cassette or a combine the use of Cre-lox with the new Scel system to variety of appropriately designed cassettes could be intro maximally reduce the levels of helper virus contamination in duced into the genome of mammalian cells and I-Sce helper dependent vector preparations. Examples of helper expression in said cells could be induced by delivery of the Viruses that contain both lox sites and Scel Sites, not meant I-Sce gene through transfection with plasmid DNA or to be limiting, are illustrated in FIG. 7 and in FIG. 19. An through infection with a viral vector carrying an expression illustration of the effectiveness of a helper virus containing cassette with an I-Sce gene or the I-Sce gene could be an SceI site and embedded ITR (AdNGUS20ITR2) in ampli integrated into the cellular chromosome, but its expression fication of a helper dependent vector is provided in FIG. 31. could be regulated So that I-Sce production is induced when It can be seen that the amplification efficiency is comparable and as desired to initiate the excision and double Strand to that obtained with the Cre-lox system. break repair proceSS and its consequent up or down regula tion of an Seel dependent expression cassette. An example, Example 17 not meant to be limiting, is illustrated in FIG. 29 wherein a transgenic animal with a genome containing a gene under Use of the DNA Cleavage-rejoining Process in the control of an SceI susceptible molecular Switch is Multiple Applications infected with a vector expressing I-Sce. Expression of 0105 The surprisingly high efficiency of joining of viral I-Sce and Subsequent double Strand break repair leads to DNA fragments generated by I-Sce mediated cleavage excision of DNA and, following double strand break repair, disclosed herein and the operational Similarities of this in the illustrative example, results in expression of B-galac process to Cre-lox mediated excision Suggest a number of tosidase. Use of a transgenic animal in this example is not applications besides the use of Sce to eliminate helper virus meant to be limiting as one skilled in the art will appreciate in a helper dependent vector System. For example, as that one could establish cells in culture containing similar illustrated in FIG. 28, based on the present disclosure, one expression cassettes regulated by cleavage rejoining reac skilled in the art could readily construct a vector containing tions. an expression cassette in which expression of a cDNA is 0.108 Use of SceI cleavage and double stand break repair regulated by an Scel dependent molecular Switch wherein readily lends itself to other applications one of which is Sce cleavage and DNA rejoining results in excision of a illustrated in FIG. 30 wherein excision of the pX coding DNA fragment (a “spacer”) that otherwise inhibits expres Sequences abolishes expression of pX and leads to a method sion of the cDNA. This example is not meant to be limiting for production of helper dependent vectors that are free of as one skilled in the art would appreciate that one could helper virus. design and construct a Switch Such that expression is turned off in the presence of I-Sce by, for example, flanking the 0109) An example illustrative of SceI cleavage at an Sce promoter of an expression cassette with Scel Sites or by site in chromosomal DNA is provided in FIG. 32 in which flanking the cDNA with Sce sites. Furthermore the use of a cell line transformed with a DNA containing an Sce site I-Sce mediated cleavage in combination with efficient DNA (such as 293.1 cells) is infected with an Ad vector (AdMS fragment rejoining would not be limited to Adenovirus ceI) expressing Sce resulting in DNA cleavage at said Sce vectors but could equally be employed with other viral Site. TABLE 1. Titrations of Ad viruses containing Sce sites on various cell lines". Cell lines Viruses 293 293Crea 2-14 4-3 4-4 6-3 8-4 AdNGUS2OITR2 5.15 x 10 6 x 10 5.4 x 107 5.35 x 107 4.4 x 107 6.15 x 107 6.4 x 107 average 5.6 x 10 5.5 x 10' (102 fold) AdNGUS 41 4.6 x 100 6 x 1010 1.25 x 10 4 x 107 3.5 x 107 6.5 x 107 6.5 x 107 average 5.3 x 1010 6.6 x 107 (803 fold) US 2002/0136708 A1 Sep. 26, 2002 15 TABLE 1-continued Titrations of Ad viruses containing Sce sites on various cell lines". Cell lines Viruses 293 293Crea 2-14 4-3 4-4 6-3 8-4 AdNGUS43d 115 x 1011 4.25 x 1010 5 x 108 7.5 x 10 9 x 108 8.5 x 10 1.25 x 10 average 7.9 x 1010 8.5 x 10 (93 fold) AdLC8cluc 4.3 x 10 4.85 x 107 3.5 x 107 2.1 x 107 3.25 x 107 2.1 x 107 3.4 x 107 average (89 fold) 2.89 x 107 (149 fold) AdCAMCIL-2f 5.2 x 1010 5.5 x 1010 2.5 x 1010 3.3 x 1010 3.1 x 1010 3.95 x 1010 4.15 x 1010 The indicated viruses were titrated on 293, 293Cre4 and the 293Cre4 derived I-SceI expressing cells lines 2-14, 4-3, 4-4, 6-3 and 8-4. An average of 102-fold reduction in titre was observed on I-SceI expressing cells compared to 293 and 293Cre4 cells. An average of 803-fold reduction in titre was observed on I-SceI expressing cells compared to 293 and 293Cre4 cells. An average of 93-fold reduction in titre was observed on I-SceI expressing cells compared to 293 and 293Cre4 cells. An 89-fold reduction in titre was observed on 293Cre4 cells compared to 293 cells. An average of 149-fold reduction in itre was observed on the 293Cre4 derived I-SceI expressing cells compared to 293. Control virus used to compare the plaguing efficiencies of the various cell lines (unaffected by Cre or I-SceI). 0110 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 20 <210> SEQ ID NO 1 &2 11s LENGTH 30 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence : Oligonucleotide sequence for cloning sequencing PCR hybridization primer extension <400 SEQUENCE: 1 acttaa.gcta gggata acag g g taatatag 30 <210> SEQ ID NO 2 &2 11s LENGTH 30 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence : Oligonucleotide sequence for cloning sequencing PCR hybridization primer extension <400 SEQUENCE: 2 tgaattcg at coctattgtc. ccattatato 30 <210> SEQ ID NO 3 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence : Oligonucleotide sequence for cloning sequencing PCR hybridization primer extension <400 SEQUENCE: 3 cggatccaag cittgc.gagat cqaattic 27 <210> SEQ ID NO 4 &2 11s LENGTH 27 &212> TYPE DNA US 2002/0136708 A1 Sep. 26, 2002 16 -continued <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence : Oligonucleotide sequence for cloning sequencing PCR hybridization primer extension <400 SEQUENCE: 4 gcc taggtog acactcc.gcc ctaaaac 27 <210 SEQ ID NO 5 &2 11s LENGTH: 31 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence : Oligonucleotide sequence for cloning sequencing PCR hybridization primer extension <400 SEQUENCE: 5 ggatat citgc agatctactc cqc cotaaaa c 31 <210> SEQ ID NO 6 &2 11s LENGTH 26 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence : Oligonucleotide sequence for cloning sequencing PCR hybridization primer extension <400s. SEQUENCE: 6 ccitcgagtcg acgc.gagatc gaattic 26 <210 SEQ ID NO 7 &2 11s LENGTH 26 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence : Oligonucleotide sequence for cloning sequencing PCR hybridization primer extension <400 SEQUENCE: 7 gggggg to at gaaaaag.cct galactic 26 <210 SEQ ID NO 8 &2 11s LENGTH 2.8 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence : Oligonucleotide sequence for cloning sequencing PCR hybridization primer extension <400 SEQUENCE: 8 gggggggtcg accaga CCCC acgcaa.cg 28 <210 SEQ ID NO 9 <211& LENGTH: 41 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: cDNA <400 SEQUENCE: 9 US 2002/0136708 A1 Sep. 26, 2002 17 -continued gaattcagat cogcc.gc.cat atgggatcat catcagacga c 41 <210> SEQ ID NO 10 &2 11s LENGTH 26 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: cDNA <400 SEQUENCE: 10 ccaccaaaaa aaaacgaaaa gtagaa 26 <210> SEQ ID NO 11 &2 11s LENGTH 6 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: synthetic peptide <400 SEQUENCE: 11 Met Gly Ser Ser Asp Asp 1 5 <210> SEQ ID NO 12 &2 11s LENGTH 7 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: synthetic peptide <400 SEQUENCE: 12 Pro Pro Llys Lys Asn. Glu Lys 1 5 <210> SEQ ID NO 13 &2 11s LENGTH 36 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: cDNA <400 SEQUENCE: 13 gaattic gocq cc.gctatogg atcatcatca gacgac 36 <210> SEQ ID NO 14 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: cDNA <400 SEQUENCE: 14 ccaccaaaaa aaaaacgaaa agtagaa 27 <210 SEQ ID NO 15 &2 11s LENGTH 7 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: synthetic peptide <400 SEQUENCE: 15 US 2002/0136708 A1 Sep. 26, 2002 18 -continued Met Gly Ser Ser Ser Asp Asp 1 5 <210> SEQ ID NO 16 &2 11s LENGTH 9 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: synthetic peptide <400 SEQUENCE: 16 Pro Pro Llys Lys Lys Arg Lys Val Glu 1 5 <210 SEQ ID NO 17 &2 11s LENGTH 136 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: cDNA <400 SEQUENCE: 17 aatticgcc.gc cqc catggga to atcatcag acgacgaagc aac agcagac goaca acacg 60 cago accacc aaaaaaaaaa cqaaaagtag aag acco acg atttatgtac ccatacgatg 120 titcc toacta toc ggg 136 <210> SEQ ID NO 18 <211& LENGTH: 134 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: cDNA <400 SEQUENCE: 18 taccc.gcata gtcaggaaca togtatgggit acataaatcg toggtottct acttittcgtt 60 tttitttittgg togtgctg.cg tdttgtgcgt citgctgttgc titcgtcgtot gatgatgatc 120 cCatgg.cggc gg.cg 134 <210 SEQ ID NO 19 &2 11s LENGTH 30 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: cDNA <400 SEQUENCE: 19 acttaa.gcta gggata acag g g taatatag 30 <210> SEQ ID NO 20 &2 11s LENGTH 30 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: cDNA <400 SEQUENCE: 20 citat attacc citgttatccc tag cittaagt 30 US 2002/0136708 A1 Sep. 26, 2002 What is claimed is: 10. A System for producing a helper dependent adenovirus 1. An helper adenovirus nucleic acid Sequence comprising vector comprising: a packaging Signal, an endonuclease recognition site, and an (A) a helper adenovirus nucleic acid sequence comprising embedded inverted terminal repeat (ITR), wherein: a packaging signal, an endonuclease recognition site, (A) said endonuclease recognition site is for an endonu and an embedded inverted terminal repeat (ITR), clease that does not cleave anywhere else in the helper wherein: adenovirus nucleic acid Sequence, and wherein Said (i) said endonuclease recognition site is for an endo endonuclease recognition Site is disposed at a location nuclease that does not cleave anywhere else in the in Said helper adenovirus nucleic acid Sequence 3' to adenovirus genome, and wherein Said endonuclease Said packaging Signal, and recognition site is disposed at a location in Said (B) wherein said embedded ITR is disposed at a location helper adenovirus nucleic acid Sequence 3' to Said in Said adenovirus 3' to Said endonuclease recognition packaging Signal; and Site. 2. A helper adenovirus nucleic acid Sequence comprising (ii) said embedded ITR is disposed at a location in said a packaging Signal, an endonuclease recognition site, and an helper adenovirus nucleic acid Sequence 3' to Said embedded inverted terminal repeat (ITR), wherein: endonuclease recognition Site, and (A) said endonuclease recognition site is for an endonu (B) a helper dependent adenovirus vector comprising a clease that does not cleave anywhere else in the helper left adenoviral ITR, a right adenoviral ITR, an aden adenovirus nucleic acid Sequence, and wherein Said Oviral packaging Signal and additional nucleic acid endonuclease recognition Site is disposed at a location Sequences, Such that upon co-introduction of Said in Said helper adenovirus nucleic acid Sequence 3' to helper dependent adenovirus vector into a cell with Said Said packaging Signal; helper adenovirus nucleic acid Sequence, Said helper dependent adenovirus vector is packaged. (B) said embedded ITR is disposed at a location in said 11. The system according to claim 10 wherein said adenovirus 3' to Said endonuclease recognition Site, and packaging Signal of Said helper adenovirus nucleic acid (C) said packaging Signal is flanked on either side thereof Sequence is flanked on either Side by a recombinase recog by recognition sites for a recombinase, Such that upon nition Site. contact of Said helper adenovirus nucleic acid Sequence 12. The System according to claim 11 wherein Said with Said recombinase, Said packaging Signal is recombinase recognition sites are loXP recognition Sites, and excised. said recombinase is Cre, or wherein said recognition site for 3. The helper adenovirus nucleic acid Sequence according a recombinase is a FRT site, and said recombinase is FLP. to claim 2 wherein Said recognition site for a recombinase is 13. The System according to claim 11 further comprising a loXP Site, and Said recombinase is Cre, or wherein Said a cell which expresses Said endonuclease which cleaves Said recognition Site for a recombinase is a FRT Site, and Said endonuclease recognition Site. recombinase is FLP. 14. The System according to claim 12 further comprising 4. The helper adenovirus nucleic acid Sequence according a cell which expresses Said Cre and Said endonuclease which to claim 2 wherein Said endonuclease recognition Site is cleaves Said endonuclease recognition site. flanked on either Side thereof by recognition Sites for a 15. The System according to claim 11 further comprising recombinase, Such that upon contact of Said helper adenovi a cell which expresses the adenoviral gene product encoded ruS nucleic acid Sequence with Said recombinase, Said endo by adenoviral E1. nuclease recognition site is excised. 16. The System according to claim 11 wherein Said helper 5. The helper adenovirus nucleic acid Sequence according adenovirus nucleic acid Sequence comprises a deletion or to claim 4 wherein Said recognition sites for a recombinase mutation in a Sequence encoding the adenovirus pX gene are loXp Sites, and Said recombinase is Cre, or wherein Said product, rendering the nucleic acid Sequence unable to recognition Sites for a recombinase are FRT Sites, and Said produce a functional pX gene product to, thereby inhibiting recombinase is FLP. packaging adenoviral DNA larger than approximately 35 kb. 6. The adenovirus according to claim 2 wherein Said 17. The System according to claim 16 further comprising packaging Signal and Said endonuclease recognition site are a cell which expresses said adenovirus pX gene product. flanked by recognition sites for a recombinase, Such that 18. A method for making a helper dependent adenovirus upon contact of Said helper adenovirus nucleic acid vector preparation which comprises: Sequence with Said recombinase, Said packaging Signal and Said endonuclease recognition site are excised. (A) making a helper adenovirus having a genome inca 7. The helper adenovirus nucleic acid Sequence according pable of being packaged into an infectious adenoviral to claim 6 wherein Said recombinase recognition sites are Virion, due to deletion of an adenoviral packaging loXp recognition Sites, and Said recombinase is Cre, or Signal by endonuclease-mediated cleavage, alone or in wherein Said recognition Sites for a recombinase are FRT combination with (a) Site-directed recombinatorial sites, and said recombinase is FLP. excision of Said packaging signal; or (b) a deletion or 8. The helper adenovirus nucleic acid Sequence according mutation of adenoviral pX encoding Sequences, to claim 2 wherein Said endonuclease recognition site is for whereby a size restricted limitation of genome pack the endonuclease Sce. aging prevents packaging or a genome which exceeds 9. The helper adenovirus nucleic acid Sequence according approximately 35 kb; or both (a) and (b); and to claim 2 further comprising a deletion or modification in (B) propagating said helper dependent adenovirus vector a nucleic acid Sequence encoding the adenovirus pX gene in a cell permissive for replication of Said helper product. dependent adenovirus vector. US 2002/0136708 A1 Sep. 26, 2002 20 19. The method according to claim 18 wherein said step 34. A method for achieving gene expression in a cell for making Said helper dependent adenovirus vector com which comprises introducing into Said cell an adenoviral prises co-introducing Said helper dependent adenoviral vec vector preparation Substantially free of helper adenovirus, tor and Said helper adenovirus into a cell, wherein Said cell wherein Said adenoviral vector preparation is produced by a expresses an endonuclease which induces endonuclease method which comprises: mediated cleavage of the adenoviral packaging Signal from Said helper adenovirus. (A) making a helper adenovirus having a genome inca 20. The method according to claim 19 wherein said cell pable of being packaged into an infections adenoviral further expresses a recombinase which induces site-directed Virion, due to deletion of adenoviral packaging Signal recombinatorial excision of Said packaging Signal. by endonuclease-mediated cleavage, alone or in com 21. The method according to claim 18 additionally com bination with (a) Site-directed recombinatorial excision prising propagating Said helper adenovirus, Said helper of Said packaging Signal; or (b) deletion or mutation of adenovirus nucleic acid Sequence comprising a deletion or adenoviral pX encoding sequences, or both (a) and (b); mutation in a pX encoding nucleic acid Sequence rendering and the helper adenovirus nucleic acid Sequence unable to pro (B) propagating said helper dependent adenovirus vector duce a functional pX gene product, Such that reduced in a cell permissive for replication of Said helper functional plX protein levels are produced by Said helper dependent adenovirus vector by virtue of introduction adenovirus in cells expressing adenoviral pX. into Said cell of Said helper adenovirus. 22. The method according to claim 18 further comprising 35. An adenovirus comprising a packaging Signal flanked co-introducing Said helper dependent adenoviral vector and by endonuclease recognition sites wherein each of Said Said helper virus into a cell which does not express aden endonuclease recognition Sites is for an endonuclease that oviral pX. does not cleave elsewhere in the adenovirus genome, and 23. A cell which expresses SceI and Cre or FLP. wherein Said endonuclease recognition sites are disposed at 24. The cell according to claim 23 which further expresses locations in Said adenovirus 5' and 3' to Said packaging adenovirus E1. Signal. 25. A cell which expresses adenovirus pX. 36. The adenovirus according to claim 35 wherein said 26. The cell according to claim 25 which further expresses packaging Signal is flanked by endonuclease recognition E1. Sites for a site-specific recombinase. 27. A cell which expresses SceI and adenoviral pX. 37. The adenovirus according to claim 36 wherein said 28. A cell which expresses SceI and E1. endonuclease recognition Sites for a site-specific recombi 29. A recombinant adenovirus vector System for express nase are endonuclease recognition Sites for the Cre recom ing foreign genes comprising a host cell coinfected with: binase or the FLP recombinase. 38. The adenovirus according to claim 35 wherein an (a) a helper virus characterized by a modified early region embedded ITR is disposed at a location in said adenovirus 1 (E1), said modified early region 1 comprising: a 3' of Said 3' endonuclease recognition Site. packaging Signal; a recognition site for an endonu 39. A cell that expresses at least one site-specific recom clease positioned 3' (rightward) of Said packaging Sig binase Selected from the group consisting of Sce, Cre, and nal; and a DNA segment comprising all or part of an FLP, and that also expresses E1 or pX, or E1 and pX. inverted terminal repeat positioned 3' (rightward) of 40. A helper virus comprising at least one internal ITR and Said recognition site for Said endonuclease, and Stuffer nucleic acid to prevent the packaging of viral (b) a vector comprising: genomes with duplications of the DNA sequences between an external ITR and said at least one internal ITR. (i) a viral nucleic acid structure having a deletion of up 41. A helper virus comprising a packaging Signal flanked to approximately 35,000 bp of native adenoviral by Scel sites in combination with flanking lox sites or FRT nucleic acid, but retaining adenoviral Sequences Sites. required in cis for viral DNA replication and pack 42. The helper virus according to claim 41 comprising aging of viral DNA into virions, including the left Said Scel Sites, Said flanking lox Sites and Said FRT Sites. and right ITRS and the packaging Signal; and 43. A helper virus System wherein packaging of the helper (ii) an insertion into said viral structure of a fragment Virus genome is regulated by deletion of pX from Said or fragments of foreign DNA of up to approximately helper virus upon introduction of Said helper virus into a cell 35,000 bp in size; that expresses a Specific restriction nuclease, a Site specific recombinase, or both, and wherein Said helper virus com wherein the host cell additionally expresses an endo prises a pX gene flanked by Specific restriction nuclease nuclease which cleaves Said recognition site of recognition sites, Site-specific recombinase recognition sites, Said helper virus. or both. 30. A recombinant adenovirus vector System according to 44. The helper virus according to claim 43 wherein said claim 29, wherein Said endonuclease expressed in Said cell Site Specific restriction nuclease is I-Sce, Said Site-specific is Scel and the wherein Said recognition site is cleaved by recombinase is Cre, FLP, or both, and Said Site-specific Sce. recombinase recognition sites are lox Sites, FRT Sites, or 31. A human cell which expresses Sce I. both. 32. A mammalian cell which expresses Scel and aden 45. An expression cassette under the control of a molecu oviral E1. lar Switch Such that expression of a cDNA of Said cassette is 33. The cell according to claim 32 wherein said cell is a regulated by excision of a DNA and rejoining of DNA human cell. fragments in Vivo. US 2002/0136708 A1 Sep. 26, 2002 46. The expression cassette according to claim 45 wherein and Said internal ITR renderS Said virus genome too large to Said expression cassette is located within a plasmid, a virus, be packaged. or a vertebrate genome. 49. The system according to claim 11 wherein said 47. An adenovirus comprising coding Sequences for recombinase recognition sites are FRTSites, and Said recom encoding an optimized Kozak sequence and a sequence binase is FLP. encoding the restriction endonuclease Sce. 48. A method for preventing packaging of a rearranged 50. The system according to claim 10 wherein said helper recombinant helper adenovirus genome comprising a left dependent adenovirus vector has a genome of approximately ITR and an internal ITR which comprises cloning stuffer 20 to 35 kb of nucleic acid sequences in total. Sequences between Said left and Said internal ITR Sequences such that duplication of DNA sequences between said left