Diversity of Bemisia Tabaci, the Bacterial Endosymbionts It Harbours and Geminiviruses It Acquires Across Pakistan

Diversity of Bemisia tabaci, the Bacterial Endosymbionts it Harbours and Geminiviruses it Acquires Across Pakistan

Mariyam Masood

2019

Department of Biotechnology Pakistan Institute of Engineering and Applied Sciences Nilore, Islamabad, Pakistan

This page intentionally left blank.

Diversity of Bemisia tabaci, the Bacterial Endosymbionts it Harbours and Geminiviruses it Acquires Across Pakistan

Mariyam Masood

Submitted in partial fulfillment of the requirements for the degree of Ph.D.

2019

Department of Biotechnology Pakistan Institute of Engineering and Applied Sciences Nilore, Islamabad, Pakistan

Dedications

To my Parents

And

My Husband

Acknowledgements

Saying of the Holy Prophet Muhammad (SAW) is, “A person who is not thankful to his benefactor is not thankful to Allah”. All acclamations, appreciations, and praises go to ALLAH ALMIGHTY, The Supreme, Self-existing, The Compassionate, The Creator of the universe and the day of repayment, Who blessed me with the ability to observe, the mind to thoughts, health and opportunity to add a drop to the already existing ocean of knowledge. I offer my humblest thanks and countless salutations to the Holy Prophet Muhammad (SAW), the bacon of light, the city of eternal knowledge, the messenger of peace, the biggest benefactor of the mankind and forever torch of guidance for humanity.

I have no words to thanks my supervisor Dr. Rob W. Briddon. When he left NIBGE he never let me feel at any stage that he is away, always does every possible effort to resolve the problems. I feel lucky to have him as my supervisor, he told me what the actual science and scientific attitude is. I really appreciate his valuable comments, advice, and support in overcoming the numerous obstacles I have been facing through my research and during write up. I feel special being your last Ph.D student in NIBGE. I would like to express my utmost gratitude to Co-supervisor and Director NIBGE, Dr. Shahid Mansoor (SI), for providing me the opportunity to do Ph.D. in a prestigious research institute NIBGE. I am very thankful to him for providing me the not only infrastructure and scientific platform to conduct this research work but also the valuable suggestions he gave throughout my research. I express my utmost appreciation to Dr. Zahid Mukhtar (DCS), Head of Agricultural Biotechnology Division (ABD), NIBGE, for facilitating a pleasant and working environment.

A special mention is required for Dr. Imran Amin, a soft-hearted person with scientific attitude. I appreciate him for his valuable feedback, cooperation, and suggestions regarding research. I a am thankful to Dr. Muhammad Saeed for his cooperation. I would also like to thank the Higher Education Commission of Pakistan for funding my six-month stay in the USA. I have no words to say thanks to all my

iii

senior lab fellows for their being cooperative, Dr. Zafar Iqbal, Qamar Abbas, Dr. Muhammad Shafiq, Dr. M. Nouman Tahir, Dr. Amir Raza, Dr. Amir Hameed, Dr. Ishtiaq Hasan, Dr. Shaista Javaid, Dr. Huma Mumtaz and junior Ali Tahir and Ali Raza. I am very much thankful to my class fellows for providing me best company, Shan-e-Ali Zaidi, Muhammad Umar, Hassan Jamil Malik, Rubab Zehra Naqvi. Nevertheless, I truly blessed to have a gang of friends Muhammad Hamza Rana, Hira Kamal, Roma Mustafa, Iqra Sohail, Hazrat Ismail. I am very much thankful to them for only providing me the moral and emotional support but for being supportive during up and down. Regarding the provision of chemicals and availability of lab equipment, the best technical assistance was provided by Mr. Atiq-ur-Rehman. I want to convey special acknowledgment to the lab supporting staff, Mrs. Yasmeen, Rizwan Ahmad, Amir Iqbal and Ghulam Mustafa for their cooperation in lab work. I am also pleased to acknowledge Dr. Angela.E. Douglas, Cornell University, the USA for her extensive cooperation, guidance, and encouragement during my stay at her lab. I am also very thankful to Dr. Judith K. Brown for giving valuable suggestion in manuscript writing. I also want to appreciate Muhammad Iqbal, Mr. Asif and Mr. Ali Imran of University Cell. They always facilitated and never wasted my time in official hurdles.

Last but not least I would like to thank my family; my parents, My Father Masood-ul-Hassan and Mother Mrs. Azra Masood, they deserve special mention for their inseparable support and prayers. My Father-in-Law, Mr. Mujahid Hussain, especially my Mother-in-Law Mrs. Rubina Mujahid for being cooperative all the time. I have no words to express my feelings for my husband, Umair Hussain. I am thankful for his never-ending support, unconditional love and for tolerating my tantrums. I am thankful to my loving son Sarib Umair for being an inspiration and reason for joy. I am thankful to Mansoor-ul-Hassan, Madiha Masood, Ummara Qureshi, Shahnah Qureshi, Yamina Qureshi for providing me escape from my work.

Mariyam Masood

Copyrights Statement

The entire contents of this thesis entitled Diversity of Bemisia tabaci, the Bacterial Endosymbionts it Harbours and the Geminiviruses it Acquires Across Pakistan by Mariyam Masood are an intellectual property of Pakistan Institute of Engineering & Applied Sciences (PIEAS). No portion of the thesis should be reproduced without obtaining explicit permission from PIEAS.

Table of Contents

Dedications ...... ii Acknowledgments...... iii Declaration of Originality ...... Error! Bookmark not defined. Copyrights Statement ...... v Table of contents ...... vii List of Figures ...... x List of Tables ...... xi Abstract ...... xii List of Publications ...... xiv List of Abbreviations and Symbols...... xv 1 Introduction and Review of Literature ...... 1 1.1 Bemisia tabaci ...... 1 1.1.1 Morphology...... 1 1.1.2 Geographical Distribution ...... 2 1.1.3 Host Range ...... 2 1.1.4 Life Cycle of Bemisia tabaci ...... 2 1.2 Economic Impact of B. tabaci ...... 4 1.3 History and Synonymization ...... 6 1.4 Host Races and the Biotype Concept ...... 7 1.5 Bemisia tabaci, a Cryptic Species Complex ...... 8 1.6 Endosymbionts ...... 9 1.6.1 Primary Endosymbionts ...... 9 1.6.2 Secondary Endosymbionts ...... 10 1.7 Bemisia tabaci Transmitted Viruses ...... 13 1.8 Mechanisms of Virus Transmission by Whiteflies ...... 13 1.8.1 Begomovirus Transmission by B. tabaci ...... 13 1.9 Geminiviruses...... 14 1.9.1 Classification of Geminiviruses ...... 16 1.9.2 The Genus Begomovirus ...... 16 1.9.3 Satellites Associated with Geminiviruses ...... 19 1.10 Objectives of the Study...... 24

vii

2 Materials and Methods ...... 25 2.1 Insect Collection and Storage ...... 25 2.2 DNA Extraction...... 25 2.3 Quantification of DNA ...... 25 2.4 Amplification of DNA ...... 25 2.4.1 Polymerase Chain Reaction (PCR) Amplification ...... 25 2.4.2 Rolling Circle Amplification (RCA) ...... 26 2.5 Gel Electrophoresis ...... 26 2.6 Cloning of PCR Products ...... 26 2.7 Cloning of RCA Product ...... 27 2.8 Preparation and Transformation of Competent Cells ...... 27 2.8.1 Preparation of Heat Shock Competent E. Coli Cells ...... 27 2.9 Transformation of Competent E. coli Cells ...... 27 2.10 Small-scale Plasmid Purification ...... 28 2.11 Restriction Digestion of DNA ...... 29 2.12 Preparation of Glycerol Stocks ...... 29 2.13 Purification of DNA ...... 30 2.13.1 Purification of PCR Product ...... 30 2.13.2 Gel Extraction Purification ...... 30 2.13.3 Extraction of DNA by Ethanol Precipitation ...... 31 2.14 Sequencing of Clones and Sequence Analysis ...... 31 3 Diversity and Distribution of Cryptic Species of Bemisia tabaci (Hemiptera: Aleyrodidae) Complex in Pakistan ...... 32 3.1 Introduction ...... 32 3.2 Materials and Methods ...... 34 3.2.1 Sample Collection ...... 34 3.2.2 DNA Isolation and PCR Amplification ...... 34 3.2.3 Cloning, Sequencing and Sequence Analysis ...... 35 3.3 Results ...... 35 3.3.1 Phylogenetic Analysis of COI-3' Sequences...... 35 3.3.2 Geographic and Host Distribution of B. tabaci Cryptic Species in Pakistan ...... 39 3.4 Discussion ...... 40 4 Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan ...... 45 4.1 Introduction ...... 45 4.2 Materials and Methods ...... 48 4.2.1 Whitefly Sampling and DNA Extraction ...... 48

viii

4.2.2 Molecular Identification of S-symbionts ...... 48 4.2.3 Cloning and Sequencing ...... 50 4.2.4 Sequence/Phylogenetic Studies ...... 50 4.2.5 Statistical Analysis ...... 50 4.3 Results ...... 50 4.3.1 Identification of B. tabaci Biotypes ...... 50 4.3.2 Identification of Secondary Endosymbionts Infection ...... 50 4.3.3 Phylogenetic Analysis of S-endosymbionts...... 53 4.4 Discussion ...... 58 5 Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci…...... 61 5.1 Introduction ...... 61 5.2 Materials and Methods ...... 62 5.2.1 Cloning of Begomoiruses, Alphasatellites, and Betasatellites...... 62 5.2.2 Cloning of Viruses and Satellites ...... 63 5.2.3 Sequencing of Viruses, Alphasatellites, and Betasatellites ...... 63 5.2.4 Sequence and phylogenetic analysis ...... 63 5.3 Results ...... 64 5.3.1 Cloning and Sequencing of Begomoviruses, Betasatellites and Alphasatellites from Whiteflies...... 64 5.3.2 Characterisation of Begomoviruses Isolated from Whiteflies ...... 64 5.3.3 Characterization of Satellites Isolated from Whiteflies ...... 77 5.4 Discussion ...... 86 6 Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci feeding on CLCuD Affected Cotton During the Growing Season ...... 100 6.1 Introduction ...... 100 6.2 Materials and Methods ...... 101 6.2.1 Sample Collection and DNA Extraction ...... 101 6.2.2 PCR Amplification...... 101 6.2.3 Quantitative Real-Time PCR ...... 101 6.2.4 Standard Curves ...... 101 6.2.5 Environmental Data ...... 102 6.3 Results ...... 102 6.4 Discussion ...... 105 7 Final Discussion ...... 110 References ...... 112 Appendices ...... 148

List of Figures

Figure 1-1 Life cycle of Bemisia tabaci...... 4 Figure 1-2 The circulative, (non-propagative) persistent virus transmission by B. tabaci...... 14 Figure 1-3 Three-dimensional representations of geminivirus particles...... 15 Figure 1-4 Genome organization of bipartite begomoviruses (A) and B. tabaci (B), the vector of begomoviruses...... 18 Figure 1-5 Typical genome organization of monopartite begomoviruses...... 19 Figure 1-6 Genetic organization of betasatellites...... 21 Figure 1-7 Genetic organization of alphasatellites...... 23 Figure 3-1 Phylogenetic tree based upon an alignment of mitochondrial COI-3’ sequences of Bemisia tabaci...... 36 Figure 3-2 Map of Pakistan showing the distribution of cryptic species of the Bemisia tabaci complex...... 40 Figure 4-1 Infection probability of Secondary Endosymbionts...... 52 Figure 4-2 Infection of different S-endosymbionts in different regions of Pakistan...... 53 Figure 4-3 Phylogenetic analysis of Cardinium 16S rRNA sequences from two Bemisia tabaci biotypes/species...... 54 Figure 4-4 Phylogenetic analysis of Wolbachia 16S rRNA sequences from three Bemisia tabaci biotypes/ species...... 55 Figure 4-5 Phylogenetic relationship of 16S rRNA Hamiltonella sequences from two B. tabaci biotypes/ species...... 56 Figure 4-6 Phylogenetic analysis of Arsenophonus 23S rRNA sequences from three B. tabaci biotypes/ species...... 57 Figure 5-1 Geographic origins of the Bemisia tabaci insects from which begomoviruses, betasatellites and alphasatellites were cloned...... 78 Figure 5-2 Phylogenetic analysis of full-length begomoviruses sequences obtained from whiteflies samples...... 82 Figure 5-3 Phylogenetic dendrogram based upon an alignment of the complete nucleotide sequences of alphasatellites identified in whiteflies with selected alphasatellites from the databases...... 83 Figure 5-4 Alignment of the sequences of CLCuMuB isolates obtained from B. tabaci with those of a typical CLCuMuBMul (AJ298903) and CLCuMuBBur (FN554719)...... 84 Figure 5-5 Phylogenetic dendrogram based upon an alignment of the complete nucleotide sequences of betasatellites identified in whiteflies with selected betaasatellites from the databases...... 85

List of Tables

Table 3.1 Pairwise distances (%) for species of the B. tabaci complex identified in the study ...... 38 Table 5.1 Oligonucleotide primers used in the study...... 63 Table 5.2 Origins of the begomovirus, betasatellite and alphasatellite clones. ... 67 Table 5.3 Features of the begomoviruses isolated in this study...... 71 Table 5.4 Features of the alphasatellites and betasatellites isolated in the study. 74 Table 5.5 Summary of the relationship between viruses, betasatellites and alphasatellites identified...... 87 Table 5.6 Summary of the virus, betasatellite and alphasatellites harboured by each B. tabaci cryptic species...... 94 Table 5.7 Summary virus, betasatellite and alphasatellites harboured by each B. tabaci cryptic species broken down by province...... 97

Abstract

The whitefly Bemisia tabaci (Gennadius; Hemiptera: Aleyrodidae) is a highly invasive insect pest and is considered a cryptic species complex. This study was conducted to investigate the diversity and distribution of whiteflies of the B. tabaci species complex in Pakistan, and also to investigate the diversity endosymbionts and viruses harboured. Using a well-established, PCR-based cloning and sequencing of a mitochondrial cytochrome oxidase subunit I (mtCOI) marker, six biotypes Asia II 8, Asia II 7, Asia II 5, Asia II 1, Asia 1, and MEAM 1” were identified in Pakistan. Asia II-1 was found to be the most common biotype present and thus may possibly be the most important vector of the begomovirus complex which causes cotton leaf curl disease in Pakistan. The study also highlighted changes in the prevalent biotypes in some regions in the country.

Using the 16S general and specific primers, in conjunction with sequencing, six endosymbionts (Arsenophonus, Cardinium, Hamiltonella, Rickettsia, and Wolbachia) were identified. Arsenophonus found to be associated with Asia II-1 while Hamiltonella was associated with the MEAM-1. The presence and prevalence of each symbiont varied in different biotypes and also varied between regions. Endosymbionts are important in virus-vector interactions.

A number of distinct begomovirus species were identified with Cotton leaf curl Burewala virus, the most prevalent virus causing CLCuD in Pakistan at this time, the frequently identified. The levels of viral and betasatellite DNA were measured at 2 weekly intervals in B. tabaci collected from cotton using a quantitative PCR assay during the cotton growing seasons of 2014, 2015 and 2016. Although there were differences between the three years, in general, it was found that the level of betasatellite rises during the cotton growing season whereas the level of virus initially rises and then decreases at the end of the season. For both virus and betasatellite the DNA levels are very low initially, when there are no CLCuD symptoms in the crop, indicating that the initial inoculum is low. This comprehensive study provides the basis

xii

for the design of vector/virus control strategies which can be tested using the methodologies devised and implemented during the study.

xiii

List of Publications

• M. Masood, I. Amin, I. Hassan, S. Mansoor, J. K. Brown, and R. W. Briddon, "Diversity and Distribution of Cryptic Species of the Bemisia tabaci (Hemiptera: Aleyrodidae) complex in Pakistan," Journal of Economic Entomology, vol. 110, pp. 2295-2300, 2017. • M. Ashfaq, S. Prosser, S. Nasir, M. Masood, S. Ratnasingham and P. D. Hebert "High diversity and rapid diversification in the head louse, Pediculus humanus (Pediculidae: Phthiraptera),"Scientific Reports, vol. 5, pp. 14188, 2015. • M. Ashfaq, S. Akhtar, S. Akhtar, M. Masood "PCR-based detection of hyperparasitism in solenopsis mealybug, Phenacoccus solenopsis (Hemiptera: Pseudococcidae)" Pakistan Journal of Zoology, vol. 49(4), pp. 1-4, 2017. • M. Masood and R. W. Briddon " Transmission of cotton leaf curl disease answer to a long-standing question" Virus Genes, 2018

xiv

List of Abbreviations and Symbols

µg Micrograms µL microlitre µM micromolar aa Amino acid AFLP Ampliﬁed fragment length polymorphisms BLAST Basic Local Alignment Search Tool B. tabaci Bemisia tabaci bp base pair BSA Bovine serum albumin CAPS/RFLP Cleaved ampliﬁed polymorphic sequences or restriction fragment length polymorphisms

CaCl2 Calcium chloride CIAP Calf intestine alkaline phosphatase COI Cytochrome oxidase 1 CP coat protein CR common region CTAB cetyltriethyl ammonium bromide DNA deoxyribonucleic acid dNTP deoxyribonucleotide triphosphate dsDNA double-stranded DNA dsRNA double-stranded RNA DTT Dithiothreitol EDTA Ethylene diaminetetraacetic acid

FeSO4.7H2O Ferrous sulphate hepta hydrate GFP Green fluorescence protein GPS Global positioning system GRAB geminivirus RepA binding HCl Hydrochloric acid

HR hypersensitive response HV Helper virus ICTV International Committee on Taxonomy of Viruses IPTG Isopropyl-beta-D-1-thiogalactopyranoside ITS1 Internal transcribe spacer 1 IR Intergenic region

K2HPO4 Dipotassium phosphate KCl Potassium chloride kDa Kilo Dalton °C degree celsius % Percent LB Luria-Bertani LIR Large intergenic region M molar mg milligram

MgCl2 Magnesium chloride

MgSO4 Magnesium sulphate

MgSO4.7H2O magnesium sulphate heptahydrate min minute miRNA microRNA mL Milliliter mM Millimolar MP movement protein mRNA messenger RNA MEAM 1 Middle East Asia Minor 1 MED Mediterranean NaCl Sodium chloride NaOH Sodium hydroxide

NaH2PO4 Sodium phosphate

NH4Cl Ammonium chloride NCBI National Center for Biotechnology Information ng Nanogram

xvi

NGS Next generation sequencing NSP Nuclear shuttle protein nt. nucleotide NW New World OD optical density ORF open reading frame OW Old World PCR polymerase chain reaction pH potential of hydrogen RAPD-PCR randomly ampliﬁed polymorphic DNA- polymerase chain reaction RCA rolling circle amplification RCR rolling circle replication REn replication enhancer protein Rep replication associated protein RFLP restriction fragment length polymorphism RNA ribonucleic acid RNAi RNA interference rpm revolutions per minute satRNAs satellite RNAs SCR satellite conserved region sg DNAs sub-genomic DNAs SIR Small intergenic region siRNAs short interfering RNAs SDS Sodium dodecyl sulphate SDW Sterile distilled water ssDNA Single-stranded DNA SSC Standard saline citrate TAE Tris-acetate EDTA Taq Thermus aquaticus TGS transcriptional gene silencing TrAP transcriptional activator protein

xvii

UV Ultra violet X-Gal 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside

xviii

Viruses and Satellites

ACMV African cassava mosaic virus AlYVV Alternanthera yellow vein virus AEA Ageratum enation Alphasatellite AYVSGA Ageratum Yellow Vein Singspore Alphasatellite BGYMV Bean golden yellow mosaic virus BhiYVDV Bhendi Yellow Vein Dehli Virus CLCuBuV Cotton leaf curl Burewala virus CLCuKoV Cotton leaf curl Kokhran virus CLCuMuV Cotton leaf curl Multan virus CLCuShV Cotton leaf curl Shahdadpur virus ChiLCuV Chilli Leaf Curl Virus ChiLCuB Chilli Leaf Curl Betasatellite CLCuMuA Cotton leaf curl Multan alphasatellite CLCuMuB Cotton leaf curl Multan betasatellite GDarSLA Gossypium darwinii symptomless Alphasatellite MeYVMV Mesta yellow vein mosaic virus OELCuV Okra enation leaf curl Virus ToLCuPkB Tomato Leaf Curl Pakistan Betasatellite

xix

1 Introduction and Review of Literature

1.1 Bemisia tabaci

1.1.1 Morphology Bemisia tabaci belongs to the order Hemiptera, sub-order Homoptera, the sub-family Aleyrodinae, family Aleyrodidae, superfamily Aleyrodoidea, [1, 2]. Members of the Aleyrodoidea derive their common name from white powdery secretion that cover their body and wings. Adults B. tabaci are whitish yellow in color and their body is soft when they emerge. Within few hours of emergence, their wings become lustrous white because of the powdery wax whereas the body remains light yellow. Males are usually smaller in size (0.82 mm) than females (0.96 mm) [3, 4].

The closest relative to whiteflies are aphids, psyllids, mealybugs, and scale insects which all feed on plant sap by using sucking and piercing mouthparts [5-7]. Both adults B. tabaci and immatures feed exclusively on phloem. Two maxillary and mandibulary stylets fuse to form a stylet bundle which is used to extract the fluids from plants. The food and salivary canal are formed by the joining of the maxillary stylets [8, 9]. From the stylet plant fluid proceeds into the precibarium which connects the food canal to the cibarium and esophagus. Food passes through the various parts of the digestive tract, including midgut, filter chamber and hindgut, and is excreted out through the anus [10, 11]. B. tabaci excretes a sugary sticky material called honeydew which serves as a substrate for the black sooty mold fungi that reduce the photosynthetic activity and ultimately market value of plant products [12-14].

“Whiteflies have a unique sex determination system known as haplodiploid, in which fertilized eggs develop into females whereas unfertilized eggs are developed into males”[15, 16]. All the female offsprings inherit paternal genes while male offsprings have only a maternal genome.

Chapter 1: Introduction and Review of Literature

1.1.2 Geographical Distribution In the family Aleyrodidae, the evolutionary history of the Bemisia taxa, suggest that this species may have originated in tropical African and very recently moved to the Neοtropics and sοuthern North America [17].“However, some indications proposes that B. tabaci may have originated in India/Pakistan because of the vast diversity of parasitoids present, which is a criterion to identifying the geographical origin of a species”[18].

In 1897, for the first time, B. tabaci was found on sweet potato in Unites States [19]. In 1928, it was collected from Euphorbia hortella plant in Brazil and then it was found in Taiwan in 1933 [2]. It now occurs globally, from trοpical to subtrοpical regions and is also found in temperate regions of the world, such as Canada, Japan and the Netherlands, where it has affected greenhouse crops [20]. B. tabaci has become a serious problem around the world with the exception of Antartica [21].

1.1.3 Host Range Bemisia tabaci is a polyphagous pest around the world that has been recorded on 600 plant species [2, 22, 23]. Due to its polyphagous nature, it has been found to use various plant species, including annual and perennial, cultivated and non-cultivated, as a feeding and reproductive hosts [24, 25]. B. tabaci has been documented to infest plants in the families Sοlanaceae, Malvaceae, Labiatae, Leguminοsae, Fabaceae, Euphοrbiaceae, Cοmpοsitae, Cruciferae, Cucurbitaceae, and Asteraceae [2, 26, 27], and appears to show a preference for tomato, sweet potato, squash, poinsettia, melon, gherkin, eggplant, cucumber, cotton”[28]. Oviposition of B tabaci varies with different hosts plants and leaf surfaces within the host [29, 30]. In Pakistan, B. tabaci has been recorded from 229 from plant species [31].

1.1.4 Life Cycle of Bemisia tabaci The life cycle of B. tabaci comprises of six life stages: the eggs (Fig-1-A), the first nymph also called a crawler (Fig 1-B), 2nd and 3rd instars which are sessile, 4th instar and the adult. The eggs are usually 0.2 mm long and are whitish- yellow in color. When eggs are about to hatch they become darker in color. Female B. tabaci lay eggs on the lower side of leaves which are attached to the host plant via the pedicel or stalk. It has been reported that female lays eggs in circular or semi-circular pattern during feeding

Chapter 1: Introduction and Review of Literature

[1, 32]. After the hatching the first instar (crawler) is 0.3 mm in size and transparent to opaque in color. This instar is mobile and searches for a suitable place to start feeding. Two molting events take place and the immobile second and third nymphs produced are 0.4 and 0.5 mm in size, respectively. The early fourth nymphal instar is 0.6mm in size and the eyes are smaller than in the previous nymphs. There is some morphological character difference between early and late fourth nymphal stages but there is no molting between these two stages. The eyes are prominent appearing as two red spots. This stage is referred to as pupa but B. tabaci has incomplete metamorphosis, the life cycle is completed without a pupal stage. After the last nymphal stage, the adult whitefly will emerge leaving behind the transparent exuvia. The adults are normally soft-bodied and whitish-yellow in color and become completely white after deposition of wax. The life cycle of Bemisia tabaci varies according to the temperature and the host plant. In summer it lasts 14-20 days while in winter it lasts for 74-75 days in Eygpt [33]. Bemisia tabaci reproduces throughout the year. In winter eggs and adults are found on newly emerging plants [34]. Whiteflies prefer fresh young leaves for oviposition while the other life stages take place on the middle-aged and older leaves [32, 35, 36]. Depending upon the environmental conditions females can produce as many as 300 eggs during their life cycle [12].

Chapter 1: Introduction and Review of Literature

A: oval-shaped eggs B: 1st nymphal stage C: 2nd and 3rd nymphal stage

F: Adult E: Red eyed stage D: 4th nymphal stage

Figure 1-1 Life cycle of Bemisia tabaci. The eggs (A) are oval and attached to the leaf, (B) the first nymphal stage, (C, D) 2nd, 3rd and 4th nymphal stages, (E) red-eyed or also called pupa, (F) adult whitefly. Reproduced from the web site of Lance S. Osborne (mrec.ifas.ufl.edu). 1.2 Economic Impact of B. tabaci The insect damage plants directly by feeding on plant sap which causes the change in the physiology of the plant and ultimately physical abnormalities such as silver leaf symptoms in Curcubita plants, irregular ripening of tomato and white stem disorder of brassicas [13, 37-41]. Excreta (honeydew) of whiteflies are rich in carbohydrates which cause stickiness and act as host of sooty mold fungi on plant leaves, fruit and the lint of cotton. Indirect damage caused by whiteflies is by vectoring important plant-infecting viruses. B. tabaci vectors an estimated 111 distinct virus species [14].

There have been several reports of B. tabaci vectored diseases causing huge yield losses not only in field crops but also affecting greenhouse crops [42-44]. B. tabaci was first reported to cause serious damages to the cotton in northern India, in the late 1920s and early 1930s, which is now the part of Pakistan [45, 46]. Later on, there were several reports of invasion of B. tabaci on cotton around the world like including Iran and Sudan in 1950, El-Salvador, Mexico, Brazil, Turkey, Israel, Thailand, Arizona and California, USA, Ethiopia and Burkina-Faso [41] in the years 1961, 1962, 1968, 1974, 1976, 1978, 1981, 1984 and 2003, respectively. Heavy infestation of whiteflies in cotton fields leads to the scattering of insects to other crops present in adjacent areas, which ultimately resulted in the need to use more insecticides.

Chapter 1: Introduction and Review of Literature

In Africa, epidemics of pest population was well documented, due to the extensive use of DDT and other insecticides to control the pest population in cotton in Sudan Gezira agricultural complex. The frequent (over) use of insecticides has caused the development of resistance in B. tabaci and thus a failure to control [47, 48]. B. tabaci resistant to insecticides increase their oviposition rate due to insecticide stress, thus produce large populations [49]. B. tabaci has also affected the cassava which is the main staple crop of African by spreading African Cassava Mosaic Disease [50].

In the USA, B. tabaci has been found in different agricultural regions of many States, until 1981 when it causes serious damages in Arizona and California. In Florida, a heavy infestation of whiteflies was found on poinsettias and symptoms of Silverleaf were found on the squash in 1986 [51, 52]. The estimated losses were between US$ 200 and 500 million in Arizona, Florida, California and Texas in 1991 and 1992 respectively. A total of US$ 153.9 million was spent by the cotton grower to reduce Bemisia infestation and to avoid lint stickiness in cotton between the year 1994 and 1998 in Arizona, California and Texas [53]. One study examined the socio-economic effects of B. tabaci, showing that for every US$ one million lost there was 1.2 million US$ loss of personal income and also the loss of forty two jobs [54]. In Mexico US$ 33 million losses were caused by B. tabaci to cotton, sesame, melon and watermelon crops in the Mexicali Valley in 1991 and 1992. In 1991, cotton production was reduced to 653 ha from 39,415 ha due to the heavy losses in the Mexicali valley [55]. In 1995 and 1996, the cultivated area of cotton was reduced to 65% as result of the invasion of B. tabaci in Sonora [56]. Production of soybean in Sonora, Mexico has been greatly affected because of the heavy infestation. Although the cultivated area ranged from 89,000 to 124,000 ha, the estimated profit was marginal between the years 1992 and 1994 [38]. The cost of insecticides was about US$ 120 per ha but was not effective because of resistance. Since 1998 in the US the production of soybean and cultivated area (about 500 ha annually) and ultimately profit has reduced (American Soybean Association, 2000). Due to the sooty mold and geminivirus infection on tomato, melon and pepper crop, the cost of whiteflies control was increased from 30% to 50% in the year 1998 and 1991 in Guatemala, particularly the loss was increased to 40% in case of melon [57].

Since 1995, estimated losses exceeded US$ 5 billion in Brazil due to the damages caused by B. tabaci. The problems has expanded and cover almost all regions 5

Chapter 1: Introduction and Review of Literature of the country and affect a vast variety of crops including beans, cotton, cabbage and many others [37]. There have been numerous reports of huge losses due to B. tabaci infestation in from South America, including Argentina [58], Colombia [59] and Bolivia [60]. At the beginning of 1974, B. tabaci infestation and losses were reported in countries surrounding the Mediterranean Basin. Severe damage was found on the poinsettia and tomato crops in Itay and France [61]. In Azerbaijan and Georgia, B. tabaci has been recorded and also found affecting citrus grown in glasshouses in the southern coast of the Crimean and the Black-Sea-Coast of the Caucasuse”[61]. It has been reported as a pest affecting various crops in many countries in the east in Yemen, UAE, Turkey, Somalia, Saudi Arabia, Morocco, Libya, Kuwait, Jordan, Iraq, Iran, Eygpt, Cyprus, Bahrain and Algeria [61].

In Taiwan (1953) several epidemics of B. tabaci were noticed in 1953 and in 1972 in Yunnan (China). The problem spread from six to 12 provinces covering the south to north parts of the country between the 1953 and 1995 [62].

In Australia, Bemisia was first reported in 1959 but it was not a problem [63- 65]. Then in 1994, it was in cotton. In the Pacific region, in mid 1990s, B. tabaci was reported from on eighteen islands including“American-Samοa, Cook-Island, Fiji, Federated-States-Micrοnesia, Guam, Kiribati, Marshall-Islands, New Caledonia, Niue, Papua-New-Guinea, and the Sοlomon Islands [66].

In Pakistan, there has been massive damage to the cotton crop since the early 1990s, with the spread of cotton leaf curl disease vectored by B. tabaci. In 2013 and 2014 there was a 9.2% reduction in cotton production due to various factors, the most prominent of which were insect and virus damage (Pakistan economy survey, 2014; http://www.finance.gov.pk). The invasion of B. tabaci into crops and the extent of damage vary with different plant species and also changes with the season and locality. The plant species which are heavily infested in one area may have no infestation in other area. For example, in Africa, cassava is severely affected, but not significantly in South America [67].

1.3 History and Synonymization In 1889 B. tabaci was reported for the first time, causing damage to tobacco in Greece and was named “Aleyrodes tabaci” [68]. In 1897, it was found on sweet potato in the US and was named as Aleyrodes inconspicua and later named the “sweet potato 6

Chapter 1: Introduction and Review of Literature whitefly” [19]. In 1914, Aleyrodes inconspicua was moved to another genus, Bemisia and named Bemisia inconspicua, a species type. Over the following 50 years, between 1914 and 1964 19 additional species were identified from 14 countries on different hosts plants which were later synonymized with Bemisia tabaci. The most distinct event occurred in 1936 by Takahashi [69], which moved the species tabaci into the genus Bemisia resulting in B. tabaci, a name used to this day.

Initially, morphological characteristics of the fourth instar were the preferred characteristics for identifying whitefly species [70]. However, it was realized that there was an overlap of the morphological characters leading to synonymization of a number of earlier species. The reason for this is that the fourth instar changes its morphology with the host plant. The major synonymization events occurred in 1957 and 1978 [2, 71].

1.4 Host Races and the Biotype Concept The concept of host race came into being in 1957 by Bird when two populations of B. tabaci were observed in Puerto Rico [72]. These two populations were named the “Sida” and “Jatropha” races on the basis of differing host ranges. The Sida race was polyphagous, colonized many hosts plans easily and was an efficient vector of viruses while the Jatropha race was monophagous and only transmitted Jatropha mosaic virus [72]. A similar situation was observed in Africa with the introduction of cassava varieties from Brazil. B. tabaci present in Brazil was polyphagous but did not colonize cassava [67] while in Africa it only colonizes cassava. Because of the Brazilian cassava varieties in Africa, cavassa production suffered from huge losses due to the viruses causing cassava mosaic disease [73]. These examples showed B. tabaci populations with apparently no differences in morphology nevertheless showed significant differences in colonizing on a particular host [74]. The concept of host race was based upon the biological difference in the form of host utilization which ultimately reflects the genetic difference between them.

The term “biotype” has been used to describe B. tabaci races which have differing host preference, inducing distinct effects on plants (such as “silver leaf” syndrome), have differing resistance to insecticides and differing abilities to transmit viruses [49, 75, 76]. This issue gained in prominence when the A biotype caused serious damage to cotton and cucurbits crops in the southwestern US and Mexico in 1980. In

Chapter 1: Introduction and Review of Literature

1991 biotype B displaced the already present A biotype leading to a proposal that the B biotype is considered as a separate species [77]. In order to differentiate among different biotypes, various techniques have been developed over the past three decades which includes SCAR (sequence characterized amplified regions) markers [78], RAPD-PCR [77], CAPS/RFLP”[79], ampliﬁed fragment length polymorphisms (AFLP) [80], mitochondrial cytochrome oxidase 1 (mtCO1) sequencing [81-85], ITS 1 sequencing [86], and microsatellites [87, 88].

1.5 Bemisia tabaci, a Cryptic Species Complex

A taxonomic system was proposed in 2010, using the mtCOI sequence-based analysis, and a 3.5 % threshold was set to delimit species [82, 89-92]. The cut-off threshold was subsequently raised to 4% [84]. The geographical origin and the distribution pattern of B. tabaci cryptic species have been studied extensively [81-83]. Two main groups were identified and named as Old World (OW) and New World (NW). The OW group was further divided into three sub groups: Indian sub-continent, equatorial Africa and Sahel region groups [81, 87]. The species were named according to the region they were identified for example species which were found in Americas were named as new world [93, 94] while the Asian species (Asia I, II, III, IV, Japan, China 1,2,3) [95, 96] and SSA (1,2,3,4,5,6) [97, 98] species were named according to their regions. However, recently B. tabaci species from Africa (OW) has been shown to group with the New world species, showing an evolutionary relationship between Old World and New World species [99].

B. tabaci was regarded as a complex species, but a new vision has revealed that it is a morphologically indistinguishable cryptic species complex consisting of 36, or more, species [82, 95, 100-102], which were formerly referred to as biotypes [81, 83]. These are Africa, Asia I, Asia III, Asia IV, Asia II 12, Asia II 11, Asia II 10, Asia II 9, Asia II 8, Asia II 7, Asia II 6, Asia II 5, Asia II 4, Asia II 3, Asia II 2, Asia II 1, Australia, Australia/Indonesia, China 4, China 3, China 2, China 1, Indian Ocean, Italy 1, Japan 1, Japan 2, Middle East - Asia Minor 1 (MEAM 2, MEAM 1), Mediterranean (MED), New World 1, New World 2, , Sub-Saharan Africa (SSA) 1, SSA 2, SSA 3, SSA 4, SSA 5, Uganda [82, 95, 103, 104]. Recently five putative species were identified (SSA 9 through SSA 13) providing evidence that the ancestor of the B. tabaci species complex originated in Sub Saharan Africa [99]. The most invasive species are the B 8

Chapter 1: Introduction and Review of Literature and Q biotypes (MEAM 1 and MED species, respectively) which have a wide geographical distribution due to their ability to invade new areas and displace the native species [18, 105].

The time of evolutionary divergence of the species within the B. tabaci species complex is debatable. Based on fossil material and DNA sequences it has been estimated that the genus Bemisia diverged from the other whiteflies members about 87- 90 million years ago (mya) at the time when South America separated from Africa ([103, 106, 107]. There has been an inconsistency in the estimated time of divergence of MEAM 1 and MED, which has been put at ~13 mya [103], 2.9-0.4 mya [107] and 5- 6 mya [99] although all studies agree that agriculture was not the cause of diversification.

1.6 Endosymbionts Bacterial endosymbionts are prevalent in nature but are particularly prevalent in arthropods. The symbiotic relationship among bacteria and the insect is well known and have been well characterized [108]. Due to benefits of endosymbionts insects have been able to establish diverse and different environmental places without deleterious effects of unbalanced nutritional resources.

1.6.1 Primary Endosymbionts Primary endosymbionts are well characterized for their role in providing their insect host with nutrients and amino acid essential for their life and they are present in all hosts individuals. In insects, primary symbionts are located in specialized cells known as bacteriocytes and these are grouped to form a large mass of cells called bacteriomes. Primary endosymbionts are thought to have co-evolved with their hosts [108, 109]. Transmission electron microscopy studies have shown that whitefly bacteriocyte cells contain a bacterium which changes shape and size according to an environmental condition (pleomorphic) which was named “Candidatus Portiera aleyrodidarum” [110]. This differs from other primary endosymbionts in lacking the outer membrane of Gram-negative cell wall [111-113]. All the species of whiteflies harbor Proteira which are transmitted vertically and located in bacteriocytes of their host [113-115]. The nutritional role of primary endosymbionts has been studied extensively. Like other phloem feeding insects, whiteflies have maintained a

Chapter 1: Introduction and Review of Literature

.mutualistic relationship with the bacterial endosymbionts which provide them with the nutrients essential for their life, due to their unbalanced diet [108, 116, 117]. The genome sequence of Proteira has highlighted some other function this bacterium with the identification of carotenoid biosynthesis genes which are involved in overcoming oxidative stress [118-120].

1.6.2 Secondary Endosymbionts Obligate endosymbionts generally have much smaller genomes (less than 1000 kb, encoding less than 600 genes) consisting of genes which are involved in the biosynthesis of amino acids, other nutrients, and some housekeeping genes [108]. Metabolic complementation is crucial for the synthesis of these essential amino acids and nutrients not only from the host but also from other endosymbionts [121]. Secondary endosymbionts are facultative and are transmitted both horizontally and vertically [109, 122, 123]. In contrast to primary endosymbionts, secondary endosymbionts contribute to the insect hosts in many ways and also affects the host survival. Whiteflies have been shown to be infected with up to seven secondary endosymbionts; Arsenophonus, Cardinium, Fritschea, Hamiltonella, Rickettsia, Wolbachia, and Orentia like organism”[124-126]. Hamiltonella was found to be associated with MEAM-1 (B biotype) although Arsenophonus and Wolbachia infection was only identified in MED (Q biotype). The infection frequency of Rickettsia varies according to the host plant and the geographic location but was found in both biotypes but with a slightly higher frequency in MED (Q biotype) than MEAM-1 (B-biotype) [126]. Cardinium and Fritschea have been reported from another part of the world but found to be absent in Israel. So far Orientia has only found to infect whitefly populations in China [124].

1.6.2.1 Hamiltonella

Hamiltonella is a gammaproteobacterium (a class of Proteobacteria which includes several medically, ecologically, and scientifically important groups of bacteria) which is found irregularly in some Hemipteran insects such as aphids and whiteflies. The bacteria are facultative symbionts and are maternally transmitted. Studies have shown that “Candidatus Hamiltonella defensa” protects aphids from parasitoid wasps by killing the larvae of the wasp [127]. Hamiltonella has been reported from the two invasive B. tabaci species – B biotype knowns as MEAM 1 and Q biotype known as

Chapter 1: Introduction and Review of Literature

MED [124, 125, 128] although in Israel it has been identified in the MEAM 1 but not in the MED [126].

The GroEL protein produced by Hamiltonella defensa has been shown to interact with TYLCV and play a role transmission, possibly by stabilizing the virus in the insect [129]. For B. tabaci, the function of Hamiltonella as a whole remains to be fully explored. Whole genome sequencing of Hamiltonella has shown it to be involved in the synthesis of amino acids and their cofactors [130]. It has also been reported that Hamiltonella increases the fitness of whiteflies [131]. The later two studies support the hypothesis that Hamiltonella has some role in providing nutritions to its host B. tabaci. The whitefly host is not only dependent on the Hamiltonella for an amino acid supplement but can help the host in storing the amino acid and aid in nitrogen homeostasis [132].

1.6.2.2 Arsenophonus Arsenophonus is a gammaproteobacterium and has been estimated to infect 5 % of the arthropods species on the earth [133]. In Bemisia tabaci, the GroEL protein produced by Arsenophonus interacts with the CP of one of the viruses associated with CLCuD thus assisting in virus transmission [134]. Arsenophonus has been identified in Asia II 1 Biotype from China, India, and Pakistan [134, 135] as well as in Q biotype insects in Israel but not in the B biotype [126]. A study by Raina et al [136] has shown that this bacterium has additionally been shown to have a negative effect on host fitness, reducing fecundity and slowing the development of nymphs. In other arthropods, Arsenophonus has been shown to be involved in manipulation sex ratio by killing the male of the parasitic wasp Nosania [137].

1.6.2.3 Cardinium Candidatus Cardinium belongs to the group Bacteroidetes alters the reproduction of the host by cytoplasmic incompatibility, parthenogenesis, and feminization. Infection of insects with bacteria of the genus Cardinium not only reported in whiteflies but also in other insects as well such as armored scale insects and sharpshooters as well as arthropods such as spiders, ticks, and mites. The infection rate of Cardinium among different arthropods is about 7 % [138, 139]. In B. tabaci, “Ca. Cardinium hertigii” was first identified in the parasitic wasp Encarsia and was proposed as species type [138]. Cardinium hertigii, like Wolbachia, has causes cytoplasmic incompatibility and

Chapter 1: Introduction and Review of Literature parthenogenesis [140]. These effects have not been reported for B. tabaci, signifying the importance of this bacterium as mutualistic endosymbiont. Genus Cardinium can be divided into four supergroups A, B, C and D, on the basis of molecular data (16S and gyrB genes), indicating that this nomenclature is similar to the Wolbachia endosymbionts [141-143].

1.6.2.4 Rickettsia Rickettsia is Gram-negative alphaproteobacteria some of which are animal and plant pathogens [144]. In B. tabaci, Rickettsia was first detected by using PCR and confirmed by fluorescent in situ hybridization for MEAM-1 [145]. Rickettsia has been reported to be associated to affect whitefly reproduction by changing the sex ratio, by producing more females and enhancing the fitness of offspring [146]. Rickettsia has been documented to increase susceptibility to insecticides [147, 148] and increased tolerance of heat stress in B. tabaci [149].

1.6.2.5 Wolbachia Wolbachia is a genus of Gram-negative bacteria belonging to the class Alphaproteobacteria and is one of the most widespread symbionts, being associated with 70% of the insect species which have been investigated [150]. Wolbachia has the ability to enhance its own transmission to the next generations by to manipulating host reproduction through parthenogenesis, feminization, cytoplasmic incompatibility, and male killing [151]. Wolbachia has been shown to perform number of different roles in bedbugs by providing nutrients [152], increasing the host fitness in the moths [153] and by suppressing RNA viruses in Aedes aegypti, Drosophila and Culex quinquefasciatus [154-157]. These bacteria have been identified in B. tabaci but their role is poorly understood [87, 135, 158]. They have been found to cause cytoplasmic incompatibility among various biotypes of B. tabaci [159] and increase the host fitness by playing role in reproduction, development, and defense against parasites [160].

1.6.2.6 Fritschea Candidatus Fritschea (Chlamydiae) are facultative symbionts of sap-feeding whitefly Bemisia tabaci and the scale insect Eriocccus spurius. This bacterium occurs within bacteriocytes in B. tabaci and is transmitted vertically but there is very less information about its phenotype in B. tabaci [161]. This bacterium has been only reported from the

Chapter 1: Introduction and Review of Literature

A biotype in USA [161]. Recently, it has been reported to infect whiteflies species T. acaciae and B. tuberculata other than Bemisia tabaci [93].

1.7 Bemisia tabaci Transmitted Viruses Of the 1500 described species of whiteflies [6], only few are able to transmit plant viruses. These vectors are the sweet potato whitefly “Bemisia tabaci” and the green house whitefly “Trialeurodes vaporarium”. Bemisia tabaci vectors five genera of plant viruses - “begomoviruses, carlaviruses, criniviruses, ipomoviruses and torradoviruses” [162]. The most devastating viruses transmitted by whiteflies are the begomoviruses (family Geminiviridae, genus Begomovirus) and the criniviruses (family Closteroviridae). These two groups of viruses are both transmitted by whiteflies but differ in the mechanism of transmission.

1.8 Mechanisms of Virus Transmission by Whiteflies Whiteflies transmit viruses to host plants by two mechanisms, known as semi-persistent and persistent. By definition, in semipersistent transmission, the transmitted virus does not circulate through the body of the insect; this is also known as forgut- or stylet-borne transmission [163]. The acquisition time lasts for minutes to hours and the retention time is for hours to days for semi-persistent transmission. Carlaviruses, criniviruses, ipomoviruses and torradoviruses are transmitted semi-persistently [162]. For persistent transmission the acquisition time lasts for hours and retention time is for days or the entire life of the insect. Persistent transmission can characterized as either persistent circulative, in which the virus does not replicate in the insect, and persistent propagative, in which the virus replicates in the insect [163, 164]. Geminiviruses are circulatvely transmitted, with one possible exception [165], whereas whiteflies have so far not been shown to transmit viruses in a propagative manner.

1.8.1 Begomovirus Transmission by B. tabaci B. tabaci transmit Begomoviruses in a circulative (non-propagative) persistent manner. Virus particles are acquired from the plant in the phloem sap with help of the stylet [166]. The viral particles then pass through esophagus and the midgut. The virions cross into the haemolymph from either the filter chamber or the anterior midgut by receptor- mediated endocytosis. The virions are translocated to the primary salivary glands and enter the salivary secretions by endocytosis before being transported to the plant

Chapter 1: Introduction and Review of Literature phloem with salivary secretion. The GroEL protein, produced by endosymbiotic bacteria, protect the virus particles in the haemolymph [165, 166].

Figure 1-2 The circulative, (non-propagative) persistent virus transmission by B. tabaci. "The ingested viral particles (shown in red) are ingested from the plant phloem (p) through the stylet (s). Virions pass through the filter chamber (fc) with the help of HPS70 protein (black particles) and enter into the haemolymph by endocytosis from either the filter chamber or the anterior midgut (mg). The GroEL protein, produced by endosymbiotic bacteria residing in bacteriocytes (bc), protect the virus in the haemolymph, and forms a complex with the virus coat protein (CP). Protected by GroEL the virus circulates throughout the haemocoel and enters the posterior salivary glands (psg) by endocytosis. The virus is then “spit” into the phloem of plants upon which the insect feeds along with salivary secretions. Other insect structures are shown as hindgut (hg) and esophagus (e). The figure has been reproduced from Gray et al. [167]. 1.9 Geminiviruses The family Geminiviridae is a group of genetically and biologically diverse viruses. The name of geminiviruses is derived from Latin “gemini”, meaning twins; referring to the twinned icosahedral particle [168]. Geminiviruses infect either dicotyledonous or monocotyledonous plants and have two distinguished features:

• Their genetic material consists of either one or two molecules of single-stranded (ss)DNA each of which ranges from 2.5 to 3.6 kb • The particle morphology which is twinned quasi-icosahedral, 18-30 nm (Figure 1.1) [169, 170]

Chapter 1: Introduction and Review of Literature

Figure 1-3 Three-dimensional representations of geminivirus particles. The protein coat is shown in yellow, which contains encapsulated DNA shown in red. The figure has been reproduced from Böttcher et al. [171].

B. tabaci, various species of leafhoppers, an alphid and treehopper are the phloem-feeding insects which are vectors of geminiviruses, although viruses of each genus are usually only transmitted by a single species of insect [172]. Some of the geminiviruses are vegetatively transmissible, causing problems in for example cassava and sweet potato [173, 174], and a few are transmitted mechanically. Although the majority of geminiviruses are not vertically transmitted through seed, recently at least three species have been shown to be seed transmissible ([175-177]. In plants different various of symptoms are caused by geminiviruses including distorted growth, leaf streaking/striation, stunting in monocotyledonous plants whereas in dicotyledonous plants they cause yellow spots, golden/green yellow mosaic/mottle, curling, leaf crumpling, distortion, interveinal yellowing, purpling and vein swelling [172]. A small number of geminiviruses, particularly begomoviruses, are characterized by latent (non- symptomatic) infections, such as those infecting sweet potato [178, 179]. Geminiviruses have also found use as expression vectors in plant molecular biology research. They are used for the analysis of gene regulation and expression of foreign proteins (such as medically important proteins – known as “molecular pharming”) in both monocotyledon and dicotyledons [180].

Chapter 1: Introduction and Review of Literature

1.9.1 Classification of Geminiviruses Geminiviruses are classified into nine genera:

• Becurtovirus • Begomovirus • Capulavirus • Curtovirus • Eragrovirus • Grablovirus • Mastrevirus” • Topocuvirus • Turncurtovirus

The classification is on the behalf of their insect vector, host range, genome structure, genome organization, sequence relatedness and phylogenetic relationships [168, 172, 181]. The identification of further, distinct geminiviruses, suggests that additional genera will need to be established [182-185].

1.9.2 The Genus Begomovirus The name “begomovirus” derives from the name of the first species in the genus identified, at the time known as “Bean golden mosaic virus”, which is now called Bean golden yellow mosaic virus [181, 186-188]. Devastating diseases of economically important crops are caused by begomoviruses in the warmer parts of the world. Begomovirus is the largest genus of geminiviruses containing approx..288 members [189]. Begomoviruses infect only dicotyledonous plants and are transferred from infected to healthy plants by the whitefly vector B. tabaci [190]. Recombination and the expansion of the geographic host range of the whitefly vector are the main factors involved in the increasing spread of and losses due to begomoviruses [191].

1.9.2.1 Bipartite Begomoviruses Until quite recently all begomoviruses native to the NW were shown to have bipartite genomes. Only recently were three species with monopartite genomes identified [192- 194]. In contrast few bipartite begomoviruses have been identified in the OW, including two more similar to begomoviruses native to the NW [195]. The major difference

Chapter 1: Introduction and Review of Literature between begomoviruses native to the NW and those native to the OW are that begomoviruses native to the NW lack the AV2 gene [195].

Bipartite begomoviruses have two genomic components, known as DNA A and DNA B, each of 2600 to 2800 nt. The two components which share a sequence of 180- 200 nt with high levels of sequence identity, known as the common region (CR) which resides (for most begomoviruses) within the non-coding intergenic region (IR) [196]. The CR has an important role in maintaining the integrity of the split genome, by encoding the origin of replication (ori) for virion-strand rolling-circle DNA replication [197, 198]. The ori consists of the conserved (between all geminiviruses) stem-loop structure with the nonanucleotide (TAATATTAC) sequence forming part of the loop and iterons (short repeated sequences upstream of the stem-loop structure).

The DNA-A component encodes, four (in some cases five) proteins in the complementary-sense orientation; the replication-associated protein (Rep), the replication-enhancer protein (REn), the AC4 protein and the transcriptional-activator protein (TrAP). The virion-sense encodes the coat protein (CP) and the AV1 protein. Rep is a rolling-circle replication initiator that binds DNA in a sequence-specific manner (specifically the iterons) and induces a nick within the nonanucleotide sequence (TAATATTAC) to initiate replication of the virion-strand; it is the only virus-encoded product required for viral DNA replication [199-204]. REn interacts with Rep and various host factors to create an environment conducive for virus replication [205]. The TrAP is a transcription factor which up-regulates virion-strand gene expression and various host genes and can act as a suppressor of small RNA mediated host defense [206-208]. The AC4 protein can be a suppressor of small RNA mediated host defense as well as a symptom determinant [209]. The function of the AC5 protein (when present) remains unclear but may be involved in virus replication, pathogenicity and overcoming RNAi based host defenses [210, 211]. The CP is the only structural protein encoded by geminiviruses and is involved in movement within plants as well as transmission between plants [212, 213]. The AV1 protein may be involved in virus movement in plants and also affect the relative levels of ss and dsDNA [214, 215].

Although capable of independent replication and production of virus particles, the DNA-A component of the bipartite viruses requires the movement protein (MP) and the nuclear shuttle protein (NSP) encoded by the DNA B component to

Chapter 1: Introduction and Review of Literature symptomatically infect plants [216]. NSP and MP influence on the host range of the virus and are necessary for intra- and intercellular viral movement [217, 218].

Figure 1-4 Genome organization of bipartite begomoviruses (A) and B. tabaci (B), the vector of begomoviruses. Orientation and the position of the genes are shown by arrows. Bipartite begomoviruses encode up to nine gene products. The DNA A component encodes the transcriptional- activator protein (TrAP), the replication-enhancer protein (REn), replication-associated protein (Rep), the AC4 protein, the AC5 protein, the AV2 protein, and the coat protein (CP) and the DNA B component encodes the movement protein (MP) and the nuclear shuttle protein (NSP). Bipartite begomoviruses native to the New World (and two species native to the Old World) lack the AV2 encoding gene. The DNA A and DNA B shared a conserved region known as the common region (CR). The CR encompasses a conserved stem-loop structure which contains, as part of the loop, the nonanucleotide sequence TAATATTAC which is conserved between the vast majority of geminiviruses. The image of B. tabaci is reproduced from http://biottec.es.

1.9.2.2 Monopartite Begomoviruses The genomes of monopartite begomoviruses are 2.7-2.8 kb in length are homologs of the DNA A components of bipartite begomoviruses but differ from these in being able to induce symptomatic disease in the absence of a second component (DNA B). The major differences between bipartite and monopartite begomoviruses, other than the absence of the DNA B component, is that monopartite begomoviruses require the V1 protein and CP to induce symptomatic infection whereas they are dispensable for bipartite begomoviruses, although mutation of the genes encoding these proteins does attenuate symptoms for bipartite begomoviruses [219]. Interestingly, the majority of monopartite begomoviruses associate with betasatellites, which, although not essential for symptomatic infection (as is the case for DNA B), do appear to encode at least some of the functions provided by the DNA B component (see section 1.9.3.1).

Chapter 1: Introduction and Review of Literature

Figure 1-5 Typical genome organization of monopartite begomoviruses. The genome of monopartite begomoviruses, which is a homolog of the DNA A components of bipartite begomoviruses, encodes up to seven gene products; the transcriptional-activator protein (TrAP), the replication-enhancer protein (REn), the replication-associated protein (Rep), the C4 protein, the C5 protein, the V2 protein, and the coat protein (CP). Monopartite begomoviruses native to the New World (and two species native to the Old World) lack the V2 encoding gene. The non-coding sequences from which the genes diverge contains a conserved stem-loop structure which has, as part of the loop, the nonanucleotide sequence TAATATTAC which is conserved between the vast majority of geminiviruses. 1.9.3 Satellites Associated with Geminiviruses The term “satellite” was used for the first time in 1962 by Kassanis during the investigation of Satellite tobacco necrosis virus (STNV) associated with Tobacco necrosis virus (TNV) [220]. Satellites are defined as nucleic acid or viruses which are dependent upon a helper virus to perform their all or some functions such as replication, encapsidation, movement in plants and transmission. There is no sequence similarity found between Satellites and their helper viruses and are not required for the proliferation of the helper viruses [221]. The difference between a satellite nucleic acid and asatellite virus is that later are encapsidated by their own structural protein whereas satellite nucleic acids use the structural proteins of their helper virus. Most satellites are ssRNA, only a few consists of dsRNA [222]. Monopartite begomoviruses may associate with two types of satellites - alphasatellites and betasatellites.

1.9.3.1 Betasatellites DNA β known as Betasatellites, are single-stranded DNA molecules (~1350 nucleotides in length) that are generally identified in association with monopartite

Chapter 1: Introduction and Review of Literature begomoviruses and have so far been identified only in the OW. However, recently betasatellites are increasingly being identified in association with bipartite begomoviruses [223, 224]. Since they were first identified, greater than 1000 full-length sequences of betasatellites have been submitted to the databases – indicating the importance of these satellites to agriculture in the OW. It has also become evident that, in contrast to the NW, monopartite begomoviruses associating betasatellites are the norm, with relatively few bipartite begomoviruses having been identified.”

The first DNA satellite was reported in Australia in 1997, in plants infected with the monopartite begomovirus Tomato leaf curl virus (ToLCV) and was named ToLCV- sat [225]. ToLCV-sat is a small DNA molecule (682 nucleotides in length) that has no apparent effect on symptoms induced by the helper virus in plants and depends for its replication and insect transmission upon a helper begomovirus [225]. Only upon the identification of betasatellites in association with Cotton leaf curl Multan virus and Ageratum yellow vein virus was it realized that ToLCV-sat is a defective betasatellite [226, 227].

Betasatellites have a very conserved genome organization comprising of a region conserved among all betasatellites known as SCR, the satellite conserved region, (A-rich) sequence and a single coding sequence (known as βC1) encoded in reverse orientation [228]. The SCR region of ~150 nt encompasses a predicted stem-loop structure with, for the vast majority of betasatellites, the nonanucletide sequence TAATATTAC forming part of the loop.“This structure is similar to the origin of virion- strand DNA replication of geminiviruses, although the vast majority of betasatellites lack the iterons (sequence-specific Rep binding sites) of their helper viruses.”

The βC1 protein is the only protein encoded by betasatellites and is multifunctional. The protein is a suppressor of post-transcriptional and transcriptional gene silencing, is a dominant symptom determinant and interacts with a range of host- encoded factors [229-232].

Chapter 1: Introduction and Review of Literature

Figure 1-6 Genetic organization of betasatellites. Betasatellites encode a single protein, the βC1 protein and (A-rich) region, rich in adenine as well as a region known as satellite conserved region (SCR) which is conserved among all betasatellites. “The SCR contains a conserved stem-loop structure which contains, as part of the loop, known as nonanucleotide sequence TAATATTAC with similarity to the origin of virion-sense DNA replication of geminiviruses.” 1.9.3.2 Alphasatellites Alphasatellites have recently been classified by the International Committee on Taxonomy of Viruses [233]. The newly established family Alphasatellitidae encompasses two sub-families – Geminialphasatellitinae that includes alphasatellites associated with geminiviruses and Nanoalphasatellitinae that includes alphasatellites associated with nanoviruses (family Nanoviridae; a second family of viruses with multicomponent ssDNA genomes). However, recent studies of coconut foliar decay disease suggest that a proposed additional family of ssDNA viruses, which is as yet unnamed, also associates with alphasatellites [234]. Alphasatellites can be defined as Rep-encoding components of multipartite ssDNA viruses which have become “feral”, having become dissociated from the viruses which they were originally a component of. Although alphasatellites associated with nanoviruses were identified first [235], it was not until the identification of alphasatellites in association with geminiviruses (which are believed to have originated from nanoviruses - a case of interfamilial [pseudo-]recombination) that the significance of these molecules became apparent.

Alphasatellites, previously known as DNA 1, are circular single stranded DNA molecule ~1375 nucleotide in length, associated with geminiviruses and are mostly identified in association with monopartite begomoviruses in the OW that associate with betasatellites [236]. However, more recently, phylogenetically distinct alphasatellites have been identified which are associated with bipartite begomoviruses in NW [237,

Chapter 1: Introduction and Review of Literature

238] and alphasatellites have been identified in association with a mastrevirus and betasatellite infecting a monocot (wheat) [239].

In Pakistan, the alphasatellite reported with a geminivirus was shown in association with CLCuD in 1999 [236]. Since then over 1000 alphasatellite sequences have been submitted in databases. Alphasatellites are approx. half the size of their helper begomovirus DNA and have the ability to replicate independently, by virtue of encoding a Rep, but for their movement in host plants and transmission by insect vectors require a helper virus. For this reason, they are referred to as the satellite-like, rather than satellites – which needs a helper virus for their replication [58].

Alphasatellites encode a single gene that codes for a Rep protein (a rolling-circle replication-initiator protein) with similarity to the Rep protein of nanoviruses. This, together with the fact that alphasatellites have a nonanucleotide sequence TAGTATTAC in common with the components of nanoviruses, has led to the hypothesis that alphasatellites associated with geminiviruses were captured from nanoviruses during co-infection. The A-rich sequence, that contains 46-58% adenine residues, is proposed to be required to increase the size of alphasatellites from the size typical of nanovirus components (~1000 nt) to half that of a typical monopartite begomovirus (~1400 nt) [240]. Geminivirus particles have a strict size limitation for the encapsidation of ssDNA [241-243].

In contrast to betasatellites, alphasatellites from the NW do not enhance symptoms but rather appear to attenuate symptoms. This phenomenon appears to be due to a reduction in the replication of the betasatellite [244]. In contrast, alphasatellites from the NW, interacting with NW bipartite begomoviruses, appear to enhance virus accumulation and symptoms in plants [237, 245].

Chapter 1: Introduction and Review of Literature

Figure 1-7 Genetic organization of alphasatellites. Alphasatellites encode a single protein, “Rep (replication-associated protein) And adenine rich region (A-rich)”. The non-coding sequences contain a conserved stem- loop structure which contains, as part of the loop, TAGTATTAC, the nonanucleotide sequence with similarity to the origin of virion-sense DNA replication of nanoviruses.

Chapter 1: Introduction and Review of Literature

1.10 Objectives of the Study The study described in this Thesis was designed to investigate the whitefly Bemisia tabaci in Pakistan with emphasis on its relationship to CLCuD. The objectives of the study were:

1. To identify B. tabaci biotypes/cryptic species present in Pakistan using standard marker genes.

2. To identify endosymbionts and investigate the diversity harbored by B. tabaci in Pakistan.

3. To investigate the diversity of geminiviruses in B. tabaci in different geographical areas and from various hosts.

4. To investigate the level of virus and betasatellite acquired by B. tabaci using quantitative, real-time PCR (qPCR).

2 Materials and Methods

2.1 Insect Collection and Storage Whitefly specimens were collected from different geographic locations of Pakistan which cover the three provinces Punjab, Sindh, and Khyber Pakhtoon Khaw (KPK) in the years 2012 to 2015. Samples were collected from 161 locations and a variety of hosts. Samples were preserved in 80 % ethanol at −20°C until use.

2.2 DNA Extraction DNA was isolated from single whiteflies using a Fast tissue to PCR kit (Fermentas). Each whitefly sample was placed in a 1ml microfuge tube and crushed with 1 ml pipette tip. Lysis buffer (35 μL) was added plus 3.5 μL of proteinase K. The mixture was incubated at 55 ºC for at least 10 min before being maintained at 95 ºC for 3 min in order to inactivate the enzyme. Then 35 μL of neutralization buffer was added and the resulting DNA was stored at -20 °C for future use.

2.3 Quantification of DNA DNA was quantified using a Thermo Scientific Nanodrop Spectrophotometer 2000c. Absorbance was measured at 260 nm (A 1 at 260 nm=50 mg/mL).

2.4 Amplification of DNA

2.4.1 Polymerase Chain Reaction (PCR) Amplification A list of primers and their sequences has been provided in Table 2.1. The total reaction volume was made 25 μL containing 12.5 μL of Dream Taq polymerase master mix (Thermo Fischer Scientific, USA), forward and reverse primers 0.5 μL each of 10 pmol and sterile distilled water (SDW; 9.5 μL). PCR was carried out in a thermal cycler (Bio- Rad, USA) using specific PCR profiles determined for each target and primer pair.

Chapter 2: Materials and Methods

2.4.2 Rolling Circle Amplification (RCA) Circular molecules were amplified by RCA [199-201]. 18 μL of total Buffer mixture with 200-250 ng of genomic DNA plus 2 μL of ɸ 29 polymerase buffer (10X) (TRIS- Acetate pH 7.9), 1 μL of (50 mM) random hexamer primers, 2 μL of dNTPs (10 mM) was prepared and remaining volume was adjusted using SDW. This reaction mixture was heated at 95 °C for 5 min in order to denature the DNA and then cooled to room temperature. Another reaction mixture of the enzyme was made using ∼5-7 units of ɸ 29 DNA polymerase (0.25 μL; Thermo Fischer Scientific, USA) and 0.75 μL of ∼0.02 units of ppase (pyrophosphatase) (to prevent the inhibitory accumulation of pyrophosphate) plus 1 μL of SDW making 2 μL total volume. This 2 μL enzyme mixture was added to the buffer mixture and the reaction was incubated for 18-20 hours at 28 °C. After this inactivation of ɸ 29 DNA polymerase was done at 65 °C for 10 min.

2.5 Gel Electrophoresis For most purposes, a 1% agarose gel was used. 1 g of Agarose was boiled in 100 μL TAE buffer (0.5x) (0.5 mM EDTA and 20 mM Tris-acetate [pH 8.0]) and after cooling 3 μL (0.5 μg/mL) of ethidium bromide was added and poured into a gel tray sealed at both ends with stoppers and with a comb to produce wells. Once cool and set the ends and comb were removed and the gel tray was dipped into 0.5x TAE buffer contained in a midi gel apparatus (18 x 15 cm).“DNA samples (2 μL) were mixed with the 6x loading dye and loaded onto the gel. A one kb DNA ladder (Fermentas) was also loaded in order to estimate band sizes. The gel was electrophoresed at 100 volts and imagined in a Gel Documentation system (Gel DocTM EZ imager) under UV light.

2.6 Cloning of PCR Products PCR products of variable sizes 400-2800 bp were ligated into a plasmid vector (pTZ57R/T) using a T/A cloning kit (Thermo Fisher Scientific, USA). The reaction mixture (20 μL) contained ~350 ng (varied according to the length of DNA fragment), 1 μL pTZ57R/T (50 ng/μL), 2 μL 10X ligase buffer, and 0.5 μL (1-2 unit) of DNA ligase. The reaction mixture was incubated at 16°C for overnight in a water bath. Next day, the ligation mixture was transformed into competent cells of the TOP 10 strain of Escherichia coli (section 2.8.1).

Chapter 2: Materials and Methods

2.7 Cloning of RCA Product In order to clone the RCA product, the concatamers of DNA were digested with a suitable restriction endonuclease to yield monomers. The plasmid vector pTZ57R was digested with the same restriction enzyme. In order to avoid the self-ligation of the vector, this was treated with calf-intestinal alkaline phosphatase and then both the vector and RCA product were phenol-chloroform extracted and ethanol precipitated to remove proteins. Restricted vector and RCA product were then ligated in 1:3 ratio in a

20 μL volume containing 2 µL of ligation buffer (10x) and 0.5 µL of T4 DNA ligase. The ligation mixture was then placed at 16 °C overnight and next day it was transformed into a TOP-10 strain of E. coli (section 2.9).

2.8 Preparation and Transformation of Competent Cells

2.8.1 Preparation of Heat Shock Competent E. Coli Cells The method used for the preparation of E. coli competent cells was described by Cohen et al. [246]. “From freshly streaked plate of E. coli, a single colony was picked and transferred into 50 mL Luria Broth (LB) medium (1% tryptone [w/v], 1% NaCl [w/v], 0.5% yeast extract [w/v]) and kept at 37 °C in a shaking incubator overnight. Next day 3 mL of the culture was transferred to the flask containing fresh LB medium of 300 mL and then incubated in a shaking incubator at 37 °C until an OD600 of 0.2-0.5 was attained. The flask containing the culture was then cooled on ice for half an hour and the culture was transferred to sterile 50 mL tubes. All work was done in sterile conditions in a laminar flow hood. The tubes were then centrifuged at 3220×g at 4 oC for 10 min in order to pellet the cells and then supernatant was discarded. Then 15 mL

MgCl2 (0.1 M) was added to the cell pellet, resuspended and centrifuged at 3220×g at o 4 C for 8 min. Again, 10 mL CaCl2 (0.1 M) was added to the pellet, resuspended and kept on ice for half an hour. After this, it was again centrifuged at 3220×g at 4 °C.

Finally, 3-5 mL CaCl2 (0.1 M) was added to resuspend the cell pellet and cold glycerol was added at a ratio of 3:1. Aliquots (100 µl) of cells were made in microfuge tubes and kept at -80 °C.

2.9 Transformation of Competent E. coli Cells Heat shock method is used for the transformation of ligation products into competent E.coli cells. Competent cells (100 µL aliquot) were taken from -80 °C and thawed on

Chapter 2: Materials and Methods

ice. The ligated product of 8 µL was added to the E. coli competent cells and kept on ice for half an hour. Heat shock was given to the cells for 2 min in a water bath set at 42 °C temperature and then cells were immediately kept on ice for a further 2 min. LB medium of 1 mL was added to the cells and kept at 37 °C for one hour. After this, the cells were centrifuged to get pellet at 13000xg for 2 min. After transformation, cells were then spread on petri plates of solid LB medium (3 g Typton, 1.5 g yeast extract, 3 g of NaCl pH 7.0 and 4.5 g agar/300 mL of distilled water and autoclaved) containing ampicillin (100 µg/mL) along with 100 µL of IPTG (Isopropyl Beta-D-1- thiοgalactοpyranοside; 24 mg/mL) and 20 µL of 50 mg/mL X-Gal and kept at 37 °C for 16 hours. The following day white colonies were selected and transferred into culture tubes containing 3 to 5 mL of LB media containing appropriate antibiotic and again kept overnight at 37 °C in a shaking incubator. Plasmid DNA was extracted (section 2.10) and restriction analysis (section 2.11) was done to confirm the cloned product.

2.10 Small-scale Plasmid Purification Using sterile tooth pick, a single bacterial colony was picked from petri plate and transferred into an autoclaved culture tube containing 5 mL of LB media containing 5 µL ampicillin (0.5 mg). The culture tube was then kept in a shaking incubator, set at 37 °C, overnight and the following day the culture was transferred to a 1.5 mL centrifuge tube. After this tube was centrifuged at 13000xg for 2 min. The supernatant was removed, and the pellet was vortexed to resuspend in 100 µL of solution 1 (EDTA 10 mM [pH 8.0], glucose 50 mM, RNase A 100 µg/mL and 25 mM Tris-HCl [pH 8.5].” Cell lysis was carried out by adding 150 μL of lysis solution 2 (1% [w/v] SDS and 0.2 N NaOH) and mixed by inverting the tube 2-3 times. Then neutralization solution 3 (200 µL) (glacial acetic acid 11.5 % [v/v] and potassium acetate 3.0 M [pH 5.2]) was added, mixed by inversion and the tube was centrifuged at 13000xg for 10 min. The supernatant was transferred to a new microfuge tube and 450 µL of isopropanol was added. The eppendrof were refrigerate at -20 °C for 30 mins and then centrifuged for 15 min at 13000xg to pellet the plasmid DNA. The pellet formed, washed with 70% chilled ethanol and kept at 37 °C to dry the pellet. Finally, the dried pellet was dissolved in 50 μL of SDW.

Chapter 2: Materials and Methods

For sequencing purposes, plasmid DNA was purified with the help of Miniprep Kit (AxyprepTM Plasmid Miniprep kit, Biosciences, USA). E. coli cultures harboring the desired plasmids were inoculated to 3-4 mL of LB media and kept at 37 °C overnight. The next day cultures were moved into 1.5 mL microfuge tubes and rotated at 12000xg for 2 min. After removing the overlaying liquid, the same process was repeated 2-3 times to get good plasmid yield. The cell pellet was mixed in 250 µL of resuspension solution by vortexing. Then 250 µL of S2 lysis solution was added. This mixture was inverted 2-3 times, followed by the addition of 300 µL neutralization solution S3. The tubes were then inverted 5-6 times and rotated for 10 min at 12000xg. The overlayying liquid was transferred to a Miniprep column on a 2 mL collection tube. The assembly was then microfuged at 12000xg for 1 min. The filtrate was removed, and the column bound DNA was washed with 700 µL of W2 buffer. A second wash was carried out using 400 µL of buffer W2 by centrifuging the column for 1 min at 12000xg. An additional 2 min centrifugation was given to remove ethanol and the column was then kept at 37 °C to dry. After drying, the column was put on a 1.5 mL eppendrof tube and Elution buffer (60 µL) was added and kept at room temperature for 5-7 min. The assembly was then rotated at 12000xg for 60 sec and the filtrate was kept at -20 °C until use.

2.11 Restriction Digestion of DNA Restriction endonuclease digestion was carried out by using appropriate enzymes along with their corresponding buffers in accordance with the supplier’s (Thermo Fisher Scientific, USA) guidelines. For restriction, the reaction mixture of 20 µL contained 2- 3 µL (~2 μg) of DNA, 0.5 µL of restriction enzymes, buffer 2 µL, RNAse 0.5 µL and SDW to make-up the volume. The restriction mixture was kept at 37 °C (30 oC for some enzymes) for 2 hours. Restricted DNA was checked on a agarose gel 1 % (w/v) tainted with ethidium bromide along with DNA ladder of 1kb (Fermentas, USA) (section 2.5).”

2.12 Preparation of Glycerol Stocks Cultures of E. coli were preserved by producing glycerol stocks. For this purpose, 700 µL of fresh cell culture was mixed with filter-sterilized glycerol of 300 µL in a microfuge tube of 1.5 mL and stored at -80 °C. Using a sterile wire loop, a small amount of the culture in glycerol was streaked on a Petri plate of freshly prepared LB medium containing the appropriate antibiotic(s), in order to revive the culture.

Chapter 2: Materials and Methods

2.13 Purification of DNA

2.13.1 Purification of PCR Product Impurities, particularly nucleotides and primers, were removed from PCR reactions using a PCR cleanup kit (AxygenTM PCR Purification kit, Biosciences, USA). For this purpose, 100 µL of the buffer PCR A buffer was added to the PCR mixture and inverted gently. This mixture was then shifted to a purification column in a collection tube of 2 mL and centrifuged at 12000xg for 1 min. The filtrate was discarded, and column bound DNA was given two washing of buffer W2. In order to remove ethanol, the empty column was again centrifuged at 12000xg for 1 min and kept at 37 °C for half an hour. “The dried column was then transferred to a 1.5 mL microfuge tube and 50 µL of pre- warmed eluent buffer added. The tube was kept at room temperature for 2-3 min and then centrifuged at 12000xg for 1 min. Finally, the concentration of purified DNA was checked on a Nanodrop spectrophotometer (section 2.3) and by running on 1 % agarose gel tainted with ethidium bromide (section 2.5).

2.13.2 Gel Extraction Purification In order to separate our desired fragment from, for example, restriction digests gel extraction purification was carried out. For this purpose, DNA was loaded on a agarose gel (1 %). After electrophoresis, the desired band was visualized under UV illumination and separated from the gel by using the sterile surgical blade. Purification of the respective fragment was then carried out by using the kit (AxyPrepTM DNA Gel Extraction kit, Biosciences, USA) according to the protocol described by kit manufacturer. The excised agarose gel portion was transferred to a microfuge tube and weighed. Then buffer DE-A (3x the weight of the fragment weight) was added and kept at 75 oC in order to dissolve the gel. After this, tubes were cooled to room temperature and buffer DE-B (half the volume of DE-A) was added and mixed gently. This mixture was then moved into a column in a 2 mL collection tube and centrifuged at 12000xg for 1 min. The extract was discarded, and the column was washed twice - with 700 and 400 µL of W2 buffer, respectively. The empty tube containing column only was again centrifuged at 12000xg for 1 min and the column was kept at 37 °C to remove remaining ethanol. Finally, the pre-warmed elution buffer was added to the column in a clean 1.5 mL eppendrof tube and centrifuged at 12000xg for 60 sec after keeping at room temperature for 3-5 min. The concentration of purified fragment was checked by 30

Chapter 2: Materials and Methods

loading into agarose gel (1 %) stained with ethidium bromide (section 2.5) and with a Nanodrop spectrophotometer (section 2.3).

2.13.3 Extraction of DNA by Ethanol Precipitation In order to remove the proteins, present in DNA solution, ethanol precipitation was carried out. For this purpose, DNA solution was mixed with SDW in order to make the total volume up to 200 µL and mixed gently. After this 20 µL of 3M sodium acetate was added and vortexed slightly. Then 600 µL of ethanol (100 %) was added into it and kept at -20 °C for overnight. Next day this mixture was rotate at 13000xg for 15 min. The overlying liquid was wasted and pellet washed with 200 µL of 70 % ethanol.” Tubes were kept at 37 °C for half an hour in order to dry the pellet. Finally, the pellet was dissolved in a defined amount of SDW.

2.14 Sequencing of Clones and Sequence Analysis Plasmid Miniprep Kit (AxyprepTM Plasmid Miniprep kit, Biosciences, USA) was used to purify the confirmed clones and sent for sequencing to Genomics and Bioinformatics Research Unit (GBRU) Stoneville MS, USA. Using the universal primers M13F and M13R, sequencing was carried out. For the assembly of raw data obtained after sequencing, software (DNAStar Inc., Madison, WI, USA) was used. In order to check the homology of our query sequences with already known sequences Blast, NCBI was performed by using the database. Characterization and naming of clones were based on already published data and confirmed by making phylogenetic trees. Once the sequences were complete, alignment was performed using Clustal W or Muscle program of MEGA 7. The best substitution model test was also performed in MEGA 7 and resulting model was used for tree building either by Neighbor-joining or Maximum Likelihood method. In order to find the open reading frame, online ORF finder tool was used (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). All the complete sequences were submitted in EMBL (http://www.ebi.ac.uk/embl)or in Genbank https://www.ncbi.nlm.nih.gov).

3 Diversity and Distribution of Cryptic Species of Bemisia tabaci (Hemiptera: Aleyrodidae) Complex in Pakistan

3.1 Introduction The whitefly Bemisia tabaci belongs to the family Aleyrodidae (order Hemiptera) [1, 2]. The insects are 1-3 mm in length and get the name “whitefly” because their bodies are covered with white powdery, flour-like wax. Aphids, mealybugs, psyllids, and scale insects are the closest relatives to whiteflies, all of which feed using piercing and sucking mouthparts, which are specialized for feeding on plant phloem [5-7]. Whiteflies mostly lay eggs on the lower side of leaves and immatures stages also raise on the lower side of leaves. Mostly whiteflies are consider as tropical insects but whiteflies are also found in warmer and temperate regions causing severe damages in greenhouses [20]. Whiteflies damage a wide range of plants including agricultural crops by making punctures and sucking plant sap (whiteflies are phloem feeders) which disturb plant turgor pressure. Whiteflies also secrete honeydew which causes sooty mold fungi to grow, interfering with photosynthesis and affecting yield and quality [12]. The main concern with regards to whiteflies is that they transmit economically important groups of viruses.

The taxonomic characteristic of the family Aleyrodidae known to be challenging because of the complex morphological characters of adults which does not allow the accurate identification. Earlier, the morphological characteristics of the pupae or the 4th instar were used for the identification of their taxonomy [2, 70, 247]. Due to the complex morphology, numerous genera and species were placed into a single taxonomic unit in the late 1950s, Bemisia tabaci (Genn.) [71], which also included several host races due to their biological difference [67, 72]. That is the reason B. tabaci is considered a sibling species group or cryptic species complex [248], referring to the group of closely related species and named as biotypes or haplotypes [249-252]. The member of the species complex were differentiated on the basis of their biological

Chapter 3: Diversity and Distribution of Cryptic species of Bemisia tabaci

Characteristics like plant host range, insecticide resistance, virus transmission capabilities, and parasitoids [14, 18, 253] and exhibit full or incomplete reproductive isolation due to reproductive incompatibility [38, 90].

The usefulness of species demarcation using sequence information from a single gene is debatable [254-256]. However, the increasing use of COI gene (mitochondrial cytochrome C oxidase 1) sequences has revolutionized the accurate species identification world [257-259]. A study by Hebert et al. [257] has shown that the 98% species pair had 2% sequences divergence. Similarly, in other studies, divergence has been shown among recognized species [258, 260]. In Lepidopteran, 3% sequence divergence was found in 196 of 200 species which were previously identified using morphological characteristics [257]. it has been revealed that nuclear gene [87, 261- 263] used for the identification of B. tabaci, provide similar relationships as described by mtCOI gene, suggesting that mtCOI is the most promising tool for the identification of species within this taxon.

Based on the pairwise genetic distance comparisons and the phylogenetic analysis between different genetic groups of B. tabaci globally, Dinsdale et al. [82] revealed the presence of eleven higher genetic groups of more or less 24 morphologically indistinguishable species of B. tabaci cryptic (or sibling) species complex. Following the ‘phylogenetic’ species boundaries anticipated by Dinsdale et al. [82] and the Hu et al. [101] raised the total number of cryptic species to 28 by added four more species. Firdaus et al. [95] added seven more groups to the previously reported phylogenies meaning that 36 biotypes/cryptic species have been described. Ashfaq et al. [264] have reported another biotype and named it “Pakistan”. Very recently, Mugerwa et al. [99] added five new putative species to the Sub Saharan Africa clade using the mitochondrial gene COI, increasing the number up to 36 biotypes/species.

“Since the early 1990s, CLCuD has been a major issue in Pakistan and northwestern India [265]. The disease first came to prominence in 1987 and quickly spread across most of the cotton producing areas of Pakistan and into northwestern India. Problems persisted until the late 1990s with the introduction of cotton varieties resistant to disease, restoring the cotton productivity to pre-epidemic levels. During 2002 CLCuD symptoms appeared in previously resistant cotton varieties [266]. This

Chapter 3: Diversity and Distribution of Cryptic species of Bemisia tabaci

resistance breaking virus complex achieved epidemic levels in succeeding years and spread across most of Pakistan and into northwestern India. There are no commercial cotton varieties, at this time, with resistance to CLCuD. “In the 1990s, the disease was shown to be caused by several distinct begomoviruses, the most important of which were CLCuMuV and CLCuKoV, in association with a disease-specific betasatellite [226, 267].” Resistance breaking after 2002 was shown to be associated with a recombinant strain of the same betasatellite and with a distinct strain of CLCuKoV, the Burewala strain, which resulted from recombination between CLCuMuV and CLCuKoV [268, 269]. The diversity of B. tabaci in Pakistan has come under extensive investigation due to the diversity of begomoviruses present in the country and due to the country’s geographic position.

The study described here has explored the diversity of B. tabaci across Pakistan by determining the sequence of the 3’ segment of the mitochondrial cytochrome oxidase 1 (COI-3') gene. Comparison of the results to earlier studies suggests that the diversity of B. tabaci is increasing and that the geographic distribution pattern of cryptic species in the country is very dynamic.

3.2 Materials and Methods

3.2.1 Sample Collection Sampling of adult B. tabaci whiteflies followed the protocols outlined by Ahmed et al. [270]. Samples were collected using an aspirator and were preserved in 85 % ethanol until use. The geographic coordinates of the sampling site were obtained using a handheld GPS device (e trex 10, Garmin, Schaffhausen, Switzerland).

3.2.2 DNA Isolation and PCR Amplification Total DNA was isolated from single whiteflies using a Fast Tissue-to-PCR Kit (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer. Amplification of the 3'-fragment (780 bp) of the mitochondrial COI-3' gene was carried out using the primer pair C1J2195/TL2N3014 (TTGATTTTTTGGTCATCCAGAAGT/ TCCAATGCACTAATCTGCCATATTA) and the cycling parameters described for B. tabaci [81, 271] and DreamTaq Green PCR Master Mix (Thermo Fisher Scientific). “The polymerase chain reaction (PCR) cycling parameters were one denaturation cycle

Chapter 3: Diversity and Distribution of Cryptic species of Bemisia tabaci

for 5 min at 95 °C, followed by 35 cycles of 94 °C for 1 min, 45 °C for 1 min, and 72 °C for 1 min, followed by a final extension of 72 °C for 7 min.”

3.2.3 Cloning, Sequencing and Sequence Analysis The PCR products were ligated in the pTZ57R/T plasmid vector (Thermo Fisher Scientific). The sequence of each cloned insert was determined by bi-directional, automated Sanger sequencing using a capillary ABI 3730XL sequencer (Thermo Fisher Scientific). “The sequences obtained were aligned, assembled and edited using software named as Lasergene (DNASTAR, Madison, WI, USA).” Sequence alignment and pairwise distance analyses were completed using MEGA 5 [272]. The best fit model of evolution identified was HKY85 (Hasegawa Kishnio Yano) with  distributed variation among different sites.”

3.3 Results

3.3.1 Phylogenetic Analysis of COI-3' Sequences. The COI-3' sequence (780 bp) for 285 individual whiteflies was determined (Table 3.1; Suppl. Table Appendix A) and aligned with 550 COI-3' sequences of 658 bp in size, available in a curated global Bemisia tabaci database (http://doi.org/10.4225/08/50EB54B6F1042) and used to assign the insects collected in Pakistan to cryptic B. tabaci species, as described by Boykin and De Barro (2014). Six cryptic species of B. tabaci were identified among the samples, including those that grouped with Asia II 1, Asia II 8, Asia II 7, Asia II 5, Asia 1, and MEAM 1 (also, known as the B biotype) clades (Table 3.1). Analysis of representative sequences from Pakistan aligned with previously identified B. tabaci variants/cryptic species (Figure 3-1) revealed that among the six phylogeographical clades, including those endemic to Asia and an exotic variant from the North Africa-Middle East (Figure 3-1; [83, 248, 273]). A separate analysis containing all of the sequences determined herein showed that the Asia II and MEAM-1 (B biotype group) cryptic species, respectively, were represented by n=233 and n=38 collections (Supp. Table; Appendix A).

Chapter 3: Diversity and Distribution of Cryptic species of Bemisia tabaci

Figure 3-1 Phylogenetic tree based upon an alignment of mitochondrial COI-3’ sequences of Bemisia tabaci. The sequences produced in this study are highlighed as white text on a black background, representing the six groups identified, and the sequences selected from the databases, representing the 36 cryptic species of the B. tabaci complex were used. Bootstrap values are shown at the nodes with score (500 replicates. The sequences of the B. afer and Trialeurodes vaporariorum were included and the tree was rooted on these sequences as outgroup. For the reference sequences the cryptic species name is given followed by the origin of the isolate. Database accession numbers are given for all entries.

Chapter 3: Diversity and Distribution of Cryptic species of Bemisia tabaci

Pairwise distances among sequences range from 0.0% to 19.4%. The greatest distance observed for Asia II 1 among COI-3' sequences was at 3.3%, followed by MEAM-1 1.1%, and then Asia 1, at 0.2% (Table 3.1). Based on the initial, 3.5% species delineation or proposed cutoff value for distinguishing cryptic B. tabaci species [82], albeit revised to an as yet undetermined pairwise nucleotide percentage [273], the major phylogeographical clades were evident making the affiliations straightforward. The greatest pairwise sequence divergence for the Pakistan collections was observed for the Asia II 1 clade, which diverged from the other clades, at 3.3%. For Asia II 8, Asia II 7 and Asia II 5 clades, the interclade pairwise distances were 1.6%, 2.6% and 1.8% divergence, suggesting the differentiation of these groups is overall relatively low and less than a 3.5 % cutoff, perhaps suggesting more minimal diversification, compared to the Asia II 1 group.

Chapter 3: Diversity and Distribution of Cryptic Species of Bemisia tabaci

Table 3.1 Pairwise distances (%) for species of the B. tabaci complex identified in the study.

Cryptic Number of Mindist Mean Max Hosts@ Previously reported* species insects dist dist All 285 0.0 6.3 19.4 - - Asia II 1 233 0.0 0.3 3.3 cotton, tomato, okra, , guar, IN, PK, CN, BD mungbean, sunflower, potato, pumpkin, bean, chilli, bottle gourd, eggplant, castor bean, unidentified weed

Asia I 9 0.0 0.2 0.2 cotton, eggplant, sunflower, IN, PK, CN, BD, ID tomato MEAM-1 38 0.0 0.3 1.1 cotton, tomato, CN, IN, PK, IL, IR, ID, US, JP, IT, MA Asia II 5 3 - - - cotton PK, IN Asia II 7 1 - - - cotton PK, IN Asia II 8 1 - - - mungbean IN

@ Plants from which insects were sampled. * Regions where the cryptic species has previously been identified. Countries are denoted by their standard two letter abbreviation

Chapter 3: Diversity and Distribution of Cryptic Species of Bemisia tabaci

3.3.2 Geographic and Host Distribution of B. tabaci Cryptic Species in Pakistan The geographical distribution within Pakistan of cryptic B. tabaci species determined here is summarized in Figure 3.2. Results indicated that in the Punjab province, the most common cryptic species was Asia II 1, however some individuals were identified as the exotic MEAM-1 (B-biotype) in the southern region that borders Sindh province, whereas, in Sindh province, MEAM-1 was the most common cryptic species, with relatively moderate numbers of Asia II 1 interspersed. For samples analyzed for the first time from the Khyber Pakhtoon Khaw province in northern Pakistan, the only cryptic species identified was Asia II 1. Also, three specimens of Asia II 5, and at a low frequency, Asia 1 and Asia II 7 cryptic species were identified in both the Sindh and Punjab provinces. Additionally, one Asia II 8 specimen was collected near the Punjab border with India.

Of the 285 B. tabaci specimens analyzed, 251 were collected on cotton and 36 on other plants species (Supp. Table Appendix A). Of the specimens from cotton 207 were identified as cryptic species Asia II 1 with 176 originating from the Punjab and 31 from Sindh. For MEAM-1 36 specimens came from cotton; 34 from Sindh and only 2 from Punjab. Keeping in mind that encountering an insect on a plant species does not necessarily indicate that the plant species is a host, the overwhelming numbers of Asia II 1 would suggest that cotton is a major host of this cryptic species. For MEAM-1, of the 38 specimens identified, only two came from plants other than cotton (an unidentified curcurbit). For the other cryptic species, too few individuals were identified to draw any meaningful conclusions concerning host association.

Chapter 3: Diversity and Distribution of Cryptic Species of Bemisia tabaci

Figure 3-2 Map of Pakistan showing the distribution of cryptic species of the Bemisia tabaci complex. The regions of Pakistan are Azad Jammu and Kashmir (AJK), Khyber Pakhtoon Khaw province (KPK) and the Federally Administered Tribal Areas (FATA). 3.4 Discussion

The genetic diversity and geographical distribution of B. tabaci is of great interest because of its importance as the insect vector of begomoviruses [274]. In Pakistan and western India, the most prominent and widespread virus of cotton is the leaf curl virus complex that causes CLCuD, which causes extensive losses to the cotton crop. Three cryptic B. tabaci species have previously been identified in Pakistan [275]; two endemic cryptic species groups, Asia 1 and Asia II 1, and the exotic MEAM-1 (B biotype) introduced from the Middle East-Mediterranean, North African region [248]. Recently Ashfaq et al. [264] reported six biotype or cryptic species, Asia II 7, Asia II 5, Asia II 1, MEAM-1, and Asia 1, and a previously unreported variant, provisionally referred to as “Pakistan”, until further verification is possible. In the study described here, analysis

Chapter 3: Diversity and Distribution of Cryptic Species of Bemisia tabaci

of COI-3′ sequences corroborated the presence of six cryptic species in Pakistan, with the sixth type represented by Asia II 8, instead of the “Pakistan” variant. Whether the recently documented prevalence is the result of the increased interest and study of B. tabaci diversity in Pakistan or is the consequence of real changes in or expansion of B. tabaci populations is unclear.

The begomoviruses transmission by cryptic B. tabaci species has been shown to vary in efficiency [253, 274, 276]. For example, MEAM-1 (B) and MED (Q) were found to transmit TYLCV with equal efficiency, whereas transmission efficiency by Asia II 1 (K, P, ZHJ2) was about half that of the other two cryptic species [277]. Similarly MEAM-1 (B) transmitted Papaya leaf curl China virus more efficiently than MED (Q), Asia 1 (H, M, NA), and Asia II-7 (Cv) [278]. Until recently no similar studies had been reported for transmission of the CLCuD complex by different B. tabaci species. Nevertheless, the prevalence of Asia II 1 (K, P, ZHJ2) in Punjab province, where CLCuD is endemic, and the earlier absence of this cryptic species in Sindh province, where CLCuD has been rarely reported, suggests that the predominant vector of CLCuD is/has been Asia II 1 [275]. Very recently, it has been shown that Asia II 1 is a significantly more efficient vector of CLCuMV and CLCuMuB, than the other biotypes tested (Asia 1, MEAM-1 and MED) [279]. CLCuMV, along with several other begomoviruses, was associated with CLCuD before the resistance breaking in 2001- 2002 [266]. This study further showed that that the coat protein sequences of the seven out of ten begomoviruses associated with CLCuD grouped in phylogenetic analyses, suggesting that Asia II 1 may also transmit these viruses. These results would seem to all but conclusively prove that Asia II 1 is the vector of CLCuD in Pakistan and northwestern India.

Recently, Asia II 1 has been encountered more frequently in Sindh Province [264], and results presented here corroborate this finding. This putative ingress could feasibly occur either from the Punjab provinces of Pakistan or India or from Gujarat and Rajasthan states in India where Asia II 1 has been documented [280]. The recent increase in begomovirus diseases, in particular, the increased incidence of CLCuD in cotton in Sindh, may be associated with the subsequently increased prevalence of Asia II 1 (K, P, ZHJ2) [281, 282]. Previous studies indicated that only the exotic MEAM-1 (B) was present in Sindh province [275, 283]. However, because Asia II 1 is a more efficient vector, and performs better on cotton in Pakistan [284], the recent findings 41

Chapter 3: Diversity and Distribution of Cryptic Species of Bemisia tabaci

either suggests that the geographic range of Asia II 1 has recently expanded into the Sindh province or that its presence was missed in previous surveys, or both. Possibly of consequence to this scenario is that the GroEL heat shock protein of a B. tabaci endosymbiont, Arsenophonus nasoniae, associated with clade Asia II B. tabaci from cotton in India, interacts with the CP of CLCuMuV [134]. GroEL proteins of insect endosymbionts have been shown to contribute to the transmission of certain circulative plant viruses, including geminiviruses [285-287].

No previous studies have reported B. tabaci from Khyber Pakhtoon Khwa province (KPK; previously known as Northwest Frontier Province) in northwestern Pakistan, and herein, only Asia II 1 was found colonizing plants there. These locales are too cold in the winter to allow overwintering of B. tabaci, suggesting that they have been encountered in these areas as yearly immigrants arriving from the warmer southern areas. Cotton is grown in the southern areas of KPK, near Dera Ismail Khan, but not in the northern areas where vegetable production dominates, and the whitefly collections studied herein were obtained. Thus, one possibility is that most or all begomoviruses occurring there are introduced each year when the weather warms sufficiently to support B. tabaci populations, although, at this time, the plant viruses that prevail there have not been identified.

The report here is the first of the Asia II 8 cryptic species in Pakistan, specifically in the Thar region near the border with India. However, it has been identified in India [280]. This suggests that Asia II-8 may have entered Pakistan from India, or that it is endemic to this dry region of the sub-Continent which spans the border. However, Ellango et al. [280] reported Asia II 8 in Kerala, Tamil Nadu and Karnataka states of southern India, but not in the states immediately adjacent to Pakistan. This suggests that Asia II 8 found in Pakistan is either endemic elsewhere in the country, or that its occurrence in India has shifted since the study in India was conducted. Asia II 1 was only identified in states bordering Pakistan [280] identified only, with the exception of the Indian Punjab, in which a member of the major Asia 1 clade was also identified.

As well as India, Pakistan has borders with Afghanistan, Iran, and China. No information is available on B. tabaci present in Afghanistan and the B-biotype (MEAM- 1) is believed to predominate in Iran [288]. Some of the same cryptic species have been

Chapter 3: Diversity and Distribution of Cryptic Species of Bemisia tabaci

identified in China and Pakistan, including the endemic Asia II 1, Asia 1, Asia II 7, and exotic MEAM 1also occurs there [101]. Other important cryptic species identified in China have not been identified in Pakistan [248]. Among the most important of these is MED [248], which comprises multiple lineages endemic to the Mediterranean region [289], from where it was recently introduced into China [290, 291]. The China-3 population, a cryptic species with its origins in China, has been reported in eastern India [101], but so far has not been detected in Pakistan. Interestingly, the B. tabaci transmitted begomovirus Squash leaf curl China virus, endemic to China [292], occurs in India and Pakistan [293, 294]. Whether the China-3 like the population in India is the result of an introduction or India is part of the natural range of the habitat for this lineage, this introduction occurred some time ago because the haplotype present in India is divergent from the extant exemplar in China and South East Asia. The difference, in both the populations of B. tabaci and begomoviruses, between China and the Indian subcontinent has probably resulted from the Himalayan Mountains, which presents a formidable barrier to the movement of whitefly and viruses.

Earlier studies of B. tabaci diversity, which either did not use COI sequences or did not use the nomenclature proposed for cryptic species complex by Dinsdale et al. [82], also looked at the identity of B. tabaci populations present in Pakistan, India, and China. Baoli et al. [295] did not identify the B-biotype (now MEAM I) in India but did show it to be present in China. This study additionally showed populations of Asia I and Asia II clades to be present in India, Pakistan and China and Med in only China. Studies based on esterase banding patterns showed the presence of the K-biotype (Asia II 1) in Pakistan and H (Asia I), I and D (New World) in India [253, 296].

Results described here and in previous studies indicate that the distribution pattern of cryptic species complex of B. tabaci in Pakistan is relatively diverse and dynamic, depending on the region. Based on previous studies, it appears that Asia II 1 cryptic species may have expanded southward over time, from Punjab into Sindh, whereas, MEAM-1 (B) has spread, following its introduction, northwards into Punjab province. In addition, it is likely that Asia II 8 present in Pakistan originated from India and the results might indicate that whiteflies migrate during summer months into northern areas. Changes in B. tabaci populations have long been known to be associated with the appearance of new begomovirus species and changes in begomovirus populations [297-299]. The results highlight the need for additional studies of the 43

Chapter 3: Diversity and Distribution of Cryptic Species of Bemisia tabaci

interactions between the CLCuD complex and different B. tabaci cryptic species that may lead to differential transmission and the emergence of particular leaf curl viral species/strains, including the potential for differential transmission competency. This knowledge of greater than expected diversity among the B. tabaci complex, including the presence of at least one exotic cryptic species (MEAM-1B-biotype), is expected to provide new insights about patterns of begomovirus transmission and spread associated with the dynamic nature of B. tabaci cryptic species in Pakistan.

4 Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

4.1 Introduction Bacterial endosymbionts are prevalent in nature and mostly prevailing in arthropods. Nutritionally symbiotic relationships between maternally inherited bacteria and insects are well known [108]. Due to these mutually beneficial relationships insects have been able to adopt diverse and novel ecological niches without fear of unbalanced nutritional resources. Endosymbionts are grouped into two different types: Obligate symbionts also known as primary endosymbionts and Facultative symbionts known as endosymbionts [108]. Primary endosymbionts are known to provide their insect hosts with essential nutrients and amino acid which are not present in their diet. For a long time, P-endosymbionts are thought to have evolved with their insect hosts [108, 109]. Obligate endosymbionts tend to have much smaller genomes (<1000 kb, <600 genes), which contain conserved housekeeping genes and genes that are involved in the synthesis of different vitamin and amino acids [108]. It has been shown that synthesis of these essential compounds requires metabolic complementation not only from the host but also from the other endosymbionts [121]. Nutritional role of P-endosymbionts has been studied extensively but the other important aspects (role in virus transmission, sex ratio determination) of endosymbionts' biochemistry needs to be explored. Secondary endosymbionts are considered as optional (facultative) and are transmitted both horizontally and vertically between insects [109, 122, 123].

Secondary endosymbionts, such as Wolbachia, Serratia, Rickettsia, Regiella, and Hamiltonella facilitate their hosts by providing essential nutrients, contrary to P- endosymbionts [300, 301], resistance against parasitic wasps and fungal/viral pathogens [127, 154, 157, 302-304] and also help their host by improving tolerance against heat [305].

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

S-endosymbionts such as Wolbachia, Rickettsia, Cardinium, and Arsenophonus can also play a negative role rather than providing benefits to their hosts. They may manipulate insect reproduction by imposing asexuality, killing males, producing more females, and causing cytoplasmic incompatibility (CI) along with parthenogenesis, which ultimately helps the endosymbiont spread to other hosts and ecological niches [151, 306, 307].

Sweet potato whitefly known as Bemisia tabaci (Gennadius), is one of the most devastating pests of crops and vegetables around the world [90]. Several characters, besides molecular and biochemical markers, have been used for the identification of B. tabaci populations [18, 90, 308]. Due to the significant genetic difference among B. tabaci populations they are considered as a species complex [89, 90, 95]. These cryptic species complex can be distinguished by sequencing of the cytochrome oxidase 1 (COI) gene. Generally, in order to investigate the phylogenetic relationships in animals and plants, mitochondrial COI gene is often used [309], it has also became establish for whiteflies [81, 83, 310]. The mtCOI sequences data collected from worldwide is deposited in databases. Except for the two species (B and Q biotypes) which are present around the world, the analysis of these sequences collected has revealed that the genetic difference among B. tabaci populations is due to the difference in their geographical origin [89, 90, 101, 102, 311-313]. There is no or barely gene flow found among different geographical isolated populations supports the concept of B. tabaci species complex consisting of several morphologically cryptic species. It has also been shown by many studies that there is no mating compatibility among different biotypes [18, 81, 91, 313-315].

B. tabaci, in-common with many other hemipterans harbour P-endosymbionts, known as Pοrtiera aleyrοdidarum (Oceanospirillales), which is located in bacteriocytes within the insect [108, 316] and are transmitted vertically. In addition to P- endosymboints, B. tabaci hosts a diverse range of S-endosymbionts, which may play some role in the evolution and host biology but are not important for their survival. Over the past decade or so, various S-endosymbionts have been reported from B. tabaci including Hamiltonella (Enterobacteriaceae), Arsenophonous (Enterobacteriaceae), Rickettsia (Rickettsiales), Wolbachia (Rickettsiales), Cardinium (Bacteriodetes) and Fritschea (Chlamydiales) [145, 161, 317], as well as Orientia-like organisms [124].

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

S-endosymbionts have been shown to be involved to play a different role in maintaining biology of the B tabaci. Biotypes B from Israel has been found to be infected with Hamiltοnella and Rickettsia and Arsenophonus whereas Wolbachia and Rickettsia were found in biotype Q [126]. No infection was detected for Fritschea and Cardinium in either Q or B biotype [126]. Rickettsia has been reported to helps the insect by providing resistance/susceptibility against environmental stresses through the qPCR and FISH analyses [318]. For example, susceptibility to various insecticides has been found increased in B Biotype due the presence of Rickettsia [148], while significant influence was found on survival of Q biotype due to the double infections of Arsenοphοnus-Wolbachia or Arsenοphοnus-Rickettsia, when exposed to the different insecticides such as thiamethoxam, spiromesifen, pyriproxyfen and imidacloprid [319].

A number of S-endosymbionts, influence their whitefly hosts in different ways including help in virus transmission [320], by providing thermotolerance [149], resistance to parasitoids and various insecticides [148, 318, 319]. In USA, it has been reported that infection of Rickettsia in MEAM-1 increase the host fitness and also increase the female bias in host population [146]. In this way, endosymbionts has positive effect on the host population and also facilitate their spread in the field, thus acting as mutalistic as well as reproductive manipulator for the host. It has been suggested that secondary endosymbionts might have some role in the interbreeding among different whiteflies species [321].Very few studies have investigated the functions of S-endosymbionts in B. tabaci that showed the impact of these symbionts on the ecology of their hosts.

Rickettsia (α-Proteobacteria), genus of bacteria, known as obligate endosymbionts which feed on blood and cause diseases for example typhus. They are also involved in various other phenomena such as manipulation of the sex ratio in non- blood feeding arthropods [322]. Wolbachia (α-Proteobacteria) is known for its ability to manipulate the reproductive system in many arthropods [323] . In previous studies, Wolbachia was found in B. tabaci [87, 158, 317], thought to be the possible cause of cytοplasmic incοmpatibility among different B. tabaci biotypes [159]. Arsenοphοnus spp. (γ Proteobacteria) has been reported from many arthropods including aphids, louse fly, psyllids and [108, 324]. Cardinium (Bacteroidetes) is also known to be a cause of manipulation in reproductive processes [325]. Bacteria belonging to the order, 47

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

Chlamydiales, some of them are vectored by arthropods and also cause diseases in humans and vertebrates (http://www.chlamydiae.com). However, the role of Fritschea (Chlamydiales) in B. tabaci has not been studied extensively [161].

In Pakistan, the most prevalent biotype reported from Punjab region is Asia II 1 whereas MEAM-1 is most common in Sindh (Chapter 3; [104, 264]). The diversity of the endosymbionts within B. tabaci from Pakistan has not been investigated. The study described in this chapter was designed to investigate the diversity of endosymbionts in field populations of B. tabaci in Pakistan and to determine if the secondary symbionts distribution and their infection frequencies have a correlation with the biotype.

4.2 Materials and Methods

4.2.1 Whitefly Sampling and DNA Extraction Sample collection and DNA extraction protocols have been described in Chapter 3. Whiteflies which were already identified using mtCOI genes (Asia II 1, and Asia 1 MEAM-1) were used in this study.

4.2.2 Molecular Identification of S-symbionts In total, two hundred and fifty-four individuals whiteflies were screened for the detection of different endosymbionts using the PCR primers specific for each endosymbiont, targeting the 23S rRNA gene for Aresenophonus and Fritschea and 16S ribosomal RNA (rRNA) gene for Porteira, Hamiltonella, Cardinium, Wolbachia, Rickettsia (Table 4.1). PCR was carried out in 10 µL of Green mixture (Fermentas) containing standard PCR (dNTPs, Taq Buffer, MgCl2) reaction mix and 2 µL of (3-6 ng/ µL) DNA template. PCR products of all the target genes were visualized on 1% agarose gel.

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

Table 4.1 Primers and PCR conditions used in the analysis of endosymbiont diversity

Targeted Primers Primer sequence Annealing Size Reference genes (5´ – 3´) temp. (C) (bp) B. tabaci C1-J-2195 TTGATTTTTTGGTCATCCAGAAGT 45 °C ~866 [158] MtCOI L2-N-3014 TCCAATGCACTAATCTGCCATATTA Portiera 28F TGCAAGTCGAGCGGCATCAT 60 °C ~1500 [157] 16S rDNA 1495R CTACGGCTACCTTGTTACGA Arsenophonus Ars-23S-1 CGTTTGATGAATTCATAGTCAAA 60 °C ~600 [314] 23S rDNA Ars-23S-2 GGTCCTCCAGTTAGTGTTACCCAAC Cardinium CFB-F GCGGTGTAAAATGAGCGTG 58 °C ~400 [158] 16S rDNA CFB-R ACCTMTTCTTAACTCAAGCCT Fritschea U23F GATGCCTTGGCATTGATAGGCGATGAAGGA 60 °C ~600 [160] 23S rDNA 23SGISR TGGCTCATCATGCAAAAGGCA Hamiltonella Ham-F TGAGTAAAGTCTGGAATCTGG 60 °C ~700 [157] 16S rDNA Ham-R AGTTCAAGACCGCAACCTC Rickettsia Rb-F GCTCAGAACGAACGCTATC 60 °C ~900 [144] 16S rDNA Rb-R GAAGGAAAGCATCTCTGC Wolbachia Wol16S-F CGGGGGAAAAATTTATTGCT 55 °C ~700 [159] 16S rDNA Wol16S-R AGCTGTAATACAGAAAGTAAA

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

4.2.3 Cloning and Sequencing PCR products were ligated into the pTZ57R/T vector (Fermentas). The sequences of clone inserts were determined by automated Sanger dideoxy chain termination sequencing at the USDA Mid South Area Genomics Laboratory (Stoneville, MS, USA). Sequences were assembled, aligned and edited using the Lasergene package of sequence analysis software (DNAStar).

4.2.4 Sequence/Phylogenetic Studies Reference sequences of the16S rRNA gene or 23S rRNA gene of endosymbionts isolated from neighboring countries like India and China were obtained from GenBank. Multiple sequence alignments were produced using Clustal W [326] and phylogenetic trees were constructed with the maximum-likelihood (ML) method using MEGA7 [327]. The best fit model of substitution for all the bacterial sequences were determined using Maximum Likelihood Ratio Test in MEGA 7. All trees were constructed using an HKY85 + gamma substitution model for ML [328]. Bootstrap values for each tree were calculated by generating 500 bootstrap replicates.

4.2.5 Statistical Analysis The mean infection probability was calculated by statistical formula Tukey's HSD. The software used for this analysis was XLSTAT [Citation, "XLSTAT 2017: Data Analysis and Statistical Solution for Microsoft Excel. Addinsoft, Paris, France (2017)"]

4.3 Results

4.3.1 Identification of B. tabaci Biotypes In Chapter 3 six biotypes, Asia II 1, Asia II 5, Asia II 7, Asia II 8, Asia I and MEAM- 1, of B. tabaci were identified in Pakistan (Fig 3-1). Asia II 1 was found to be most dominant in the Punjab region and MEAM-1 was found to be most prevalent in Sindh [104]. Due to the small number of individuals of biotypes/species in Asia II 5, Asia II 7, and Asia II 8, these were not used to investigate the diversity of symbionts.

4.3.2 Identification of Secondary Endosymbionts Infection To determine the relationship between B. tabaci biotypes/species and symbiont infection, individual whiteflies were analyzed for six secondary symbionts using

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

specific primers for each symbiont (Table 4.1). In the 268 adults from three biotypes/species (Asia II 1, Asia 1 and MEAM-1) the P-endosymbiont Protiera was detected in all samples. Five secondary endosymbionts (Arsenophonus, Cardinium, Hamiltonella, Rickettsia, and Wolbachia) were detected in the B. tabaci with variable infection frequencies. Of the 268 samples examined, 240 (89.5%) were found to be infected with at least one and up to four S-symbionts. The presence and prevalence of each symbiont varied in different biotypes and also varied between regions (Figure 4- 2). Initially, PCR for Fritschea seems positive comprising of the same size reported from different studies but upon sequencing it was found it was a false positive. This suggests that Bemisia populations in Pakistan are not hosts to Fritschea. Out of the five symbionts, four were present in the most dominant biotype/species (Asia II 1); Rickettsia was identified but in just one sample. The infection frequency of Arsenophonus varied from 18.3% (9/49) in MEAM-1, 66% (6/9) in Asia 1 and 63.3% (133/210) in Asia II 1. Cardinium infection rate varied from 33.3% (3/9) in Asia 1, 38% (19/49) in MEAM-1 and 54.7% (115/210) in Asia II 1. Hamiltonella infection was comparatively low in Asia II 1 23.3% (49/210) and 57% (28/49) for MEAM-1 and very low in case of Asia 1 1% (1/9). Wolbachia infection rate was 17% in Asia II 1, 67% in Asia 1 and 58% in MEAM-1. Infection frequency of Rickettsia was very low, very few samples were positive for this bacteria.

The infection frequency of secondary endosymbionts also varied among insects from the different regions of Pakistan. Arsenophonus was more common 79% (99/124) in the Punjab region than in KPK 77% (27/35) or Sindh 20% (21/109) (Figure 4-2). While Hamiltonella was more dominant in Sindh 39% (43/109) than in KPK 11% (08/35) and Punjab 21% (27/124) (Figure 4-2). Wolbachia was found most prevalent in KPK 34% (12/35), followed by Sindh 13% (14/109) and Punjab 7% (09/124 (Figure 4- 2). Cardium was most frequent in the Punjab region 75% (93/124) and equally prevalent in KPK (65% (23/35) and Sindh 20% (22/109) regions. The difference in the S-endosymbionts prevalence in Punjab and Sindh may be related to the difference in the biotypes/species present in these regions.

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

Figure 4-1 Infection probability of Secondary Endosymbionts. Arsenophonus, Cardinium, Hamiltonella, Rickettsia and Wolbachia in Bemisia tabaci biotypes/species Asia II 1, MEAM-1 and Asia 1.

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

Figure 4-2 Infection of different S-endosymbionts in different regions of Pakistan. The regions are denoted as KPK (A), Punjab (B) and Sindh (C). S-endosymbionts are shown in color and denoted as Wolbachia (W), Rickettsia (R), Hamiltonella (H), Cardinium (C), and Arsenophonus (A). Their numbers also are shown in each bracket. 4.3.3 Phylogenetic Analysis of S-endosymbionts Phylogenetic trees were constructed for each of symbiont datasets by the ML method. Cardium sequences obtained from Asia II 1 and MEAM 1 from different regions (Punjab, Sindh, and KPK) showed 98-100% similarity with Cardinium sequences isolated from different biotypes from different countries (Figure 4-3). We note that the Wolbachia sequence from our study clustered into three groups that may be called as three strains and only one strain give resemblance with Wolbachia sequences obtained from India (Figure 4-4). The Hamiltonella sequence from Asia II 1 and MEAM 1 are almost same and grouped with the Hamiltonella sequences isolated from MED and MEAM-1 Biotype from China (Figure 4-5). The Arsenophonus sequences showed 98- 100% similarity with Arsenophonus sequences from India and also grouped on one branch in the phylogenetic tree.

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

Figure 4-3 Phylogenetic analysis of Cardinium 16S rRNA sequences from two Bemisia tabaci biotypes/species. The sequences in bold were determined in the study described here and colored text is used to differentiate regions. Horizontal distances are calculated as per mutation while the vertical distances are random. Bootstrap values at shown at nodes with score (500 replicates).

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

Figure 4-4 Phylogenetic analysis of Wolbachia 16S rRNA sequences from three Bemisia tabaci biotypes/ species. The sequences in bold were determined in the study described here and colored text is used to differentiate regions. Horizontal distances are calculated as per mutation while the vertical distances are random. Bootstrap values at shown at nodes with score (500 replicates).

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

Figure 4-5 Phylogenetic relationship of 16S rRNA Hamiltonella sequences from two B. tabaci biotypes/ species. The sequences obtained in this study are colored and different colored text is used to differentiate regions. Horizontal distances are calculated as per mutation while the vertical distances are random. Bootstrap values at shown at nodes with score (500 replicates).

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

Figure 4-6 Phylogenetic analysis of Arsenophonus 23S rRNA sequences from three B. tabaci biotypes/ species. The sequences obtained in this study are colored and different colored text is used to differentiate regions. Horizontal distances are calculated as per mutation while the vertical distances are random. Bootstrap values at shown at nodes with score (500 replicates).

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

4.4 Discussion Our current survey suggests that Asia II 1 is widely distributed in most of the region of Pakistan but the MEAM-1 is mostly restricted to the Sindh region of Pakistan. This study was conducted for the first time in Pakistan to see how diversified endosymbionts are present in Pakistani Bemisia population. Among the Six secondary endosymbionts tested primers for Fritschea give false positive results and was verified by sequencing the product and it was concluded that Pakistani Bemisia populations are not infected with the Fritschea. Various studies of whitefly species around the world that include MEAM-1, MED and others, such as Africa, European countries [329], Israel [126], Croatia [330, 331], and China [332], shown that any of the Bemisia population are not infected with Fritschea. It has only found to infect the NW (A Biotype) in USA [161] except the they found few samples of whiteflies other than genus Bemisia positive for Fritschea [93].

Rickettsia is known as a reproductive manipulator in many arthropods [147, 333]. Previous studies have shown that females B. tabaci infected with Rickettsia showed better fitness such as increased fertility, better rate of survival, and host reproduction manipulation by producing female bias population [146]. Rickettsia has shown to provide the resistance to the whiteflies against heat stress [149] and has also shown to increase the whitefly’s susceptibility to various chemical insecticides [148]. However, in this study, there were only two samples found positive for Rickettsia, it was concluded that this bacterium is least found in Pakistani Bemisia population. It has been reported from the neighboring countries like India and China [134, 135], but its absence in Pakistan may be due to the difference in biotypes in these regions.

The previous study by Gottlieb et al. [129] indicates that in Israel, GroEL proteins produced by Hamiltonella present in MEAM 1 population help whiteflies in transmitting Tomato yellow leaf curl virus (TYLCV). While there is no such record for the MED population in Israel, they are inefficient in transmitting TYLCV because they do not harbor Hamiltonella. In China, both MEAM1 and MED have been reported to harbor Hamiltonella with high incidences [128, 135] and both are capable of transmitting TYLCV very efficiently [277]. However, it has been reported that the native whitefly species in Asia II 1 do not harbor Hamiltonella, but still, it transmits various begomoviruses, including TYLCV and CLCuMV with high efficiency [275,

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

277, 279, 334, 335]. In our study, Hamiltonella is detected from all the MEAM-1 biotypes, which is prevalent in Sindh region of Pakistan, also confirm the previous reports [126, 135] but it is interesting to know that we have also found few samples of Asia II 1 positive for Hamiltonella while there is no such report of the presence of this bacterium from the Asia II 1 around the world. The presence of Hamiltonella is few Asia II 1 samples may be due to the horizontal transfer among different insect. The presence of Hamiltonella in MEAM-1 biotype and its role in virus transmission need further investigation.

Arsenophonus is reported to be present in Q biotype in different studies. Gueguen et al. [329] reported that Arsenophonus is strongly hosted in different Biotypes. In Israeli populations, Arsenophonus is found at a high rate only in the Q Biotype [126]. In this study, Arsenophonus infection was most common among the Asia II 1 which confirm the previous reports [134, 135]. However, infection frequency of Arsenophonus in MEAM 1 was low (Fig 4.1). Rana et al. [134] have shown that GroEL protein of Arsenophonus interacts with the coat protein of one of the viruses causing CLCuD (probably Cotton leaf curl Multan virus) and helps Asia II 1 B. tabaci in virus transmission. Further, they also show that besides bacteriocytes, Arsenophonus also localized in the salivary glands and the midgut of B. tabaci. It has been revealed that Asia II 1 transmit CLCuMV efficiently [279] and occurrence of Arsenophonus in Asia II 1 frequently might have some role in virus transmission in Pakistani Asia II 1 population which needs to be investigated.

The Wolbachia is known as a reproductive manipulator in many arthropods by causing cytoplasmic incompatibility, parthenogenesis and killing male insects [336, 337]. In Israeli Bemisia population, Wolbachia was only present in MED but was not found in the MEAM 1 populations [126]. Similarly, in 2010, Gueguen et al. [329] revealed the presence of Wolbachia in MED and absent in MEAM 1. However, in Chinese Bemisia populations, Wolbachia infection occurs at a high rate in B, Q biotype and indigenous biotypes [283, 338]. In this study, Wolbachia was detected in all biotypes tested (Asia II 1, MEAM-1, Asia 1) but the infection frequency of Wolbachia in Asia II 1 was found to be in low as compared to the MEAM 1 and Asia 1. It may suggest that Wolbachia in Pakistani Bemisia population, not involved in manipulating their reproduction or sex ratio as reported in other arthropods.

Chapter 4: Diversity of Bacterial Endosymbionts of Bemisia tabaci in Pakistan

Studies have shown that not only whiteflies but other insects and arthropods like mites, ticks spider and copepods have been found to be infected with the bacteria belongs to the genus Cardinium. It has been reported that the infection rate of Cardinium in arthropods is close to 7% [139, 142, 339]. Cardinium hertigii, for the first time, detected in Encarsia wasp which parasitoids B tabaci [340]. In many arthropod, C. hertigii has been defined to cause cytoplasmic incompatibility, feminization and parthenogenesis. [140]. Though, the role of Cardinium and its effect has not been studied in B. tabaci, considering it a mutualistic bacterium. But recently Santos-Garcia et al. [107] indicated that the genome of Cardinium has been reduced and undergone many changes in order to facilitate its survival in B. tabaci. In view of previous studies, the infection of Cardinium among MEAM-1 and MED found to be very low as compared to the native whiteflies [321, 329, 332]. In our study, Cardinium was detected in all three Biotype used with variable infection frequency. The infection was high in Asia II 1 and it was mostly found co-infected with Arsenophonus in Punjab region which has high virus incidence, suggesting that Cardinium presence in Asia II 1 might have some impact on host biology.

In conclusion, our results show the diversity of S endosymbionts in the different biotypes of the B. tabaci complex in different regions of Pakistan. More than one endosymbionts were found infecting B. tabaci particularly multiple infections seem to be more common in both Asia II 1 and MEAM 1. In the opinion of the impact of secondary endosymbionts in the biology of whiteflies, this study forecast new aspects of different S-endosymbionts association with the B. tabaci species complex. This study has also highlighted the prevalence of Arsenophonus and Cardinium might have a role in virus transmission or either have an impact on their biology.

5 Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

5.1 Introduction

In Pakistan, cotton is the foremost cash crop and contributes up to 60% of foreign exchange earnings. Cotton is grown on approximately three times (2.5 million hectares) in Punjab province then the cotton grown area in Sindh province. Since the early 1990s the yield of cotton from the Punjab has been seriously reduced due to cotton leaf curl disease (CLCuD; [341]). CLCuD was reported for the first time in late 1967 in the vicinity of Multan, Punjab province [342] and remained limited to that area until 1986 [343, 344]. However, during the 1990s the disease spread rapidly affecting all cotton growing areas of the Punjab and also spread into northern Sindh province and northwestern India. It has been estimated that between 1992 and 1997 the economy of Pakistan suffered a loss of US$5 billion [341]. The introduction of CLCuD resistant cotton varieties, developed by conventional breeding, virtually eliminated losses due to the disease by the late 1990s [345]. Due to the sporadic nature of CLCuD in Sindh province, Pakistan, and northewestern India, the cultivation of resistant cotton varieties was always something of a gamble between growing the lower yielding resistant varieties or growing the high yielding non-resistant varieties but risking losses should the disease be prevalent that year. For this reason, the cultivation of resistant cotton varieties was not uniform in these areas. However, the resistance was not long-lived as in 2001 all previously resistant cotton varieties began to exhibit symptoms of CLCuD and the resistance breaking “strain” of the disease spread into northwestern India [266, 346, 347].

Cotton Leaf Curl Disease is caused by begomoviruses in association with a specific betasatellite known as CLCuMuB [226, 347]. A number of distinct begomovirus species were shown to be associated with the disease in the 1990s, the most important of which are Cotton leaf curl Multan

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

virus (CLCuMuV) and Cotton leaf curl Kokhran virus (CLCuKoV; [267, 348]). These viruses are poorly infectious to G. hirsutum and require CLCuMuB to cause typical CLCuD symptoms. After resistance breaking in 2001 the disease across the Punjab (Pakistan) in resistant cotton was shown to be associated with only a single virus, the “Burewala” strain of CLCuKoV (CLCuKoV-Bur); a strain resulting from recombination between CLCuKoV and CLCuMuV [282]. Although this strain became dominant across the Punjab in Pakistan, in Sindh province Pakistan and northewestern India, although CLCuKoV-Bur was important, other virus species, some of which were not identified in the Punjab (Pakistan), persisted; likely due to the continued cultivation of non-resistant cotton varieties in these regions [282, 346, 349]. CLCuKoV-Bur was shown to be associated with a recombinant CLCuMuB, known as the “Burewala” strain (CLCuMuBBur) resulting from recombination with a betasatellite prevalent in tomato – Tomato leaf curl betasatellite [268].

At the present time, 17 years post-resistance breaking, there remain no cotton varieties with resistance to CLCuD, although some promising tolerant varieties are in development. The available evidence suggests that the virus situation in cotton is reverting to the state of affairs that were present during the 1990s, with multiple begomoviruses in the crop across the affected area [350]. Nevertheless, CLCuKoV-Bur and CLCuMuBBur appear to remain the predominant cause of CLCuD across the Punjab, Pakistan.

The study described in this chapter has analysed the diversity begomoviruses and their associated alphasatellites and betsatellites harboured by B. tabaci insects collected, for the most part, on cotton around the Punjab and Sindh provinces of Pakistan.

5.2 Materials and Methods

5.2.1 Cloning of Begomoiruses, Alphasatellites, and Betasatellites The DNA extracted from whiteflies for determination of the sequence of the COI marker (Chapter 3) was used as a template in RCA reactions to amplify all circular DNA molecules. The RCA products were then used as a template in PCR. Begomoviruses, alphasatellites and betasatellites were amplified by PCR with the

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

universal primer pairs BegomoF/BegomoR [351], DNA101/ DNA102 [352] and beta01/beta02 [353], respectively. PCR products were identified on ethidium bromide stained 1% agarose gels and products of ~2.8 kb, for reactions with begomovirusprimers, and ~1.4 kb, for satellites, were cloned.

Table 5.1 Oligonucleotide primers used in the study.

Primer Sequence Restriction site BegomoF ACGCGTGCCGTGCTGCTGCCCCCA MluI BegomoR ACGCGTATGGGCTGYCGAAGTTSAGACG beta01 GGTACCACTACGCTACGCAGCAGCC KpnI beta02 GGTACCACTACGCTACGCAGCAGCC DNA101 CTGCAGATAATGTAGCTTACCAG PstI DNA102 CTGCAGATCCTCCACGTGTATAG 5.2.2 Cloning of Viruses and Satellites PCR amplified fragments were ligated into the vector (PTZ57R/T) using an InsTAclone PCR Cloning Kit (Thermo Scientific) as described by the manufacturer. Ligated plasmids were transformed into E. coli and clones were identified by restriction analysis (Chapter 2). Clones with the desired inserts (~2.8 kb for viruses and ~1.4 kb for satellites) were progressed to sequencing.

5.2.3 Sequencing of Viruses, Alphasatellites, and Betasatellites An AxyPrep Plasmid Miniprep Kit (Axygen) was used for the isolation of plasmids of selected clones for sequencing following the procedures recommended by the manufacturer. Purified plasmids were sent to the USA for sequencing using a capillary ABI 3730XL sequencer (Thermo Fisher Scientific). Sequences were extended by “primer-walking” using specifically designed oligonucleotide primers. SeqMan, part of Lasergene package of sequence analysis software (DNAStar Inc., Madison, WI, USA) was used for the assembling of the sequences.

5.2.4 Sequence and Phylogenetic Analysis The Basic Local Alignment Search Tool (BLAST) () was used to determine percent identity values to sequences in the databases and provide an initial identification of virus/satellite sequences. Final identification of sequences was achieved using the procedures described in Brown et al. [189], for begomoviruses, Briddon et al. [354] for alphasatellites, and Briddon et al. [355] for betasatellites, using the Sequence

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

Demarcation Tool (SDT; [356]). Potential coding sequences (ORFs) were identified using ORF Finder. Multiple alignments of sequences were produced using Clustal W in MEGA 7 [327]. Phylogenetic dendrograms were produced using the Neighbor- Joining algorithm in MEGA 7. Potential recombination between sequences was identified using the RDP version 4 (Recombination Detection Program) [357].

5.3 Results

5.3.1 Cloning and Sequencing of Begomoviruses, Betasatellites and Alphasatellites from Whiteflies. The DNA extracted from 82 whiteflies which were characterized in Chapter 3 were used for RCA amplification. Analyses on agarose gels showed only 58 samples yielded a high molecular weight product by RCA. A total of 41, 20, and 41 presumed full-length (approx.. size 2.8, 1.3 and 1.4 kb respectively) virus, betasatellite and alphasatellite, respectively, clones were obtained by PCR with specific universal primers from the RCA products. The origins of the clones is summarized in Table 5.2. The sequences of the clones are available in the databases under the accession numbers given in Tables 5.3 for virus and Table 5.4 for betasatellites and alphasatellites. All but three of the insects for which virus, betasatellite and alphasatellite clones were obtained were collected from cotton. Three of the insects were collected from binjal (eggplant) (Table 5.2).

5.3.2 Characterisation of Begomoviruses Isolated from Whiteflies An initial analysis of the 41 virus sequences using SDT showed these to fall into 6 groups with less than 91% nucleotide sequence similarity (the species delineation threshold for begomoviruses [189], indicative of the data set encompassing 6 distinct species (results not shown). The 6 groups consisted of –

Group 1 - P-663, P-664, MM-665, MM-666 (4 isolates)

Group 2 - MM-622 (1 isolate)

Group 3 - P-566 1 isolate)

Group 4 - P-107 (1 isolate)

Group 5 - P-593, P-595, P596, P-598 (4 isolates)

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

Group 6 - P-668, P-625 ,P-626, P-646, P-647, P-648, P-649, P-650, P-651, P652, P653, P-654, P-655, P-661, P-667, P-669, P-671, P-682, P-685, P-686, P-687, P-702, P-703, P-662, P-709, P-710, P-711, P-712, P-627, P-643 (30 isolates)

Analysis of the sequences of Group 1 isolates to selected sequences obtained from the nucleotide sequence databases using SDT showed these to have highest sequence similarity to isolates of Alternanthera yellow vein virus (AlYVV) with the highest (96.5 to 95.8%) to an isolate of the virus from Eclipta prostrata originating from India (EU188920). This indicates that sequences P-663, P-664, P-665 and P-666 are isolates of AlYVV.

SDT analysis of the sequence of P-622 (Group 2) showed this to have high levels of sequence identity to the many (>100) sequences of Chili leaf curl virus (ChiLCV) available in the databases. The levels of nucleotide sequence identity to isolates of the “Pakistan” strain of ChiLCV were higher than to isolates of the other strains of the virus; the highest identity levels were to two isolates of ChiLCV-PK originating from Capsicum annuum in India (EU939533, [358]), and cotton in Pakistan (KY420138), at 96.4 and 96% identity, respectively. This indicates that P-622 is an isolate of ChiLCV-PK.

The sequence of P-566 (Group 3) showed relatively high levels of sequence identity to two previously identified species of begomovirus; 90.6% identity to Mesta yellow vein mosaic virus (MeYVMV; KT948076) and 90.8% identity to Hollyhock leaf curl virus (HoLCV; GQ478343). Based on the recommendations of Brown et al. [189] this means that P-566 should be considered an isolate of HoLCV – the isolate to which it shows the highest nucleotide sequence similarity. However, it is likely that in the future the species MeYVMV and HoLCV will be merged.

The sequence of P-107 (Group 4) showed high levels of sequence identity to the many (>100) sequences of Okra enation leaf curl virus (OEnLCV) available in the databases with the highest (99.9%) to two isolates of OEnLCV (KC019308, KC019309) isolated from okra originating from India. This indicates that P-107 is an isolate of OEnLCV.

The sequences of Group 5 isolates had highest sequence similarity to isolates of Cotton leaf curl Multan virus (CLCuMuV) with the highest (90.5 to 94.5%) to isolates of the

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

“Rajasthan” strain (CLCuMuV-Raj). This indicates that P-593, P-595, P596, P-598 are isolates of CLCuMuV-Raj.

To sequences of isolates from Group 6 the highest levels of identity by SDT were to isolates of Cotton leaf curl Kokhran virus (CLCuKoV). Two of the isolates (P- 627 and P-643) showed overall highest similarity to the isolates of the “Shahdadpur” strain of CLCuKoV (CLCuKoV-Sha) than to isolates of the other strains of this species, indicating that these are isolates of CLCuKoV-Sha. The remaining 28 isolates showed overall higher nucleotide sequence identity to the “Burewala” strain of CLCuKoV (CLCuKoV-Bur) than to isolates of the other strains of the species. This indicates that the majority of the viruses cloned in the study are isolates of CLCuKoV-Bur.

The identification of species was confirmed by a phylogenetic analysis (Figure 5-1) that showed each of the virus sequences isolated from whiteflies to segregate with relevant reference virus sequences from the databases.

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

Table 5. 2 Origins of the begomovirus, betasatellite and alphasatellite clones.

Insect Biotype Host Location COI Virus Virus Betasatellite Betasatellite Alphasatellite Alphasatellite no. (city/province) accession identified* (clone no./ identified* (clone no./ Identified* (clone no./ accession no.) accession no.) accession no.) 1 Asia II 1 Gh Rashidabad HG918197 HoLCV P-566/ - - - - Tayar/Sindh MH538339 2 MEAM Gh Tando Allahyar/ HG918201 ChiLCV P-622 ChLCB P-620/ AEA P-577/ 1 Sindh MH538340 MH411247 MH510291 3 MEAM Gh Tando Allahyar/ HG918199 - - - - AEA P-578/ 1 Sindh MH510292 4 MEAM Gh Tando Allahyar/ HG918200 - - - - AEA P-579/ 1 Sindh MH510293 5 MEAM Gh Tando Allahyar/ HG918202 - - - - AEA P-580/ 1 Sindh MH510294 6 MEAM Gh Mirpurkhas/ HG918203 - - - - AEA P-581/ 1 Sindh MH510295 7 Asia II 1 Gh Sakand/ LN832289 CLCuMV- P-593/ - - - - Sindh Raj MH555071 8 Asia II 1 Gh Sakrand/ LN832303 CLCuMV- P-595/ CLCuMBSha P-629/ CLCuMuA P-611/ Sindh Raj MH555070 MH427318 MH517042 9 Asia II 1 Gh Sakrand/ LN832304 CLCuMV- P-596/ CLCuMBSha P-630/ - - Sindh Raj MH555072 MH427319 10 Asia II 1 Gh Sakrand/ LN832305 CLCuMV- P-598/ - - - - Sindh Raj MH560503 11 Asia II 1 Gh Faisalabad/Punja HF934975 OELCuV P-107/ - - AYVSGA P-101/ b MH538338 MH517043 12 Asia II 1 Gh Haroonabad/Punj HG915744 AlYVV P-663/ - - - - ab MH538342 13 Asia II 1 Gh Haroonabad/Punj HG915745 AlYVV P-664/ - - - - ab MH538343 14 Asia II 1 Gh Haroonabad/Punj HG915746 AlYVV P-665/ - - GDarSLA P-720/ ab MH538344 MH517039 15 Asia II 1 Gh Haroonabad/Punj HF935011 AlYVV P-666/ - - - - ab MH538345

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

16 Asia II 1 Gh Qaziabad/Sindh LN832306 CLCuKoV- P-627/ - - AEA P-631/ Sha MH538341 MH517040 17 Asia II 1 Gh Moro/Sindh LN832307 CLCuKoV- P-643/ - - AEA P-633/ Sha MH781030 MH517041 18 Asia II 1 Gh Rahim Yar LT222297 CLCuKoV- P-651/ CLCuMuBBur P-693/ CLCuMuA P-676/ Khan/Punjab Bu MH766871 MH427326 MH450227 19 Asia II 1 Gh Rahim Yar HG315647 CLCuKoV- P-652/ CLCuMuBBur P-694/ CLCuMuA P-677/ Khan/Punjab Bu MH766872 MH427327 MH464254 20 Asia II 1 Gh Rahim Yar HG315648 CLCuKoV- P-653/ - CLCuMuA P-678/ Khan/Punjab Bu MH766873 MH464255 21 Asia II 1 Gh Kot HF934993 CLCuKoV- P-667/ CLCuMuBBur P-701/ GDarSLA P-609/ Samba/Punjab Bu MH766876 MH450220 MH817849 22 Asia II 1 Gh Kot HG315657 CLCuKoV- P-668/ CLCuMuA P-679/ Samba/Punjab Bu MH766877 MH464256 23 Asia II 1 Gh Kot HG315658 CLCuKoV- P-669/ Samba/Punjab Bu MH766878 24 Asia II 1 Gh Khanewal/Punja HF934984 CLCuKoV- P-646/ CLCuMuBBur P-658/ CLCuMuA P-644/ b Bu MH756640 MH427323 MH510284 25 Asia II 1 Gh Kacha HF934982 CLCuKoV- P-661/ GuLCB P-692/ CLCuMuA P-634/ Khuh/Punjab Bu MH781029 MH411248 MH510283 26 Asia 1 Sm Wahi HF934987 CLCuKoV- P-649/ CLCuMuBBur P-696/ CLCuMuA P-656/ Hussain/Punjab Bu MH756643 MH427328 MH510285 27 Asia 1 Sm Wahi HF934997 CLCuKoV- P-650/ CLCuMuBBur P-639/ CLCuMuA P-659/ Hussain/Punjab Bu MH756644 MH427322 MH510286 28 Asia 1 Sm Wahi HG315652 CLCuKoV- P-647/ - - Hussain/Punjab Bu MH756641 29 Asia II 1 Gh Firoza/Punjab HF934992 CLCuKoV- P-648/ CLCuMuBBur P-673/ CLCuMuA P-674/ Bu MH756642 MH427325 MH510287 30 Asia II 1 Gh Firoza/Punjab HF935005 CLCuKoV- P-654/ CLCuMuBBur P-704/ - Bu MH766874 MH450221 31 Asia II 1 Gh Firoza/Punjab HG315649 CLCuKoV- P-655/ - - Bu MH766875 32 Asia II 1 Gh Burewala/Punjab HG918181 CLCuKoV- P-709/ CLCuMuBBur P-721/ CLCuMuA P-680/ Bu MH766879 MH450223 MH510279 33 Asia II 1 Gh Burewala/Punjab HG315640 CLCuKoV- P-710/ CLCuMuBBur P-722/ - Bu MH766880 MH450224 68

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

34 Asia II 1 Gh Burewala/Punjab LN897417 CLCuKoV- P-711/ - GDarSLA P-699/ Bu MH766881 MH517037 35 Asia II 1 Gh Faisalabad/Punja HF934976 CLCuKoV- P-625/ CLCuMuBBur P-637/ CLCuMA P-681/ b Bu MH756638 MH427321 MH510280 36 Asia II 1 Gh Faisalabad/Punja HF934977 CLCuKoV- P-626/ - GDarSLA P-108/ b Bu MH756639 LN874303 37 Asia II 1 Gh Vehari/Punjab HF935013 CLCuKoV- P-712/ CLCuMuBBur P-706/ CLCuMuA P-690/ Bu MH766882 MH450222 MH510281 38 Asia II 1 Gh Vehari/ HG315642 CLCuKoV- P-687/ - GDarSLA P-700/ Punjab Bu MH766884 MH517038 39 Asia II 1 Gh Dadu/ LN832312 CLCuKoV- P-682/ CLCuMuBSha P-638/ CLCuMuA P-691/ Sindh Bu MH766885 MH427320 MH510282 40 Asia II 1 Gh Dadu/ LN832309 CLCuKoV- P-685/ CLCuMuBBur P-672/ - - Sindh Bu MH766886 MH427324 41 Asia II 1 Gh Dadu/ LN832310 CLCuKoV- P-686/ - AEA P-610/ Sindh Bu MH766887 Defective 42 Asia II 1 Gh Sakrand/ LN832299 CLCuKoV- P-671/ CLCuMuBBur P-723/ - - Sindh Bu MH766883 MH450225 43 Asia II 1 Gh Jhandoloo LN832292 CLCuKoV- P-702/ CLCuMuBBur P-724/ - - Shah/Sindh Bu MH766888 MH450226 44 Asia II 1 Gh Jhandoloo LN832293 CLCuKoV- P-703/ Shah/Sindh Bu MH766889 45 Asia II 1 Gh Jhandoloo LN832294 CLCuKoV- P-662/ Shah/Sindh Bu MH766890 46 MEAM1 Gh Thana HG315664 - - - - CLCuMuA P-329/ varyam/Punjab MH510288 47 MEAM Gh Mirwah/Sindh HG918207 - - - - CLCuMuA P-583/ 1 MH510289 48 MEAM Gh Goth Mukhtar LN832284 - - - - CLCuMuA P-584/ 1 Arain/Sindh MH510290 49 MEAM Gh Tando Ghulam HG918208 - - - - AEA P-589/ 1 Ali/Sindh MH510296 50 MEAM Gh Tando Ghulam HG918212 - - - - AEA P-590/ 1 Ali/Sindh MH510297

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

51 MEAM Gh Tando Ghulam HG918213 - - - - AEA P-591/ 1 Ali/Sindh MH510298 52 MEAM Gh Pano Aqil/ LN835378 - - - - AEA P-603/ 1 Sindh MH517030 53 Asia II 1 Gh Pano Aqil/ LN835380 - - - - AEA P-605/ Sindh MH517031 54 MEAM Gh Mandu LN835387 - - - - GDarSLA P-606/ 1 dhero/Sindh MH517032 55 Asia II 1 Gh Mandu LN835399 - - - - GDarSLA P-607/ dhero/Sindh MH517033 56 MEAM Gh Mirpur LN835377 - - - - GDarSLA P-608/ 1 Mathelo/Sindh MH517034 57 MEAM Gh Mirpur LN835385 - - - - GDarSLA P-613/ 1 Mathelo/Sindh MH517035 58 MEAM Gh Mirpur LN835386 - - - - GDarSLA P-614/ 1 Mathelo/Sindh MH517036

*Viruses are denoted as Cotton leaf curl Khokran virus-Burewala strain (CLCuKoV-Bur), Cotton leaf curl Multan virus-Rajasthan strain (CLCuMuV-Raj), Cotton leaf curl Kokhran virus – Shadadpur strain (CLCuKoV-Sha), Alternanthera yellow vein virus (AlYVV), Okra enation leaf curl virus (OELCuV), Chilli leaf curl virus (ChiLCV), Hollyhock leaf curl virus (HoLCV)

$ Host plant species from which whiteflies were collected are denoted as Gossypium hirsutum (Gh) and Solanum melongena (Sm)

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

Table 5.3 Features of the begomoviruses isolated in this study.

Virus* N Location/ Plant Biotype Clone nos./ Size Coding capacity (no. of amino acids) and position [nucleotide Province species$ accession (bp) coordinates of start/stop codons] nos. V1 V2 C1 C2£ C3 C4 CLCuKoV- 02 Faisalabad/ G. hirsutum Asia II 1 P-625/ 2759 256(292- 118(132 363(1505 1S 134(105 146(224 Bur Punjab MH756638 1062) -488) -2596) 9-1463) 2-2682) P-626/ MH756639 CLCuKoV- 03 Burewala/ G. hirsutum Asia II 1 P-709/ 2759 256(292- 118(132 363(1505 FS 134(105 146(224 Bur Punjab MH766879 1062) -488) -2596) 9-1463) 2-2682) P-710/ MH766880 P-711/ MH766881 CLCuKoV- 02 Vehari/ G. hirsutum Asia II 1 P-712/ 2759 256(292- 118(132 363(1505 FS 134(105 146(224 Bur Punjab MH766882 1062) -488) -2596) 9-1463) 2-2682) P-687/ MH766884 CLCuKoV- 01 Khanewal/ G. hirsutum Asia II 1 P-646/ 2759 256(292- 118(132 363(1505 FS 134(105 146(224 Bur Punjab MH756640 1062) -488) -2596) 9-1463) 2-2682) CLCuKoV- 03 Rahim Yar G. hirsutum Asia II 1 P-651/ 2759 256(292- 118(132 363(1505 FS 134(105 146(224 Bur Khan/ MH766871 1062) -488) -2596) 9-1463) 2-2682) Punjab P-652/ MH766872 P-653/ MH766873 CLCuKoV- 01 Kaccha G. hirsutum Asia II 1 P-661/ 2759 256(292- 118(132 363(1505 FS 134(105 146(224 Bur Khuh/ MH781029 1062) -488) -2596) 9-1463) 2-2682) Punjab CLCuKoV- 03 Firoza/ G. hirsutum Asia II 1 P-648/ 2759 256(292- 118(132 363(1505 FS 134(105 146(224 Bur Punjab MH756642 1062) -488) -2596) 9-1463) 2-2682) 71

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

P-654/ MH766874 P-655/ MH766875 CLCuKoV- 03 Wahi S. Asia 1 P-647/ 2759 256(292- 118(132 363(1505 1S 134(105 146(224 Bur Hussain/ melongena MH756641 1062) -488) -2596) 9-1463) 2-2682) Punjab P-649/ MH756643 P-650/ MH756644 CLCuKoV- 03 Kot Samba/ G. hirsutum Asia II 1 P-667/ 2759 256(292- 118(132 363(1505 1S 134(105 146(224 Bur Punjab MH766876 1062) -488) -2596) 9-1463) 2-2682) P-668/ MH766877 P-669/ MH766878 CLCuKoV- 01 Sakrand/ G. hirsutum Asia II 1 P-671/ 2759 256(292- 118(132 363(1505 FS 134(105 146(224 Bur Sindh MH766883 1062) -488) -2596) 9-1463) 2-2682) CLCuKoV- 03 Dadu/ G. hirsutum Asia II 1 P-682/ 2759 256(292- 118(132 363(1505 FS 134(105 146(224 Bur Sindh MH766885 1062) -488) -2596) 9-1463) 2-2682) P-685/ MH766886 P-686/ MH766887 CLCuKoV- 03 Jhandolo G. hirsutum Asia II 1 P-662/ 2759 256(292- 118(132 363(1505 1S 134(105 146(224 Bur shah/ MH766890 1062) -488) -2596) 9-1463) 2-2682) Sindh P-702/ MH766888 P-703/ MH766889 CLCuKoV- 01 Moro/Sindh G. hirsutum Asia II 1 P-643/ 2748 256(292- 118(132 362(1505 150(115 134(105 100(213 Sha MH781030 1062) -488) -2593) 6-1608) 9-1463) 7-2439)

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

CLCuKoV- 01 Qaziabad/ G. hirsutum Asia II 1 P-627/ 2748 256(292- 118(132 362(1505 150(115 134(105 100(213 Sha Sindh MH538341 1062) -488) -2593) 6-1608) 9-1463) 7-2439) CLCuMuV- 04 Sarkand/ G. hirsutum Asia II 1 P-593/ 2738 256(276- 118(116 362(1495 150(115 134(104 100(212 Raj Sindh MH555071 1046) -472) -2583) 6-1598) 9-1453) 7-2429) P-595/ MH555070 P-596/ MH555072 P-598/ MH560503 AlYVV 04 Haroonabadl/ G. hirsutum Asia II 1 P-666/ 2746 256(313- 115(153 361(1532 134(112 134(108 96(2170- Punjab MH538345 1083) -500) -2617) 5-1629) 0-1484) 2460) P-667/ MH766876 P-668/ MH766877 P-669/ MH766878 OELCuV 1 Faisalabad/ G. hirsutum Asia II 1 P-107/ 2741 256(281- 115(121 362(1500 150(115 134(105 102(213 Punjab MH538338 1051) -468) -2588) 1-1603) 4-1458) 2-2440) HoLCV 1 Rashidabad/ G. hirsutum Asia II 1 P-566/ 2742 256(292- 115(132 361(1511 150(116 134(106 100(214 Sindh MH538339 1062) -479) -2598) 2-1614) 5-1465) 5-2447) ChiLCV-PK 1 Tando C. annuum MEAM- P-622/ 2756 256(308- 118(148 361(1527 134(122 134(107 97(2162- Allahyar/ 1 MH538340 1078) -504) -2612) 0-1624) 9-1479) 2455) Sindh *Viruses are denoted as CLCuKoV-Bur, CLCuMuV-Raj, CLCuKoV-Sha, AlYVV, OELCuV, ChiLCV, and HoLCV.

$Plant species from which the insect was collected.

The mutations of the TrAP-encoding gene of CLCuKoV-Bur are identified as first identified by Amrao et al. [359]. These mutations are showed as 1S (one in frame stop codon), 2S (two in frame stop codon), and third one is the FS (frame shift mutation).

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

Table 5.4 Features of the alphasatellites and betasatellites isolated in the study.

Satellite* N Location/ Province Clone umbers/ Size Coding sequence (nucleotide accession nos. (bp) coordinates of start/stop codons/no. of amino acids) Rep βC1 CLCuMuA 01 Faisalabad/ Punjab P-681/MH510280 1368 77-1024/315 - CLCuMuA 01 Mirwah/Sindh P-583/MH510289 1365 77-1024/315 - CLCuMuA 01 Dadu/Sindh P-691/MH510282 1365 77-1024/315 - CLCuMuA 01 Goth Muktar Arain/ Sindh P-584/MH510290 1365 77-1024/315 - CLCuMuA 01 Burewala/ Punjab P-680/MH510279 1375 77-1024/315 - CLCuMuA 01 Vehari/ Punjab P-690/MH510281 1375 77-1024/315 - CLCuMuA 01 Thana varyam/ Punjab P-329/MH510288 1375 77-1024/315 - CLCuMuA 03 Rahim Yar Khan/ Punjab P-676/MH450227, 1374 77-1024/315 - P-677/MH464254 P-678/MH464255 CLCuMuA 01 Kot Samba/ Punjab P-679/MH464256 1374 77-1024/315 - CLCuMuA 01 Firoza/ Punjab P-674/MH510287 1374 77-1024/315 - CLCuMuA 02 Wahi Hussain/ Punjab P-656/MH510285, 1374 77-1024/315 - P-659/MH510286 CLCuMuA 01 Khanewal/ Punjab P-644/MH510284 1374 77-1024/315 - CLCuMuA 01 Kacha khuh/ Punjab P-634/MH510283 1374 77-1024/315 - CLCuMuA 01 Sarkand/ Sindh P-611/MH517042 1374 77-1024/315 - AEA 05 Tando Allah yar/Sindh P-577/MH510291 1365 82-1029/315 - P-578/MH510292 P-579/MH510293 P-580/MH510294 P-581/MH510295 AEA 03 Tando Ghulam Ali/Sindh P-589/MH510296 1361 82-1029/315 - P-590/MH510297 P-591/MH510298

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

AEA 02 Panu Aqil/Sindh P-603/MH517030 1361 82-1029/315 - P-605/MH517031 AEA 01 Qaziabad/Sindh P-631/MH517040 1362 82-1029/315 - AEA 01 Moro/ Sindh P-633/MH517041 1362 82-1029/315 - AEA 01 Dadu/ Sindh P-610/ 1165 defective - GDarSLA 01 Faisalabad/ Punjab P-108/LN874303 1373 70-1017/315 - GDarSLA 01 Burewwala/ Punjab P-699/MH517037 1373 70-1017/315 - GDarSLA 02 Mandu dhero/ Sindh P-606/MH517032 1373 70-1017/315 - P-607/MH517033 GDarSLA 03 Meer Mathelo/Sindh P-608/MH517034 1373 70-1017/315 - P-613/MH517035 P-614/MH517036 GDarSLA 01 Kot Samba/Punjab P-609/ 1373 70-1017/315 - GDarSLA 01 Vehari/Punjab P-700/MH517038 1373 70-1017/315 - GDarSLA 01 Haroonabad/ Punjab P-720/MH517039 1373 70-1017/315 - AYVSGA 01 Fsisalabad/ Punjab P-101/MH517043 1379 57-944/295 - CLCuMuB 02 Sarkand/Sindh P-629/MH427318 1353 - 195-551/118 P-630/MH427319 CLCuMuB 01 Sarkand/ Sindh P-723/MH450225 1353 - 195-551/118 CLCuMuB 01 Jhandoloo shah/ Sindh P-724/MH450226 1353 - 195-551/118 CLCuMuB 02 Dadu/Sindh P-638/MH427320 1353 - 195-551/118 P-672/MH427324 CLCuMuB 01 Kot Samba/Punjab P-701/MH450220 1351 - 195-551/118 CLCuMuB 01 Vehari/Punjab P-706/ MH450222 1350 - 195-551/118 CLCuMuB 02 Wahi Hussain/ Punjab P-696/MH427328 1351 - 195-551/118 P-639/MH427322 CLCuMuB 02 Firoza/ Punjab P-673/MH427325 1351 - 195-551/118 P-704/MH450221 CLCuMuB 01 Khanewal/ Punjab P-658/MH427323 1350 - 195-551/118 CLCuMuB 02 Rahim Yar khan/ Punjab P-693/MH427326 1350 - 195-551/118 P-694/MH427327 CLCuMuB 01 Faisalabad/ Punjab P-637/MH427321 1350 - 195-551/118

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

CLCuMuB 02 Burewala/ Punjab P-721/MH450223 1350 - 195-551/118 P-722/MH450224 ChiLCB 01 Tando Allah yar/Sindh P-620/MH411247 1358 - 200-562/200 GuLCB 01 Kacha khuh/ Punjab P-692/ 1356 - 187-570/127 MH411248

*Alphasatellites are denoted as AEA, AYVSGA, CLCuMuA, GDarSLA. Betasatellites are denoted as ChiLCB, CLCuMuB and GuLCB

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

The virus sequences were analyzed for the presence of their potential coding sequences (genes) using the ORF Finder tool. This showed all but the CLCuKoV-Bur sequences to have the genome arrangement typical of the genomes of Old World begomoviruses or DNA A components, with 6 predicted genes encoding proteins of the expected size for begomoviruses (Table 5.3). For the CLCuKoV-Bur isolates the ORF Finder analysis showed a significantly reduced TrAp gene – encoding a TrAP predicted to be 35 amino acids rather than the more normal 134 amino acids. This feature, a truncated TrAP, is characteristic of CLCuKoV-Bur strain which was reported as resistance breaking strain in cotton [359]. In common with previously characterized isolates of CLCuKoV-Sha [282], the TrAP gene of the two isolates of CLCuKoV-Sha obtained here is predicted to encode a protein of 150 amino acids (Table 5.3), rather than the more common 134 amino acid TrAP of Old World begomoviruses.

5.3.3 Characterization of Satellites Isolated from Whiteflies A total of 61 1.3 to 1.4 kb clones were obtained from whiteflies collected from locations across Pakistan. The geographic origins of the whiteflies is summarised in Table 5.2 and shown in Figure 5-2. Analysis of the sequences using ORF Finder showed the presence of one large gene of (~950 nucleotides) encoded in the virion-sense, typical of alphasatellites, for 41 of the sequences (Table 5.4). For the remaining 20 clones ORF Finder showed numerous small genes but with a single conserved gene, encoded in the complementary-sense, with a coding capacity of 118 amino acids or greater, typical of betasatellites (Table 5.4).

SDT analysis of the 41 presumed alphasatellite sequences showed them to fall into five groups based on the recently proposed species demarcation threshold for alphasatellites of 88% (Briddon et al., [354]).

Group 1 – P-606, P-614, P-608, P-613, P-607, P-609, P-699, P-700, P-720, P-108 (10 isolates)

Group 2 – P-577, P-578, P-579, P-589, P-581, P-603, P-605, P-631, P-633, P-590, P- 591, P-580, P-610 (defective molecule) (13 isolates)

Group 3 – P-676, P-677, P-678, P-679 (4 isolates)

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

Group 4 – P-329, P-644, P-584, P-583, P-611, P-634, P-674, P-680, P-681, P-659, P- 690, P-691, P-656, P-657 (14 isolates)

Group5 – P-101 (1 isolate)

Figure 5-1 Geographic origins of the Bemisia tabaci insects from which begomoviruses, betasatellites and alphasatellites were cloned. For each sample the insect number (Table 5.2) is given. The 10 sequences forming Group 1 showed >90% sequence identity except for P-607 which showed >90% sequence identity to most isolates except P-699, P-700, P-720,P- 108, to which it showed 85.6, 85.6, 87.2 and 86.7% identity, respectively. This indicates that the 10 sequences belongs to a single alphasatellite species based on the recommendation of Briddon et al. [233]. BLASTn analysis of the 10 sequences to available sequences in the databases showed them to have high sequence similarity to isolates of Gossypium darwinii symptomless alphasatellite (GDarSLA). This indicates that Group 1 sequences are isolates of GDarSLA. The identification of the Group 1 isolates as GDarSLA was confirmed by a phylogenetic analysis (Figure 5-2) which showed the Group 1 sequences to segregate with selected isolates of GDarSLA obtained from the databases. 78

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

The 13 sequences forming Group 2 showed between 95.2 and 100% identity marking them as isolates of a single alphasatellite species. In comparison to sequences in the datbases using BLASTn the Group 2 sequences showed high (>95% identity) to isolates of Ageratum enation alphasatellite (AEA). Based on the recommendations of Briddon et al. [354] this indicates that Group 2 sequences are isolates of AEA. This conclusion was confirmed by a phylogenetic analysis (Figure 5-2) which showed the Group 2 sequences to segregate with selected isolates of AEA obtained from the databases. One of the sequence of the AEA was smaller in size because it was defective molecule, it was not considered in tree building.

An SDT analysis of all sequences of Cotton leaf curl Multan alphasatellite (CLCuMuA) available in the databases, in comparionns to the sequences of both the Group 3 and Group 4 isolates, showed each isolate obtained here to have a level of sequence identity of >88% to at least one previously characterised CLCuMuA sequence. This indicates that both the Group 3 and Group 4 sequences are isolates of CLCuMuA.The unusual grouping of sequences of the Group 3 isolates in the SDT analysis of only alphasatellites obtained here was also supported by the phylogenetic analysis (Figure 5-2). This showed the four Group 3 sequences to segregate with an isolate of CLCuMuA previously known as Cotton leaf curl Shahdadpur alphasatellite (AM711115; [282]). To AM711115 the Group 3 sequences showed >99% identity. This unusual behaviour of the Group 3 sequences in phylogenetic analyses is likely due to recombination. An RDP analysis of all available CLCuMuA sequences suggested an unusual recombination event for the Group 3 sequences, with a significant fragment of the sequences originating from AM711115, although the direction of recombination and the parental sequences could not be accurately identified. Also the recombination event was not well supported by either the number of methods in RDP (only one method supported the identified recombination event) or p values (the p value obtained was very high (results not shown).

The sequence of P-101 (Group 5) showed high (>91%) levels of sequence identity to only 3 alphasatellite sequences, all isolates of Ageratum yellow vein Singapore alphsatellite (AYVSGA), available in the databases with the highest (97.7%) to an isolate from Oman isolated from tomato (FJ956707; [244]). To all other alphasatellite sequences in the databases the levels of sequence identity were less than 78.7%. This indicates that P-101 is an isolate of AYVSGA. This conclusion was 79

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci supported by a phylogentic analysis which showed P-101 to group with previously characterised isolates of AYVSGA (Figure 5-3).

Further analysis of the presumed betasatellite sequences using SDT showed them to form three groups based on the species delineation threshold of 91% nucleotide sequence identity for betasatellites, proposed recently (https://talk.ictvonline.org/ICTV/proposals/2016.021a- kP.A.v2.Tolecusatellitidae.pdf).

Group 1 - P-620 (1 isolate)

Group 2 - P-692 (1 isolate)

Group 3 - P-629, P-630, P-637, P-638, P-639, P-658, P-672, P-673, P-693, P-694, P- 696, P-701, P-704, P-706, P-721, P-722, P-723, P-724 (18 isolates) The sequence of P-620 (Group 1) showed highest nucleotide sequence similarity by SDT analysis to isolates of Chili leaf curl betasatellite (ChiLCB) with the highest (95.8%) to two isolates (AM279662, AM279663) originating from chili (Capsicum annum) in Pakistan [360]. This indicates that P-620 is an isolate of ChiLCB.

To sequences available in the databases SDT analysis showed the sequence of P-692 (Group 2) to have high levels of nucleotide sequence identity (98.9 and 99.1%) to two as yet unclassified betasatellite isolates (LN811050 and LN811051) from cluster bean (Cyamopsis tetragonoloba; also known as guar) in Pakistan. To all other betasatellites the identity levels were less than 86% indicating that LN811050, LN811051 and P-692 represent a single, as yet unclassified, species that will be referred to as Guar leaf curl betasatellite (GuLCB). In a phylogenetic analysis (Figure 5-5) the sequence of P-692 was shown to group with LN811050 and LN811051 and the three sequences were distinct from all other sequences in the analysis.

The 18 sequences in Group 3 showed between 90.3 and 100% identity, demonstrating that they all belongs to a single species based on the 91% species delineation threshold. To sequences in the databases the Group 3 sequences showed high levels of identity to the many sequences of Cotton leaf curl Multan betasatellite (CLCuMuB) available in the databases indicating that these are isolates of CLCuMuB. Closer analysis of alignments of the sequences of the Group 3 isolates with representative isolates of the “Multan” strain of CLCuMuB (CLCuMuBMul, AJ298903)

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci and “Burewala” strain of CLCuMuB (CLCuMuBBur, FN554719) showed the majority to have the recombinant fragment of Tomato leaf curl betasatellite (ToLCB), which is characteristic of CLCuMuBBur (Figure 5-4; [361, 362]). However, three of the Group 3 isolates, P-629, P-630 and P-638, showed a reduced fragment of ToLCB typical of the “Shahdadpur” strain of CLCuMuB (CLCuMuBSha; Figure 5-5; [282, 362]). The classification of Goup 3 isolates as CLCuMuB was confirmed by phylogenetic analysis which showed all to group closely with previously characterised CLCuMuBBur isolates and the three unusual isolates (P-629, P-630 and P-638) to segregate with CLCuMuBSha.

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

Figure 5-2 Phylogenetic analysis of full-length begomoviruses sequences obtained from whiteflies samples. Vertical distances are arbitrary, horizontal distances are proportional to calculated mutation distance. The bootstrap value are given at the nodes with confidence values (1000 repeats). The tree was arbitrarily rooted on the sequence of Bhendi yellow vein Dehli virus DNA B as outgroup. The sequences obtained in the study described here are shown in various colours whereas sequences obtained from the databases are shown in black. The viruses are indicated as AlYVV, ChiLCV, CLCuKoV-Bur, CLCuKoV-Sha, CLCuMuV-His, CLCuMuV-PK, CLCuMuV-Raj, HoLCV, MeYVMV and OEnLCV.

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

Figure 5-3 Phylogenetic dendrogram based upon an alignment of the complete nucleotide sequences of alphasatellites identified in whiteflies with selected alphasatellites from the databases. Horizontal distances are calculated as per mutation distance and vertical distance are random. The bootstrap values are given at nodes with confidence values (1000 repeats). The genus within the family Geminialphasatellitinae is given on the right. The alphasatellite species are given as AEA , AYVSGA, CLCuMuA, and GDarSLA. For each sequence the isolate descriptor is given in square brackets and for the alphasatellites from the database the accession number is given. The tree was arbitrarily rooted on AYVSGA-[PK:Pun:05] as outgroup.

Chapter 5: Diversity of Begomoviruses and Associated Satellites harboured by Bemisia tabaci

Figure 5-4 Alignment of the sequences of CLCuMuB isolates obtained from B. tabaci with those of a typical CLCuMuBMul (AJ298903) and CLCuMuBBur (FN554719) across the sequence in the satellite conserved region which has recombined between ToLCB and CLCuMuB [361]. The region of the recombination is indicated by the black bar. The grey bar indicates the typical recombinant sequences of CLCuMuBSha. Sequences divergent from CLCuMB-[PK:Fai1:96] (AJ298903; a CLCuMBMul isolate) are highlighted as black text on a white background. The numbers above the alignment refer to positions in the alignment and the numbers along the right refer to the nucletide coordinates of the respective sequence

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

Figure 5-5 Phylogenetic dendrogram based upon an alignment of the complete nucleotide sequences of betasatellites identified in whiteflies with selected betaasatellites from the databases. Horizontal distances are calculated as per mutation distance and vertical distance are random. The bootstrap values are given at nodes with confidence values (1000 repeats). The betasatellite species are given as Cotton leaf curl Multan betasatellite (CLCuMuB), Chili leaf curl betasatellite (ChiLCB) and the proposed species Guar leaf curl betasatellite (GuLCB). The strains of CLCuMuB are given as “Burewala” (CLCuMuBBur) and “Shahdadpur” (CLCuMuBSha). For each sequence the isolate descriptor is given in square brackets and for the betasatellites from the database the accession number is given. The tree was arbitrarily rooted on an isolate of Gossypium darwinii symptomless alphasatellite (GDarSLA) as outgroup.

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

5.4 Discussion The study conducted here has isolated and sequenced full-length begomoviruses, betasatellites and alphasatellites harboured by B. tabaci insects identified to the cryptic species level across the Punjab and Sindh provinces of Pakistan. The insects were collected, for the most part, off cotton (G. hirsutum) plants in areas where CLCuD occurs. The study was designed to complement a recent analysis of the diversity of B. tabaci cryptic species prevalent in Pakistan [104] and an analysis of the diversity of begomoviruses, betasatellites and alphasatellites occurring across Pakistan (manuscript in preparation).

For interpretation of the results of the study it is important to note that the identification of a begomovirus in a particular B. tabaci insect does not necessarily indicate that the plant on which the insect was collected was infected by that virus, nor that that the betasatellite and/or alphasatellite isolated from the insect was necessarily associated with the virus identified in the insect. B. tabaci can be highly polyphagous and thus may collect begomoviruses, betasatellites and alphasatellites from a number of different plants/plant species. Nevertheless, an analysis of begomoviruses, betasatellites and alphasatellites harboured by B. tabaci provides information on the range of begomoviruses, betasatellites and alphasatellites present within the plants upon which the insects were feeding.

The complete sequences of total of 41 begomoviruses, 20 betasatellites and 41 alphasatellites, isolated from a total of 58 whitefly were determined. The virus sequences consisted of 6 species and three strains (Table 5.3 and 5.5). AlYVV has previously been identified in Picrorhiza kurrooa in India, Sonchus arvensis Mubin et al., [363] and Eclipta prostrata [364, 365] in Pakistan, Alternanthera sessilis, Synedrella nodiflora and Rumex nepalensis in India, E. prostrata, Ludwigia hyssopifolia [366], and Alternanthera philoxeroide [367] in China and Zinnia elegans and E. prostrata in Vietnam [195]. With the possible exception of P. kurrooa, a medicinal plant, these are all weeds (non-cultivated plants).

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

Table 5.5 Summary of the relationship between viruses, betasatellites and alphasatellites identified.

Virus Betasatellite Alphasatellite (no.)* (no.)* (no.)* [n=41] [n=20] [n=41] AlYVV (4) none (4) none (3) GDarSLA (1) ChiLCV (1) ChLCB (1) AEA (1) CLCuKoV-Bur (28) CLCuMuBBur (15) CLCuMuA (09) none (5) GDarSLA (1) CLCuMuBSha (1) CLCuMuA (1) none (11) none (5) GDarSLA (3) CLCuMuA (2) AEA (1) GuLCB (1) CLCuMuA (1) CLCuKoV-Sha (2) none (2) AEA (1) AEA (1) CLCuMuV-Raj (4) CLCuMuBSha (2) CLCuMuA (1) none (1) none (2) none (2) HoLCV (1) none (1) none (1) OELCuV (1) none (1) AYVSGA (1) none (17) none (9) AEA (9) none (5) GDarSLA (5) none (3) CLCuMuA(3)

*Number of insects harbouring each virus/satellite. It would thus seem unlikely that the AlYVV isolate identified here, isolated from four Asia II 1 insects collected off cotton, originated from cotton. Additionally, for the majority of plants in which AlYVV was identified, and which the earlier studies searched for a betasatellite, only for one was a betasatellite identified [195] although some studies did identify the association with an alphasatellite. This is consistent with the findings here where no betasatellite, but for one insect an alphasatellite was identified (Table 5.2 and 5.5).

ChiLCV is a frequently encountered monopartite begomovirus across the subcontinent which has also spread into Oman [368, 369]. The virus is a major problem in chilli peppers and tomato but has also been identified in papaya and a number of other crops and weeds [368, 369]. The virus is associates with a number of distinct betasatellites but most commonly with ChLCB [360, 369]. The identification of ChiLCV with ChLCB in an insect collected in Sindh (Table 5.2 and 5.5) is thus

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

consistent with the earlier findings. However, the insect was collected off cotton and ChiLCV is not known to infect G. hirsutum, although recently ChLCB has on one occasion been identified in G. arboreum, although the significance of this remains unclear [370].

Hollyhock leaf curl virus (HoLCV) was identified in one insect on cotton originating from Sindh, but no betasatellite or alphasatellite was isolated from the same insect (Table 5.2 and 5.5). This virus is usually identified infecting Eclipta prostrata but has also been identified infecting Althea rosea (hollyhock), Andrographis paniculata and most recently Malva parviflora [371]. In M. parviflora HoLCV was shown to be associated with CLCuMuB (called by them Kenaf leaf curl betasatellite) which was here also isolated from the insect from which the virus was obtained. Although HoLCV clearly infects plants of the family Malvaceae, so far, has not been shown to cause disease in cotton. It would thus seem likely that the virus identified here was acquired prior to the insect settling on cotton.

Okra enation leaf curl virus (OELuV) has been most commonly identified infecting okra in India [346, 372]. Recently the virus has also been identified in okra in Sri Lanka [373], papaya in Iran [374], okra in Pakistan [375]. OELuV in association with CLCuMuB has on one occasion been identified in cotton with CLCuD symptoms [376]. Saeed et al. [377] have shown that the OELuV and CLCuMuB isolates from cotton can infect Nicotiana benthamiana and induce CLCuD-like symtpoms. Together these findings suggest that OELuV and CLCuMuB can cause CLCuD but the relatively infrequent identification of this complex in cotton (one plant so far; [376]) suggests that it is not a major contributor to losses in the field. The identification of OELuV in one insect from Faisalabad is consistent with this idea (Table 5.2 and 5.5).

The “Rajasthan” strain of CLCuMuV (earlier known as Cotton leaf curl Rajasthan virus) was first identified in cotton in northwestern India as early as 1994 (acc. no. AF363011; [189]) but was not identified in G. hirsutum in Pakistan until quite recently [350], although it was identified infecting tomato and the weed Digera arvensis in Pakistan in 2005 [351, 363]. CLCuMuV-Raj was also identified in a study conducted between 2006 and 2008 of a collection of exotic, and presumed non-resistant, Gossypium species maintained in Multan [378]. CLCuMuV-Raj appears to have evolved in India and is not believed to be resistance breaking. This may explain why 88

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

the virus did not spread out of India into cotton in Pakistan at the time when only resistant cotton was being grown in the Punjab province of Pakistan, although it was present in the country. More recently, with even resistant cotton being susceptible to CLCuD, there has been no pressure to maintain the resistance (to CLCuKoV- Bur/CLCuMuB) and the cultivation of non-resistant varieties has likely allowed the reemergence of viruses that infected cotton prior to the introduction of the resistant varieties as well as non-resistance breaking viruses such as CLCuMuV-Raj [350]. The four isolates identified in B. tabaci here come from Asia II 1 insects collected from cotton in Sindh (Table 5.2, 5.5, and 5.6). This marks the first identification of CLCuMuV-Raj in Sindh. As noted previously, CLCuD has only sporadically occurred in Sindh and the cultivation of resistant cotton varieties there was never common-place. The appearance of this strain in Sindh likely is due to the spread of B. tabaci Asia II 1 from Pakistan Punjab into Sindh (Chapter 3; [104]), although the virus itself is more likely to have originated in neighbouring Rajasthan state (India), assuming that CLCuMuV-Raj is transmitted efficiently by this cryptic species (the study of Pan et al. [279] used the “Faisalabad” strain of CLCuMuV for their transmission studies).

The Shahdadpur strain of CLCuKoV-Sha; previously known as Cotton leaf curl Shahdadpur virus was first identified in association with CLCuD in Sindh in samples collected in 2004 and 2005 [282]. Subsequently the strain has also been identified in the Punjab in samples collected in 2015 [350]. It is unclear whether CLCuKoV-Sha is resistance breaking but the first identification of this strain of CLCuMuV in Sindh and the identification the Punjab well after the spread of resistance breaking (after 2001) would possibly suggest not. The results here, identifying CLCuKoV-Sha in insects collected from Sindh (Table 5.2 and 5.6), indicate that this virus strain continues to circulate in Sindh.

The majority of the virus isolates identified here were of the “Burewala” strain of CLCuKoV (previously known as Cotton leaf curl Burewala virus; Table 5.2 and 5.5). This virus was first identified by Amrao et al. [359] and shown to be associated with resistant (to CLCuD) cotton varieties. Although the mechanism for breaking resistance remains a question, the evidence suggests that CLCuKoV-Bur break the resistance by virtue of encoding a mutated TrAP gene [359]– the suggestion being that TrAP is the avirulence determinant recognized by the resistance gene product(s) encoded by

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

resistant cotton varieties [359, 379, 380]. All the isolates of CLCuKoV-Bur identified here have mutations of the TrAP-encoding gene which truncate the product to 35 aa (Table 5.3) indicative of the resistance breaking strain. More recently CLCuKoV-Bur isolates with either a greater than 35 aa or a full-length TrAP-encoding gene have been identified but these have not been shown to be associated with resistant cotton varieties [381]. It is likely that these isolates represent reversions of the virus occurring due to the absence of resistant cotton in the field.

Alphasatellites (family Alphasatellitidae) are a group of small (1000-1400 nt) circular DNA molecules that are associated with geminiviruses and nanoviruses (family Nanoviridae) [354]. They are self-replicating single-stranded satellite-like molecules which require a helper virus for their encapsidation, transmission and movement between plants. Alphasatellites are highly variable but all encode a Rep rolling-circle replication initiator protein and are not essential for infectivity or symptom induction of the helper viruses with which they are associated. Recently, the Rep encoded by alphasatellites encoded by geminivirus associated alphasatellites (sub-family Geminialphasatellitinae) have been shown to suppress transcriptional gene silencing in plants, signifying that they are involved in overcoming host defense [382]. With the exception of AYVSGA, all alphasatellites identified here are members of the subfamily Geminialphasatellitinae and genus Colecusatellite, which are common across the Old World. The most frequently identified in whitefly here is CLCuMuA, which is the most common alphasatellite identified with cotton plants affected by CLCuD

The most unusual alphasatellite identified here is AYVSGV (sub-family Geminialphasatellitinae, genus Ageyesisatellite) [233]. AYVSGV was first identified in association with Ageratum yellow vein virus and Ageratum yellow vein betasatellite in Ageratum conyzoides originating from Singapore [383] and subsequently in association with Tomato yellow leaf curl virus and Tomato leaf curl betasatellite in tomato originating from Oman [244]. The Oman isolate was shown experimentally to reduce symptoms severity of disease in tomato by reducing betasatellite levels [244]. The identification of AYVSGV here marks the first identification of this alphasatellite species outside of Singapore and Oman. It is thus surprising to find this alphasatellite present in Punjab province, Pakistan, and in an insect in which OELCuV was also identified.

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

The study described here obtained a total of 20 betasatellites sequences. Of these 18 were identified as CLCuMuB. CLCuMuB has been shown experimentally, in association with a number of distinct monopartite begomoviruses, to cause CLCuD [226, 267]. Since the majority of insects examined in the study were collected from cotton, and during the summer months cotton is the major crop grown across the regions where the whiteflies were collected (Figure 5.1), the identification of CLCuMuB is not surprising.

Of the 18 CLCuMuB isolates 15 were shown to have the distinctive recombinant fragment derived from ToLCB marking them as the “Burewala” strain of CLCuMuB. CLCuMuBBur was first identified by Amin et al. [361] and was associated with resistance (to CLCuD) breaking in cotton which occurred in 2001 [266]. After this time, when only resistant cotton (Gossypium hirsutum) was grown in most parts of Pakistan except Sindh, only CLCuMuBBur was isolated from CLCuD symptomatic cotton. The results obtained here are consistent with this in that for insects in which CLCuMuBBur was identified, and a virus was also identified, that virus was CLCuKoV- Bur.

Three isolates of CLCuMuB identified in whiteflies have a reduced fragment of ToLCB typical of the “Shahdadpur” strain. CLCuMuBSha was first identified by Amrao et al. [282] but has since also been identified in the Punjab [350] Zubair et al. referred to this betasatellite as the “Vehari” strain of CLCuMuB, since it differed slightly from typical CLCuMuBSha isolates. However, since these isolates are not phylogenetically distinct from CLCuMuBSha (see KX697597 and KX697602 in Figure 5-5) use of this additional strain name seems inappropriate. The phylogenetic analysis of Zubair et al. [384] gave an erroneous result, suggesting a phylogenetic difference, since the alignments upon which it was based included three partial CLCuMuB sequences originating from India. Here the three CLCuMuBSha isolates were from insects collected from cotton in Sindh, indicating that this strain of CLCuMuB continues to be present in Sindh and suggesting that it continues to cause problems in this crop. Interestingly two of the CLCuMuBSha isolates obtained from Sindh emanated from insects in which CLCuMuV-Raj was identified; CLCuMuV-Raj has not so far been shown to associate with CLCuMuBSha.

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

An unusual betasatellite, with highest of sequence similarity to two betasatellite sequences available in the databases isolated from guar (cluster bean), was identified in one Asia II 1insect collected from cotton in the Punjab. For this reason, the name Guar leaf curl betasatellite (GuLCB) was proposed for this newly identified betasatellite species. The insect in which GuLCB was detected also harboured CLCuKoV-Bur and CLCuMuA. It is unlikely that this betasatellite is associated with CLCuD suggesting that the insect concerned may have fed on some other plants species, such as guar, before alighting on cotton. An annual legume, Guar (Cyamopsis tetragonoloba) (family Fabaceae) a fodder crop, as green manure as well as for its beans, is cultivated as a vegetable across the Indian subcontinent,

Since insects examined here were collected from only two plant species, G. hirsutum and Solanum melongena (eggplant) it is not possible to draw any conclusion concerning differences between the two. Nevertheless, the identification here of three (nos. 26, 27 and 28; Table 5.2) B. tabaci insects habouring CLCuKoV-Bur, and two of which also harboured CLCuMuB and one CLCuMuA, is consistent with the earlier identification of CLCuKoV-Bur and CLCuMuB in S. melongena [385]. The plant collected by Ullah et al. [385] exhibited yellow mosaic symptoms, which are not typical of infections involving CLCuKoV-Bur and CLCuMuB. Nevertheless, the CLCuKoV- Bur and CLCuMuB harboured by S. melongena was shown to induce CLCuD symptoms in resistant G. hirsutum by back transmission using B. tabaci, showing that the plants species may act as a reservoir host of the virus complex.

Although Pan et al. [279] have recently shown that of four cryptic species only Asia II 1 transmits CLCuMuV/CLCuMuB to cotton, experiments transmitting to tobacco showed that MED could transmit at low efficiency (~10%) to yield symptomatic plants, compared to ~70% for Asia II 1. However, all four cryptic species examined (Asia II 1, MED, MEAM-1 and Asia 1) also transmitted CLCuMuV to plants (10-20%) that ultimately were non-symptomatic but contained virus at very low titer for MED, MEAM-1 and Asia 1. Unfortunately, the authors did not further investigate these plants. Since only diagnostics for the virus was used, it is possible that these plants represent infections of the virus without the betasatellite. This raises the question of whether possibly MEAM-1 and Asia 1 in Pakistan might transmit the CLCuD complex between alternate host plants even if they do not transmit to cotton. The identification

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

of all the main components of the CLCuD complex (CLCuKoV-Bur and CLCuMuB) in three Asia 1 insects supports this hypothesis (Table 5.2 and 5.6). However, MEAM- 1 (16 insects) was not found to harbor any of the viruses known to be associated with CLCuD (Table 5.2 and 5.6), suggesting that this cryptic species plays no, or a very minor, role in the spread of CLCuD, as suggested by Pan et al. [279]. This is also consistent with the findings of Ahmed et al. [284] who have shown that although Asia II 1 preferentially feeds on and performs better on cotton, the opposite is true of MEAM-1.

Although a significant number of MEAM-1 insects were examined (n = 16) only for one was a virus isolated, whereas for Asia II 1, of 39 insects examined, only for two insects was no virus isolated (Table 5.2 and 5.6). This discrepancy may indicate that virus and betasatellite DNA levels in MEAM-1 insects are very low. It is possible that the exotic MEAM-1 may not transmit, or only poorly transmit, the begomoviruses present in Pakistan; as was shown for CLCuMuV [279]. In this respect it is important to remember than even cryptic B. tabaci species that do not transmit a particular virus can take up that virus into the digestive tract but that this would then not be acquired (pass across the gut into the haemocoel) but either be digested or excreted.

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

Table 5.6 Summary of the virus, betasatellite and alphasatellites harboured by each B. tabaci cryptic species.

Species Virus Betasatellite Alphasatellite (no.) (no.) (no.) (no.) [n=58] [n=41] [n=20] [n=41] Asia II 1 (39) CLCuKoV-Bur CLCuMuBBur (13) CLCuMuA (7) (25) GDarSLA (1) none (5) CLCuMuBSha (1) CLCuMuA (1) GuLCB (1) CLCuMuA (1) none (10) GDarSLA (3) CLCuMuA (2) AEA (1) none (4) CLCuKoV-Raj (4) CLCuMuBSha (2) CLCuMuA (1) none (1) none (2) none (2) CLCuKoV-Sha (2) none (2) AEA (2) AlYVV (4) none (4) GDarSLA (1) none (3) HoLCV (1) none (1) none (1) OELCuV (1) none (1) AYVSGA (1) none (2) none (2) AEA (1) GDarSLA (1) Asia 1 (3) CLCuKoV-Bur (3) CLCuMuBBur (2) CLCuMuA (2) none (1) none (1) MEAM 1 (16) ChiLCV (1) ChLCB (1) AEA (1) none (15) none (15) GDarSLA (4) AEA (8) CLCuMuA (3)

The study here does not support the contention, put forward in a number of recent papers, that a change is occurring in the CLCuD complex at this time [350, 386, 387]. Zubair et al. [350] reported the recent presence in cotton of begomoviruses not seen since the introduction of resistance to the CLCuD complex in the 1990s, including CLCuMuV, CLCuKoV (strains other than “Burewala”) and Cotton leaf curl Alabad virus based on an analysis of 6 plants collected in 2015. Hassan et al. [386] showed the presence in cotton of a CLCuKoV-Bur with a longer than usual (for this virus in resistant cotton) TrAP-encoding gene (127aa rather than the 35aa typical of CLCuKoV- Bur; a typical begomovirus TrAP is 134aa) in non-resistant cotton based on an analysis 94

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

of two plants collected in 2013. The available evidence suggests that TrAP is the avirulence determinant of the resistance introduced into cotton into the 1990s and that the resistance was broken by CLCuKoV-Bur having a mutated TrAP gene [359, 379, 380]. With, at this time, all cotton varieties being susceptible to CLCuD and there being no means of screening for the presence (in the field) of the resistance genes introduced into cotton in the 1990s, much of the cultivated cotton (if not all) now lacks these genes allowing the viruses which the resistance kept at bay to possibly again infect the cotton crop. The results of the analysis of B. tabaci here does not support the contention that viruses not previously associated with cotton, such as Tomato leaf curl New Delhi virus, the bipartite begomovirus, are a significant factor in the changing circumstances in cotton, as has been suggested by some [387] based mainly on the results of Zaidi et al. [388] who examined 31 plants and identified ToLCNDV in 20. Nor is there evidence for a third epidemic, which has again been predicted by some based on the changes occurring in Pakistan [350, 387]. Rather the results here would suggest that these are sporadic, transient and limited ingressions of into cotton of virus(es) not usually identified in cotton. The results obtained here from the identification of viruses, betasatellites and alphasatellites harboured by B. tabaci is that the status quo remains, with the major virus identified in the Punjab being CLCuKoV-Bur (18 out of 26 isolates identified) and there probably being more diversity of viruses infecting cotton in Sindh (CLCuKoV-Bur [7 isolates], CLCuMuV-Raj [4], CLCuKoV-Sha [2] out of a total of 13 isolates). This is very much in line with the situation reported for the period 2005 to 2010 in these two regions with the possible exception of the ingress of CLCuKoV-Bur into Sindh [282, 359]. Similarly, the major beta- and alphasatellites identified are CLCuMuB, CLCuMuA and GDarSLA which are well known in cotton affected by CLCuD.

Although roughly the same numbers of insects were analyzed from the Punjab and Sindh (n= 27 and 31, respectively), relatively few viruses and betasatellites were isolated from the insects collected in Sindh (Table 5.2 and 5.7). This is due to greater than half the insects collected in Sindh being MEAM 1 and this cryptic species likely not transmitting native begomoviruses in Pakistan and thus having low begomovirus and betasatellite DNA levels; as noted previously. Despite this an approx. equal number of insects originating from Sindh and the Punjab were shown to harbor alphasatellites (n =23 and 18, respectively; Table 5.7). This would seems to suggest that in both 95

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

provinces B. tabaci insects are feeding on plants harbouring begomoviruses/betasatellites/alphasatellites - remembering that although self- replicating they need a helper virus to move inside and between plants and alphasatellites are most commonly encountered with begomovirus-betasatellite complexes. The successful amplification and cloning of alphasatellites in situations where no begomovirus and or betasatellites were obtained is possibly due to the fact that alphasatellites are autonomous and can, in many instances, reach high levels in plants even when the helper virus and associated betasatellite do not [389].

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

Table 5.7 Summary virus, betasatellite and alphasatellites harboured by each B. tabaci cryptic species broken down by province.

Province Species Virus Betasatellite Alphasatellite (no.) (no.) (no.) (no.) (no.) [n=58] Punjab (27) - Total = 26 Total = 13 Total = 18 Asia II 1 (23) CLCuKoV-Bur CLCuMuBBur CLCuMuA (7) (18) (10) GDarSLA (1) none (2) GuLCB (1) CLCuMuA (1) none (7) CLCuMuA (2) GDarSLA (3) none (2) AlYVV (4) none (4) GDarSLA (1) none (3) OELCuV (1) none (1) AYVSGA (1) Asia 1 (3) CLCuKoV-Bur (3) CLCuMuBBur CLCuMuA (2) (2) none (1) none (1) MEAM 1 (1) none (1) none (1) CLCuMuA (1) Sindh (31) - Total = 15 Total = 7 Total = 23 Asia II 1 (16) CLCuKoV-Bur (7) CLCuMuBBur none (3) (3) CLCuMuBSha CLCuMuA (1) (1) none (3) AEA (1) none (2) CLCuMuV-Raj (4) CLCuMuBSha CLCuMuA (1) (2) none (1) none (2) none (2) CLCuKoV-Sha (2) none (2) AEA (2) none (2) none (2) GDarSLA (1) AEA (1) HoLCV (1) none (1) none (1) MEAM 1 (15) ChiLCV (1) ChLCB (1) AEA (1) none (14) none (14) AEA (8) GDarSLA (4) CLCuMuA (2)

A study similar to that reported here was recently conducted [390]. This study differed from that conducted here in that cryptic species were not identified, insects originated from a much wider area (4 provinces compared to the 2 examined here). insects were

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

pooled in groups of 10-15, did not look for betasatellites or alphasatellites and only the sequences of the coat protein gene (~550 nt) of the viruses were determined, which, due to recombination, can give incorrect species identification. The study of Islam et al. [390] identified a much wider range of begomoviruses than was identified in the study here. This may be due to the study of Islam et al. [390] collecting insects of a much wider range of plants (although the relationship between each plant species and the virus obtained was not considered; in fact, it is unclear whether all the insects in pooled samples were collected from a single plant species) than was examined here. Although there are some commonalities between the two studies, such as the identification of AlYVV, the results with viruses associated with CLCuD differ significantly. The study of Islam et al. [390] identified only CLCuMuV-Raj occurring across Pakistan. This finding goes against all previous studies of begomovirus diversity in Pakistan, including the results here, and can only be explained by misidentification due the sequencing of only the coat protein gene. Nevertheless, the study of Islam et al. [390] has shown that B. tabaci insects harbor a wide variety of begomoviruses, possibly a wider diversity than has so far be realised by analyses of viruses isolated from plants.

The study described here has identified begomoviruses/betasatellites and alphasatellites harboured by B. tabaci insects collected, for the most part, on cotton plants in Punjab and Sindh provinces of Pakistan. The study has shown distinct differences between insects collected in the two provinces, which likely reflects differences between the diversity of viruses in the two provinces, as well as differences between cryptic species (particularly Asia II 1 and MEAM-1), which likely is due to their differing transmission specificities (native begomoviruses apparently not being adapted to transmission by MEAM-1). This information will be useful in devising control measures aimed at reducing losses due to begomoviruses as well as providing useful information regarding the changes that are likely to occur in the prevalence of begomoviruses due to changes in the prevalent cryptic species. For example, the increasing prevalence of MEAM-1 in the Punjab and increasing prevalence of Asia II 1 in Sindh (Chapter 3) would be predicted to lead to a decrease and increase, respectively, of viruses associated with CLCuD in the two provinces. In turn the presence of MEAM-1 would be expected to lead to an increase in problems due to Tomato yellow leaf curl virus, which is efficiently transmitted by MEAM-1 and has recently been identified in Pakistan [391]. The study highlights the need to examine the 98

Chapter 5: The Diversity of Begomoviruses and their Associated Satellites Inside Bemisia tabaci

other prevalent cryptic species present in Pakistan for their ability to transmit begomoviruses, particularly those associated with CLCuD.

6 Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci feeding on CLCuD Affected Cotton During the Growing Season

6.1 Introduction Losses in agricultural productivity are greatly affected by a number of variables that include crop variety, sowing time and environmental influences such as temperature, rainfall and relative humidity [392] as well as due to biotic stresses such as virus infection [393]. For the virus complex causing cotton leaf curl disease, and other diseases caused by geminivirus, studies have addressed the effects of plant variety, sowing time and environmental factors such as temperature, rainfall and relative humidity on disease incidence and crop loses [394, 395]. Similarly, studies have addressed the effects of environmental variables on whiteflies populations and consequent effects on disease incidence and crop loses [394, 396, 397]. However, although our understanding of the mechanism of transmission of, in this case, begomoviruses by the vector Bemisia tabaci has advanced significantly in the last 30 years [165] we know little about the in-field seasonal dynamics of the viruses in the insect vector.

Several PCR-based methods, along with sequence-based serological and hybridization-based protocols, have been developed to detect begomoviruses [398-402]. Of these methods, however, only quantitative real-time PCR (qPCR) provides the accuracy and sensitivity to detect the minute quantities of viral DNA harboured by insects [403-406].

The study described in this chapter was designed to investigate the levels of virus and betasatellite associated with CLCuD harbored by Bemisia tabaci collected from cotton plants throughout the cotton growing season using qPCR. Such a study has not been conducted previously and could potentially provide valuable information

100

Chapter 6: Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci

about the epidemiology of the virus complex causing CLCuD and possible means of controlling losses due to it.

6.2 Materials and Methods

6.2.1 Sample Collection and DNA Extraction Whiteflies were collected from NIBGE in the cotton growing season from the year 2014 to 2016. Usually, cotton is sown in late April and remains in the field until the end of September. Samples were collected every month in the year 2014 and 2015 from May to September. In the year 2016 cotton was sown a month later than usual, so sampling was started in June and continued until October. For each month two samples, consisting of ten whiteflies, was collected. The whiteflies samples were kept in 80% ethanol until use for DNA extraction. DNA was extracted as described in Chapter 2 and DNA was quantified using NanoDrop spectrophotometer. An of dilution (20 ng/µL) was made of each sample for qPCR. Non-viruliferous whiteflies, maintained in the insect rearing facility of NIBGE, were used as negative controls.

6.2.2 PCR Amplification The virus and betasatellite primers were designed to amplify all the begomoviruses associated with CLCuD, including CLCuBuV, and CLCuMB [389]. A conventional PCR was run to optimize the primers for amplification from whitefly-extracted DNA.

6.2.3 Quantitative Real-Time PCR The qPCR was conducted essentially as described in [389]. The reaction mixture for the qPCR comprised of SYBERGreen Super mix (12.5 µL), 0.25 µL (2.5 pico moles) of each primer, template DNA (50 ng/µL) of 2.5 µl and final volume of 25µl was made by adding 9.5 µL of water. The PCR cycling profile used was an initial 10 min at 94 ºC, followed by 40 cycles at 94 ºC for 30 sec, at 58 ºC for 30 sec and at 72 ºC for 30 sec. The reaction was run in a 96 well microtiter plate “(Bio-rad) in an iQ 5 thermal cycler (Bio-Rad).” Samples were run in triplicate.

6.2.4 Standard Curves Linear regression analysis between (Ct) threshold cycle over the amount of the DNA of each of the triplicates of standard dilution was done to get a standard curve. Data

101

Chapter 6: Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci

analysis and interpretation were done automatically by the software. PCR efficiency was calculated by the formula:

E=eln/10-s-1… (6-1)

“A PCR efficiency of 100 ± 5% using the standard curve constructed with serial dilutions of genomic DNA is sufficient for further quantification.”

6.2.5 Environmental Data Environmental data (temperature, humidity, and rainfall) were obtained from the Meteorological department, Pakistan (http://namc.pmd.gov.pk/).

6.3 Results

Whitefly samples were collected each month starting from May to September in the year 2014, 2015 and from July to October in the year 2016. The late sowing in 2016 was attributed to a lack of water for irrigation. The results of the qPCR determination of the amounts of virus and betasatellite satellite DNA in the samples collected are given in Figures 6.1 and 6.2, respectively. The results for the amounts of viral DNA in insects firstly showed considerable variation between the two samples collected at each time point, suggesting a great variation in the amounts of virus carried by each insect. Although in the first year of sampling (2014) the amounts of virus in insects possibly showed a peak in June and a slight trough in July this was far from convincing. Overall the was little variation in the amounts of viral DNA in insects over the sampling periods. Striking is the very low amounts of viral DNA detected in insects in the year 2014 in comparison to the two following year – a factor of 10 difference.

The amounts of betasatellite DNA detected in insects was initially very low and gradually built-up during the sampling period. Noticeably in the year 2016, the year that planting was delayed, the amount of betasatellite DNA detected at first sampling (July) was significantly higher than in the previous two years and also dropped off at the last sampling (October; Figure 6.2). Also, in contrast to the figure for virus DNA, the amount of variation between the two samples at each sampling showed less variation than was the case for viral DNA.

102

Chapter 6: Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci

Figure 6-1 qPCR analysis of the levels of virus in Bemisia tabaci. Insects were collected from cotton in Faisalabad over the cotton growing periods 2014 (A), 2015 (B) and 2016 (C).

103

Chapter 6: Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci

Figure 6-2 qPCR analysis of the levels of betasatellite in Bemisia tabaci. Insects were collected from cotton in Faisalabad over the cotton growing period 2014 (A), 2015 (B) and 2016 (C).

104

Chapter 6: Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci

6.4 Discussion

Geminiviruses are transmitted by their insect vector in a persistent, circulative manner. Begomoviruses are exclusively transmitted by the whitefly B. tabaci. Although for the vast majority of begomoviruses the association with B. tabaci is non-propagative, the virus does not undergo replication in the whitefly, for Tomato yellow leaf curl virus there is some evidence that, in fact, the virus may undergo replication in (at least some) biotypes (cryptic species) of B. tabaci [407, 408]. The pathway of the begomoviruses inside B. tabaci has been extensively studied [9, 115, 409]. Whiteflies are phloem feeders and B. tabaci used its stylet to ingests begomoviruses, whilst feeding on the phloem of infected plants. Virions pass through the food canal, the esophagus, the filter chamber and into the mid-gut. In the filter chamber and/or anterior mid-gut the virus crosses the gut wall into the haemolymph, which circulates throughout the insect. Carried in the haemolymph the virus translocates into the primary salivary glands and is egested with the saliva into the plant phloem. The time taken from ingestion to ultimate egestion in the saliva is known as the “latent period” and is a time during which the insect is unable to infect – transmit the virus to - healthy plants upon which it feeds [165].

Detection of geminiviruses and their path in insect vector whiteflies has been studied extensively [115, 165, 166]. Molecular hybridization methods have been used to detect pathogens, but the methods based upon the PCR are more sensitive and allow quantification as reviewed by [399]. Real-time PCR has an advantage over conventional PCR due to its greater sensitivity [402, 410, 411] and for this reason has become the most reliable and generally used method to detect viruses in insect vectors [403-406].

A general assumption, for the infection of crops by geminiviruses, is that B. tabaci “overwintering” on weeds/ornamentals or winter crops migrate into the new plantings and bring the virus with them to establish infection. The field in Faisalabad where this study was conducted is in an area where predominantly chickpea, lentil, and wheat is grown over the winter months. These are not hosts of the virus complex that causes CLCuD. They are instead hosts to other geminiviruses, such as Chickpea chlorotic dwarf virus for chickpea and lentil [412, 413] or, in the case of wheat, have not so far been shown to be a host of geminiviruses in this area. It would seem not 105

Chapter 6: Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci

unreasonable to assume that, at the time of planting, the majority of virus inoculum carried by B. tabaci insects originates from plants which are not cotton, and are not good hosts for the viruses causing CLCuD (such as chickpea and lentil). However, there are exceptions to this, such as Hibiscus rosa-sinensis, which is grown as an ornamental in gardens and on roadside verges. H. rosa-sinensis, a plant of the family Malvaceae, is a host of the virus complex causing CLCuD [265, 414]. Also, in the area where the insect samples were collected are several small plots of ratoon cotton; cotton plants from the previous year maintained for seed multiplication and invariably showing symptoms of CLCuD.

The basis for the study was the hypothesis that the virus and betasatellite titer in the vector B. tabaci would change over the growing season of cotton. The results obtained showed that this is the case for betasatellite DNA levels but are somewhat ambiguous for the virus DNA levels changing over the period of the study for each year. Particularly for 2016 but also to some degree for 2015, the levels of virus detected in insects were not significantly different as evidenced by largely overlapping error bars for the monthly values. Noticeable also is the variation between samples collected in the same month, suggesting that there is significant variation in the amount of virus carried by individual insects at each time period. Nevertheless, based on the results from 2014, there appears to be a peak in virus DNA levels for June, a trough in July followed by another peak in August/September. This would suggest that insects migrating into cotton early in the season (May) carry low amounts of virus, suggesting that the plants upon which the insects fed prior to migrating into cotton contained low amounts of virus and betasatellite.

Very low virus amounts were acquired by insects in 2014, relative to the other two years. The possible reasons for this are unclear. However, 2015 was a particularly bad year for cotton production in Pakistan with record losses (production estimated at 544 kg/Ha, a drop of 30% over the previous year; https://www.indexmundi.com/agriculture/?country=pk&commodity=cotton&graph= yield). Similarly, the production in 2016 was lower (699 kg/Ha) than in 2014 (a record year with production estimated at 782 kg/Ha) but nevertheless better than in 2015. Possibly there was a particularly virulent CLCuD complex after 2014, although there is no evidence to suggest that this was the case.

106

Chapter 6: Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci

What is quite noticeable is that the virus DNA levels are not mirrored by the betasatellite DNA levels. Possibly this is not surprising since there is no evidence to suggest that in planta betasatellite levels are tied to virus levels despite the fact that betasatellite replication depends upon virus-encoded Rep [226, 227]. This lack of correlation between virus and betasatellite levels in plants was evident in the recent study of the correlation between virus/betasatellite levels in plants in relation to the severity of CLCuD symptoms [389]. This contrasts with the other family of plant- infecting ssDNA viruses, the multipartite genome nanoviruses, where the relative levels of each component seems strictly controlled in both plants and insect vector [415].

In contrast the virus DNA levels, which seem to rise and fall during the season (possible due to ambient temperatures), the DNA levels of the betasatellite appear to increase gradually during the growing season, peaking at the end of the sampling (harvest time). Only for the 2016 season, the year that planting was delayed, was there a drop-off in betasatellite level at the last sampling time. This possibly occurred due to senescence and/or a reduction in plant growth this late in the year with low temperatures and shortening day-length. The difference in acquired virus and betasatellite DNA levels is difficult to explain. Betasatellite DNA is encapsidated in virus-encoded coat protein, allowing it to be acquired and transmitted by the vector [416]. Since both particles containing viral or betasatellite DNA consist of only CP and DNA it is difficult to see how one can accumulate to an excess in insects. Insect vectors of circulatively transmitted plant viruses can be seen as efficient sieves which selectively “filter-out” nutrients and virus particles from a large volume of plant (phloem) sap. Virus particles are selectively taken up in the filter chamber and/or anterior mid-gut by endocytosis and transported into the haemolymph. The interaction at the gut wall is selective, only begomoviruses (in the case of B. tabaci) being able to interact with specific receptors to pass into the haemocoel – most likely by clathrin- mediated endocytosis [417]. The specificity is determined, on the virus side, by amino acid sequences on the CP [212, 418-420]. The receptor(s) within the insect responsible for specific begomovirus up-take remain unclear, although several proteins have been implicated in the process [165]. The same virus CP amino acid sequences and insect receptors are also believed to be involved in the specific transport of the virus from the haemocoel into the salivary secretions [418-422]. These factors would thus suggest

107

Chapter 6: Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci

that the relative amounts of virus and betasatellite containing particles acquired by the insect should mirror the amounts present in the plants on which the insects feed. Although the relative amounts of virus and betasatellite DNA in infected plants has been examined at single time points, such as in the study of CLCuD affected cotton [389], no studies have so far examined the relative amounts virus and betasatellite DNA across a growing season. The relationship between virus and betasatellite DNA in infected plants relative to the virus and betasatellite DNA in insects feeding on the plants thus remains unclear. The results might thus suggest that particles containing betasatellite DNA are preferentially acquired, relative to particles containing viral DNA, or, alternatively, are less readily excreted by the insect. A possible explanation for this could be that betasatellite DNA, being half the size of the helper begomovirus genome, is encapsidated in isometric rather than geminate particles. For Maize streak virus, isometric particles have been shown to encapsidate approx. half genome length subgenomic (also known as “defective”) DNAs [423]. Betasatellite DNA could thus be encapsidated in isometric particles which might be treated differently by the acquisition/transmission system of the insect than geminate particles. For example, there might be more retention sites in the insect (on GroEL) for isometric particles than geminate particles. This apparent anomaly requires further investigation.

With limited numbers of receptors in the insect to acquire begomoviruses (the gut-haemocoel boundary) and limited numbers of receptors to excrete begomoviruses (the haemocoel-salivary gland boundary) B. tabaci insects appear to have a maximum capacity for virus; the implication being that B. tabaci has a mechanism to control the amounts of virus in the insect [165, 424-427]. The results obtained here with the CLCuD complex suggest that at no point during the cotton growing season, or at the very least for the majority of the season, is this maximum reached. This might indicate that the plants upon which the insects are feeding do not contain enough virus/betasatellite to saturate the insect, or the environmental conditions are sub- optimal for the acquisition of virus by the insect. No studies have so far examined the effects of, in particular, the temperature on the acquisition and transmission of begomoviruses by B. tabaci. Such a study would be difficult to conduct since the temperature has a significant effect on plant growth which would also have an effect on available virus/betasatellite for acquisition. However, this problem could be overcome by feeding insect through membranes on purified virus; assuming that

108

Chapter 6: Temporal Changes in the Levels of Virus and Betasatellite DNA in B. tabaci

begomovirus stability is not adversely affected by temperature. Membrane feeding insects has previously been used to show that exchange of the coat protein of a begomovirus for that of a curtovirus changes vector specificity from B. tabaci to the leafhopper vector of the curtovirus [212].

It is unclear from the study presented here whether environmental variables such as temperature, rainfall, and humidity are affecting the levels of virus and betasatellite in B. tabaci. Environmental variables have a significant effect on plant growth [428] and on CLCuD severity and incidence [429-431]. Similarly, environmental conditions have a great effect on B. tabaci, affecting reproduction and thereby population numbers [430]. However, what effects the environment has on the levels of begomoviruses acquired by B. tabaci has not been investigated. This issue requires investigation.

Overall the study described in this chapter has raised more questions than it has answered. The amounts of at least the betasatellite appear to increase gradually during the season whereas for the amount of virus the situation is less clear, the 2014 analysis appearing to suggest that there are two peaks of virus titer. Nevertheless, the results would seem to support the idea that controlling insects early in the season, by for example treatments with insecticides would be more effective than treatments later in the season, to prevent the build-up of inoculum in the insect. Later in the season, most plants are symptomatically infected and insects appear to contain large amounts of inoculum. Clearly, the study conducted here needs repeating to, particularly, establish what is happening with respect to virus levels in whiteflies and try to establish the effects of environmental variables on the levels of virus/betasatellite in whiteflies. It would also be interesting to determine the levels of alphasatellite, the third part of the CLCuD complex, in whiteflies during the cotton growing season.

109

7 Final Discussion

Bemisia tabaci (Gennadius) has become a serious pest for agriculture globally due directly to their feeding and indirectly to their ability to transmit viruses that cause diseases resulting in reduced yield and quality of crops. In Pakistan, in terms of economics, the most important disease is cotton leaf curl disease which is caused by begomoviruses and vectored by the B. tabaci. The work conducted in this project was designed to advance our understanding of the insect side of the virus- vector-plant interaction triangle with an emphasis on CLCuD. The work has extended our knowledge of the diversity of the insect B. tabaci, the endosymbionts it harbours and the begomoviruses, and associated satellites, it transmits. This information will be invaluable in the on-going efforts to reduce losses in, particularly cotton.

In addition to the development of resistance by conventional (breeding and selection) approaches [432], there have been numerous publications in recent years on efforts to develop so called “non-conventional” resistance to the viruses causing CLCuD as well as to B. tabaci in cotton. For virus resistance this has included the RNA interference approach, using both small-interfering RNAs [433, 434] and micro RNAs [435], and mutagenesis [436]. For resistance to B. tabaci efforts have focused almost exclusively on the RNA interference approach [437, 438]. Some of the methods pioneered in the work described in this thesis will be invaluable in monitoring the effectiveness of newly developed cotton varieties with resistance to the viruses causing CLCuD as well as the vector of those viruses – specifically the monitoring of viruses in insects (Chapter 5) and the determination of the amount of virus/betasatellite in insects (Chapter 6). Additionally, the determination of the prevalent cryptic species (Chapter 3) is invaluable in ensuring that any anti-B. tabaci resistance is targeted at relevant cryptic species – thus an insect resistance aimed at reducing CLCuD will only work if it actually knocks-down a cryptic species which occurs in the cotton growing region and, most importantly, transmits the viruses causing CLCuD.

On the subject of transmission of the viruses causing CLCuD, the work of Pan et al. [279] has highlighted the importance of knowing specifically which B. tabaci

110

Chapter 7: Final Discussion

cryptic species transmit not just viruses causing a particular disease, not just CLCuD. The knowledge on vector specificity remains meager. It is clear that much more effort is needed in this area since, as pointed out in the previous chapter, such knowledge can save a lot of wasted effort working towards resistance (for example) to cryptic species which are not an important part of the pathosystem. In this respect the host preferences of B. tabaci cryptic species are also important and under-investigated.

One aspect of the interaction of begomoviruses with their whitefly vector which has received almost no attention has been the genetics of the interaction. Although we know a lot about the virus side of the interaction, the coat protein has been shown to mediate those interactions [212] and amino acid sequences of the coat protein important in this interaction have been identified [420], we know nothing about the genetics of the insect that control transmission, although various proteins involved in the process have been identified but likely play a secondary role [439]. The most well understood geminivirus system is the transmission of Maize streak virus (MSV; genus Mastrevirus) with the vector leafhopper Cicadulina mbila. Studies with this system, conducted before the advent of molecular biology, by breeding non-transmitting races of the leafhopper, has shown transmission to be genetically controlled by a simple Mendelian sex-linked character. Despite this knowledge the gene or genes controlling MSV transmission have yet to be identified. The knowledge concerning transmission of begomoviruses, specifically that there are transmitting and non-transmitting cryptic species (which in some cases can be crossed) and the acquisition specificity occurs at the gut haemocoel and haemocoel/salivary gland boundaries, as well as the availability of sensitive detection methods for viruses in insects/insect tissues and the availability of genome sequences of various B. tabaci cryptic species [440, 441] should make it a relatively simple task to identify the vector proteins (and thus the genes) which control transmission. Efforts should be instigated, if they have not already, to identify such proteins in insects since these would be prime targets for developing resistance to begomoviruses and reducing losses in crops.

111

References

[1] M. LA, " Zoogeographical distribution of whiteﬂies," Curr. Topics Vect. Res, vol. 2, pp. 185–197, 1984.

[2] L. A. Mound and S. H. Halsey, Whitefly of the world. A systematic catalogue of the Aleyrodidae (Homoptera) with host plant and natural enemy data: John Wiley and Sons., 1978.

[3] A. Mohanty and A. Basu, "Effect of host plants and seasonal factors on intraspecific variations in pupal morphology of the whitefly vector, Bemisia tabaci (Genn.) (Homoptera: Aleyrodidae)," J. Entomol. Res., 1986.

[4] D. Brar, A. Aneja, J. Singh, and M. Mahal, "Biology of whitefly Bemisia tabaci (Gennadius) on American cotton Gossypium hirsutum Linnaeus," J. Insect Sci., vol. 18, pp. 48-59, 2005.

[5] J. Martin, "An identification guide to common whitefly pest species of the world (Homopt Aleyrodidae)," Intl. J. Pest. Manag., vol. 33, pp. 298-322, 1987.

[6] J. Martin and L. Mound, "An annotated check list of the world's whiteflies (Insecta: Hemiptera: Aleyrodidae). Lista de las moscas blancas del mundo (Insecta: Hemiptera: Aleyrodidae)," Zootaxa, vol. 1, pp. 1-84, 2007.

[7] J. H. Martin, "Whiteflies (Hemiptera: Aleyrodidae): Their systematic history and the resulting problems of conventional taxonomy, with special reference to descriptions of Aleyrodes proletella (Linnaeus, 1758) and Bemisia tabaci (Gennadius, 1889)," 2003.

[8] R. C. Rosell, J. E. Lichty, and J. K. Brown, "Ultrastructure of the mouthparts of adult sweetpotato whitefly, Bemisia tabaci Gennadius (Homoptera: Aleyrodidae)," Int. J. Insect. Morphol, Embryol., vol. 24, pp. 297-306, 1995.

[9] R. C. Rosell, I. Torres-Jerez, and J. K. Brown, "Tracing the geminivirus- whitefly transmission pathway by polymerase chain reaction in whitefly extracts, saliva, hemolymph, and honeydew," Phytopathol., vol. 89, pp. 239-46, Mar 1999.

[10] H. Czosnek, M. Ghanim, S. Morin, G. Rubinstein, V. Fridman, and M. Zeidan, "Whiteflies: vectors, and victims (?), of geminiviruses," Adv. Virus Res., vol. 57, pp. 291-322, 2001.

[11] M. Ghanim, R. C. Rosell, L. R. Campbell, H. Czosnek, J. K. Brown, and D. E. Ullman, "Digestive, salivary, and reproductive organs of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) B type," J. Morphol., vol. 248, pp. 22- 40, 2001.

112

References

[12] D. N. Byrne and T. S. Bellows, "Whitefly Biology," Annl. Rev. Entomol., vol. 36, pp. 431-457, 1991.

[13] H. S. Costa, J. K. Brown, and D. Byrne, "Host plant selection by the whitefly, Bemisia tabaci (Gennadius),(Hom., Aleyrodidae) under greenhouse conditions," J. Appl. Entomol., vol. 112, pp. 146-152, 1991.

[14] D. R. Jones, "Plant viruses transmitted by whiteflies," Eur. J. Plant Pathol., vol. 109, pp. 195-219, 2003.

[15] R. Blackman and M. Cahill, "The karyotype of Bemisia tabaci (Hemiptera: Aleyrodidae)," Bull. Entomol. Res., vol. 88, pp. 213-215, 1998.

[16] S. F, "Sex determination in the whitefly (Trialeurodes vaporariorum)," J. Morphol., vol. 34, pp. 267–297, 1920.

[17] B. Campbell, J. Steffen-Campbell, and R. Gill, "Origin and radiation of whiteflies: an initial molecular phylogenetic assessment," Bemisia: 1995, taxonomy, biology, damage, control and management, 1996.

[18] J. Brown, D. Frohlich, and R. Rosell, "The sweetpotato or silverleaf whiteflies: biotypes of Bemisia tabaci or a species complex?," Annl. Rev. Entomol., vol. 40, pp. 511-534, 1995.

[19] A. L. Quaintance and N. Banks, "Contributions toward a monograph of the American Aleurodidae," US Dept. Agric., Tech. Ser., Bureau. Entomol., vol. 8, pp. 9–64, 1900.

[20] J. H. Martin, The whitefly fauna of Australia (Sternorrhyncha: Aleyrodidae): a taxonomic account and identification guide: Commonwealth Scientific and Industrial Research Organisation, 1999.

[21] J. H. Martin, D. Mifsud, and C. Rapisarda, "The whiteflies (Hemiptera: Aleyrodidae) of Europe and the Mediterranean basin," Bull. Entomol. Res., vol. 90, pp. 407-448, 2000.

[22] A. Secker, I. Bedford, P. G. Markham, and M. de Williams, "Squash, a reliable field indicator for the presence of the B biotype of tobacco whitefly, Bemisia tabaci," in Brighton Crop Protection Conference: Pests & Diseases-1998: Volume 3: Proceedings of an International Conference, Brighton, UK, 16-19 November 1998., 1998, pp. 837-842.

[23] G. A. Evans, "Host plant list of the whiteflies (Aleyrodidae) of the world," USDA/Animal Plant Health Inspection Service (APHIS). Version, vol. 70611, 2007.

[24] G. Butler Jr and T. J. Henneberry, "Bemisia tabaci (Gennadius), a pest of cotton in the southwestern United States," United States Department of Agriculture, Economic Research Service1986.

[25] I. Bedford, R. Briddon, P. Markham, J. Brown, and R. Rosell, "Bemisia tabaci- biotype characterisation and the threat of this whitefly species to agriculture," 113

References

in Proceedings-Brighton Crop Protection Conference Pests and Diseases-1992 Brighton, November 23-26, 1992., 1992, pp. 1235-1240.

[26] E. Bayhan, M. Ulusoy, and J. Brown, "Effects of different cucurbit species and temperature on selected life history traits of the ‘B’biotype of Bemisia tabaci," Phytoparasitica, vol. 34, pp. 235-242, 2006.

[27] M. Johnson, N. Toscano, H. Reynolds, E. Sylvester, K. Kido, and E. Natwick, "Whiteflies cause problems for southern California growers [Bemisia tabaci, Trialeurodes abutilonea, Aleyrodes spiraeoides]," Calif. Agric., vol. 36, pp. 24– 26, 1982.

[28] J. C. v. Van Lenteren and L. Noldus, Whitefly-plant relationships: behavioural and ecological aspects, 1990.

[29] N. M. Gruenhagen and T. M. Perring, "Plant influences on silverleaf whitefly oviposition and development and the potential for enemy‐free space," Entomol. Exp. Appl., vol. 99, pp. 387-391, 2001.

[30] T.-X. Liu and P. A. Stansly, "Oviposition by Bemisia argentifolii (Homoptera: Aleyrodidae) on tomato: effects of leaf factors and insecticide residues," J. Econ. Entomol., vol. 88, pp. 992-997, 1995.

[31] M. Attique, M. Rafiq, A. Ghaffar, Z. Ahmad, and A. Mohyuddin, "Hosts of Bemisia tabaci (Genn.) (Homoptera: Aleyrodidae) in cotton areas of Punjab, Pakistan," Crop protection, vol. 22, pp. 715-720, 2003.

[32] Y. J. Cardoza, H. J. Mcauslane, and S. E. Webb, "Effect of leaf age and silverleaf symptoms on oviposition site selection and development of Bemisia argentifolii (Homoptera: Aleyrodidae) on zucchini," Environ. Entomol., vol. 29, pp. 220-225, 2000.

[33] A. Azab, M. Megahed, and D. El-Mirsawi, "On the biology of Bemisia tabaci (Genn.). hemiptera, Homoptera: Aleyrodidae," Soc. Entomol. Egypte Bull., 1972.

[34] D. Gerling, "The overwintering mode ofBemisia tabaci and its parasitoids in Israel," Phytoparasitica, vol. 12, p. 109, 1984.

[35] D. Chu, F. H. Wan, Y. J. Zhang, and J. K. Brown, "Change in the biotype composition of Bemisia tabaci in Shandong Province of China from 2005 to 2008," Environ. Entomol., vol. 39, pp. 1028-36, Jun 2010.

[36] D. Schuster, G. A. Evans, F. Bennett, P. A. Stansly, R. Jansson, G. Leibee, et al., "A survey of parasitoids of Bemisia spp. whiteflies in Florida, the Caribbean, and Central and South America," Int. J. Pest Manag., vol. 44, pp. 255-260, 1998.

[37] L. Lima, D. Návia, P. Inglis, and M. De Oliveira, "Survey of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) biotypes in Brazil using RAPD markers," Genet. Mol. Biol., vol. 23, pp. 781-785, 2000.

114

References

[38] M. Oliveira, T. Henneberry, and P. Anderson, "History, current status, and collaborative research projects for Bemisia tabaci," Crop Protection, vol. 20, pp. 709-723, 2001.

[39] J. G. Schmalstig and H. J. McAuslane, "Developmental anatomy of zucchini leaves with squash silverleaf disorder caused by the silverleaf whitefly," J. Am. Soc. Hort. Sci., vol. 126, pp. 544-554, 2001.

[40] D. Jiménez, R. Yokomi, R. Mayer, and J. Shapiro, "Cytology and physiology of silverleaf whitefly-induced squash silverleaf," Physiol. Mol. Plant Pathol., vol. 46, pp. 227-242, 1995.

[41] L. C. Otoidobiga, C. Vincent, and R. K. Stewart, "Susceptibility of field populations of adult Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Eretmocerus sp (Hymenoptera: Aphelinidae) to cotton insecticides in Burkina Faso (West Africa)," Pest Manag. Sci., vol. 59, pp. 97-106, 2003.

[42] M. Alegbejo, "Whitefly transmitted plant viruses in Nigeria," J. Sustain Agric., vol. 17, pp. 99-109, 2001.

[43] E. Moriones and J. Navas-Castillo, "Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide," Virus Res., vol. 71, pp. 123-134, 2000.

[44] L. Papayiannis, J. Brown, M. Hadjistylli, and N. Katis, "Note: Bemisia tabaci biotype B associated with tomato yellow leaf curl disease epidemics on rhodes Island, Greece," Phytoparasitica, vol. 36, pp. 20-22, 2008.

[45] C. Misra and K. Lamba, "The cotton whitefly (Bemisia gossypiperda n. sp,) Agric," Res. Inst. Pusa, p. 7, 1929.

[46] M. A. Husain and K. N. Trehan, "Observations on the life-history, bionomics and control of the white-fly of cotton (Bemisia gossypiperda M. & L.)," Indian J. Agric. Sci., vol. 3, pp. 701-753, 1933.

[47] K. Eveleens, "Cotton-insect control in the Sudan Gezira: analysis of a crisis," Crop Prot., vol. 2, pp. 273-287, 1983.

[48] V. Dittrich, S. Hassan, and G. Ernst, "Sudanese cotton and the whitefly: a case study of the emergence of a new primary pest," Crop Prot., vol. 4, pp. 161-176, 1985.

[49] V. Dittrich, G. H. Ernst, O. Ruesch, and S. Uk, "Resistance mechanisms in sweetpotato whitefly (Homoptera: Aleyrodidae) populations from Sudan, Turkey, Guatemala, and Nicaragua," J. Econ. Entomol., vol. 83, pp. 1665-1670, 1990.

[50] G. Konate, N. Barro, D. Fargette, M. Swanson, and B. Harrison, "Occurrence of whitefly‐transmitted geminiviruses in crops in Burkina Faso, and their serological detection and differentiation," Ann. Appl. Biol., vol. 126, pp. 121- 129, 1995.

115

References

[51] J. Price, D. Schuster, and D. Short, "Managing sweetpotato whitefly," Greenhouse Grower, vol. 35, pp. 55-57, 1987.

[52] D. Maynard and D. Cantliffe, "Squash silverleaf and tomato ripening: new vegetable disorders in Florida," University of Florida, vegetable fact sheet VC- 37, 1989.

[53] P. Ellsworth, R. Tronstad, J. Leser, P. Goodell, L. Godfrey, T. Henneberry, et al., "Sticky cotton sources and solutions," IPM Series, 1999.

[54] R. Gonzalez, G. Goldman, E. Natwick, H. Rosenberg, J. Grieshop, S. Sutter, et al., "Whitefly invasion in Imperial Valley costs growers, workers millions in losses," Calif .Agri., vol. 46, pp. 7-8, 1992.

[55] J. Medina-Esparza and R. Leon-Paul, "Evaluation of pesticides for the control of whitefly on cotton," INIFAP-CIRNO-CEMEXI, Mexicali Valley-1993. In Proceedings of the International Pest Work Committee, Mazatlan, Mexico1994.

[56] C. Silva-Sanchez, "Behavior of the silverleaf whitefly (Bemisia argentifolii B&P) in the cotton crop on the coast of Hermosillo, Sonora," in Proceedings of the International Cotton Pest Work Committee, 1997, p. 34.

[57] A. Dávila, "La mosca blanca (Homoptera: Aleyrodidae) en Guatemala," VII Taller Latinoamericano y del Caribe Sobre Moscas-Blancas y Geminivirus, pp. 125-126, 1999.

[58] M. M. Viscarret, E. Botto, and A. Polaszek, "Whiteflies (Hemiptera: Aleyrodidae) of economic importance and their natural enemies (Hymenoptera: Aphelinidae, Signiphoridae) in Argentina," Revista Chilena de Entomología, vol. 26, pp. 5-11, 2000.

[59] C. Quintero, C. Cardona Mejía, D. Ramírez, and N. C. Jiménez, "Primer registro del biotipo B de Bemisia tabaci (Homoptera: Aleyrodidae) en Colombia= First report of the B biotype of Bemisia tabaci (Homoptera: Aleyrodidae) in Colombia," Revista Colombiana de Entomología., vol. 1, pp. 23-28, 1998.

[60] F. J. Morales and P. K. Anderson, "The emergence and dissemination of whitefly-transmitted geminiviruses in Latin America," Arch. Virol., vol. 146, pp. 415-441, 2001.

[61] R. Traboulsi, "Bemisia tabaci: a report on its pest status with particular reference to the Near East," FAO Plant Protection Bulletin, vol. 42, pp. 33-58, 1994.

[62] X. Rumei, "occurrence and distribution of Bemisia in China," Bemisia: 1995, taxonomy, biology, damage, control and management, 1996.

[63] R. V. Gunning, F. J. Byrne, B. D. Cone, M. I. Connelly, K. Hergstrom, and A. L. Devonshire, "First Report of B‐Biotype Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) in Australia," Austral. Entomol., vol. 34, pp. 116- 116, 1995.

116

References

[64] R. V. Gunning, F. J. Byrne, and A. L. Devonshire, "Electrophoretic Analysis of Non‐B and B‐Biotype Bemisia tabaci (Gennaduis) (Hemiptera: Aleyrodidae) in Australia," Austral. Entomol., vol. 36, pp. 245-250, 1997.

[65] B. Fransmann, D. Lea, and P. De Barro, "The distribution and parasitism of biotypes of the whitefly Bemisia tabaci in cotton areas of Queensland," in Proceedings of the Ninth Australian Cotton Conference, 1998, pp. 461-464.

[66] P. J. De Barro, W. Liebregts, and M. Carver, "Distribution and identity of biotypes of Bemisia tabaci (Gennadius)(Hemiptera: Aleyrodidae) in member countries of the Secretariat of the Pacific Community," Austral. Entomol., vol. 37, pp. 214-218, 1998.

[67] A. Costa and L. Russell, "Failure of Bemisia tabaci to breed on cassava plants in Brazil (Homoptera: Aleyrodidae)," Cienc. Cult., vol. 27, pp. 388-390, 1975.

[68] P. Gennadius, "Disease of tobacco plantations in the Trikonia," The aleurodid of tobacco. Ellenike Georgia, vol. 5, pp. 1-3, 1889.

[69] R. Takahashi, "Some Aleyrodidae, Aphididae, Coccidae (Homoptera), and Thysanoptera from Micronesia," Tenthredo= Acta Entomologica. Takeuchi Entomological Laboratory, vol. 1, pp. 109-120, 1936.

[70] R. Gill, "The morphology of whiteflies," Whiteflies: their bionomics, pest status and management, pp. 13-46, 1990.

[71] L. M. Russell, " Synonyms of Bemisia tabaci (Gennadius) (Homoptera, Aleyrodidae)," Bull. Brooklyn Entomol., vol. 52, pp. 122-123, 1957.

[72] J. Bird, "A whitefly-transmitted mosaic of Jatropha gossypifolia," 1957.

[73] I. Robertson, "The whitefly, Bemisia tabaci (Gennadius) as a vector of African cassava mosaic virus at the Kenya coast and ways in which the yield losses in cassava, Manihot esculenta Crantz caused by the virus can be reduced," Intl. J. Trop. Insect Sci., vol. 8, pp. 797-801, 1987.

[74] M. Claridge, H. Dawah, and M. Wilson, "Species in insect herbivores and parasitoids-sibling species, host races and biotypes," 1997.

[75] H. Delatte, B. Reynaud, M. Granier, L. Thornary, J.-M. Lett, R. Goldbach, et al., "A new silverleaf-inducing biotype Ms of Bemisia tabaci (Hemiptera: Aleyrodidae) indigenous to the islands of the south-west Indian Ocean," Bull. Entomol. Res., vol. 95, pp. 29-35, 2005.

[76] J. K. Brown, "Molecular markers for the identification and global tracking of whitefly vector–Begomovirus complexes," Virus Res., vol. 71, pp. 233-260, 2001.

[77] T. M. gPerring, A. D. Cooper, R. J. Rodriguez, C. A. Farrar, and T. S. Bellows, "Identification of a whitefly species by genomic and behavioral studies," Science, vol. 259, pp. 74-77, 1993.

117

References

[78] D. Chu, Y. Zhang, B. Cong, B. Xu, and Q. Wu, "Developing sequence characterized amplified regions (SCARs) to identify {\sl Bemisia tabaci} and {\sl Trialeurodes vaporariorum}," Plant Prot., vol. 30, pp. 27-30, 2004.

[79] W. H. Ma, X. C. Li, T. J. Dennehy, C. L. Lei, M. Wang, B. A. Degain, et al., "Utility of MtCOI polymerase chain reaction‐restriction fragment length polymorphism in differentiating between Q and B whitefly Bemisia tabaci biotypes," Insect Sci., vol. 16, pp. 107-114, 2009.

[80] M. T. Cervera, J. A. Cabezas, B. Simon, J. M. Martinez-Zapater, F. Beitia, and J. L. Cenis, "Genetic relationships among biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae) based on AFLP analysis," Bull. Entomol. Res., vol. 90, pp. 391-6, Oct 2000.

[81] D. R. Frohlich, I. Torres-Jerez, I. D. Bedford, P. G. Markham, and J. K. Brown, "A phylogeographical analysis of the Bemisia tabaci species complex based on mitochondrial DNA markers," Mol. Ecol., vol. 8, pp. 1683–1691, 1999.

[82] A. Dinsdale, L. Cook, C. Riginos, Y. M. Buckley, and P. D. Barro, "Refined Global Analysis of Bemisia tabaci (Hemiptera:Sternorrhyncha:Aleyrodoidea: Aleyrodidae) Mitochondrial Cytochrome Oxidase 1 to Identify Species Level Genetic Boundaries," Ann. Entomol. Soc. Am., vol. 103, pp. 196-208, 2010.

[83] L. M. Boykin, R. G. Shatters, Jr., R. C. Rosell, C. L. McKenzie, R. A. Bagnall, P. De Barro, et al., "Global relationships of Bemisia tabaci (Hemiptera: Aleyrodidae) revealed using Bayesian analysis of mitochondrial COI DNA sequences," Mol. Phylogenet. Evol., vol. 44, pp. 1306-19, Sep 2007.

[84] W. Lee, J. Park, G.-S. Lee, S. Lee, and S.-I. Akimoto, "Taxonomic status of the Bemisia tabaci complex (Hemiptera: Aleyrodidae) and reassessment of the number of its constituent species," PLoS ONE, vol. 8, p. e63817, 2013.

[85] S.-s. LIU, J. Colvin, and P. J. De Barro, "Species concepts as applied to the whitefly Bemisia tabaci systematics: how many species are there?," J. Integr. Agric., vol. 11, pp. 176-186, 2012.

[86] P. J. De Barro, F. Driver, J. W. Trueman, and J. Curran, "Phylogenetic relationships of world populations of Bemisia tabaci (Gennadius) using ribosomal ITS1," Mol. Phylogenet. Evol., vol. 16, pp. 29-36, Jul 2000.

[87] P. De Barro, "Genetic structure of the whitefly Bemisia tabaci in the Asia– Pacific region revealed using microsatellite markers," Mol. Ecol., vol. 14, pp. 3695-3718, 2005.

[88] H.-L. Wang, J. Yang, L. M. Boykin, Q.-Y. Zhao, Y.-J. Wang, S.-S. Liu, et al., "Developing conversed microsatellite markers and their implications in evolutionary analysis of the Bemisia tabaci complex," Sci. Rep., vol. 4, p. 6351, 2014.

[89] P. J. De Barro, "The Bemisia tabaci Species Complex: Questions to Guide Future Research," J. Integr. Agric., vol. 11, pp. 187–196, 2012.

118

References

[90] P. De Barro and M. Z. Ahmed, "Genetic networking of the Bemisia tabaci cryptic species complex reveals pattern of biological invasions," PLoS One, vol. 6, p. e25579, 2011.

[91] S.-s. Liu, J. Colvin, and P. J. De Barro, "Species Concepts as Applied to the Whitefly Bemisia tabaci Systematics: How Many Species Are There?," J. Integr. Agric., vol. 11, pp. 176–186, 2012.

[92] W. T. Tay, G. A. Evans, L. M. Boykin, and P. J. De Barro, "Will the real Bemisia tabaci please stand up?," PLoS One, vol. 7, p. e50550, 2012.

[93] J. M. Marubayashi, A. Kliot, V. A. Yuki, J. A. Rezende, R. Krause-Sakate, M. A. Pavan, et al., "Diversity and localization of bacterial endosymbionts from whitefly species collected in Brazil," PLoS One, vol. 9, p. 108363, 2014.

[94] F. Barbosa Lda, J. M. Marubayashi, B. R. De Marchi, V. A. Yuki, M. A. Pavan, E. Moriones, et al., "Indigenous American species of the Bemisia tabaci complex are still widespread in the Americas," Pest Manag. Sci., vol. 70, pp. 1440-5, Oct 2014.

[95] S. Firdaus, B. Vosman, N. Hidayati, E. D. Jaya Supena, R. G.F. Visser, and A. W. van Heusden, "The Bemisia tabaci species complex: Additions from different parts of the world," Insect Sci., vol. 20, pp. 723–733, 2013.

[96] S. Ghosh, S. Bouvaine, and M. N. Maruthi, "Prevalence and genetic diversity of endosymbiotic bacteria infecting cassava whiteflies in Africa," BMC Microbiol., vol. 15, p. 93, 2015.

[97] J. P. Legg, P. Sseruwagi, S. Boniface, G. Okao-Okuja, R. Shirima, S. Bigirimana, et al., "Spatio-temporal patterns of genetic change amongst populations of cassava Bemisia tabaci whiteflies driving virus pandemics in East and Central Africa," Virus Res., vol. 186, pp. 61-75, 2014.

[98] Esterhuizen LL, Mabasa KG, van Heerden SW, Czosnek H, Brown JK, van Heerden H, et al., "Genetic identification of members of the Bemisia tabaci cryptic species complex from South Africa reveals native and introduced haplotypes," J. Appl. Entomol., vol. 137, pp. 122–135, 2013.

[99] H. Mugerwa, S. Seal, H.-L. Wang, M. V. Patel, R. Kabaalu, C. A. Omongo, et al., "African ancestry of New World, Bemisia tabaci-whitefly species," Sci. Rep., vol. 8, p. 2734, 2018.

[100] P. J. De Barro, S. S. Liu, L. M. Boykin, and A. B. Dinsdale, "Bemisia tabaci: a statement of species status," Annu. Rev. Entomol., vol. 56, pp. 1-19, 2011.

[101] J. Hu, P. De Barro, H. Zhao, J. Wang, F. Nardi, and S. S. Liu, "An Extensive Field Survey Combined with a Phylogenetic Analysis Reveals Rapid and Widespread Invasion of Two Alien Whiteflies in China," PLoS One, vol. 6, 2011.

[102] V. Alemandri, P. De Barro, N. Bejerman, E. B. Arguello Caro, A. D. Dumon, M. F. Mattio, et al., "Species within the Bemisia tabaci (Hemiptera: 119

References

Aleyrodidae) complex in soybean and bean crops in Argentina," J. Econ. Entomol., vol. 105, pp. 48-53, Feb 2012.

[103] L. M. Boykin, C. D. Bell, G. Evans, I. Small, and P. J. De Barro, "Is agriculture driving the diversification of the Bemisia tabaci species complex (Hemiptera: Sternorrhyncha: Aleyrodidae)?: Dating, diversification and biogeographic evidence revealed," BMC Evol. Biol., vol. 13, p. 228, 2013.

[104] M. Masood, I. Amin, I. Hassan, S. Mansoor, J. K. Brown, and R. W. Briddon, "Diversity and Distribution of Cryptic Species of the Bemisia tabaci (Hemiptera: Aleyrodidae) complex in Pakistan," J. Econ. Entomol., vol. 110, pp. 2295-2300, 2017.

[105] S.-S. Liu, P. De Barro, J. Xu, J.-B. Luan, L.-S. Zang, Y.-M. Ruan, et al., "Asymmetric mating interactions drive widespread invasion and displacement in a whitefly," Science, vol. 318, pp. 1769-1772, 2007.

[106] B. C. Campbell, "Congruent evolution between whiteflies (Homoptera: Aleyrodidae) and their bacterial endosymbionts based on respective 18S and 16S rDNAs," Curr. Microbiol., vol. 26, pp. 129-32, Mar 1993.

[107] D. Santos-Garcia, C. Vargas-Chavez, A. Moya, A. Latorre, and F. J. Silva, "Genome evolution in the primary endosymbiont of whiteflies sheds light on their divergence," Genom. Biol. Evol., vol. 7, pp. 873-88, Mar 2015.

[108] P. Baumann, "Biology bacteriocyte-associated endosymbionts of plant sap- sucking insects," Annu Rev Microbiol, vol. 59, pp. 155-89, 2005.

[109] R. C. Rosell, J. L. Blackmer, H. Czosnek, and M. Inbar, "Mutualistic and dependent relationships with other organisms," in Bemisia: Bionomics and management of a global pest, ed: Springer, 2009, pp. 161-183.

[110] L. Baumann, M. L. Thao, C. J. Funk, B. W. Falk, J. C. Ng, and P. Baumann, "Sequence analysis of DNA fragments from the genome of the primary endosymbiont of the whitefly Bemisia tabaci," Curr. Microbiol., vol. 48, pp. 77- 81, Jan 2004.

[111] H. Costa, D. Ullman, M. Johnson, and B. Tabashnik, "Squash silverleaf symptoms induced by immature, but not adult, Bemisia tabaci," Phytopathol., vol. 83, pp. 763-763, 1993.

[112] H. Costa, D. Westcot, D. Ullman, R. Rosell, J. Brown, and M. Johnson, "Morphological variation in Bemisia endosymbionts," Protoplasma, vol. 189, pp. 194-202, 1995.

[113] T. Szklarzewicz and A. Moskal, "Ultrastructure, distribution, and transmission of endosymbionts in the whitefly Aleurochiton aceris Modeer (Insecta,Hemiptera,Aleyrodinea). ," Protoplasma, vol. 218, pp. 45-53, 2001.

[114] H. Costa, D. Westcot, D. Ullman, R. Rosell, J. Brown, and M. Johnson, "Virus- like particles in the mycetocytes of the sweetpotato whitefly, Bemisia tabaci (Homoptera, Aleyrodidae)," J. Invertebr. Pathol., vol. 67, pp. 183-186, 1996. 120

References

[115] M. Ghanim, S. Morin, and H. Czosnek, "Rate of Tomato yellow leaf curl virus translocation in the circulative transmission pathway of its vector, the whitefly Bemisia tabaci," Phytopathol., vol. 91, pp. 188-196, 2001.

[116] N. A. Moran, J. P. McCutcheon, and A. Nakabachi, "Genomics and evolution of heritable bacterial symbionts," Annl. Rev. Genet., vol. 42, pp. 165-190, 2008.

[117] A. Moya, J. Peretó, R. Gil, and A. Latorre, "Learning how to live together: genomic insights into prokaryote–animal symbioses," Nat. Rev. Genet., vol. 9, p. 218, 2008.

[118] Z. F. Jiang, F. Xia, K. W. Johnson, C. D. Brown, E. Bartom, J. H. Tuteja, et al., "Comparison of the genome sequences of "Candidatus Portiera aleyrodidarum" primary endosymbionts of the whitefly Bemisia tabaci B and Q biotypes," Appl. Environ. Microbiol., vol. 79, pp. 1757-9, Mar 2013.

[119] D. Santos-Garcia, P.-A. Farnier, F. Beitia, E. Zchori-Fein, F. Vavre, L. Mouton, et al., "Complete genome sequence of “Candidatus Portiera aleyrodidarum” BT-QVLC, an obligate symbiont that supplies amino acids and carotenoids to Bemisia tabaci," J. Bacteriol., vol. 194, pp. 6654-6655, 2012.

[120] D. B. Sloan and N. A. Moran, "Endosymbiotic bacteria as a source of carotenoids in whiteflies," Biology letters, vol. 8, pp. 986–989, 2012.

[121] J. P. McCutcheon and N. A. Moran, "Extreme genome reduction in symbiotic bacteria," Nat. Rev. Microbiol., vol. 10, p. 13, 2012.

[122] S. Sintupachee, J. Milne, S. Poonchaisri, V. Baimai, and P. Kittayapong, "Closely related Wolbachia strains within the pumpkin arthropod community and the potential for horizontal transmission via the plant," Microbial. Ecol., vol. 51, pp. 294-301, 2006.

[123] E. Chiel, E. Zchori-Fein, M. Inbar, Y. Gottlieb, T. Adachi-Hagimori, S. E. Kelly, et al., "Almost there: transmission routes of bacterial symbionts between trophic levels," PLoS One, vol. 4, p. e4767, 2009.

[124] X. L. Bing, J. Yang, E. Zchori-Fein, X. W. Wang, and S. S. Liu, "Characterization of a newly discovered symbiont of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae)," Appl. Environ. Microbiol., vol. 79, pp. 569- 75, 2013.

[125] Y. Gottlieb, M. Ghanim, G. Gueguen, S. Kontsedalov, F. Vavre, F. Fleury, et al., "Inherited intracellular ecosystem: symbiotic bacteria share bacteriocytes in whiteflies," FASEB J., vol. 22, pp. 2591-9, Jul 2008.

[126] E. Chiel, Y. Gottlieb, E. Zchori-Fein, N. Mozes-Daube, N. Katzir, M. Inbar, et al., "Biotype-dependent secondary symbiont communities in sympatric populations of Bemisia tabaci," Bull. Entomol. Res., vol. 97, pp. 407-13, Aug 2007.

121

References

[127] K. M. Oliver, J. A. Russell, N. A. Moran, and M. S. Hunter, "Facultative bacterial symbionts in Aphids confer resistance to parasitic wasps," Proc. National Acad. Sci., vol. 100, pp. 1803-1807, 2003.

[128] D. Chu, C. Gao, P. De Barro, Y. Zhang, F. Wan, and I. Khan, "Further insights into the strange role of bacterial endosymbionts in whitefly, Bemisia tabaci: Comparison of secondary symbionts from biotypes B and Q in China," Bull. Entomol. Res., vol. 101, pp. 477-486, 2011.

[129] Y. Gottlieb, E. Zchori-Fein, N. Mozes-Daube, S. Kontsedalov, M. Skaljac, M. Brumin, et al., "The transmission efficiency of tomato yellow leaf curl virus by the whitefly Bemisia tabaci is correlated with the presence of a specific symbiotic bacterium species," J. Virol., vol. 84, pp. 9310-9317, 2010.

[130] Q. Rao, S. Wang, Y. L. Su, X. L. Bing, S. S. Liu, and X. W. Wang, "Draft genome sequence of "Candidatus Hamiltonella defensa," an endosymbiont of the whitefly Bemisia tabaci," J. Bacteriol., vol. 194, p. 3558, Jul 2012.

[131] Q. Su, K. M. Oliver, H. Pan, X. Jiao, B. Liu, W. Xie, et al., "Facultative symbiont Hamiltonella confers benefits to Bemisia tabaci (Hemiptera: Aleyrodidae), an invasive agricultural pest worldwide," Environ. Entomol., vol. 42, pp. 1265-71, 2013.

[132] Q. Su, W. Xie, S. Wang, Q. Wu, B. Liu, Y. Fang, et al., "The endosymbiont Hamiltonella increases the growth rate of its host Bemisia tabaci during periods of nutritional stress," PLoS One, vol. 9, p. e89002, 2014.

[133] O. Duron, D. Bouchon, S. Boutin, L. Bellamy, L. Zhou, J. Engelstädter, et al., "The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone," BMC Biol., vol. 6, p. 27, 2008.

[134] V. S. Rana, S. T. Singh, N. G. Priya, J. Kumar, and R. Rajagopal, "Arsenophonus GroEL interacts with CLCuV and is localized in midgut and salivary gland of whitefly B. tabaci," PLoS One, vol. 7, p. e42168, 2012.

[135] X.-L. Bing, Y.-M. Ruan, Q. Rao, X.-W. Wang, and S.-S. Liu, "Diversity of secondary endosymbionts among different putative species of the whitefly Bemisia tabaci," Insect. Sci., vol. 20, pp. 194–206, 2013.

[136] H. S. Raina, V. Rawal, S. Singh, G. Daimei, M. Shakarad, and R. Rajagopal, "Elimination of Arsenophonus and decrease in the bacterial symbionts diversity by antibiotic treatment leads to increase in fitness of whitefly, Bemisia tabaci," Infect. Genet. Evol., vol. 32, pp. 224-30, 2015.

[137] R. L. Gherna, J. H. Werren, W. Weisburg, R. Cote, C. R. Woese, L. Mandelco, et al., "Arsenophonus nasoniae gen. nov., sp. nov., the causative agent of the son-killer trait in the parasitic wasp Nasonia vitripennis," Int. J. Syst. Evol. Microbiol., vol. 41, pp. 563-565, 1991.

[138] E. Zchori‐Fein and S. J. Perlman, "Distribution of the bacterial symbiont Cardinium in arthropods," Mol. Ecol., vol. 13, pp. 2009-2016, 2004.

122

References

[139] M. Gruwell, J. Wu, and B. Normark, "Diversity and phylogeny of Cardinium (Bacteroidetes) in armored scale insects (Hemiptera: Diaspididae)," Annu. Entomol. Soc. Am., vol. 102, pp. 1050-1061, 2009.

[140] J. White, S. Kelly, S. Cockburn, S. Perlman, and M. Hunter, "Endosymbiont costs and benefits in a parasitoid infected with both Wolbachia and Cardinium," Heredity, vol. 106, p. 585, 2011.

[141] N. Lo, M. Casiraghi, E. Salati, C. Bazzocchi, and C. Bandi, "How many Wolbachia supergroups exist?," Mol. Biol. Evol., vol. 19, pp. 341-346, 2002.

[142] Y. Nakamura, S. Kawai, F. Yukuhiro, S. Ito, T. Gotoh, R. Kisimoto, et al., "Prevalence of Cardinium bacteria in planthoppers and spider mites and taxonomic revision of “Candidatus Cardinium hertigii” based on detection of a new Cardinium group from biting midges," Appl. Environ. Microbiol., vol. 75, pp. 6757-6763, 2009.

[143] A. Edlund, K. Ek, M. Breitholtz, and E. Gorokhova, "Antibiotic-induced change of bacterial communities associated with the copepod Nitocra spinipes," PLoS One, vol. 7, p. e33107, 2012.

[144] M. P. McLeod, X. Qin, S. E. Karpathy, J. Gioia, S. K. Highlander, G. E. Fox, et al., "Complete genome sequence of Rickettsia typhi and comparison with sequences of other rickettsiae," J. Bacteriol., vol. 186, pp. 5842-5855, 2004.

[145] Y. Gottlieb, M. Ghanim, E. Chiel, D. Gerling, V. Portnoy, S. Steinberg, et al., "Identification and localization of a Rickettsia sp. in Bemisia tabaci (Homoptera: Aleyrodidae)," Appl. Environ. Microbiol., vol. 72, pp. 3646-52, May 2006.

[146] A. G. Himler, T. Adachi-Hagimori, J. E. Bergen, A. Kozuch, S. E. Kelly, B. E. Tabashnik, et al., "Rapid spread of a bacterial symbiont in an invasive whitefly is driven by fitness benefits and female bias," Science, vol. 332, pp. 254-6, Apr 8 2011.

[147] E. T. Lawson, T. A. Mousseau, R. Klaper, M. D. Hunter, and J. H. Werren, "Rickettsia associated with male-killing in a buprestid beetle," Heredity, vol. 86, p. 497, 2001.

[148] S. Kontsedalov, E. Zchori-Fein, E. Chiel, Y. Gottlieb, M. Inbar, and M. Ghanim, "The presence of Rickettsia is associated with increased susceptibility of Bemisia tabaci (Homoptera: Aleyrodidae) to insecticides," Pest. Manag. Sci., vol. 64, pp. 789–792, 2008.

[149] M. Brumin, S. Kontsedalov, and M. Ghanim, "Rickettsia influences thermotolerance in the whitefly Bemisia tabaci B biotype," Insect Sci., vol. 18, pp. 57-66, 2011.

[150] K. Hilgenboecker, P. Hammerstein, P. Schlattmann, A. Telschow, and J. H. Werren, "How many species are infected with Wolbachia?–a statistical analysis of current data," FEMS Microbiol. lett., vol. 281, pp. 215-220, 2008.

123

References

[151] J. H. Werren, L. Baldo, and M. E. Clark, "Wolbachia: master manipulators of invertebrate biology," Nat. Rev. Microbiol., vol. 6, pp. 741-51, Oct 2008.

[152] T. Hosokawa, R. Koga, Y. Kikuchi, X.-Y. Meng, and T. Fukatsu, "Wolbachia as a bacteriocyte-associated nutritional mutualist," Proc. Natl. Acad. Sci., vol. 107, pp. 769-774, 2010.

[153] W. Kaiser, E. Huguet, J. Casas, C. Commin, and D. Giron, "Plant green-island phenotype induced by leaf-miners is mediated by bacterial symbionts," Proc. R. Soc. Lond. [Biol], p. rspb20100214, 2010.

[154] L. M. Hedges, J. C. Brownlie, S. L. O'neill, and K. N. Johnson, "Wolbachia and virus protection in insects," Science, vol. 322, pp. 702-702, 2008.

[155] R. L. Glaser and M. A. Meola, "The native Wolbachia endosymbionts of Drosophila melanogaster and Culex quinquefasciatus increase host resistance to West Nile virus infection," PloS One, vol. 5, p. e11977, 2010.

[156] L. A. Moreira, I. Iturbe-Ormaetxe, J. A. Jeffery, G. Lu, A. T. Pyke, L. M. Hedges, et al., "A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium," Cell, vol. 139, pp. 1268-1278, 2009.

[157] L. Teixeira, Á. Ferreira, and M. Ashburner, "The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster," PLoS Biol., vol. 6, p. e1000002, 2008.

[158] E. Zchori-Fein and J. K. Brown, "Diversity of Prokaryotes Associated with Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae)," Ann. Entomol. Soc. Am., vol. 95, 2002.

[159] P. De Barro and P. Hart, "Mating interactions between two biotypes of the whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae) in Australia," Bull. Entomol. Res., vol. 90, pp. 103-112, 2000.

[160] X. Xue, S. J. Li, M. Z. Ahmed, P. J. De Barro, S. X. Ren, and B. L. Qiu, "Inactivation of Wolbachia reveals its biological roles in whitefly host," PLoS One, vol. 7, p. e48148, 2012.

[161] K. D. Everett, M. Thao, M. Horn, G. E. Dyszynski, and P. Baumann, "Novel chlamydiae in whiteflies and scale insects: endosymbionts 'Candidatus Fritschea bemisiae' strain Falk and 'Candidatus Fritschea eriococci' strain Elm," Int. J. Syst. Evol. Microbiol., vol. 55, pp. 1581-7, Jul 2005.

[162] J. Navas-Castillo, E. Fiallo-Olivé, and S. Sánchez-Campos, "Emerging virus diseases transmitted by whiteflies," Annu. Rev. Phytopathol., vol. 49, pp. 219- 248, 2011.

[163] L. Nault, "Arthropod transmission of plant viruses: a new synthesis," Annu. Entomol. Soc. Am., vol. 90, pp. 521-541, 1997.

124

References

[164] S. A. Hogenhout, E.-D. Ammar, A. E. Whitfield, and M. G. Redinbaugh, "Insect vector interactions with persistently transmitted viruses," Annu. Rev. Phytopathol., vol. 46, pp. 327-359, 2008.

[165] H. Czosnek, A. Hariton-Shalev, I. Sobol, R. Gorovits, and M. Ghanim, "The Incredible Journey of Begomoviruses in Their Whitefly Vector," Viruses, vol. 9, p. 273, 2017.

[166] M. Ghanim, "A review of the mechanisms and components that determine the transmission efficiency of Tomato yellow leaf curl virus (Geminiviridae; Begomovirus) by its whitefly vector," Virus Res., vol. 186, pp. 47-54, 2014.

[167] S. Gray, M. Cilia, and M. Ghanim, "Circulative,“nonpropagative” virus transmission: an orchestra of virus-, insect-, and plant-derived instruments," in Adv. Virus. Res., vol. 89, ed: Elsevier, 2014, pp. 141-199.

[168] L. Hanley-Bowdoin, E. R. Bejarano, D. Robertson, and S. Mansoor, "Geminiviruses: masters at redirecting and reprogramming plant processes," Nat. Rev. Microbiol., vol. 11, pp. 777-788, 2013.

[169] C. Gutierrez, "Geminivirus DNA replication," Cellular and Molecular Life Sciences CMLS, vol. 56, pp. 313-329, 1999.

[170] A. T. Lima, R. R. Sobrinho, J. Gonzalez-Aguilera, C. S. Rocha, S. J. Silva, C. A. Xavier, et al., "Synonymous site variation due to recombination explains higher genetic variability in begomovirus populations infecting non-cultivated hosts," J. Gen. Virol., vol. 94, pp. 418-431, 2013.

[171] B. Böttcher, S. Unseld, H. Ceulemans, R. B. Russell, and H. Jeske, "Geminate structures of African cassava mosaic virus," J. Virol., vol. 78, pp. 6758-6765, 2004.

[172] A. K. Inoue-Nagata, M. F. Lima, and R. L. Gilbertson, "A review of geminivirus diseases in vegetables and other crops in Brazil: current status and approaches for management," Horticultura Brasileira, vol. 34, pp. 8-18, 2016.

[173] A. Anabestani, S. A. A. Behjatnia, K. Izadpanah, S. Tabein, and G. P. Accotto, "Seed Transmission of Beet Curly Top Virus and Beet Curly Top Iran Virus in a Local Cultivar of Petunia in Iran," Viruses, vol. 9, p. 299, 2017.

[174] E.-J. Kil, J. Park, H.-S. Choi, C.-S. Kim, and S. Lee, "Seed transmission of Tomato yellow leaf curl virus in white soybean (Glycine max)," Plant. pathol. J., vol. 33, p. 424, 2017.

[175] E.-J. Kil, J. Park, E.-Y. Choi, H.-S. Byun, K.-Y. Lee, C. G. An, et al., "Seed transmission of Tomato yellow leaf curl virus in sweet pepper (Capsicum annuum)," Eur. J. Plant Pathol., vol. 150, pp. 759-764, 2018.

[176] J. Kim, E. J. Kil, S. Kim, H. Seo, H. S. Byun, J. Park, et al., "Seed transmission of Sweet potato leaf curl virus in sweet potato (Ipomoea batatas)," Plant .Pathol., vol. 64, pp. 1284-1291, 2015.

125

References

[177] S. V. Kothandaraman, A. Devadason, and M. V. Ganesan, "Seed-borne nature of a begomovirus, Mung bean yellow mosaic virus in black gram," Appl. Microbiol. Biotechnol., vol. 100, pp. 1925-1933, 2016.

[178] C. Clark and M. Hoy, "Effects of common viruses on yield and quality of Beauregard sweetpotato in Louisiana," Plant Disease, vol. 90, pp. 83-88, 2006.

[179] R. A. Valverde, C. A. Clark, and J. P. Valkonen, "Viruses and virus disease complexes of sweetpotato," Plant Viruses, vol. 1, pp. 116-126, 2007.

[180] J. Stanley, "Geminiviruses: plant viral vectors," Curr. Opin. Genet. develop., vol. 3, pp. 91-96, 1993.

[181] F. M. Zerbini, R. W. Briddon, A. Idris, D. P. Martin, E. Moriones, J. Navas- Castillo, et al., "ICTV virus taxonomy profile: geminiviridae," J. Gen. Virol., vol. 98, pp. 131-133, 2017.

[182] J. Guo, X. Lai, J. Li, J. Yue, S. Zhang, Y. Li, et al., "First report on citrus chlorotic dwarf associated virus on lemon in Dehong prefecture, Yunnan, China," Plant Disease, vol. 99, pp. 1287-1287, 2015.

[183] G. Loconsole, P. Saldarelli, H. Doddapaneni, V. Savino, G. P. Martelli, and M. Saponari, "Identification of a single-stranded DNA virus associated with citrus chlorotic dwarf disease, a new member in the family Geminiviridae," Virol., vol. 432, pp. 162-172, 2012.

[184] Q.-Y. Lu, Z.-J. Wu, Z.-S. Xia, and L.-H. Xie, "Complete genome sequence of a novel monopartite geminivirus identified in mulberry (Morus alba L.)," Arch. Virol., vol. 160, pp. 2135-2138, 2015.

[185] Y. Ma, B. Navarro, Z. Zhang, M. Lu, X. Zhou, S. Chi, et al., "Identification and molecular characterization of a novel monopartite geminivirus associated with mulberry mosaic dwarf disease," J. Gen. Virol., vol. 96, pp. 2421-2434, 2015.

[186] E. Rybicki, "A phylogenetic and evolutionary justification for three genera of Geminiviridae," Arch. Virol., vol. 139, pp. 49-77, 1994.

[187] M. Padidam, R. N. Beachy, and C. M. Fauquet, "Classification and identification of geminiviruses using sequence comparisons," J. Gen. Virol., vol. 76, pp. 249-263, 1995.

[188] M. Mayo and C. Pringle, "Virus taxonomy--1997," J. Gen. Virol., vol. 79, pp. 649-657, 1998.

[189] J. K. Brown, F. M. Zerbini, J. Navas-Castillo, E. Moriones, R. Ramos-Sobrinho, J. C. Silva, et al., "Revision of Begomovirus taxonomy based on pairwise sequence comparisons," Arch. Virol., vol. 160, pp. 1593-1619, 2015.

[190] J. Brown, "Family geminiviridae," Virus taxonomy, classification and nomenclature of viruses: ninth report of the international committee on taxonomy of viruses, pp. 351-373, 2012.

126

References

[191] M. Padidam, S. Sawyer, and C. M. Fauquet, "Possible emergence of new geminiviruses by frequent recombination," Virol., vol. 265, pp. 218-225, 1999.

[192] T. A. Melgarejo, T. Kon, M. R. Rojas, L. Paz-Carrasco, F. M. Zerbini, and R. L. Gilbertson, "Characterization of a new world monopartite begomovirus causing leaf curl disease of tomato in Ecuador and Peru reveals a new direction in geminivirus evolution," J. Virol., vol. 87, pp. 5397-5413, 2013.

[193] S. Sánchez-Campos, A. Martínez-Ayala, B. Márquez-Martín, L. Aragón- Caballero, J. Navas-Castillo, and E. Moriones, "Fulfilling Koch's postulates confirms the monopartite nature of tomato leaf deformation virus: A begomovirus native to the New World," Virus Res., vol. 173, pp. 286-293, 2013.

[194] M. Macedo, L. Albuquerque, M. Maliano, J. Souza, M. Rojas, A. Inoue-Nagata, et al., "Characterization of tomato leaf curl purple vein virus, a new monopartite New World begomovirus infecting tomato in Northeast Brazil," Arch. Virol., vol. 163, pp. 737-743, 2018.

[195] C. Ha, S. Coombs, P. Revill, R. Harding, M. Vu, and J. Dale, "Molecular characterization of begomoviruses and DNA satellites from Vietnam: additional evidence that the New World geminiviruses were present in the Old World prior to continental separation," J. Gen. Virol., vol. 89, pp. 312-326, 2008.

[196] R. W. Briddon, B. L. Patil, B. Bagewadi, M. S. Nawaz-ul-Rehman, and C. M. Fauquet, "Distinct evolutionary histories of the DNA-A and DNA-B components of bipartite begomoviruses," BMC Evol. Biol., vol. 10, p. 97, 2010.

[197] E. Fontes, H. J. Gladfelter, R. L. Schaffer, I. Petty, and L. Hanley-Bowdoin, "Geminivirus replication origins have a modular organization," The Plant Cell, vol. 6, pp. 405-416, 1994.

[198] S. Baliji, M. C. Black, R. French, D. C. Stenger, and G. Sunter, "Spinach curly top virus: a newly described curtovirus species from southwest Texas with incongruent gene phylogenies," Phytopathol., vol. 94, pp. 772-779, 2004.

[199] D. M. Bisaro, "Geminivirus DNA replication," DNA Replication in Eukaryotic Cells, vol. 33, pp. 833-854, 1996.

[200] H. J. Gladfelter, P. A. Eagle, E. P. Fontes, L. Batts, and L. Hanley-Bowdoin, "Two domains of the AL1 protein mediate geminivirus origin recognition," Virol., vol. 239, pp. 186-197, 1997.

[201] I. Jupin, F. Hericourt, B. Benz, and B. Gronenborn, "DNA replication specificity of TYLCV geminivirus is mediated by the amino‐terminal 116 amino acids of the Rep protein," FEBS letters, vol. 362, pp. 116-120, 1995.

[202] J. Laufs, I. Jupin, C. David, S. Schumacher, F. Heyraud-Nitschke, and B. Gronenborn, "Geminivirus replication: genetic and biochemical characterization of Rep protein function, a review," Biochimie, vol. 77, pp. 765- 773, 1995.

127

References

[203] S. G. Lazarowitz and R. Shepherd, "Geminiviruses: genome structure and gene function," Crit. Rev. Plant Sci., vol. 11, pp. 327-349, 1992.

[204] B. M. Orozco, H. J. Gladfelter, S. B. Settlage, P. A. Eagle, R. N. Gentry, and L. Hanley-Bowdoin, "MultipleCisElements Contribute to Geminivirus Origin Function," Virol, vol. 242, pp. 346-356, 1998.

[205] K. K. Pasumarthy, N. R. Choudhury, and S. K. Mukherjee, "Tomato leaf curl Kerala virus (ToLCKeV) AC3 protein forms a higher order oligomer and enhances ATPase activity of replication initiator protein (Rep/AC1)," Virol. J., vol. 7, p. 128, 2010.

[206] G. Sunter and D. M. Bisaro, "Transactivation of geminivirus AR1 and BR1 gene expression by the viral AL2 gene product occurs at the level of transcription," Plant Cell, vol. 4, pp. 1321-1331, 1992.

[207] G. Sunter, J. L. Sunter, and D. M. Bisaro, "Plants expressing tomato golden mosaic virus AL2 or beet curly top virus L2 transgenes show enhanced susceptibility to infection by DNA and RNA viruses," Virol, vol. 285, pp. 59- 70, 2001.

[208] P. Raja, J. N. Wolf, and D. M. Bisaro, "RNA silencing directed against geminiviruses: post-transcriptional and epigenetic components," Biochimica et Biophysica Acta (BBA)-Gene Regulatory Mechanisms, vol. 1799, pp. 337-351, 2010.

[209] I. Amin, K. Hussain, R. Akbergenov, J. S. Yadav, J. Qazi, S. Mansoor, et al., "Suppressors of RNA silencing encoded by the components of the cotton leaf curl begomovirus-betasatellite complex," Mol. Plant Microb. Interact., vol. 24, pp. 973-983, 2011.

[210] V. Raghavan, P. S. Malik, N. R. Choudhury, and S. K. Mukherjee, "The DNA- A component of a plant geminivirus (Indian mung bean yellow mosaic virus) replicates in budding yeast cells," J. Virol., vol. 78, pp. 2405-2413, 2004.

[211] F. Li, X. Xu, C. Huang, Z. Gu, L. Cao, T. Hu, et al., "The AC5 protein encoded by Mungbean yellow mosaic India virus is a pathogenicity determinant that suppresses RNA silencing‐based antiviral defenses," New Phytologist., vol. 208, pp. 555-569, 2015.

[212] R. Briddon, M. Pinner, J. Stanley, and P. Markham, "Geminivirus coat protein gene replacement alters insect specificity," Virol., vol. 177, pp. 85-94, 1990.

[213] M. R. Rojas, H. Jiang, R. Salati, B. Xoconostle-Cázares, M. Sudarshana, W. J. Lucas, et al., "Functional analysis of proteins involved in movement of the monopartite begomovirus, Tomato Yellow Leaf curl virus," Virol., vol. 291, pp. 110-125, 2001.

[214] D. Rothenstein, B. Krenz, O. Selchow, and H. Jeske, "Tissue and cell tropism of Indian cassava mosaic virus (ICMV) and its AV2 (precoat) gene product," Virol., vol. 359, pp. 137-145, 2007.

128

References

[215] A. Rouhibakhsh, Q. Haq, and V. Malathi, "Mutagenesis in ORF AV2 affects viral replication in Mungbean yellow mosaic India virus," J. Biosci., vol. 36, pp. 329-340, 2011.

[216] X. Zhou, "Advances in understanding begomovirus satellites," Annu. Rev. Phytopathol., vol. 51, pp. 357-381, 2013.

[217] D. J. Ingham, E. Pascal, and S. G. Lazarowitz, "Both bipartite geminivirus movement proteins define viral host range, but only BL1 determines viral pathogenicity," Virol., vol. 207, pp. 191-204, 1995.

[218] J. L. Jeffrey, W. Pooma, and I. T. Petty, "Genetic requirements for local and systemic movement of tomato golden mosaic virus in infected plants," Virol., vol. 223, pp. 208-218, 1996.

[219] M. I. Boulton, D. I. King, J. Donson, and J. W. Davies, "Point substitutions in a promoter-like region and the V1 gene affect the host range and symptoms of maize streak virus," Virol., vol. 183, pp. 114-121, 1991.

[220] B. Kassanis, "Properties and behaviour of a virus depending for its multiplication on another," Microbiol., vol. 27, pp. 477-488, 1962.

[221] M. Mayo, M. Leibowitz, P. Palukaitis, K. Scholthof, A. Simon, J. Stanley, et al., "Satellites," VIIIth Report of the International Committee on Taxonomy of Viruses. Virus Taxonomy. Elsevier/Academic Press, London, pp. 1163-1169, 2005.

[222] P. Palukaitis, Rezaian, A., García-Arenal, F., Satellite nucleic acids and viruses: Academic Press, Oxford, 2008.

[223] M. Ilyas, J. Qazi, S. Mansoor, and R. W. Briddon, "Genetic diversity and phylogeography of begomoviruses infecting legumes in Pakistan," J. Gen. Virol., vol. 91, pp. 2091-2101, 2010.

[224] S. Anwar, "Distinct association of an alphasatellite and a betasatellite with tomato leaf curl New Delhi virus in field-infected cucurbit," J. Gen. Plant Pathol., vol. 83, pp. 185-188, 2017.

[225] I. B. Dry, L. R. Krake, J. E. Rigden, and M. A. Rezaian, "A novel subviral agent associated with a geminivirus: the first report of a DNA satellite," Proceedings of the National Academy of Sciences, vol. 94, pp. 7088-7093, 1997.

[226] R. W. Briddon, S. Mansoor, I. D. Bedford, M. S. Pinner, K. Saunders, J. Stanley, et al., "Identification of DNA components required for induction of cotton leaf curl disease," Virol., vol. 285, pp. 234-243, 2001.

[227] K. Saunders, I. D. Bedford, R. W. Briddon, P. G. Markham, S. M. Wong, and J. Stanley, "A unique virus complex causes Ageratum yellow vein disease," Proc. Natl. Acad. Sci., vol. 97, pp. 6890-6895, 2000.

[228] R. W. Briddon, Mansoor, S., Beta ssDNA satellite: Cotton Leaf Curl Disease vol. 5: oxford, Elsevie, 2008a 129

References

[229] M. Saeed, S. A. Behjatnia, S. Mansoor, Y. Zafar, S. Hasnain, and M. A. Rezaian, "A single complementary-sense transcript of a geminiviral DNA β satellite is determinant of pathogenicity," Mol. Plant Microb. Interact., vol. 18, pp. 7-14, 2005.

[230] R. Briddon and J. Stanley, "Subviral agents associated with plant single- stranded DNA viruses," Virol., vol. 344, pp. 198-210, 2006.

[231] R. Shukla, S. Dalal, and V. Malathi, "Suppressors of RNA silencing encoded by tomato leaf curl betasatellites," J. Biosci., vol. 38, pp. 45-51, 2013.

[232] X. Cui, X. Tao, Y. Xie, C. M. Fauquet, and X. Zhou, "A DNAβ associated with Tomato yellow leaf curl China virus is required for symptom induction," J. Virol., vol. 78, pp. 13966-13974, 2004.

[233] R. W. Briddon, D. P. Martin, P. Roumagnac, J. Navas-Castillo, E. Fiallo-Olivé, E. Moriones, et al., "Alphasatellitidae: A new family with two subfamilies for the classification of geminivirus-and nanovirus-associated alphasatellites," Arch. Virol., pp. 1-14, 2018.

[234] B. Gronenborn, J. W. Randles, D. Knierim, Q. Barrière, H. J. Vetten, N. Warthmann, et al., "Analysis of DNAs associated with coconut foliar decay disease implicates a unique single-stranded DNA virus representing a new taxon," Sci. Rep., vol. 8, p. 5698, 2018.

[235] P. Boevink, P. Chu, and P. Keese, "Sequence of subterranean clover stunt virus DNA: affinities with the geminiviruses," Virology vol. 207, pp. 354-361, 1995.

[236] S. Mansoor, S. H. Khan, A. Bashir, M. Saeed, Y. Zafar, K. A. Malik, et al., "Identification of a novel circular single-stranded DNA associated with cotton leaf curl disease in Pakistan," Virology, vol. 259, pp. 190-199, 1999.

[237] T. Paprotka, V. Metzler, and H. Jeske, "The first DNA 1-like α satellites in association with New World begomoviruses in natural infections," Virol., vol. 404, pp. 148-157, 2010.

[238] G. Romay, D. Chirinos, F. Geraud-Pouey, and C. Desbiez, "Association of an atypical alphasatellite with a bipartite New World begomovirus," Arch. Virol., vol. 155, pp. 1843-1847, 2010.

[239] J. Kumar, J. Kumar, S. P. Singh, and R. Tuli, "Association of satellites with a mastrevirus in natural infection: complexity of wheat dwarf India virus disease," J. Virol., vol. 88, pp. 7093-7104, 2014.

[240] R. W. Briddon, S. E. Bull, I. Amin, S. Mansoor, I. D. Bedford, N. Rishi, et al., "Diversity of DNA 1: a satellite-like molecule associated with monopartite begomovirus–DNA β complexes," Virol., vol. 324, pp. 462-474, 2004.

[241] P. Etessami, J. Watts, and J. Stanley, "Size reversion of African cassava mosaic virus coat protein gene deletion mutants during infection of Nicotiana benthamiana," J. Gen. Virol., vol. 70, pp. 277-289, 1989.

130

References

[242] S. Elmer and S. G. Rogers, "Selection for wild type size derivatiyes of tomato golden mosaic virus during systemic infection," Nucl. Acids. Res., vol. 18, pp. 2001-2010, 1990.

[243] R. L. Gilbertson, M. Sudarshana, H. Jiang, M. R. Rojas, and W. J. Lucas, "Limitations on geminivirus genome size imposed by plasmodesmata and virus- encoded movement protein: insights into DNA trafficking," The Plant Cell, vol. 15, pp. 2578-2591, 2003.

[244] A. M. Idris, M. S. Shahid, R. W. Briddon, A. Khan, J.-K. Zhu, and J. K. Brown, "An unusual alphasatellite associated with monopartite begomoviruses attenuates symptoms and reduces betasatellite accumulation," J. Gen. Virol., vol. 92, pp. 706-717, 2011.

[245] T. B. Mar, I. R. Mendes, D. Lau, E. Fiallo-Olivé, J. Navas-Castillo, M. S. Alves, et al., "Interaction between the New World begomovirus Euphorbia yellow mosaic virus and its associated alphasatellite: effects on infection and transmission by the whitefly Bemisia tabaci," J. Gen. Virol., vol. 98, pp. 1552- 1562, 2017.

[246] S. N. Cohen, A. C. Chang, and L. Hsu, "Nonchromosomal antibiotic resistance in bacteria: genetic transformation of Escherichia coli by R-factor DNA," Proc. Natl. Acad. Sci., vol. 69, pp. 2110-2114, 1972.

[247] A. Lopez-Avila, "Taxonomy and biology," Bemisia tabaci, pp. 3-11, 1986.

[248] J. K. Brown, "Phylogenetic biology of the Bemisia tabaci sibling species group," in Bemisia: bionomics and management of a global pest, ed: Springer, 2009, pp. 31-67.

[249] L. A. Mound, "Host‐correlated variation in Bemisia tabaci (Gennadius) (Homoptera: Aleyrodidae)," Physiol. Entomol., vol. 38, pp. 171-180, 1963.

[250] R. C. Rosell, I. D. Bedford, D. R. Frohlich, R. J. Gill, J. K. Brown, and P. G. Markham, "Analysis of morphological variation in distinct populations of Bemisia tabaci (Homoptera: Aleyrodidae)," Ann. Entomol. Soc. Am., vol. 90, pp. 575-589, 1997.

[251] L. A. Calvert, M. Cuervo, J. A. Arroyave, L. M. Constantino, A. Bellotti, and D. Frohlich, "Morphological and mitochondrial DNA marker analyses of whiteflies (Homoptera: Aleyrodidae) colonizing cassava and beans in Colombia," Ann. Entomol. Soc. Am., vol. 94, pp. 512-519, 2001.

[252] R. Gill, J. Brown, P. Stansly, and S. Narahjo, Bemisia: bionomics and management of a global pest: Springer, 2010.

[253] I. D. Bedford, R. W. Briddon, J. K. Brown, R. Rosell, and P. G. Markham, "Geminivirus transmission and biological characterisation of Bemisia tabaci (Gennadius) biotypes from different geographic regions," Ann. Appl. Biol., vol. 125, pp. 311-325, 1994.

131

References

[254] C. Moritz and C. Cicero, "DNA barcoding: promise and pitfalls," PLoS Biol., vol. 2, p. e354, 2004.

[255] A. I. Cognato, "Standard percent DNA sequence difference for insects does not predict species boundaries," J. Econ. Entomol., vol. 99, pp. 1037-1045, 2006.

[256] D. Rubinoff, "Utility of mitochondrial DNA barcodes in species conservation," Conserv. Biol., vol. 20, pp. 1026-1033, 2006.

[257] P. D. Hebert, A. Cywinska, and S. L. Ball, "Biological identifications through DNA barcodes," Proc. R. Soc. Lond. [Biol], vol. 270, pp. 313-321, 2003.

[258] A. Cywinska, F. Hunter, and P. D. Hebert, "Identifying Canadian mosquito species through DNA barcodes," Med. Vet. Entomol., vol. 20, pp. 413-424, 2006.

[259] J. Hulcr, S. E. Miller, G. P. Setliff, K. Darrow, N. D. Mueller, P. D. Hebert, et al., "DNA barcoding confirms polyphagy in a generalist moth, Homona mermerodes (Lepidoptera: Tortricidae)," Mol. Ecol. Resour., vol. 7, pp. 549- 557, 2007.

[260] S. J. Scheffer and B. M. Wiegmann, "Molecular phylogenetics of the holly leafminers (Diptera: Agromyzidae: Phytomyza): species limits, speciation, and dietary specialization," Mol. Phylogenet. Evol., vol. 17, pp. 244-255, 2000.

[261] P. J. De Barro, F. Driver, J. W. Trueman, and J. Curran, "Phylogenetic relationships of world populations of Bemisia tabaci (Gennadius) using ribosomal ITS1," Mol. Phylogen. Evol., vol. 16, pp. 29-36, 2000.

[262] H. Delatte, P. David, M. Granier, J.-M. Lett, R. Goldbach, M. Peterschmitt, et al., "Microsatellites reveal extensive geographical, ecological and genetic contacts between invasive and indigenous whitefly biotypes in an insular environment," Genet. Res,, vol. 87, pp. 109-124, 2006.

[263] B. Simón, J. Cenis, and P. De La Rúa, "Distribution patterns of the Q and B biotypes of Bemisia tabaci in the Mediterranean Basin based on microsatellite variation," Entomol. Exp. Appl., vol. 124, pp. 327-336, 2007.

[264] M. Ashfaq, P. D. Hebert, M. S. Mirza, A. M. Khan, S. Mansoor, G. S. Shah, et al., "DNA barcoding of Bemisia tabaci complex (Hemiptera: Aleyrodidae) reveals southerly expansion of the dominant whitefly species on cotton in Pakistan," PLoS One, vol. 9, p. e104485, 2014.

[265] M. N. Sattar, A. Kvarnheden, M. Saeed, and R. W. Briddon, "Cotton leaf curl disease – an emerging threat to cotton production worldwide," J. Gen. Virol., vol. 94, pp. 695-710, 2013.

[266] S. Mansoor, I. Amin, S. Iram, M. Hussain, Y. Zafar, K. A. Malik, et al., "Breakdown of resistance in cotton to Cotton Leaf Curl Disease in Pakistan," Plant Pathol., vol. 52, p. 784, 2003.

132

References

[267] S. Mansoor, R. W. Briddon, S. E. Bull, I. D. Bedford, A. Bashir, M. Hussain, et al., "Cotton leaf curl disease is associated with multiple monopartite begomoviruses supported by single DNA β," Arch. Virol., vol. 148, pp. 1969- 1986, 2003.

[268] I. Amin, S. Mansoor, L. Amrao, M. Hussain, S. Irum, Y. Zafar, et al., "Mobilisation into cotton and spread of a recombinant cotton leaf curl disease satellite," Arch. Virol., vol. 151, pp. 2055-2065, 2006.

[269] L. Amrao, I. Amin, S. Shahid, R. W. Briddon, and S. Mansoor, "Cotton leaf curl disease in resistant cotton is associated with a single begomovirus that lacks an intact transcriptional activator protein," Virus. Res., vol. 152, pp. 153-163, 2010.

[270] M. Z. Ahmed, P. J. De Barro, J. M. Greeff, S.-X. Ren, M. Naveed, and B.-L. Qiu, "Genetic identity of the Bemisia tabaci species complex and association with high cotton leaf curl disease (CLCuD) incidence in Pakistan," Pest. Manag. Sci., vol. 67, pp. 307-317, 2011.

[271] B. Simon, J. L. Cenis, F. Beitia, S. Khalid, I. M. Moreno, A. Fraile, et al., "Genetic Structure of Field Populations of Begomoviruses and of Their Vector Bemisia tabaci in Pakistan," Phytopathol., vol. 93, pp. 1422-9, 2003.

[272] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar, "MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods," Mol. Biol. Evol., vol. 28, pp. 2731-2739, 2011.

[273] L. M. Boykin and P. De Barro, "A practical guide to identifying members of the Bemisia tabaci species complex: and other morphologically identical species," Front. Ecol. Evol., vol. 2, 2014.

[274] J. E. Polston, P. De Barro, and L. M. Boykin, "Transmission specificities of plant viruses with the newly identified species of the Bemisia tabaci species complex," Pest Manag. Sci., vol. 70, pp. 1547-1552, 2014.

[275] M. Z. Ahmed, P. J. De Barro, J. M. Greeff, S. X. Ren, M. Naveed, and B. L. Qiu, "Genetic identity of the Bemisia tabaci species complex and association with high cotton leaf curl disease (CLCuD) incidence in Pakistan," Pest Manag. Sci., vol. 67, pp. 307-17, 2011.

[276] P. F. McGrath and B. D. Harrison, "Transmission of tomato leaf curl geminiviruses by Bemisia tabaci: effects of virus isolate and vector biotype," Ann. Appl. Biol., vol. 126, pp. 307-316, 1995.

[277] M. Li, J. Hu, F.-C. Xu, and S.-S. Liu, "Transmission of Tomato yellow leaf curl virus by two invasive biotypes and a Chinese indigenous biotype of the whitefly Bemisia tabaci," Intl. J. Pest. Manag., vol. 56, pp. 275-280, 2010.

133

References

[278] T. Guo, Q. Guo, X. Y. Cui, Y. Q. Liu, J. Hu, and S. S. Liu, "Comparison of transmission of Papaya leaf curl China virus among four cryptic species of the whitefly Bemisia tabaci complex," Sci. Rep., vol. 5, p. 15432, 2015.

[279] L.-L. Pan, X.-Y. Cui, Q.-F. Chen, X.-W. Wang, and S.-S. Liu, "Cotton leaf curl disease: which whitefly is the vector?," Phytopathol., vol. 108, pp. 1172-1183, 2018.

[280] R. Ellango, S. T. Singh, V. S. Rana, N. Gayatri Priya, H. Raina, R. Chaubey, et al., "Distribution of Bemisia tabaci Genetic Groups in India," Environ, Entomol., vol. 44, pp. 1258-64, 2015.

[281] G. R. Panhwar, G. A. Panhwar, A. W. Soomro, M. R. Magsi, and A. B. Leghari, " Survey of cotton leaf curl virus (CLCV) in Sindh," J. Biol. Sci., pp. 134–135, 2001.

[282] L. Amrao, S. Akhter, M. N. Tahir, I. Amin, R. W. Briddon, and S. Mansoor, "Cotton leaf curl disease in Sindh province of Pakistan is associated with recombinant begomovirus components," Virus. Res., vol. 153, pp. 161-165, 2010.

[283] M. Ahmed, S.-X. Ren, N. Mandour, M. Maruthi, M. Naveed, and B.-L. Qiu, "Phylogenetic analysis of Bemisia tabaci (Hemiptera: Aleyrodidae) populations from cotton plants in Pakistan, China, and Egypt," J. Pest. Sci., vol. 83, pp. 135- 141, 2010.

[284] M. Z. Ahmed, M. Naveed, M. Noor ul Ane, S.-X. Ren, P. De Barro, and B.-L. Qiu, "Host suitability comparison between the MEAM1 and AsiaII 1 cryptic species of Bemisia tabaci in cotton-growing zones of Pakistan," Pest. Manag. Sci., pp. n/a-n/a, 2014.

[285] S. Morin, M. Ghanim, M. Zeidan, H. Czosnek, M. Verbeek, and J. F. van den Heuvel, "A GroEL homologue from endosymbiotic bacteria of the whitefly Bemisia tabaci is implicated in the circulative transmission of tomato yellow leaf curl virus," Virol., vol. 256, pp. 75-84, Mar 30 1999.

[286] S. Morin, M. Ghanim, I. Sobol, and H. Czosnek, "The GroEL protein of the whitefly Bemisia tabaci interacts with the coat protein of transmissible and nontransmissible begomoviruses in the yeast two-hybrid system," Virol., vol. 276, pp. 404-16, Oct 25 2000.

[287] M. Kupper, S. K. Gupta, H. Feldhaar, and R. Gross, "Versatile roles of the chaperonin GroEL in microorganism–insect interactions," FEMS Microbiol. lett., vol. 354, pp. 1–10, 2014.

[288] H. R. Shoorcheh, B. Kazemi, S. Manzari, J. Brown, and A. Sarafrazi, "Genetic variation and mtCOI phylogeny for Bemisia tabaci (Hemiptera, Aleyrodidae) indicate that the ‘B’biotype predominates in Iran," J. Pest. Sci., vol. 81, p. 199, 2008.

134

References

[289] M. Hadjistylli, G. K. Roderick, and J. K. Brown, "Global Population Structure of a Worldwide Pest and Virus Vector: Genetic Diversity and Population History of the Bemisia tabaci Sibling Species Group," PLoS One, vol. 11, p. e0165105, 2016.

[290] D. Chu, Y.-j. Zhang, B. Cong, B.-Y. Xu, Q.-J. Wu, and Z. Guo-Ren, "Sequence analysis of mtDNA COI gene and molecular phylogeny of different geographical populations of Bemisia tabaci (Gennadius)," Sci. Agricul.. Sinica, vol. 38, pp. 76-85, 2005.

[291] D. Chu, Y.-J. Zhang, J. K. Brown, B. Cong, B.-Y. Xu, Q.-J. Wu, et al., "The introduction of the exotic Q biotype of Bemisia tabaci from the Mediterranean region into China on ornamental crops.," Fla. Entomol., vol. 89, pp. 168-174, 2006.

[292] Y. Hong, X. Wang, B. Tian, and J. Cai, "Chinese squash leaf curl virus: a new whitefly-transmitted geminivirus," Sci. China. Ser B, vol. 38, pp. 179-186, 1995.

[293] R. Singh, S. Raj, and V. Prasad, "Molecular characterization of a strain of Squash leaf curl China virus from North India," J. Phytopathol., vol. 156, pp. 222-228, 2008.

[294] M. Tahir, M. Haider, and R. Briddon, "First report of Squash leaf curl China virus in Pakistan," Austral. Plant. Dis. Not., vol. 5, pp. 21-24, 2010.

[295] Q. Baoli, S. A. Coats, R. Shunxiang, A. M. Idris, X. Caixia, and J. K. Brown, "Phylogenetic relationship of native and introduced Bemisia tabaci (Homoptera: Aleyrodidae) from China and India based on mtCOI DNA sequencing and host plant comparisons," Prog. Nat. Sci., vol. 17, pp. 645-654, 2007.

[296] J. Brown, S. Coats, I. Bedford, P. Markham, J. Bird, and D. Frohlich, "Characterization and distribution of esterase electromorphs in the whitefly, Bemisia tabaci (Genn.)(Homoptera: Aleyrodidae)," Biochem. Genet., vol. 33, pp. 205-214, 1995.

[297] J. P. Legg, R. French, D. Rogan, G. Okao-Okuja, and J. K. Brown, "A distinct Bemisia tabaci (Gennadius) (Hemiptera: Sternorrhyncha:Aleyrodidae) genotype cluster is associated with the epidemic of severe cassava mosaic virus disease in Uganda," Mol. Ecol., vol. 11, pp. 1219 –1229, 2002.

[298] J. K. Brown. (2007). The Bemisia tabaci complex: genetic and phenotypic variability drives begomovirus spread and virus diversification. Available: http://www.apsnet.org/online/feature/btabaci/

[299] M. Jiu, X. P. Zhou, L. Tong, J. Xu, X. Yang, F. H. Wan, et al., "Vector-virus mutualism accelerates population increase of an invasive whitefly," PLoS One, vol. 2, p. e182, 2007.

135

References

[300] J. C. Brownlie and K. N. Johnson, "Symbiont-mediated protection in insect hosts," Trend. Microbiol., vol. 17, pp. 348-354, 2009.

[301] R. Koga, T. Tsuchida, and T. Fukatsu, "Changing partners in an obligate symbiosis: a facultative endosymbiont can compensate for loss of the essential endosymbiont Buchnera in an aphid," Proc. R. Soc. Lond. [Biol], vol. 270, pp. 2543-2550, 2003.

[302] J. Ferrari, A. C. Darby, T. J. Daniell, H. C. J. Godfray, and A. E. Douglas, "Linking the bacterial community in pea aphids with host‐plant use and natural enemy resistance," Ecol. Entomol., vol. 29, pp. 60-65, 2004.

[303] E. R. Haine, "Symbiont-mediated protection," Proc. R. Soc. Lond. [Biol], vol. 275, pp. 353-361, 2008.

[304] C. Vorburger, L. Gehrer, and P. Rodriguez, "A strain of the bacterial symbiont Regiella insecticola protects aphids against parasitoids," Biol. lett., vol. 6, pp. 109-111, 2010.

[305] C. B. Montllor, A. Maxmen, and A. H. Purcell, "Facultative bacterial endosymbionts benefit Pea Aphids Acyrthosiphon pisum under heat stress," Ecol. Entomol., vol. 27, pp. 189-195, 2002.

[306] J. H. Werren and S. L. O’Neill, "The evolution of heritable symbionts," Influential passengers: inherited microorganisms and arthropod reproduction, pp. 1-41, 1997.

[307] J. Engelstädter and G. D. Hurst, "The ecology and evolution of microbes that manipulate host reproduction," Annu. Rev. Ecol. Evol. Syst., vol. 40, pp. 127- 149, 2009.

[308] T. M. Perring, "The Bemisia tabaci species complex," Crop Protect., vol. 20, pp. 725–737, 2001.

[309] D. Lunt, D. X. Zhang, J. Szymura, and O. Hewltt, "The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies," Insect Mol. Biol., vol. 5, pp. 153-165, 1996.

[310] S. Ueda, T. Kitamura, K. Kijima, K. I. Honda, and K. Kanmiya, "Distribution and molecular characterization of distinct Asian populations of Bemisia tabaci (Hemiptera: Aleyrodidae) in Japan," J. Appl. Entomol., vol. 136, pp. 355–366, 2009.

[311] P. Guirao, F. Beitia, and J. Cenis, "Biotype determination of Spanish populations of Bemisia tabaci (Hemiptera: Aleyrodidae)," Bull. Entomol. Res., vol. 87, pp. 587-593, 1997.

[312] P. Rúa, B. Simon, D. Cifuentes, C. Martinez‐Mora, and J. Cenis, "New insights into the mitochondrial phylogeny of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) in the Mediterranean Basin," J. Zool. Syst. Evol. Res., vol. 44, pp. 25-33, 2006.

136

References

[313] P. J. De Barro, J. W. Trueman, and D. R. Frohlich, "Bemisia argentifolii is a race of B. tabaci (Hemiptera: Aleyrodidae): the molecular genetic differentiation of B. tabaci populations around the world," Bull. Entomol. Res., vol. 95, pp. 193-203, 2005.

[314] J. Xu, P. J. De Barro, and S. S. Liu, "Reproductive incompatibility among genetic groups of Bemisia tabaci supports the proposition that the whitefly is a cryptic species complex," Bull. Entomol. Res., vol. 100, pp. 359-66, 2010.

[315] P. Wang, D. B. Sun, B. L. Qiu, and S. S. Liu, "The presence of six cryptic species of the whitefly Bemisia tabaci complex in China as revealed by crossing experiments," Insect Sci, vol. 18, pp. 67-77, 2011.

[316] M. L. Thao and P. Baumann, "Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts," Appl Environ Microbiol, vol. 70, pp. 3401-6, Jun 2004.

[317] A. Nirgianaki, G. K. Banks, D. R. Frohlich, Z. Veneti, H. R. Braig, T. A. Miller, et al., "Wolbachia infections of the whitefly Bemisia tabaci," Curr Microbiol, vol. 47, pp. 0093-0101, 2003.

[318] A. Mahadav, D. Gerling, Y. Gottlieb, H. Czosnek, and M. Ghanim, "Parasitization by the wasp Eretmocerus mundus induces transcription of genes related to immune response and symbiotic bacteria proliferation in the whitefly Bemisia tabaci," BMC Genomics, vol. 9, p. 342, 2008.

[319] M. Ghanim and S. Kontsedalov, "Susceptibility to insecticides in the Q biotype of Bemisia tabaci is correlated with bacterial symbiont densities," Pest. Manag. Sci., vol. 65, pp. 939-942, 2009.

[320] Y. Gottlieb, E. Zchori-Fein, N. Mozes-Daube, S. Kontsedalov, M. Skaljac, M. Brumin, et al., "The transmission efficiency of tomato yellow leaf curl virus by the whitefly Bemisia tabaci is correlated with the presence of a specific symbiotic bacterium species," J. Virol., vol. 84, pp. 9310-7, Sep 2010.

[321] M. Thierry, N. Becker, A. Hajri, B. Reynaud, J. M. Lett, and H. Delatte, "Symbiont diversity and non-random hybridization among indigenous (Ms) and invasive (B) biotypes of Bemisia tabaci," Mol. Ecol., vol. 20, pp. 2172-87, 2011.

[322] S. J. Perlman, M. S. Hunter, and E. Zchori-Fein, "The emerging diversity of Rickettsia," Proc. R. Soc. Lond. [Biol], vol. 273, pp. 2097-2106, 2006.

[323] R. Stouthamer, J. A. Breeuwer, and G. D. Hurst, "Wolbachia pipientis: microbial manipulator of arthropod reproduction," Annu. Rev. Microbiol., vol. 53, pp. 71-102, 1999.

[324] M. Kaltenpoth, W. Goettler, C. Dale, J. W. Stubblefield, G. Herzner, K. Roeser- Mueller, et al., "‘Candidatus Streptomyces philanthi’, an endosymbiotic streptomycete in the antennae of Philanthus digger wasps," Intl. J. Syst. Evol. Microbiol., vol. 56, pp. 1403-1411, 2006.

137

References

[325] A. R. Weeks, R. Velten, and R. Stouthamer, "Incidence of a new sex–ratio– distorting endosymbiotic bacterium among arthropods," Proc. R. Soc. Lond. [Biol], vol. 270, pp. 1857-1865, 2003.

[326] M. A. Larkin, G. Blackshields, N. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, et al., "Clustal W and Clustal X version 2.0," Bioinformatics, vol. 23, pp. 2947-2948, 2007.

[327] S. Kumar, G. Stecher, and K. Tamura, "MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets," Mol. Biol. Evol., vol. 33, pp. 1870-1874, 2016.

[328] M. Hasegawa, H. Kishino, and T.-a. Yano, "Dating of the human-ape splitting by a molecular clock of mitochondrial DNA," J. Mol. Evol., vol. 22, pp. 160- 174, 1985.

[329] G. Gueguen, F. Vavre, O. Gnankine, M. Peterschmitt, D. Charif, E. Chiel, et al., "Endosymbiont metacommunities, mtDNA diversity and the evolution of the Bemisia tabaci (Hemiptera: Aleyrodidae) species complex," Mol. Ecol., vol. 19, 4365–4378, 2010.

[330] M. Skaljac, K. Zanic, S. G. Ban, S. Kontsedalov, and M. Ghanim, "Co-infection and localization of secondary symbionts in two whitefly species," BMC Microbiol., vol. 10, p. 142, 2010.

[331] M. Skaljac, K. Zanic, S. Hrncic, S. Radonjic, T. Perovic, and M. Ghanim, "Diversity and localization of bacterial symbionts in three whitefly species (Hemiptera: Aleyrodidae) from the east coast of the Adriatic Sea," Bull. Entomol. Res., vol. 103, pp. 48-59, 2013.

[332] D. Chu, C. S. Gao, P. De Barro, Y. J. Zhang, F. H. Wan, and I. A. Khan, "Further insights into the strange role of bacterial endosymbionts in whitefly, Bemisia tabaci: comparison of secondary symbionts from biotypes B and Q in China," Bull. Entomol. Res., vol. 101, pp. 477-86, 2011.

[333] M. T. Balas, M. H. Lee, and J. H. Werren, "Distribution and fitness effects of the son-killer bacterium inNasonia," Evol. Ecol., vol. 10, pp. 593-607, 1996.

[334] M. Jiu, X. P. Zhou, and S. S. Liu, "Acquisition and Transmission of two Begomoviruses by the B and a non‐B Biotype of Bemisia tabaci from Zhejiang, China," J. Phytopathol., vol. 154, pp. 587-591, 2006.

[335] J. Liu, H. Zhao, K. Jiang, X. P. Zhou, and S. S. Liu, "Differential indirect effects of two plant viruses on an invasive and an indigenous whitefly vector: implications for competitive displacement," Ann. Appl. Biol., vol. 155, pp. 439- 448, 2009.

[336] K.-H. Tsai, C.-G. Huang, W.-J. Wu, C.-K. Chuang, C.-C. Lin, and W.-J. Chen, "Parallel infection of Japanese encephalitis virus and Wolbachia within cells of mosquito salivary glands," J. Med. Entomol., vol. 43, pp. 752-756, 2006.

138

References

[337] A. Saridaki and K. Bourtzis, "Wolbachia: more than just a bug in insects genitals," Curr. Opin. Microbiol., vol. 13, pp. 67-72, 2010.

[338] Z.-X. Li, H.-Z. Lin, and X.-P. Guo, "Prevalence of Wolbachia infection in Bemisia tabaci," Curr. Microbiol., vol. 54, pp. 467-471, 2007.

[339] E. Zchori-Fein and S. J. Perlman, "Distribution of the bacterial symbiont Cardinium in arthropods," Mol. Ecol., vol. 13, pp. 2009–2016, 2004.

[340] E. Zchori-Fein, S. J. Perlman, S. E. Kelly, N. Katzir, and M. S. Hunter, "Characterization of a ‘Bacteroidetes’ symbiont in Encarsia wasps (Hymenoptera: Aphelinidae): proposal of ‘Candidatus Cardinium hertigii’," Int. J. Syst. Evol. Microbiol., vol. 54, pp. 961-968, 2004.

[341] R. W. Briddon and P. Markham, "Cotton leaf curl virus disease," Virus Res., vol. 71, pp. 151-159, 2000.

[342] T. Hussain and M. Ali, "review of cotton diseases of Pakistan," Pakistan cottons, 1975.

[343] T. Hussain and T. Mahmood, "A note on leaf curl disease of cotton," Pakistan Cottons (Pakistan), 1988.

[344] M. T. T. Hussain, and T. Mahmood, , "Cotton leaf curl virus," Pak. J. Phytopathol., vol. 3, pp. 57-61, 1991.

[345] M. Rahman, D. Hussain, T. Malik, and Y. Zafar, "Genetics of resistance to cotton leaf curl disease in Gossypium hirsutum," Plant Pathol., vol. 54, pp. 764- 772, 2005.

[346] V. Zaffalon, S. K. Mukherjee, V. S. Reddy, J. R. Thompson, and M. Tepfer, "A survey of geminiviruses and associated satellite DNAs in the cotton-growing areas of northwestern India," Arch. Virol., vol. 157, pp. 483-495, 2012.

[347] M. N. Sattar, A. Kvarnheden, M. Saeed, and R. W. Briddon, "Cotton leaf curl disease–an emerging threat to cotton production worldwide," J. Gen. Virol., vol. 94, pp. 695-710, 2013.

[348] X. Zhou, Y. Liu, D. J. Robinson, and B. D. Harrison, "Four DNA-A variants among Pakistani isolates of cotton leaf curl virus and their affinities to DNA-A of geminivirus isolates from okra," J. Gen. Virol., vol. 79, pp. 915-923, 1998.

[349] P. A. Rajagopalan, A. Naik, P. Katturi, M. Kurulekar, R. S. Kankanallu, and R. Anandalakshmi, "Dominance of resistance-breaking cotton leaf curl Burewala virus (CLCuBuV) in northwestern India," Arch. Virol., vol. 157, pp. 855-868, 2012.

[350] M. Zubair, S. S.-e.-A. Zaidi, S. Shakir, M. Farooq, I. Amin, J. A. Scheffler, et al., "Multiple begomoviruses found associated with cotton leaf curl disease in Pakistan in early 1990 are back in cultivated cotton," Sci. Rep., vol. 7, p. 680, 2017.

139

References

[351] M. Shahid, S. Mansoor, and R. Briddon, "Complete nucleotide sequences of cotton leaf curl Rajasthan virus and its associated DNA β molecule infecting tomato," Arch. Virol., vol. 152, pp. 2131-2134, 2007.

[352] S. Bull, R. Briddon, and P. Markham, "Universal primers for the PCR-mediated amplification of DNA 1: a satellite-like molecule associated with begomovirus- DNA β complexes," Mol. Biotechnol., vol. 23, pp. 83-86, 2003.

[353] R. W. Briddon, S. E. Bull, S. Mansoor, I. Amin, and P. Markham, "Universal primers for the PCR-mediated amplification of DNA β," Mol. Biotechnol., vol. 20, pp. 315-318, 2002.

[354] R. W. Briddon, D. P. Martin, P. Roumagnac, J. Navas-Castillo, E. Fiallo-Olivé, E. Moriones, et al., "Alphasatellitidae: A new family with two subfamilies for the classification of geminivirus-and nanovirus-associated alphasatellites," Arch. Virol., pp. 1-14, 2018.

[355] N.-C. J. Briddon RW, Fiallo-Olivé E, Varsani A, Martin DP, Moriones E, Idris AM, Zerbini FM, "Establishment of the family Tolecusatellitidae of single- stranded DNA satellites associated with geminiviruses (family Geminiviridae): recommendations for the classification and nomenclature of betasatellites and deltasatellites," Arch. Virol. 2018.

[356] B. M. Muhire, A. Varsani, and D. P. Martin, "SDT: a virus classification tool based on pairwise sequence alignment and identity calculation," PloS One, vol. 9, p. 108277, 2014.

[357] D. P. Martin, B. Murrell, M. Golden, A. Khoosal, and B. Muhire, "RDP4: Detection and analysis of recombination patterns in virus genomes," Virus. Evol., vol. 1, 2015.

[358] D. Senanayake, B. Mandal, S. Lodha, and A. Varma, "First report of Chilli leaf curl virus affecting chilli in India," Plant Pathol., vol. 56, pp. 343-343, 2007.

[359] L. Amrao, I. Amin, M. S. Shahid, R. W. Briddon, and S. Mansoor, "Cotton leaf curl disease in resistant cotton is associated with a single begomovirus that lacks an intact transcriptional activator protein," Virus Res., vol. 152, pp. 153-163, 2010.

[360] M. Hussain, S. Iram, S. Mansoor, and R. W. Briddon, "A single species of betasatellite is prevalent in chilli across north central Pakistan and shows phylogeographic segregation," J. Phytopathol., vol. 157, pp. 576-579, 2009.

[361] I. Amin, S. Mansoor, L. Amrao, M. Hussain, S. Irum, Y. Zafar, et al., "Mobilisation into cotton and spread of a recombinant cotton leaf curl disease satellite," Arch. Virol., vol. 151, pp. 2055-2065, 2006.

[362] S. Akhtar, M. N. Tahir, G. R. Baloch, S. Javaid, A. Q. Khan, I. Amin, et al., "Regional changes in the sequence of cotton leaf curl multan betasatellite," Viruses, vol. 6, pp. 2186-2203, 2014.

140

References

[363] M. Mubin, R. Briddon, and S. Mansoor, "Diverse and recombinant DNA betasatellites are associated with a begomovirus disease complex of Digera arvensis, a weed host," Virus Res., vol. 142, pp. 208-212, 2009.

[364] G. Murtaza, M. Mubin, M. S. Nawaz-Ul-Rehman, and L. Amrao, "Alternanthera Yellow Vein Virus (AYVV) Infecting Eclipta prostrata Plant is Associated with Two Novel Alphasatellites in Pakistan," Pak. J. Life. Soc. Sci., vol. 15, 2017.

[365] S. Zaidi, S. Shakir, M. Farooq, I. Amin, and S. Mansoor, "First Report of Alternanthera yellow vein virus From Eclipta prostrata in Pakistan," Plant Disease, vol. 101, pp. 266-266, 2017.

[366] J. Huang, T. Jiang, and X. Zhou, "Molecular characterization of begomoviruses infecting Ludwigia hyssopifolia," J. Plant Pathol., pp. 83-88, 2006.

[367] X. Guo and X. Zhou, "Molecular characterization of Alternanthera yellow vein virus: a new begomovirus species infecting Alternanthera philoxeroides," J. Phytopathol., vol. 153, pp. 694-696, 2005.

[368] Z. A. Khan and J. A. Khan, "Characterization of a new begomovirus and betasatellite associated with chilli leaf curl disease in India," Arch. Virol., vol. 162, pp. 561-565, 2017.

[369] P. Singh-Pant, P. Pant, S. Mukherjee, and S. Mazumdar-Leighton, "Spatial and temporal diversity of begomoviral complexes in papayas with leaf curl disease," Arch. Virol., vol. 157, pp. 1217-1232, 2012.

[370] I. A. Khan, K. P. Akhtar, F. Akbar, I. Hassan, I. Amin, M. Saeed, et al., "Diversity in betasatellites associated with cotton leaf curl disease during source-to-sink movement through a resistant host," Plant Pathol. J., vol. 32, p. 47, 2016.

[371] M. Sattar, F. Qurashi, Z. Iqbal, and M. Saleem Haider, "Molecular characterization of Hollyhock leaf curl virus and associated DNA-satellites infecting Malva parviflora in Pakistan," Can. J. Plant. Pathol., vol. 39, pp. 229- 234, 2017.

[372] V. Venkataravanappa, C. L. Reddy, S. Jalali, R. W. Briddon, and M. K. Reddy, "Molecular identification and biological characterisation of a begomovirus associated with okra enation leaf curl disease in India," Eur. J. Plant. Pathol., vol. 141, pp. 217-235, 2015.

[373] C. Tharmila, E. Jeyaseelan, U. Ihsan, A. Wetten, D. De Costa, and M. Shaw, "First report on association of okra yellow vein mosaic virus with yellow vein mosaic disease of okra (Abelmoschus esculentus) in Sri Lanka," Plant Disease, vol. 101, p. 1335, 2017.

[374] K. Bananej, S. Kraberger, and A. Varsani, "Okra enation leaf curl virus in papaya from Iran displaying severe leaf curl symptoms," J. Plant Pathol., pp. 637-639, 2016.

141

References

[375] S. Serfraz, I. Amin, K. P. Akhtar, and S. Mansoor, "Recombination among begomoviruses on malvaceous plants leads to the evolution of Okra enation leaf curl virus in Pakistan," J. Phytopathol., vol. 163, pp. 764-776, 2015.

[376] U. Hameed, M. Zia-Ur-Rehman, H.-W. Herrmann, M. Haider, and J. Brown, "First report of Okra enation leaf curl virus and associated Cotton Leaf Curl Multan betasatellite and Cotton Leaf Curl Multan alphasatellite infecting cotton in Pakistan: a new member of the cotton leaf curl disease complex," Plant Disease, vol. 98, pp. 1447-1447, 2014.

[377] F. Saeed, M. N. Sattar, U. Hameed, M. Ilyas, M. S. Haider, M. Hamza, et al., "Infectivity of Okra Enation leaf curl virus and the role of its V2 protein in pathogenicity," Virus Res., vol. 255, pp. 90-94, 2018.

[378] M. S. Nawaz-ul-Rehman, R. W. Briddon, and C. M. Fauquet, "A melting pot of Old World begomoviruses and their satellites infecting a collection of Gossypium species in Pakistan," PLoS One, vol. 7, p. e40050, 2012.

[379] R. W. Briddon, F. Akbar, Z. Iqbal, L. Amrao, I. Amin, M. Saeed, et al., "Effects of genetic changes to the begomovirus/betasatellite complex causing cotton leaf curl disease in South Asia post-resistance breaking," Virus Res., vol. 186, pp. 114-119, 2014.

[380] F. Akbar, Z. Iqbal, R. W. Briddon, F. Vazquez, and M. Saeed, "The 35-amino acid C2 protein of Cotton leaf curl Kokhran virus, Burewala, implicated in resistance breaking in cotton, retains some activities of the full-length protein," Virus Gen., vol. 52, pp. 688-697, 2016.

[381] J. Kumar, S. Gunapati, A. Alok, A. Lalit, R. Gadre, N. C. Sharma, et al., "Cotton leaf curl Burewala virus with intact or mutant transcriptional activator proteins: complexity of cotton leaf curl disease," Arch. Virol., vol. 160, pp. 1219-1228, 2015.

[382] Q. Abbas, I. Amin, S. Mansoor, M. Shafiq, M. Wassenegger, and R. W. Briddon, "The Rep proteins encoded by alphasatellites restore expression of a transcriptionally silenced green fluorescent protein transgene in Nicotiana benthamiana," Virus Disease, pp. 1-5, 2017.

[383] K. Saunders, I. D. Bedford, and J. Stanley, "Adaptation from whitefly to leafhopper transmission of an autonomously replicating nanovirus-like DNA component associated with ageratum yellow vein disease," J. Gen. Virol., vol. 83, pp. 907-913, 2002.

[384] M. Zubair, S. S.-e.-A. Zaidi, S. Shakir, I. Amin, and S. Mansoor, "An insight into Cotton leaf curl Multan betasatellite, the most important component of cotton leaf curl disease complex," Viruses, vol. 9, p. 280, 2017.

[385] R. Ullah, K. P. Akhtar, I. Hassan, M. Saeed, N. Sarwar, and S. Mansoor, "Evidence of cotton leaf curl Burewala virus variant and its associate Betasatellite causing yellow mosaic of eggplant (Solanum melongena) in Pakistan," J. Phytopathol., vol. 163, pp. 233-237, 2015.

142

References

[386] I. Hassan, I. Amin, S. Mansoor, and R. W. Briddon, "Further changes in the cotton leaf curl disease complex: an indication of things to come?," Virus Gen., vol. 53, pp. 759-761, 2017.

[387] M. N. Sattar, Z. Iqbal, M. N. Tahir, and S. Ullah, "The prediction of a new CLCuD epidemic in the Old World," Front. Microbiol., vol. 8, p. 631, 2017.

[388] S. S. E. A. Zaidi, D. P. Martin, I. Amin, M. Farooq, and S. Mansoor, "Tomato leaf curl New Delhi virus: a widespread bipartite begomovirus in the territory of monopartite begomoviruses," Mol. Plant. Pathol., vol. 18, pp. 901-911, 2017.

[389] M. Shafiq, Z. Iqbal, I. Ali, Q. Abbas, S. Mansoor, R. W. Briddon, et al., "Real- time quantitative PCR assay for the quantification of virus and satellites causing leaf curl disease in cotton in Pakistan," J. Virol. Method., vol. 248, pp. 54-60, Oct 2017.

[390] W. Islam, W. Lin, S. U. Islam, M. Arif, X. Li, Y. Yang, et al., "Genetic diversity of begomoviruses in Pakistan captured through a vector based survey," Microbial Pathogenesis, vol. 118, pp. 91-97, 2018.

[391] S. Zaidi, S. Shakir, M. Farooq, I. Amin, and S. Mansoor, "First report of a novel strain of Tomato yellow leaf curl virus causing yellow leaf curl disease on cluster bean in Pakistan," Plant Disease, vol. 101, pp. 1071-1071, 2017.

[392] J. S. Boyer, "Plant productivity and environment," Science, vol. 218, pp. 443- 448, 1982.

[393] I. B. Rejeb, V. Pastor, and B. Mauch-Mani, "Plant responses to simultaneous biotic and abiotic stress: molecular mechanisms," Plants, vol. 3, pp. 458-475, 2014.

[394] S. Hussain, T. Mahmood, M. Tahir, H. Mahmood, and M. Afzal, "Differential Effect of Planting Time on Cotton Leaf Curl Disease (CLCuD) and Yield of Cotton Variety Cim-598 (Gossypium Hirsutum L.)," Int. J. Novel Res. Life Sci, vol. 2, pp. 1-7, 2015.

[395] M. Tahir, M. Tariq, H. Mahmood, and S. Hussain, "Effect of sowing dates on incidence of cotton leaf curl virus on different cultivars of cotton," Plant Pathol. J., vol. 3, pp. 61-64, 2004.

[396] S. Jitender, B. Jagdish, and K. Anil, "Influence of weather variable on Cotton leaf curl virus (CLCuV) disease in cotton (Gossypium hirsutum)," J. Cotton Res. Develop., vol. 20, pp. 280-285, 2006.

[397] M. A. Zeshan, M. A. Khan, A. Safdar, and M. Arshad, "Correlation of conducive environmental conditions for the development of whitefly, Bemisia tabaci population in different tomato genotypes," Pak. J. Zool., vol. 47, 2015.

[398] N. Kushwaha, A. K. Singh, B. Chattopadhyay, and S. Chakraborty, "Recent advances in geminivirus detection and future perspectives," J. Plant Prot. Sci., vol. 2, pp. 1-18, 2010.

143

References

[399] G. P. Accotto and E. Noris, "Detection methods for TYLCV and TYLCSV," in Tomato Yellow Leaf Curl Virus Disease, ed: Springer, 2007, pp. 241-249.

[400] K. Makkouk and S. Kumari, "Molecular diagnosis of plant viruses," Arab. J. Plant. Prot., vol. 24, pp. 135-138, 2006.

[401] M. Visser, R. Bester, J. T. Burger, and H. J. Maree, "Next-generation sequencing for virus detection: covering all the bases," Virol. J., vol. 13, p. 85, 2016.

[402] N. Boonham, L. G. Pérez, M. Mendez, E. L. Peralta, A. Blockley, K. Walsh, et al., "Development of a real-time RT-PCR assay for the detection of Potato spindle tuber viroid," J. Virol. Method., vol. 116, pp. 139-146, 2004.

[403] E. Noris and L. Miozzi, "Real-time PCR protocols for the quantification of the begomovirus tomato yellow leaf curl sardinia virus in tomato plants and in its insect vector," Method. Mol. Biol., vol. 1236, pp. 61-72, 2015.

[404] N. Boonham, P. Smith, K. Walsh, J. Tame, J. Morris, N. Spence, et al., "The detection of Tomato spotted wilt virus (TSWV) in individual thrips using real time fluorescent RT-PCR (TaqMan)," J. Virol. Method., vol. 101, pp. 37-48, 2002.

[405] F. Fabre, C. Kervarrec, L. Mieuzet, G. Riault, A. Vialatte, and E. Jacquot, "Improvement of Barley yellow dwarf virus-PAV detection in single aphids using a fluorescent real time RT-PCR," J. Virol. Method., vol. 110, pp. 51-60, 2003.

[406] A. Olmos, E. Bertolini, M. Gil, and M. Cambra, "Real-time assay for quantitative detection of non-persistently transmitted Plum pox virus RNA targets in single Aphids," J. Virol. Method., vol. 128, pp. 151-155, 2005.

[407] B. C. Pakkianathan, S. Kontsedalov, G. Lebedev, A. Mahadav, M. Zeidan, H. Czosnek, et al., "Replication of tomato yellow leaf curl virus in its whitefly vector, Bemisia tabaci," J. Virol., vol. 89, pp. 9791-9803, 2015.

[408] L.-L. Wang, X.-R. Wang, X.-M. Wei, H. Huang, J.-X. Wu, X.-X. Chen, et al., "The autophagy pathway participates in resistance to Tomato yellow leaf curl virus infection in whiteflies," Autophag., vol. 12, pp. 1560-1574, 2016.

[409] H. Czosnek, M. Ghanim, and M. Ghanim, "The circulative pathway of begomoviruses in the whitefly vector Bemisia tabaci—insights from studies with Tomato yellow leaf curl virus," Ann. Appl. Biol., vol. 140, pp. 215-231, 2002.

[410] R. Mumford, K. Walsh, I. Barker, and N. Boonham, "Detection of Potato mop top virus and Tobacco rattle virus using a multiplex real-time fluorescent reverse-transcription polymerase chain reaction assay," Phytopathol., vol. 90, pp. 448-453, 2000.

144

References

[411] J. Korimbocus, D. Coates, I. Barker, and N. Boonham, "Improved detection of Sugarcane yellow leaf virus using a real-time fluorescent (TaqMan) RT-PCR assay," J. Virol. Method., vol. 103, pp. 109-120, 2002.

[412] N. Nahid, I. Amin, S. Mansoor, E. Rybicki, E. Van Der Walt, and R. Briddon, "Two dicot-infecting mastreviruses (family Geminiviridae) occur in Pakistan," Arch. Virol., vol. 153, pp. 1441-1451, 2008.

[413] S. Kraberger, H. Mumtaz, S. Claverie, D. P. Martin, R. W. Briddon, and A. Varsani, "Identification of an Australian-like dicot-infecting mastrevirus in Pakistan," Arch. Virol., vol. 160, pp. 825-830, 2015.

[414] K. Akhtar, R. Ullah, M. Saeed, N. Sarwar, and S. Mansoor, "China rose (Hibiscus rosa-sinensis): a new natural host of Cotton leaf curl Burewala virus in Pakistan," J. Plant Pathol., vol. 96, pp. 385-389, 2014.

[415] A. Sicard, M. Yvon, T. Timchenko, B. Gronenborn, Y. Michalakis, S. Gutierrez, et al., "Gene copy number is differentially regulated in a multipartite virus," Nat. Commun., vol. 4, p. 2248, 2013.

[416] S. Tabein, S. A. Behjatnia, A. Anabestani, and K. Izadpanah, "Whitefly- mediated transmission of cotton leaf curl Multan betasatellite: evidence for betasatellite encapsidation in coat protein of helper begomoviruses," Arch. Virol., vol. 158, pp. 19-26, 2013.

[417] L.-L. Pan, Q.-F. Chen, J.-J. Zhao, T. Guo, X.-W. Wang, A. Hariton-Shalev, et al., "Clathrin-mediated endocytosis is involved in Tomato yellow leaf curl virus transport across the midgut barrier of its whitefly vector," Virol., vol. 502, pp. 152-159, 2017.

[418] E. Noris, A. Vaira, P. Caciagli, V. Masenga, B. Gronenborn, and G. Accotto, "Amino acids in the capsid protein of Tomato Yellow Leaf Curl virus that are crucial for systemic infection, particle formation, and insect transmission," J. Virol., vol. 72, pp. 10050-10057, 1998.

[419] P. Caciagli, V. M. Piles, D. Marian, M. Vecchiati, V. Masenga, G. Mason, et al., "Virion stability is important for the circulative transmission of Tomato yellow leaf curl Sardinia virus by Bemisia tabaci, but virion access to salivary glands does not guarantee transmissibility," J. Virol., vol. 83, pp. 5784-5795, 2009.

[420] M. Höhnle, P. Höfer, I. D. Bedford, R. W. Briddon, P. G. Markham, and T. Frischmuth, "Exchange of three amino acids in the coat protein results in efficient whitefly transmission of a nontransmissible Abutilon mosaic virus isolate," Virol, vol. 290, pp. 164-171, 2001.

[421] J. Wei, J. J. Zhao, T. Zhang, F. F. Li, M. Ghanim, X. P. Zhou, et al., "Specific cells in the primary salivary glands of the whitefly Bemisia tabaci control retention and transmission of begomoviruses," J. Virol., vol. 88, pp. 13460-8, 2014.

145

References

[422] P. Höfer, I. D. Bedford, P. G. Markham, H. Jeske, and T. Frischmuth, "Coat protein gene replacement results in whitefly transmission of an insect nontransmissible geminivirus isolate," Virol, vol. 236, pp. 288-295, 1997.

[423] C. G. Casado, G. J. Ortiz, E. Padron, S. J. Bean, R. McKenna, M. Agbandje- McKenna, et al., "Isolation and characterization of subgenomic DNAs encapsidated in “single” T= 1 isometric particles of Maize streak virus," Virol, vol. 323, pp. 164-171, 2004.

[424] M. Zeidan and H. Czosnek, "Acquisition of tomato yellow leaf curl virus by the whitefly Bemisia tabaci," J. Gen. Virol., vol. 72 ( Pt 11), pp. 2607-14, 1991.

[425] P. Caciagli and D. Bosco, "Quantitation over time of tomato yellow leaf curl geminivirus DNA in its whitefly vector," Phytopathol., vol. 87, pp. 610-613, 1997.

[426] N. Becker, L. Rimbaud, F. Chiroleu, B. Reynaud, G. Thébaud, and J.-M. Lett, "Rapid accumulation and low degradation: key parameters of Tomato yellow leaf curl virus persistence in its insect vector Bemisia tabaci," Sci. Rep., vol. 5, p. 17696, 2015.

[427] W. Ning, X. Shi, B. Liu, H. Pan, W. Wei, Y. Zeng, et al., "Transmission of Tomato Yellow Leaf Curl Virus by Bemisia tabaci as Affected by Whitefly Sex and Biotype," Sci. Rep., vol. 5, p. 10744, 2015.

[428] K. Ullah, N. Khan, Z. Usman, R. Ullah, F. Y. Saleem, S. A. I. Shah, et al., "Impact of temperature on yield and related traits in cotton genotypes," J. Integr. Agric., vol. 15, pp. 678-683, 2016.

[429] M. A. Khan and H. A. Khan, "Cotton leaf curl virus disease severity in relation to environmental conditions," Pak. J. Biol. Sci, vol. 3, pp. 1688-1690, 2000.

[430] J. Khan, Z. Bashir, A. Ahmad, W. Tariq, A. Yousaf, and M. Gohar, "Mathematical modeling of cotton leaf curl virus with respect to environmental factors," Eur. J. Microbiol. Immunol., vol. 5, pp. 172-176, 2015.

[431] A. Maharshi, N. Yadav, P. Swami, P. Singh, and J. Singh, "Progression of Cotton Leaf Curl Disease and its Vector Whitefly under Weather Influences," Int. J. Curr. Microbiol. App. Sci, vol. 6, pp. 2663-2670, 2017.

[432] S. Ahmad, K. Mahmood, M. Hanif, W. Nazeer, W. Malik, A. Qayyum, et al., "Introgression of cotton leaf curl virus-resistant genes from Asiatic cotton (Gossypium arboreum) into upland cotton (G. hirsutum)," Genet. Mol. Res., vol. 10, pp. 2404-2414, 2011.

[433] J. Amudha, G. Balasubramani, V. Malathi, D. Monga, and K. Kranthi, "Cotton leaf curl virus resistance transgenics with antisense coat protein gene (AV1)," Curr. Sci., pp. 300-307, 2011.

[434] J. A. Hashmi, Y. Zafar, M. Arshad, S. Mansoor, and S. Asad, "Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences," Virus Genes., vol. 42, pp. 286-296, 2011. 146

References

[435] I. Ali, I. Amin, R. W. Briddon, and S. Mansoor, "Artificial microRNA-mediated resistance against the monopartite begomovirus Cotton leaf curl Burewala virus," Virol. J., vol. 10, p. 231, 2013.

[436] K. Akhtar, M. K. R. Khan, M. Ahmad, N. Sarwar, and A. Ditta, "Partial resistance of a cotton mutant to Cotton leaf curl Burewala virus," Span. J. Agric. Res., pp. 1098-1104, 2010.

[437] A. Raza, H. J. Malik, M. Shafiq, I. Amin, J. A. Scheffler, B. E. Scheffler, et al., "RNA interference based approach to down regulate osmoregulators of whitefly (Bemisia tabaci): potential technology for the control of whitefly," PLoS One, vol. 11, p. e0153883, 2016.

[438] S. S.-e.-A. Zaidi, R. W. Briddon, and S. Mansoor, "Engineering dual begomovirus-Bemisia tabaci resistance in plants," Tren. Plant. Sci., vol. 22, pp. 6-8, 2017.

[439] M. Götz, S. Popovski, M. Kollenberg, R. Gorovits, J. K. Brown, J. M. Cicero, et al., "Implication of Bemisia tabaci heat shock protein 70 in begomovirus- whitefly interactions," J. Virol., vol. 86, pp. 13241-13252, 2012.

[440] W. Chen, D. K. Hasegawa, N. Kaur, A. Kliot, P. V. Pinheiro, J. Luan, et al., "The draft genome of whitefly Bemisia tabaci MEAM1, a global crop pest, provides novel insights into virus transmission, host adaptation, and insecticide resistance," BMC Biol., vol. 14, p. 110, 2016.

[441] W. Xie, X. Yang, C. Chen, Z. Yang, L. Guo, D. Wang, et al., "The invasive MED/Q Bemisia tabaci genome: a tale of gene loss and gene gain," BMC Genomics, vol. 19, p. 68, Jan 22 2018.

147

Appendices

Appendix A

Supplementary Table. B. tabaci insects collected across Pakistan

Origin Province Host Date of Genetic GPS Accession plant collection group coordinates number 1 Sunderfarm Punjab cotton 24,5,2012 Asia II 1 31.62591N,7 HF934973 3.21406 E 2 Sunderfarm Punjab cotton 24,5,2012 Asia II 1 31.62591N,7 HF679283 3.21406 E 3 Sahianwala Punjab pumpkin 24,5,2012 Asia II 1 31.64514 LN897416 N,73.23437 E 4 Hafizabad Punjab tomato 24,5,2012 Asia II 1 32.07820 HF934974 N,73.66874 E 5 Faisalabad Punjab cotton 30,5,2012 Asia II 1 31.23469 HF934975 N,73.14074 E 6 Faisalabad Punjab cotton 30,5,2012 Asia II 1 31.23469 HF934976 N,73.14074 E 7 Faisalabad Punjab cotton 30,5,2012 Asia II 1 31.23469 HF934977 N,73.14074 E 8 Thikriwala Punjab cotton 16,7,2012 Asia II 1 31.34735 HF934978 N,72.83433 E 9 Thikriwala Punjab cotton 16,7,2012 Asia II 1 31.34735 HF934979 N,72.83433 E 10 Thikriwala Punjab cotton 16,7,2012 Asia II 1 31.34735 N, HF934980 72.83433 E 11 Gojra Punjab cotton 16,7,2012 Asia II 1 31.03818 N, HF934981 72.74444 E 12 Gojra Punjab cotton 16,7,2012 Asia I 31.03818 N, HF934988 72.74444 E 13 Gojra Punjab cotton 16,7,2012 Asia II 1 31.03818 N, HF934991 72.74444 E 14 Kaccha khu Punjab cotton 16,7,2012 Asia II 1 30.36682 N, HF934982 72.12887 E 15 Khanewal Punjab cotton 16,7,2012 Asia II 1 30.28341 N, HF934983 71.92147 E 16 Sanddian wali Punjab cotton 16,7,2012 Asia II 1 30.63516 N, HF934984 72.32199 E 17 Abdul Hakim Punjab cotton 16,7,2012 Asia II 1 30.53603 N, HF934995 72.13061 E 18 Abdul Hakim Punjab cotton 16,7,2012 Asia II 1 30.53603 N, HF934985 72.13061 E 19 Bahawalpur Punjab cotton 16,7,2012 Asia II 1 29.26674 N, HF934986 71.48223 E 20 Wahi Hussain Punjab brinjal 16,7,2012 Asia I 29.17403 N, HF934987 71.34592 E 21 Wahi Hussain Punjab brinjal 16,7,2012 Asia I 29.17403 N, HF934997 71.34592 E

148

Appendices

22 Wahi Hussain Punjab brinjal 16,7,2012 Asia I 29.17403 N, HG315652 71.34592 E 23 Wahi Hussain Punjab brinjal 16,7,2012 Asia I 29.17403 N, HG315653 71.34592 E 24 Wahi Hussain Punjab brinjal 16,7,2012 Asia I 29.17403 N, HG315654 71.34592 E 25 Chak 288 JB Punjab cotton 16,7,2012 Asia II 1 31.05382 N, HF934989 72.58873 E 26 Chak 288 JB Punjab cotton 16,7,2012 Asia II 1 31.05382 N, HF934990 72.58873 E 27 Rahim Yar Punjab cotton 16,7,2012 Asia II 1 28.46687 N, LT222297 Khan 70.39155 E 28 Rahim Yar Punjab cotton 16,7,2012 Asia II 1 28.46687 N, HG315647 Khan 70.39155 E 29 Rahim Yar Punjab cotton 16,7,2012 Asia II 1 28.46687 N, HG315648 Khan 70.39155 E 30 Firoza Punjab cotton 17,7,2012 Asia II 1 28.73918 N, HF934992 70.78456 E 31 Firoza Punjab cotton 17,7,2012 Asia II 1 28.73918 N, HF935005 70.78456 E 32 Firoza Punjab cotton 17,7,2012 Asia II 1 28.73918 N, HG315649 70.78456 E 33 Firoza Punjab cotton 17,7,2012 Asia II 1 28.73918 N, HG315650 70.78456 E 34 Kot Samaba Punjab cotton 17,7,2012 Asia II 1 28.56035 N, HF934993 70.49742 E 35 Kot Samaba Punjab cotton 17,7,2012 Asia II 1 28.56035 N, HG315657 70.49742 E 36 Kot Samaba Punjab cotton 17,7,2012 Asia II 1 28.56035 N, HG315658 70.49742 E 37 Pir Mahal Punjab cotton 17,7,2012 Asia II 1 30.74912 N, HF934994 72.43624 E 38 Ahmadpur Punjab cotton 17,7,2012 Asia I 29.13293 N, HF934996 Sharqia 71.20363 E 39 Choparhatta Punjab cotton 17,7,2012 Asia II 1 30.50903 N, HG315651 71.93976 E 40 Choparhatta Punjab cotton 17,7,2012 Asia II 1 30.50903 N, HF934999 71.93976 E 41 Chak 135 GB Punjab cotton 20,7,2012 Asia II 1 31.14660 N, HG315638 72.98250 E 42 Chak 135 GB Punjab cotton 20,7,2012 Asia II 1 31.14660 N, HF935000 72.98250 E 43 Kamalia Punjab cotton 20,7,2012 Asia II 1 30.75476 N, HF935003 72.64303 E 44 Samundri Punjab cotton 20,7,2012 Asia II 1 30.97254 N, HF935004 72.86655 E 45 Samundri Punjab cotton 20,7,2012 Asia II 1 30.97254 N, HG315639 72.86655 E 46 Lodhran Punjab cotton 17,7,2012 Asia II 1 29.70385 N, HF935006 71.58041 E 47 Rajhana Punjab cotton 20,7,2012 Asia II 1 30.82518 N, HF935007 72.56967 E 48 Athara Hazari Punjab cotton 20,10,2012 Asia II 1 31.18108 N, HF935008 72.08419 E 49 Athara Hazari Punjab cotton 20,10,2012 Asia II 1 31.18108 N, HF935009 72.08419 E 50 Bangaypur Punjab cotton 10,10,2012 Asia II 1 31.32360 N, HF935010 73.47075 E

149

Appendices

51 Bangaypur Punjab cotton 10,10,2012 Asia II 1 31.32360 N, HF935014 73.47075 E 52 Haroonabad Punjab cotton 11,10,2012 Asia II 1 29.60275 N, HF935011 72.06562 E 53 Haroonabad Punjab cotton 11,10,2012 Asia II 1 29.60275 N, HG915744 72.06562 E 54 Haroonabad Punjab cotton 11,10,2012 Asia II 1 29.60275 N, HG915745 72.06562 E 55 Haroonabad Punjab cotton 11,10,2012 Asia II 1 29.60275 N, HG915746 72.06562 E 56 Cheechawatw Punjab cotton 20,7,2012 Asia II 1 30.35410 N, HG918181 ani Rd., 72.77836 E Burewala 57 Cheechawatw Punjab cotton 20,7,2012 Asia II 1 30.35410 N, HG315640 ani Rd., 72.77836 E Burewala 58 Cheechawatw Punjab cotton 20,7,2012 Asia II 1 30.35410 N, LN897417 ani Rd., 72.77836 E Burewala 59 Dijkot Punjab cotton 20,7,2012 Asia II 1 31.23895N, HG315643 73.00305 E 60 Dijkot Punjab cotton 20,7,2012 Asia II 1 31.23895N, HG315644 73.00305 E 61 Dijkot Punjab cotton 20,7,2012 Asia II 1 31.23895N, HG315645 73.00305 E 62 Vehari Punjab cotton 20,7,2012 Asia II 1 30.02322 N, HF935013 72.36804 E 63 Vehari Punjab cotton 20,7,2012 Asia II 1 30.02322 N, HG315642 72.36804 E 64 Burewala Punjab cotton 20,7,2012 Asia II 7 30.18446 N, HF935015 72.69987 E 65 Burewala Punjab cotton 20,7,2012 Asia II 1 30.18446 N, HG315641 72.69987 E 66 Arifwala Punjab cotton 20,7,2012 Asia II 1 30.28278 N, HG315634 73.01251 E 67 Arifwala Punjab cotton 20,7,2012 Asia II 1 30.28278 N, HG315635 73.01251 E 68 Chak 167, Punjab cotton 20,7,2012 Asia II 1 30.27497 N, HG315636 Arifwala 72.99274 E 69 Chak 167, Punjab cotton 20,7,2012 Asia II 1 30.27497 N, HG315637 Arifwala 72.99274 E 70 Chak 167, Punjab cotton 20,7,2012 Asia II 1 30.27497 N, HG315646 Arifwala 72.99274 E 71 Malumor Punjab cotton 13,11,2012 Asia II 1 31.12952 N, HG315655 72.21444 E 72 Malumor Punjab cotton 13,11,2012 Asia II 1 31.12952 N, LN897418 72.21444 E 73 Malumor Punjab cotton 13,11,2012 Asia II 1 31.12952 N, HG315656 72.21444 E 74 Liaqatpur Punjab cotton 17,7,2012 Asia II 1 28.84201 N, HG315659 70.86676 E 75 Liaqatpur Punjab cotton 17,7,2012 Asia II 1 28.84201 N, HF934998 70.86676 E 76 Liaqatpur Punjab cotton 17,7,2012 Asia II 1 28.84201 N, HG315660 70.86676 E 77 Liaqatpur Punjab cotton 17,7,2012 Asia II 1 28.84201 N, HG315661 70.86676 E 78 Chopar hatta Punjab cotton 13,11,2012 Asia II 1 30.51726 N, HG315662 71.94629 E 150

Appendices

79 Chopar hatta Punjab cotton 13,11,2012 Asia II 1 30.51726 N, HG315663 71.94629 E 80 Thana Punjab cotton 13,11,2012 Asia II 1 30.98471 N, HG315664 varyam 72.1593 E 81 Thana Punjab cotton 13,11,2012 Asia II 1 30.98471 N, HG315665 varyam 72.1593 E 82 Chak no 206 Punjab cotton 20,10,2012 Asia II 5 31.48838 N, HG315668 71.31079 E 83 Chak no 206 Punjab cotton 20,10,2012 Asia II 1 31.48838 N, HG315667 71.31079 E 84 Chak no 206 Punjab cotton 20,10,2012 Asia II 1 31.48838 N, LN897424 71.31079 E 85 Sheikhupura Punjab cotton 05,11,2012 Asia II 1 31.75619 N, HG915729 city 74.01165 E 86 Sheikhupura Punjab cotton 05,11,2012 Asia II 1 31.75619 N, HG915730 city 74.01165 E 87 Kot afzal Punjab cotton 20,10,2012 Asia II 1 31.41701 N, HG915732 71.39041 E 88 Kot afzal Punjab cotton 20,10,2012 Asia II 1 31.41701 N, LN897419 71.39041 E 89 Kot afzal Punjab cotton 20,10,2012 Asia II 1 31.41701 N, LN897421 71.39041 E 90 D.I.Khan Punjab cotton 20,10,2012 Asia II 1 31.95349 N, HG915733 chasma road 70.95004 E 91 D.I.Khan Punjab cotton 20,10,2012 Asia II 1 31.95349 N, LN897420 chasma road 70.95004 E 92 Depalpur Punjab cotton 10,10,2012 Asia II 1 30.64901 N, HG915737 73.62716 E 93 Depalpur Punjab cotton 10,10,2012 Asia II 1 30.64901 N, HG918186 73.62716 E 94 Depalpur Punjab cotton 10,10,2012 Asia II 1 30.64901 N, LN897422 73.62716 E 95 CCRI Multan Punjab cotton 13,11,2012 Asia II 1 30.14876 N, LN897423 71.43912 E 96 ARI, Punjab cotton 20,10,2012 Asia II 1 31.86930 N, HG915738 Rattakulach, 70.88420 E D.I.Khan 97 ARI, Punjab cotton 20,10,2012 Asia II 1 31.86930 N, HG915739 Rattakulach, 70.88420 E D.I.Khan 98 Shahkot Punjab cotton 5,11,2012 Asia II 1 31.58013 N, LN897426 73.49963 E 99 Riawind road Punjab chillies 5,11,2012 Asia II 1 31.23442 N, HG915740 74.24014 E 100 Riawind road Punjab chillies 5,11,2012 Asia II 1 31.23442 N, HG918187 74.24014 E 101 Riawind road Punjab chillies 5,11,2012 Asia II 1 31.23442 N, LN897425 74.24014 E 102 Kasur road Punjab brinjal 5,11,2012 Asia II 1 31.23442 N, HG915741 riawind 74.24014 E 103 Kasur road Punjab brinjal 5,11,2012 Asia II 1 31.23442 N, LN897427 riawind 74.24014 E 104 Dahranwala Punjab cotton 11,10,2012 Asia II 1 29.65390 N, HG915743 72.84086 E 105 Chak no 63, Punjab cotton 11,10,2012 Asia II 1 29.67959 N, HG918188 Hasilpur 72.57454 E 106 Chak no 63, Punjab cotton 11,10,2012 Asia II 1 29.67959 N, HG915747 Hasilpur 72.57454 E

151

Appendices

107 Chak no 63, Punjab cotton 11,10,2012 Asia II 1 29.67959 N, HG915748 Hasilpur 72.57454 E 108 Chak no 8 Punjab cotton 20,10,2012 Asia II 1 31.43663 N, HG915749 mankerah 71.52154 E 109 Chak no 8 Punjab cotton 20,10,2012 Asia II 1 31.43663 N, HG915731 mankerah 71.52154 E 110 Adda Hing Punjab cotton 20,10,2012 Asia II 1 30.53072 N, HG918189 Shah 73.54361 E 111 Adda Hing Punjab cotton 20,10,2012 Asia II 1 30.53072 N, LN897429 Shah 73.54361 E 112 7,Chak, Ford Punjab cotton 11,10,2012 Asia II 1 29.74869 N, LN897431 wah 72.77106 E 113 Khokharabad Punjab cotton 11,10,2012 Asia II 1 29.74435 N, LN897432 72.55082 E 114 Faisalabad Punjab sunflower 30,5,2012 Asia II 1 31.23469 N, HG918194 73.14074 E 115 Basti Punjab cotton 05,11,2012 Asia II 1 31.58974 N, HF935012 Qadarabad 73.63262 E 116 Hujra Shah Punjab cotton 10,10,2012 Asia I 30.74223 N, LN897428 Muqeem 73.81344 E 117 Bangla hayat Punjab weeds 10,10,2012 Asia II 1 30.94515 N, HG918193 74.20932 E 118 Rasidabad, Sindh cotton 09,9,2013 Asia II 1 25.45583 N, HG918195 TA yar 68.65445 E 119 Rasidabad, Sindh cotton 09,9,2013 Asia I 25.45583 N, HG918196 TA yar 68.65445 E 120 Rasidabad, Sindh cotton 09,9,2013 Asia II 1 25.45583 N, HG918197 TA yar 68.65445 E 121 Rasidabad, Sindh cotton 09,9,2013 MEAM 1 25.45583 N, HG918198 TA yar 68.65445 E 122 ARI, Sindh cotton 09,9,2013 Asia II 1 25.42040 N, LN897433 tandojam 68.53756 E 123 Tandoo Allah Sindh cotton 09,9,2013 MEAM 1 25.47351 N, HG918199 yar 68.7473 E 124 Tandoo Allah Sindh cotton 09,9,2013 MEAM 1 25.47351 N, HG918200 yar 68.7473 E 125 Tandoo Allah Sindh cotton 09,9,2013 MEAM 1 25.47351 N, HG918201 yar 68.7473 E 126 Tandoo Allah Sindh cotton 09,9,2013 MEAM 1 25.47351 N, HG918202 yar 68.7473 E 127 Mir pur khas Sindh cotton 09,9,2013 MEAM 1 25.51013 N, HG918203 68.9313 E 128 Mir pur khas Sindh cotton 09,9,2013 MEAM 1 25.51013 N, HG918204 68.9313 E 129 Mir pur khas Sindh cotton 09,9,2013 MEAM 1 25.51013 N, HG918205 68.9313 E 130 Khurra goth, Sindh cotton 09,9,2013 MEAM 1 25.40617 N, HG918206 Mirwah 69.0217 E 131 Mirwah Sindh cotton 09,9,2013 MEAM 1 25.2846 N, HG918207 69.0640 E 132 Mirwah Sindh cotton 09,9,2013 MEAM 1 25.2846 N, LN897434 69.0640 E 133 Tando Sindh cotton 09,9,2013 MEAM 1 25.14653 N, HG918208 Ghulam Ali 68.95059 E 134 Tando Sindh cotton 09,9,2013 MEAM 1 25.14653 N, HG918212 Ghulam Ali 68.95059 E 135 Tando Sindh cotton 09,9,2013 MEAM 1 25.14653 N, HG918213 Ghulam Ali 68.95059 E

152

Appendices

136 Maatli Sindh cotton 09,9,2013 MEAM 1 25.66602 N, HG918214 68.77709 E 137 Maatli Sindh cotton 09,9,2013 MEAM 1 25.66602 N, HG918215 68.77709 E 138 Maatli Sindh cotton 09,9,2013 MEAM 1 25.66602 N, HG918183 68.77709 E 139 Tando Sindh cotton 09,9,2013 MEAM 1 25.1312 N, HG918209 Muhammad 68.54988 E Khan 140 Tando Sindh cotton 09,9,2013 MEAM 1 25.1312 N, LN832283 Muhammad 68.54988 E Khan 141 Goth Muktar Sindh cotton 09,9,2013 MEAM 1 25.43158 N, LN832284 Arain 68.39657 E 142 Chalgri, Sindh cotton 09,9,2013 MEAM 1 25.49759 N, LN832285 Hyderabad 68.42879 E 143 Goth Ali Sindh cotton 09,9,2013 Asia II 1 25.93318 N, LN832286 Khan Baloch 68.69742 E 144 Goth Ali Sindh cotton 09,9,2013 Asia II 1 25.93318 N, LN832287 Khan Baloch 68.69742 E 145 Shadadpur Sindh cotton 09,9,2013 MEAM 1 25.92342 N, LN832288 68.6379 E 146 Shadadpur Sindh cotton 09,9,2013 Asia II 1 25.92342 N, LN897437 68.6379 E 147 Shadadpur Sindh cotton 09,9,2013 Asia II 1 25.92342 N, LN832290 68.6379 E 148 Shadadpur Sindh cotton 09,9,2013 MEAM 1 25.92342 N, LN832291 68.6379 E 149 Jhandoolo Sindh cotton 09,9,2013 Asia II 1 25.88934 N, LN832292 shah 68.57517 E 150 Jhandoolo Sindh cotton 09,9,2013 Asia II 1 25.88934 N, LN832293 shah 68.57517 E 151 Jhandoolo Sindh cotton 09,9,2013 Asia II 1 25.88934 N, LN832294 shah 68.57517 E 152 Nawab Shah Sindh cotton 10,9,2013 MEAM 1 26.22253 N, LN832295 68.34887 E 153 Nawab Shah Sindh cotton 10,9,2013 Asia II 1 26.22253 N, LN832296 68.34887 E 154 Moro Sindh cotton 10,9,2013 Asia II 1 26.13533 N, LN832297 68.27884 E 155 Moro Sindh cotton 10,9,2013 Asia II 1 26.13533 N, LN832298 68.27884 E 156 Sakrand Sindh cotton 10,9,2013 Asia II 1 26.12488 N, LN832299 68.27944 E 157 Sakrand Sindh cotton 10,9,2013 Asia II 1 26.12488 N, LN832289 68.27944 E 158 Sakrand Sindh cotton 10,9,2013 Asia II 1 26.12488 N, LN832303 68.27944 E 159 Sakrand Sindh cotton 10,9,2013 Asia II 1 26.12488 N, LN832304 68.27944 E 160 Sakrand Sindh cotton 10,9,2013 Asia II 1 26.12488 N, LN832305 68.27944 E 161 Qazi abad Sindh cotton 10,9,2013 Asia II 1 26.28635 N, LN832306 68.12127 E 162 Moro Sindh cotton 10,9,2013 Asia II 1 26.6548 N, LN832307 67.98912 E 163 Moro Sindh cotton 10,9,2013 MEAM 1 26.6548 N, LN832308 67.98912 E

153

Appendices

164 Moro Sindh cotton 10,9,2013 MEAM 1 26.6548 N, LN832311 67.98912 E 165 Dadu Sindh cotton 10,9,2013 Asia II 1 26.73394 N, LN832312 67.79275 E 166 Dadu Sindh cotton 10,9,2013 Asia II 1 26.73394 N, LN832309 67.79275 E 167 Dadu Sindh cotton 10,9,2013 Asia II 1 26.73394 N, LN832310 67.79275 E 168 Kot bahadar Punjab castorbean 09,10,2013 Asia II 1 30.9766 N, LN832300 shah 71.95323 E 169 Garh Punjab guar 09,10,2013 Asia II 1 30.82402 N, LN832302 Maharaja 71.88859 E 170 Garh Punjab guar 09,10,2013 Asia II 1 30.82402 N, LN832317 Maharaja 71.88859 E 171 Rangpur Punjab cotton 09,10,2013 Asia II 1 30.53487 N, LN832313 71.56268 E 172 Rangpur Punjab cotton 09,10,2013 Asia II 1 30.53487 N, LN832314 71.56268 E 173 Rangpur Punjab cotton 09,10,2013 Asia II 1 30.53487 N, LN832315 71.56268 E 174 Rangpur Punjab cotton 09,10,2013 Asia II 1 30.53487 N, LN832316 71.56268 E 175 Rangpur Punjab cotton 09,10,2013 Asia II 1 30.47496 N, LN832318 (desert) 71.49137 E 176 Rangpur Punjab cotton 09,10,2013 Asia II 1 30.47496 N, LN832319 (desert) 71.49137 E 177 Rangpur Punjab cotton 09,10,2013 Asia II 1 30.47496 N, LN832321 (desert) 71.49137 E 178 Rangpur Punjab cotton 09,10,2013 Asia II 1 30.47496 N, LN832322 (desert) 71.49137 E 179 Muradabad Punjab cotton 09,10,2013 Asia II 1 30.13723 N, LN832323 71.23855 E 180 Muradabad Punjab cotton 09,10,2013 Asia II 1 30.13723 N, LN832324 71.23855 E 181 Muradabad Punjab cotton 09,10,2013 Asia II 1 30.13723 N, LN832325 71.23855 E 182 Khangarh Punjab cotton 09,10,2013 Asia II 1 29.86397 N, LN832326 (pathan wala) 71.10969 E 183 Basti Ali Punjab cotton 10,10,2013 Asia II 1 29.62759 N, LN832327 Shah 71.02326 E 184 Basti Ali Punjab cotton 10,10,2013 Asia II 1 29.62759 N, LN832328 Shah 71.02326 E 185 Head Panjnad Punjab cotton 10,10,2013 Asia II 1 29.31868 N, LN832329 71.03506 E 186 Head Panjnad Punjab cotton 10,10,2013 Asia II 1 29.31868 N, LN832330 71.03506 E 187 Head Panjnad Punjab cotton 10,10,2013 Asia II 1 29.31868 N, LN832331 71.03506 E 188 Hamza wali Punjab cotton 10,10,2013 Asia II 1 29.50901 N, LN832332 70.98333 E 189 Kot samaba Punjab cotton 10,10,2013 Asia II 1 28.56961 N, LN832333 70.51266 E 190 Kot samaba Punjab cotton 10,10,2013 Asia II 1 28.56961 N, LN832355 70.51266 E 191 Kot samaba Punjab cotton 10,10,2013 Asia II 1 28.56961 N, LN832356 70.51266 E 192 Ahmad Pur Punjab cotton 10,10,2013 Asia II 1 29.14 N, LN832357 east 71.26 E

154

Appendices

193 Ahmad Pur Punjab cotton 10,10,2013 Asia II 1 29.14 N, LN832358 east 71.26 E 194 Ahmad Pur Punjab cotton 10,10,2013 Asia II 1 29.14 N, LN832334 east 71.26 E 195 Syed shahi Punjab cotton 10,10,2013 Asia II 1 29.09206 N, LN832335 wala 71.30063 E 196 Syed shahi Punjab cotton 10,10,2013 Asia II 1 29.09206 N, LN832336 wala 71.30063 E 197 Syed shahi Punjab cotton 10,10,2013 Asia II 1 29.09206 N, LN832359 wala 71.30063 E 198 Sui Vayar Punjab cotton 10,10,2013 Asia II 1 29.24542 N, LN832337 71.46305 E 199 Sui Vayar Punjab cotton 10,10,2013 Asia II 1 29.24542 N, LN832348 71.46305 E 200 Sui Vayar Punjab cotton 10,10,2013 Asia II 1 29.24542 N, LN832349 71.46305 E 201 Liaqatpur Punjab cotton 10,10,2013 Asia II 1 28.96211 N, LN832338 70.94493 E 202 Liaqatpur Punjab cotton 10,10,2013 Asia II 1 28.96211 N, LN832339 70.94493 E 203 Liaqatpur Punjab cotton 10,10,2013 Asia II 1 28.96211 N, LN832340 70.94493 E 204 Qila derawar Punjab cucurbit 10,10,2013 MEAM 1 28.84834 N, LN832341 71.00717 E 205 Qila derawar Punjab cucurbit 10,10,2013 MEAM 1 28.84834 N, LN832342 71.00717 E 206 Qila derawar Punjab cucurbit 10,10,2013 Asia II 1 28.84834 N, LN897438 71.00717 E 207 Rohi desert Punjab cotton 10,10,2013 MEAM 1 28.91774 N, LN832343 71.00942 E 208 Rohi desert Punjab cotton 10,10,2013 MEAM 1 28.91774 N, LN832344 71.00942 E 209 42 Adda Punjab cotton 10,10,2013 Asia II 1 29.20806 N, LN832345 71.75604 E 210 Desert near Punjab mungbean 10,10,2013 Asia II 1 29.19006 N, LN897439 Fort Abbas 72.27117 E 211 Desert near Punjab mungbean 10,10,2013 Asia II 8 29.19006 N, LN832346 Fort Abbas 72.27117 E 212 Desert near Punjab mungbean 10,10,2013 Asia II 1 29.19006 N, LN832347 Fort Abbas 72.27117 E 213 Jetha Bhutta Punjab cotton 10,10,2013 Asia II 1 28.66993 N, LN832350 70.72184 E 214 Jetha Bhutta Punjab cotton 10,10,2013 Asia II 1 28.66993 N, LN832351 70.72184 E 215 Muhammad Punjab cotton 10,10,2013 Asia II 1 28.52404 N, LN832352 Nagar 70.43422 E 216 Muhammad Punjab cotton 10,10,2013 Asia II 1 28.52404 N, LN832353 Nagar 70.43422 E 217 Muhammad Punjab cotton 10,10,2013 Asia II 1 28.52404 N, LN832354 Nagar 70.43422 E 218 Fort Abbas Punjab cotton 10,10,2013 Asia II 1 29.22075 N, LN835360 72.8096 E 219 Fort Abbas Punjab cotton 10,10,2013 Asia II 1 29.22075 N, LN835361 72.8096 E 220 Fort Abbas Punjab cotton 10,10,2013 Asia II 1 29.22075 N, LN835366 72.8096 E 221 Megha Punjab cotton 10,10,2013 Asia II 1 29.928 N, LN835367 Mukhainn 73.05296 E

155

Appendices

222 Megha Punjab cotton 10,10,2013 Asia II 1 29.928 N, LN835368 Mukhainn 73.05296 E 223 Megha Punjab cotton 10,10,2013 Asia II 1 29.928 N, LN835369 Mukhainn 73.05296 E 224 Lodhran Punjab cotton 21,8,2013 Asia II 1 29.59827 N, LN835370 71.61341 E 225 River satluj Punjab cotton 21,8,2013 Asia II 1 29.45027 N, LN835371 71.64148 E 226 River satluj Punjab cotton 21,8,2013 Asia II 1 29.45027 N, LN835400 71.64148 E 227 River satluj Punjab cotton 21,8,2013 Asia II 1 29.45027 N, LN835401 71.64148 E 228 Khairpur Punjab cotton 21,8,2013 Asia II 1 29.59226 N, LN835372 tamewali 72.24550 E 229 Khairpur Punjab cotton 21,8,2013 Asia II 1 29.59226 N, LN835406 tamewali 72.24550 E 230 Near chanab Punjab cotton 19,8,2013 Asia II 1 30.07434 N, LN835388 river 71.30641 E 231 Near chanab Punjab cotton 19,8,2013 Asia II 1 30.07434 N, LN835389 river 71.30641 E 232 Saraikistan Punjab cotton 19,8,2013 Asia II 1 30.07623 N, LN835390 71.09231 E 233 Saraikistan Punjab cotton 19,8,2013 Asia II 1 30.07623 N, LN835391 71.09231 E 234 Karimdad Punjab cotton 19,8,2013 Asia II 1 30.08374 N, LN835392 quraishi 70.87216 E 235 Karimdad Punjab cotton 19,8,2013 Asia II 1 30.08374 N, LN835393 quraishi 70.87216 E 236 D.G Khan Punjab cotton 20,8,2013 Asia II 1 30.01142 N, LN835394 70.64776 E 237 Yazman Punjab cotton 21,8,2013 Asia II 1 29.13760 N, LN835402 mandi 71.74631 E 238 Yazman Punjab cotton 21,8,2013 Asia II 1 29.13760 N, LN835403 mandi 71.74631 E 239 Lal sohanra Punjab cotton 21,8,2013 Asia II 1 29.42201 N, LN835404 71.97414 E 240 Lal sohanra Punjab cotton 21,8,2013 Asia II 1 29.42201 N, LN835405 71.97414 E 241 Muslim town Punjab cotton 21,8,2013 Asia II 1 29.74799 N, LN835407 72.19785 E 241 Muslim town Punjab cotton 21,8,2013 Asia II 1 29.74799 N, LN897441 72.19785 E 243 Muslim town Punjab cotton 21,8,2013 Asia II 1 29.74799 N, LN897442 72.19785 E 244 Ratha abad Sindh cotton 10,10,2013 Asia II 1 28.10269 N, LN835373 (Abaru) 69.71552 E 245 Ratha abad Sindh cotton 10,10,2013 MEAM 1 28.10269 N, LN835374 (Abaru) 69.71552 E 246 Ratha abad Sindh cotton 10,10,2013 MEAM 1 28.10269 N, LN835375 (Abaru) 69.71552 E 247 Ratha abad Sindh cotton 10,10,2013 MEAM 1 28.10269 N, LN835376 (Abaru) 69.71552 E 248 Mirpur Sindh cotton 10,10,2013 MEAM 1 28.03207 N, LN835377 Mathelo 69.51494 E 249 Mirpur Sindh cotton 10,10,2013 MEAM 1 28.03207 N, LN835385 Mathelo 69.51494 E 250 Mirpur Sindh cotton 10,10,2013 MEAM 1 28.03207 N, LN835386 Mathelo 69.51494 E

156

Appendices

251 Pano Aqil Sindh cotton 10,10,2013 MEAM 1 27.84557 N, LN835378 69.10013 E 252 Pano Aqil Sindh cotton 10,10,2013 Asia II 1 27.84557 N, LN835379 69.10013 E 253 Pano Aqil Sindh cotton 10,10,2013 Asia II 1 27.84557 N, LN835380 69.10013 E 254 Rahirm Yar Punjab cotton 10,10,2013 Asia II 1 28.43073 N, LN835381 Khan 70.21171 E 255 Rahirm Yar Punjab cotton 10,10,2013 Asia II 1 28.43073 N, LN835382 Khan 70.21171 E 256 Rahirm Yar Punjab cotton 10,10,2013 Asia II 1 28.43073 N, LN835383 Khan 70.21171 E 257 Rahirm Yar Punjab cotton 10,10,2013 Asia II 1 28.43073 N, LN835384 Khan 70.21171 E 258 Mandu dhero Sindh cotton 10,10,2013 MEAM 1 27.68715 N, LN835387 68.95315 E 259 Mandu dhero Sindh cotton 10,10,2013 Asia II 1 27.68715 N, LN835399 68.95315 E 260 Marot Sindh cotton 10,10,2013 Asia II 1 29.2279 N, LN835395 72.4414 E 261 Marot Sindh cotton 10,10,2013 Asia II 1 29.2279 N, LN835396 72.4414 E 262 Marot Sindh cotton 10,10,2013 Asia II 1 29.2279 N, LN835397 72.4414 E 263 Marot Sindh cotton 10,10,2013 Asia II 1 29.2279 N, LN835398 72.4414 E 264 Kot Sabzal Punjab cotton 10,10,2013 Asia II 1 28.26921 N, LN897440 70.01185 E 265 Vehari Punjab cotton 21,8,2013 Asia II 5 30.02344 N, LN897449 72.36599 E 266 Rahim yar Punjab cotton 07,7,2014 Asia II 5 28.26739N, LN897450 khan 70.22083E 267 Jehania Punjab cotton 21,8,2013 Asia II 1 29.99236 N, LN897454 71.84858 E 268 Kahror pakka Punjab cotton 21,8,2013 Asia II 1 29.71378 N, LN897453 72.03244 E 269 Azam chock, Punjab cotton 10,06,2014 Asia II 1 30.95167 N, LN897443 Layyah 71.28062 E 270 Chack 339, Punjab cotton 10,06,2014 Asia II 1 31.00708 N, LN897444 Layyah 71.21074 E 271 Chack 339, Punjab cotton 10,06,2014 Asia II 1 31.00708 N, LN897445 Layyah 71.21074 E 272 Bahaddar Punjab cotton 10,06,2014 Asia II 1 30.96695 N, LN897446 More, Layyah 70.99881 E 273 Bahaddar Punjab cotton 10,06,2014 Asia II 1 30.96695 N, LN897447 More, Layyah 70.99881 E 274 Karor, Punjab cotton 10,06,2014 Asia II 1 31.24522 N, LN897448 Layyah 70.96353 E 275 Bunar KPK okra 22,8,2012 Asia II 1 34.48 N, HG918192 72.48 E 276 Bunar KPK okra 22,8,2012 Asia II 1 34.48 N, HF935001 72.48 E 277 Bunar KPK okra 22,8,2012 Asia II 1 34.48 N, HF935002 72.48 E 278 Swat KPK tomato 07,7,2013 Asia II 1 34.65 N, LN897430 72.43 E 279 Mingora KPK weed 07,7,2013 Asia II 1 34.72862 N, LN897455 72.39239 E

157

Appendices

280 Osakay KPK cucumber 29,9,2013 Asia II 1 34.72556 N, HG918210 71.96398 E 281 Osakay KPK beans 29,9,2013 Asia II 1 34.72556 N, HG918211 71.96398 E 282 Osakay KPK cucumber 29,9,2013 Asia II 1 34.72556 N, LN897435 71.96398 E 283 Osakay KPK cucumber 29,9,2013 Asia II 1 34.72556 N, LN897436 71.96398 E 284 Charsadda KPK okra 19,11,2014 Asia II 1 34.12603 N, LN897451 71.73909 E 285 Charsadda KPK okra 19,11,2014 Asia II 1 34.12603 N, LN897452 71.73909 E

158

Appendices

Appendix B

Graphical representation of pTZ57R/T vector

159