Production of Three New Grapefruit Cybrids with Potential for Improved Citrus Canker Resistance

In Vitro Cell.Dev.Biol.—Plant (2017) 53:256–269 DOI 10.1007/s11627-017-9816-7

PLANT TISSUE CULTURE

Production of three new grapefruit cybrids with potential for improved citrus canker resistance

Ahmad A. Omar1,2 & Mayara Murata1 & Qibin Yu1 & Fred G. Gmitter Jr.1 & Christine D. Chase3 & James H. Graham1 & Jude W. Grosser1

Received: 6 January 2017 /Accepted: 8 March 2017 /Published online: 27 April 2017 / Editor: Wenhao Dai # The Society for In Vitro Biology 2017

Abstract Cybrid production, combining the nucleus of one polymorphism between kumquat and grapefruit and were used species with alien cytoplasmic organelles of another, is a poten- to validate the cybrids. All the cybrids had the mt genome of tially valuable method used for improvement of various crops kumquat, and most had the cp genome of kumquat with a few including Citrus species. Furthermore, this technology is con- exceptions. EST-SSR marker analysis confirmed that the nucle- sidered a non-GMO biotechnology strategy. In citrus, cybrid ar genome in all the generated cybrids came from the grapefruit plants can be produced as a by-product of somatic fusion. parent. All the cybrid clones have been propagated and are Host resistance is the most desirable strategy for control of undergoing extensive canker assays to identify any clones that citrus canker. By using a cybridization approach, several puta- have improved canker tolerance/resistance. These cybrid pop- tive cybrids were created by protoplast fusion of embryogenic ulations provide a valuable tool for investigating the contribu- suspension culture-derived protoplasts of canker resistant tion of cytoplasmic organelles to plant disease resistance. ‘Meiwa’ kumquat (Citrus japonica Thunb), with mesophyll- derived protoplasts of three grapefruit (Citrus paradisi Keywords Disease resistance . Microsatellite marker . Macfad.) cultivars ‘Marsh,’‘Flame,’ and ‘N11-11’ somaclone Organelle inheritance . Mitochondrial introns . Chloroplast of ‘Ruby Red.’ In an effort to generate new grapefruit cultivars genome with enhanced canker resistance, putative cybrid grapefruit plants morphologically equivalent to standard grapefruit from all three combinations were produced. Four mitochondrial (mt) Introduction introns, a mt ribosomal RNA spacer region, and four chloroplast (cp) DNA regions previously shown to have polymor- Citrus canker is one of the most devastating diseases for citrus phism among different Citrus species were tested. Four molec- industries in many regions around the world, which causes a ular markers, two mt DNA regions (intron nad7i2 and a rRNA huge economic loss. Citrus canker is caused by a gram- spacer), and two cp DNA regions (NADH dehydrogenase sub- negative bacteria, Xanthomonas citri subsp. citri, (Xcc) (syn- unit K (ndhk)geneandatrnG-trnR intergenic spacer) revealed onym, Xanthomonas axonopodis pv. citri strain A). Citrus spp. and relatives vary in terms of their susceptibility to citrus canker disease, with most of the commercially important Ahmad A. Omar and Mayara Murata contributed equally to this work. grown citrus types rated as susceptible hosts to Xcc * Jude W. Grosser (Schubert et al. 2001). For instance, grapefruit is highly sus- [email protected] ceptible to Xcc (Schubert et al. 2001,Grahamet al. 2004), while kumquats are considered to be highly resistant to citrus 1 University of Florida, IFAS, CREC, 700 Experiment Station Road, canker. Disease symptoms include canker lesions on leaves, Lake Alfred, FL 33850, USA stems, as well as fruit. Severe infections can cause both defo- 2 Biochemistry Department, College of Agriculture, Zagazig liation and fruit drop, which result in decreasing the produc- University, Zagazig 44511, Egypt tivity and profitability of affected trees. Blemished fruit is not 3 Horticultural Sciences Department, University of Florida, IFAS, accepted in the marketplace and can significantly impact ex- Gainesville, FL 32611, USA port potential. PRODUCTION OF THREE NEW GRAPEFRUIT CYBRIDS 257

Kumquats (Citrus japonica Thunb) (synonym, Fortunella Wallin et al. (1978) to produce cybrids, but found it to be spp.), closely related to citrus and sexually compatible, exhibit challenging and not applicable for citrus breeding. However, high levels of field resistance to citrus canker (Schubert et al. verified cybrid plants have been recovered spontaneously as a 2001). Khalaf et al. (2007) reported sharply contrasting phe- by-product from intraspecific, interspecific, and intergeneric notypes between ‘Duncan’ grapefruit (Citrus paradisi symmetric somatic hybridization experiments in plants, espe- Macfad.) and ‘Nagami’ kumquat (C. japonica) when both cially citrus (Grosser et al. 1996,Cabassonet al. 2001,Guo plants were challenged with ahighconcentrationofXcc et al. 2004b). Guo et al. (2013) reviewed cybrids arising from (108 cfu mL−1). Kumquat leaves showed rapid necrotic le- more than 40 combinations by symmetric fusion. These cybrids sions that appeared to be a hypersensitive response (HR), usually have the nuclear genome of the mesophyll parent and while grapefruit leaves showed water-soaking and blister- mitochondria (mt) genome of the embryogenic callus parent, like lesions, which are typical citrus canker symptoms. while the chloroplast (cp) genome is generally randomly Furthermore, gene expression analysis revealed a differential inherited (Grosser et al. 1996,Moreiraet al. 2000,Guoet al. transcriptional response, which suggested delayed HR in 2004b, Grosser and Gmitter 2005). Citrus somatic hybridiza- C. paradisi. In addition to the phenotype contrast, Fu et al. tion by symmetric fusion of callus protoplasts and mesophyll (2012) described different transcriptional responses to Xcc in protoplasts has been a powerful tool in citrus breeding, and ‘Meiwa’ kumquat (C. japonica)and‘Newhall’ navel orange numerous somatic hybrid plants from desirable parental com- (Citrus sinensis (L.) Osbeck) using microarrays, with ‘Meiwa’ binations have been produced (Grosser et al. 2000, Grosser and exhibiting upregulated expression of genes involved in the Gmitter 2005, 2011,Grosser et al. 2010b). Usually, regenerated response to biotic stimulus and in the defense response. diploid plants with morphological features similar to their leaf- Wang et al. (2011) found structural differences and physiolog- derived protoplast parent attracted attention, because leaf pro- ical responses to citrus canker inoculation between ‘Meiwa’ toplasts have been shown not to have the capacity for plant kumquat and ‘Newhall’ navel orange. ‘Meiwa’ kumquat regeneration in currently available culture schemes (Moreira showed lower stomatal density and smaller stomatal size than et al. 2000). By examining those diploid plants produced by ‘Newhall’ navel orange. In contrast, ‘Meiwa’ had a higher symmetric fusion, it was shown that they inherited mt DNA epicuticular wax content than ‘Newhall.’ The enzymatic ac- from the corresponding embryogenic callus or suspension cul- tivity also differed after Xcc inoculation in that ‘Meiwa’ ture parent, and the nuclear DNAwas from the leaf parent (Tusa showed significantly higher activities of catalase, peroxidase, et al. 1990, Grosser et al. 2000,Moreiraet al. 2000, Cabasson and phenylalanine ammonia-lyase in comparison with et al. 2001, Guo et al. 2004b, Grosser and Gmitter 2005). ‘Newhall.’ Also, in kumquat, genes responsive to Xcc infec- Therefore, citrus symmetric somatic cybridization makes it pos- tion included genes related to oxidative stress response and sible to transfer mt DNA-controlled traits from an embryogenic encoding proteins located in the mitochondria, the cell mem- callus/suspension parent to the leaf parent without altering cul- brane, and the chloroplast (Khalaf et al. 2011). Researchers tivar integrity (Satpute et al. 2015). Recently, Aleza et al. are trying to produce citrus plants resistant to Xcc by using (2016) were able to identify one tetraploid cybrid and several transgenic approaches (Boscariol et al. 2006, Omar et al. diploid cybrids exhibiting a range of mitochondrial and chloro- 2007,Mendeset al. 2010,Liet al. 2014,Penget al. 2015) plastic genome combinations from protoplast fusion between or by in vitro mutagenesis with ethyl methane sulphonate ‘Chios’ mandarin (Citrus reticulata) callus and ‘Clementine’ (EMS) (Ge et al. 2015). mandarin (C. reticulata) leaves or ‘Chios’ mandarin callus Moving cytoplasmic organelles between protoplasts in pro- and ‘Sanguinelli’ sweet orange (Citrus sinensis (L.) Osbeck) toplast fusion experiments was first reported by Maliga et al. callus. Previous work with putative grapefruit cybrids contain- (1982). Methods utilized to successfully achieve organelle ing cytoplasm from ‘Valencia’ sweet orange (C. sinensis (L.) transfer include removal of nuclear DNA by cytochalasin B Osbeck) showed that the cybrids exhibited improved canker (Wallin et al. 1978) and gradient ultracentrifugation (Lorz tolerance more similar to that of ‘Valencia’ than to the suscep- et al. 1981). Some researchers used these methods in attempt tible grapefruit control (J.H. Graham and J.W. Grosser, unpub- to produce cybrid plants with specific agronomical traits (Sakai lished data). Thus, it was hypothesized that cytoplasm from the and Imamura 1990, Spangenberg et al. 1990). Citrus cybrids highly canker resistant kumquat should provide an even higher were first produced by Vardi et al. (1987, 1989), by fusion of level of tolerance in the presently reported grapefruit cybrids. irradiated protoplasts (to destroy nuclei) with protoplasts whose To validate and confirm citrus somatic hybrids and cybrids, organelle genomes had been inhibited by iodoacetate (IOA). several types of molecular markers such as isozyme markers, The heterokaryons from this fusion produced asymmetric hy- amplified fragment length polymorphism (AFLP), brids or cybrids combining viable cytoplasm from the donor methylation-sensitive amplified polymorphism (MSAP), ran- protoplast parent with a functional nucleus from the recipient dom amplified polymorphic DNA (RAPD), cleaved amplified protoplast parent. In Citrus unshiu,Xuet al. (2006)triedtouse polymorphic sequence (CAPS), and simple sequence repeat the methods of Lorz et al. (1981), Maliga et al. (1982), and (SSR) have been used (Deng et al. 1992,Fuet al. 2004,Xu 258 OMAR ET AL. et al. 2005, Chen et al. 2008b,Grosseret al. 2010b,Xuet al. Material and Methods 2014). These techniques are polymerase chain reaction (PCR)-based DNA marker systems. Among the available Plant material ‘Meiwa’ kumquat habituated callus from the methods, SSR was found to be the best. In Citrus, EST-SSR citrus embryogenic callus collection of the University of markers have been used to validate and confirm nuclear and Florida’s Citrus Research and Education Center (CREC), zygotic offspring from diploid sour orange-like (Citrus × was maintained on H+H embryogenic callus medium aurantium L.) rootstocks, somatic hybrids, and somatic (Grosser and Gmitter 2011) and subcultured at regular inter- cybrids (Rao et al. 2007,Chenet al. 2008c, Grosser et al. vals of 30 d. Suspension cultures were established and main- 2010b, Satpute et al. 2015). SSRs have been used to investi- tained with protoplasts isolated during days 4–12 from a 2-wk gate the sources of donor genomes and the level of ploidy in subculture cycle, according to the method of Grosser and sexual hybrids, somatic hybrids, and cybrids (Chen et al. Gmitter (1990) and Grosser et al. (2010a). Seeds of ‘Marsh’ 2008a,Grosseret al. 2010b,Alezaet al. 2016). white grapefruit, ‘Flame’ dark red grapefruit, and ‘N11-11’ Most of the molecular markers research in Citrus has been somaclone of ‘Ruby Red’ grapefruit were aseptically germi- based on the total DNA or on the nuclear genome of the target nated in vitro and seedlings were maintained on rooting me- samples. However, besides the nuclear genome, the plants have dium (RMA) in Magenta™ boxes GA-7 (Magenta® two cytoplasmic genomes, the cp DNA and mt DNA. Studies Corporation, Chicago, IL) according to Grosser et al. showed that these organelle genomes can be used as markers (2010a). Fully expanded leaves were used for mesophyll pro- for evolutionary, ecological, and taxonomic studies (Petit et al. toplast isolation. Shoots of the seedlings were subcultured on 2005,Tsurutaet al. 2008, Bayer et al. 2009,Penjoret al. 2013). RMA medium in Magenta boxes as needed to provide a con- The plant mt genome is very large, ranging from 200 to 2400 kb tinuous source of sterile leaves (Grosser et al. 2010a). Table 1 and it contains well-conserved regions as exon sequences, fa- shows fusion parents used in the protoplast fusion cilitating the identification of consensus regions within coding experiments. sequences (Duminil et al. 2002). However, noncoding sequences such as mt introns or intergenic spacers are preferably Protoplast isolation, PEG fusion, protoplast culture and used as genetic markers due to the higher rate of base substitu- plant regeneration Protoplasts of suspension cultures and tions and insertion/deletion (indel) mutations compared to leaf parents (Table 1) were isolated and purified according to exons (Laroche et al. 1997). Grosser (2011) developed 13 Grosser and Gmitter (1990)andGrosseret al. (2010a). All new primer sets for the amplification of mt introns across a media used in these experiments were prepared according to wide array of plant taxa and large indel polymorphisms were Grosser and Gmitter (1990)andGrosseret al. (2010a). All identified in plant mt intron amplicons among Citrus species. chemicals for media preparation used in this study were ob- These polymorphisms have proven to be useful for confirma- tained from Sigma-Aldrich® (St. Louis, MO). The protoplast tion of Citrus cybrids (Satpute et al. 2015). Likewise, conserved densities in the suspensions were adjusted to (0.5– coding and less conserved intergenic regions of the cp genome 1) × 106 cells mL−1. After mixing callus protoplasts with leaf facilitate PCR screening for polymorphism. RFLP and PCR- protoplasts at a 1:2 ratio, somatic fusion was performed by the RFLP in cp genome have been performed for citrus phyloge- polyethylene glycol (PEG) method (Grosser and Gmitter netic studies (Green et al. 1986, Yamamoto et al. 1993, Cheng 1990,Grosseret al. 2010a). After fusion, the protoplast sus- et al. 2005 ), chloroplast inheritance in sexual crosses (Moreira pensions were cultured in the same Petri dishes. After 2 wk, et al. 2002), and protoplast fusion experiments (Cheng et al. the first reduction of the osmotic pressure was done by adding 2003,Grosseret al. 2010b). In addition, two universal cp prim- 150 μLof0.6MBH3to0.6MEMEto0.146MEME er pairs successfully produced amplicons that revealed poly- (Grosser and Gmitter 1990) in a ratio of 1:1:1 (v/v/v), then at morphism for citrus cybrid confirmation (Satpute et al. 2015). 4 wk of culture, the second reduction of the osmotic pressure In the present study, new combinations of organelle and wasdonebyadding200μL of the same mixture. Protoplast- nuclear genomes were confirmed in cybrids created from three derived callus masses were transferred to solid EME sucrose different somatic fusion parental combinations: ‘Meiwa’ kum- medium (Murashige and Tucker (MT) basal medium quat as embryogenic suspension (mt donor) and three different (Murashige and Tucker 1969)containing50gL−1 sucrose, grapefruit cultivars ‘Marsh,’‘Flame,’ and ‘N11-11’ and 500 mg L−1 malt extract, 8 g L−1 Agar-agar, pH 5.8) for somaclone of ‘Ruby Red’ as the leaf parents (nucleus donor). callus and embryo induction. If embryos did not develop, the Multiple recovered diploid plants from all three combinations calluses were transferred to solid EME-maltose medium (MT exhibited the typical grapefruit phenotype and were all vali- basal medium containing 50 g L−1 maltose, and 500 mg L−1 dated as somatic cybrids. This work associated novel nuclear- malt extract, 8 g L−1 Agar-agar, pH 5.8). After 3–4 wk, recov- organelle genome combinations with potential to improve de- ered embryos were cultured on 25 mm, 0.22 μm cellulose sirable tolerance to citrus canker, in commercially important acetate membrane disks (Thermo Fisher Scientific®, grapefruit cultivars. Waltham, MA), which were laid on fresh EME-maltose PRODUCTION OF THREE NEW GRAPEFRUIT CYBRIDS 259

Table 1 Fusion parents used in the somatic cybridization Cybrid ID Fusion parents experiments. Embryogenic parentz Non-embryogenic leaf parenty

M1-M115 ‘Meiwa’ kumquat ‘Marsh’ grapefruit F1-F25 ‘Meiwa’ kumquat ‘Flame’ grapefruit N1-N27 ‘Meiwa’ kumquat ‘N11-11’ somaclonal of ‘Ruby Red’ grapefruit

z Protoplasts derived from embryogenic cell suspension culture of ‘Meiwa’ kumquat y Leaf mesophyll cells used to obtain protoplast from all grapefruit fusion parents medium for embryo normalization. Next, embryos were cul- Flow cytometry analysis A small piece of tissue (0.25 mm2) tured on EME-1500 medium (MT basal medium containing from each plantlet was collected and a similar leaf piece was 50 g L−1 maltose, and 1.5 g L−1 malt extract, 8 g L−1 Agar- taken from a diploid control plant. Using a razor blade, sam- agar, pH 5.8) for embryo enlargement, followed by one or two ples were chopped in a small plastic Petri dish containing passages on B+ embryo germination medium (Grosser and 0.5 mL of a nuclei extraction buffer (CyStain® UV Precise Gmitter 1990, Grosser et al. 2010a). Sometimes, embryos P, Partec, Görlitz, Germany). Chopped material was filtered merely increased in size with abnormal shapes but failed to through 30-μm nylon filter (CellTrics®, Sysmex, Milton germinate. In these cases, embryos were sliced horizontally Keynes, UK). After filtration, samples were stained with (5 mm) with a sharp scalpel and cultured directly on DBA3 1 mL of a 4,6-diamine-2-phenylindol (DAPI) staining solu- medium for adventitious shoot induction (Deng et al. 1992). tion (CyStain® UV Precise P). After 5 min incubation, stained The cell lines were kept at 25°C under a photosynthetic pho- samples were run on a ploidy analyzer (Partec PA, Münster, ton flux density of 50 μmol m−2 s−1 light radiation provided Germany) flow cytometer equipped with a HBO 100-W high- by two 32 W white fluorescent lamps (Philips Lighting, pressure mercury bulb and both KG1 and BG38 filter sets. Somerset, NJ) and 16-h photoperiod, until embryo formation. Each histogram was generated by the analysis of at least All liquid media were filter-sterilized using 0.2 μm filter 5000 nuclei. (Thermo Fisher Scientific®) while the solid media were autoclaved at 103 kPa, 121°C for 20 min. Molecular characterization of regenerated plants DNA ex- Regenerated shoots (1–2 cm) were used to determine the traction Total cellular DNA was isolated from two-yr-old ploidy level, then excised and transferred to RMA rooting greenhouse grown cybrid plants. Fully expanded leaf tis- medium (1/2 MS supplemented with 30 g L−1 sucrose, sues (100 mg) were frozen in liquid nitrogen and 0.5 mg L−1 1-naphthaleneacetic acid (NAA), 0.1 mg L−1 disrupted using a Tissue Lyser II (Qiagen®, Valencia, idol-3-butyricacid(IBA),8gL−1 Agar-agar, and CA) for quick pulverization. Tissue lysis was performed 0.5 L−1 g active carbon, pH 5.8). Plant growth regulators at 30 Hz for 1 min and total DNA was extracted with were added to the medium before autoclaving. Well-rooted DNeasy® Plant Mini Kit (Qiagen®) according to the plantlets on RMA medium were planted into soil (vermicu- manufacturer’s protocol. The concentration of DNA was lite, Canadian sphagnum peat moss, coarse perlite, dolomit- determined using NanoDrop® ND-1000 spectrophotome- ic limestone, long-lasting wetting agent, and ter (Thermo Fisher Scientific®). The DNA samples were RESiLIENCE®) (Sun Gro® Horticulture Distribution diluted to the concentration of 20 ng μL−1 in distilled Inc., Agawam, MA) and moved to the greenhouse under water and used for further analysis or stored at −80°C. 70% shade achieved by using SunBlocker™ Premium PolyMax Bulk Polyethylene Knitted Shade—70% Plant genotyping For nuclear genotyping, six EST-SSR loci, (FarmTek®, Dyersville, IA) for acclimation, then after CX6F04, CX6F18, CX6F29, CX6F06, CX0010, and CX2021, 30 d moved under regular greenhouse light (SunBlocker™ were utilized as described previously by Chen et al. (2006)and Premium PolyMax Bulk Polyethylene Knitted Shade— Chen et al. (2008a). Fluorescently labeled EST-SSR PCR prod- 30%) (FarmTek®). Plantlets with poor roots were either ucts were fractionated on a Genetic Analyzer (3130 xL; Applied in vitro micrografted onto seedling rootstocks of Carrizo Biosystems®, Foster City, CA). Chromatographic peaks were citrange trifoliate rootstock or shoot-tip grafted onto well- analyzed and exported into an Excel file using GeneMarker® established rootstocks of Carrizo in the greenhouse analysis software (SoftGenetics®, State College, PA). (Navarro 1992,Omaret al. 2007). Use of a trifoliate hybrid The PCR primers used for organelle genotyping are de- rootstock such as Carrizo citrange allowed easy identifica- scribed in Table 2. For mt genotyping, forward and reverse tion and removal of adventitious shoots regenerating direct- primers flanking four mt introns of genes coding for NADH ly from the rootstock. dehydrogenase subunits 4 and 7 (nad4i1, nad4i2, nad7i1, and 260 OMAR ET AL.

Table 2 PCR primer pairs used for organelle genotyping of grapefruit cybrids.

Primer Target Forward primerz Reverse primerz Amplicon sizey

Marsh Flame N11-11 Meiwa

MRCP09 Plastid trnD-psbM Igsx CAATTGGTCAGAGCACCG GGCAGTAGGAACTA 1300 1300 1300 1300 GAATGAA MRCP03 Plastid rps16 intron GTTCTTGTAGGTTGAGCACC GATGTGGTAGAAAG 1517 1517 1517 1517 CAACGTG SPCC1 Plastid trnG-trnR Igsx CTTCCAAGCTAACGATGC CTGTCCTATCCATTAGACAA 231 231 231 219 TG MRCP13 Plastid atpF-atpA Igsx GTACGATTCGTGCTAATATT GTATCTGTGGCTACTGCTG 1200 1200 1200 1200 GGC MRCP17 Plastid ndhk CTCCTCGAACAGTACTATAGG GTGCTTATCCTAGTTGTTGG 469 469 469 463 CC309/312 Mitochondrial nad7i1 ACGGAGAAGTGGTGGAACG TTTCTCAGTCCCTCTAGTCG 1300 1300 1300 1300 CC363b/364b Mitochondrial nad7i2 AGATGCCAGCGGAATGAT GTGTTCTTGGGCCATCATAG 1321 1321 1321 1305 CC403/406 Mitochondrial nad4i1 AGGGGCCTTGTGCAGTAAA CTTTCTTTGTCTCGAACCCC 1400 1400 1400 1400 CC497/498 Mitochondrial GAGGTCGGAATGGGATCGGG GGGTGAAGTCGTAA 243 243 243 235 rrn5/rrn18-1 CAAGGT CC361/362 Mitochondrial ccmFc i1 TTTCACATGGAGGAGTGTGC TTCCCCATATGGAGTTCG 1000 1000 1000 1000 z Primer sequences are given in 5′ to 3′ orientation y Amplicon sizes are given in DNA base pairs x Igs, intergenic spacer nad7i2), a cyctochrome c maturation fc (ccmfc)geneandamt The primer pairs that successfully produced an amplicon ribosomal RNA spacer region (Grosser 2011, Satpute et al. were selected and PCR products were analyzed by Criterion™ 2015) were tested to identify polymorphism between ‘Meiwa’ 5or10%(w/v) pre-cast polyacrylamide gel (Bio-Rad® kumquat and ‘Marsh,’‘Flame,’ and ‘N11-11’ somaclone of Laboratories) for polymorphism screening. Samples contain- ‘Ruby Red’ grapefruits. PCR reactions were performed in ing 1 μL of PCR product, 4 μL of distilled water, and 1 μLof 25 μL reaction mixtures containing 50 ng of total plant DNA, 6X orange-blue loading dye (Promega® Corp.) were run at 0.4 μM of forward and reverse primers (Sigma-Aldrich®), 90–160 V for 2–4 h in 1X TBE buffer. The amplicon sizes 0.5 mM dNTP mix, 2.5 U TaKaRa Ex Taq® DNA were estimated by comparison with the G210A 100 base pair Polymerase Hot-Start Version (Clontech, Mountain View, DNA ladder (Promega® Corp.). All gels were stained in CA), and 1X TaKaRa Ex Taq® Hot-Start reaction buffer. For ethidium bromide solution (1 μgmL−1) for 15 min under slow cp genotyping, five primer pairs developed for amplification of agitation and visualized over an ultraviolet (UV) trans- cp DNA regions were selected (atpF-atpA, trnD-psbM, trnG- illuminator (Bio-Rad® Laboratories). Confirmation of poly- trnR intergenic regions, rps16 intron, and ndhk gene) (Tsuruta morphism on mt and cp markers was done by band pattern et al. 2008,Satputeet al. 2015). The PCR reactions were per- comparison between cybrid and parental amplicon sizes. formed in 25 μL reaction mixtures that contained 50 ng of total plant DNA, 0.4 μM of forward and reverse primers, and 2X Sequencing The full-length amplicons of the molecular GoTaq® Hot Start Polymerase master mix (Promega® Corp., markers that showed polymorphism among kumquat and Madison, WI). All of the PCR amplifications relied on 30 cy- grapefruit varieties were sequenced to determine the polymor- cles of denaturation for 1 min at 94°C, followed by annealing phism site. The reference amplicons in this study were ampli- for2minat55°C,and3minofextensionat72°CinaPTC- fied from ‘Ruby Red’ grapefruit. The PCR products were 100® programmable thermocycler (Bio-Rad® Laboratories, purified with Amicon® Ultra-0.5 mL Centrifugal Filters Hercules, CA). The amplification products were confirmed by (Merck KGaA, Darmstadt, Germany) for primer removal electrophoresis through a 1% (w/v) agarose gel. A combination and sequenced at Genewiz® (South Plainfield, NJ) by of 8 μL of PCR product and 2 μL of 5X loading dye (Bioline, Sanger DNA sequencing. The nucleotide sequences were Taunton, MA) was loaded in each agarose well. The amplicon aligned using the ClustalW program inserted in Biology sizes were estimated by comparison with the DNA Hyperladder WorkBench 3.2. (SDSC-UC, San Diego, CA). II™ (Bioline). Agarose gels were run in 1X Tris-Borate-EDTA (TBE) buffer (0.1 M Trizma base, 0.1 M boric acid, and Cleaved amplified polymorphic sequences (CAPS) After 0.0025 M Na2EDTA at pH 8.2) under constant voltage at sequencing, some polymorphism sites were successfully 80 V for 45 min. identified as targets for restriction endonucleases. For the PRODUCTION OF THREE NEW GRAPEFRUIT CYBRIDS 261 mt marker nad7i2 and for the cp marker trnG/trnR,PCR Results and Discussion products were digested with restriction enzymes Hpa II and Pac I (Thermo Fisher Scientific®), respectively. For Protoplast culture and plant regeneration Most protoplasts Hpa II, enzymatic digestion was performed by mixing cultured after PEG treatment underwent first division approxi- 10 μL of PCR product to 1 μL (10 U) of enzyme, 2 μL mately 12 d after initial plating (personal observation, J.W. of 10X Thermo Fisher Scientific® Tango™ Buffer Grosser). After another 50 d of protoplast culture, numerous (33 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, microcalluses emerged (Fig. 1a). At this stage, the cell colonies 66 mM potassium acetate, 0.1 mg mL−1 BSA), and 7 μLof were transferred onto solid EME sucrose medium for induction distillated water. For Pac Idigestion,10μLofPCRprod- of callus and embryos. After 4 wk of additional subculture, cell uct was added to a mixture containing 1 μL (10 U) of clusters developed into green globular embryos (Fig. 1b), enzyme, 2 μL of 10X restriction buffer (10 mM Bis-Tris whereas some others produced abundant fast-growing callus −1 Propane-HCl (pH 6.5), 10 mM MgCl2, 0.1 mg mL BSA), masses (Fig. 1c), not forming embryos regardless of a long- and 7 μL of distillated water. Both mixtures were incubat- term culture period. The embryos originating from cell clusters ed for 120 min at 37°C. The digested products were loaded were subcultured onto solid EME-maltose and/or EME-1500 (5 μL of digestion product and 1 μL of 5X loading buffer) medium for several cycles for embryo enlargement and germi- and were screened for polymorphisms by electrophoresis nation, and a few produced normal shoots after 2–3moof through a 1.5% (w/v)agarosegel. culture (Fig. 1d, e). Ploidy level of the generated shoots was

Figure 1 Somatic embryogenesis in citrus following protoplast fusion. (a) Protoplast-derived microcalluses. (b) Cell clusters with developing green globular embryos 4 wk after subculture on EME-maltose. (c) Fast-growing friable callus. (d)Enlargedembry- os on EME-1500 medium. (e) Embryos germinating and producing normal shoots after 2–3moin culture. (f) Shoots on root- induction medium for shoot elongation and root development. (g), (h) Shoot-tip grafting onto rootstock liners in the greenhouse. (i) Generated cybrids of ‘Marsh’ (M43), ‘Flame’ (F11), and ‘N11- 11’ (N10) grapefruit. (j) Leaf morphology of ‘Marsh’ grapefruit, ‘Meiwa’ kumquat, and M30 cybrid. (k) Leaf morphology of ‘Flame’ grapefruit, ‘Meiwa’ kumquat, and F9 cybrid. (l) Leaf morphology of ‘N11-11’ grapefruit, ‘Meiwa’ kumquat, and N15 cybrid. Scale bars (a)0.5cm;(b– e)2cm;(f)1.5cm;(g, h)10cm;(i) 30 cm, (j–l)3cm. 262 OMAR ET AL. PRODUCTION OF THREE NEW GRAPEFRUIT CYBRIDS 263

R Figure 2 Flow cytometry analysis of the somatic cybrid and their ‘ ’ parents. (a) Standard diploid key lime (Citrus aurantifolia)adjustedto Ruby Red grapefruit cybrids respectively, in addition to four channel ~100. (b) ‘Meiwa’ kumquat. (c) Standard ‘Marsh’ grapefruit was tetraploid plantlets, three from ‘Meiwa’ + ‘Marsh’ and one used as the control, and dominant peak of its ploidy level adjusted to from ‘Meiwa’ + ‘Flame’. The tetraploid plantlets were not ~100. (d) Example of ‘Meiwa’ + ‘Marsh’ cybrids (M33). (e) Standard able to regenerate into whole plants as all of them died on ‘Flame’ grapefruit was used as the control, and dominant peak of its ploidy level adjusted to ~100. (f)Exampleof‘Meiwa’ + ‘Flame’ (F3). the RMA medium. All the generated diploid plants exhibited (g) Standard ‘Ruby Red’ grapefruit was used as the control, and dominant typical diploid grapefruit morphology, and thus were propa- peak of its ploidy level adjusted to ~100. (h) Example of ‘Meiwa’ + ‘N11- gated for further analyses. No diploid plants with kumquat 11’ grapefruit (N24) at channel ~100. morphology were regenerated (Table 3).

determined at this stage as a fast screening method for the Molecular identification of recovered plants recovered in vitro plantlets. The regenerated shoots (1–2cm long) were excised and transferred to RMA root-induction me- Plant genotyping Polymorphisms between the parents were dium for shoot elongation and root development (Fig. 1f). The revealed by the use of molecular markers that allowed geno- regenerated shoots were shoot-tip grafted onto small trifoliate type identification and confirmation of all the regenerated rootstock plants (liners) in the greenhouse (Fig. 1g, h). By using cybrid clones. In the current study, SSRs have been used for the shoot-tip grafting technique, 115, 25, and 27 plants were validation of the nuclear genome source in the new grapefruit ‘ ’‘ ’ ‘ ’ generated of Marsh, Flame, and N11-11 somaclone of somatic cybrids. Based upon six EST-SSR markers used to ‘ ’ Ruby Red grapefruit cybrids, respectively (Fig. 1i), each from test the nuclear genomic composition of the putative cybrids, independent regeneration events. No visual morphological dif- all regenerants in the three combinations carried the allelic ferences among all the regenerated cybrids plants and those of composition of grapefruit genomic DNA. Figure 3 shows ‘ ’‘ ’ ‘ ’ ‘ normal Marsh, Flame, and N11-11 somaclone of Ruby the EST-SSR loci CX6F06 and CX0010 histogram with ’ Red grapefruit were observed (Fig. 1j, k, l). ‘Meiwa,’‘Marsh,’‘Flame,’ and ‘N11-11’ and the regenerated cybrids of ‘Marsh,’‘Flame,’ and ‘N11-11’ somaclone of Ploidy level of regenerated plants The ploidy level of regen- ‘Ruby Red’ grapefruit. When the amplified DNA fragments erated putative cybrid grapefruit plants was determined by are visualized using an ABI Genetic Analyzer, a codominant flow cytometry. Diploid standard ‘Key Lime’ (Citrus EST-SSR marker in a diploid individual can have one homo- aurantifolia) was used to adjust the analysis parameters zygous allele (one peak) or two heterozygous alleles (two (Fig. 2a). ‘Meiwa’ parent showed a diploid peak (Fig. 2b). peaks) (Chen et al. 2008a). For example, as shown in For ploidy analysis of the cybrids, fresh leaves of diploid Fig. 3a, CX6F06 locus was homozygous (one peak at 171) ‘Marsh,’‘Flame,’ and ‘Ruby Red’ grapefruit were used as in ‘Marsh,’‘Flame,’ and ‘N11-11’ somaclone of ‘Ruby Red’ the controls, and dominant peaks of their ploidy level were grapefruit and their respective cybrids M59, F3, and N9 re- adjusted to channel ~100 (Fig. 2c, e, g). Flow cytometry respectively and heterozygous (two different alleles producing vealed that dominant peaks of all resulting ‘Meiwa’ + ‘Marsh’ two peaks at 145 and 157) in ‘Meiwa’ kumquat. Furthermore, cybrid plants were all near channel 100 as shown for cybrid CX0010 locus was heterozygous (two different alleles pro- M33 (Fig. 2d). Furthermore, cybrids of ‘Meiwa’ + ‘Flame’ ducing two peaks at 220 and 227) in ‘Meiwa’ kumquat and exhibited peaks very similar peak to the standard ‘Flame’ also heterozygous (two peaks at 217 and 230) in ‘Marsh,’ plants as displayed for cybrid F3 (Fig. 2f). Figure 2h shows ‘Flame,’ and ‘N11-11’ somaclone of ‘Ruby Red’ grapefruit that cybrid of ‘Meiwa’ + ‘N11-11’ somaclone of ‘Ruby Red’ and their putative cybrids M59, F3, and N9 respectively grapefruit (N24) had a similar peak to the standard ‘Ruby (Fig. 3b). Consequently, the somatic cybrid nuclear genomes Red’ (Fig. 2g). Out of the three combinations used in this was verified as containing the alleles from the grapefruit par- study, 167 diploid plants were generated, 115, 25, and 27 ent that are not found in ‘Meiwa’ Kumquat. The allelic com- plants of ‘Marsh,’‘Flame,’ and ‘N11-11’ somaclone of binations of ‘Meiwa’ kumquat, different from those of

Table 3 Possible combination outcomes from protoplast fusion combining ‘Meiwa’ kumquat and grapefruits varieties, and the number of successful regenerated cybrids of each.

Outcome 1 Outcome 2 Outcome 3 Outcome 4 Outcome 5 Outcome 6 Outcome 7 Outcome 8 DNA type Parent 1 Cybrid Cybrid Cybrid Cybrid Cybrid Cybrid Parent 2

Nucleus Grapefruit Grapefruit Grapefruit Grapefruit Kumquat Kumquat Kumquat Kumquat Mitochondria Grapefruit Kumquat Kumquat Grapefruit Grapefruit Grapefruit Kumquat Kumquat Chloroplast Grapefruit Grapefruit Kumquat Kumquat Grapefruit Kumquat Grapefruit Kumquat Total01912500000 264 OMAR ET AL. standard grapefruit and the three cybrid grapefruit types are markers, the plastid ndhk gene (MRCP17) (Fig. 4a) depicted in Table 4. and the plastid trnG-trnR intergenic region (SPCC1) For cp DNA analysis, of five cp primer pairs that (Fig. 4b) were selected to screen the cybrid clones. A were tested, only three of the primer pairs clearly re- total of 144 cybrids were screened, 97 of ‘Marsh,’ 21 of vealed polymorphism between ‘Meiwa’ kumquat and ‘Flame’, and 26 of ‘N11-11.’ The cp molecular markers grapefruit varieties on polyacrylamide gels. Two showed that two ‘N11-11’ somaclone of ‘Ruby Red’

Figure 3 A graphic example of expressed sequence tag–simple The somatic cybrids, ‘Marsh’, ‘Flame,’ and ‘N11-11’ somaclone of sequence repeat (EST-SSR) genotypes in two parents and their putative ‘Ruby Red’ grapefruit, were verified as its alleles (indicated as cybrids using SSR primers (loci), CX6F06 (a) and CX0010 (b). It was positional peaks in this figure and sizes in Table 4). generated from ABI trace files by GeneMarker® software (SoftGenetics). PRODUCTION OF THREE NEW GRAPEFRUIT CYBRIDS 265

Table 4 Organelle and nuclear genotypes of grapefruit cybrids and their parents.

Cybrid ID Parent/cybrid Ndhkx (bp) Nad7i2y (bp) EST-SSR markersz (base pair)

CX6F04B CX6F18G CX6F29Y CX6F06R CX0010B CX2021

M1-M115 Mewia 463 1305 150/163 160/160 144/154 145/157 220/227 150/150 Cybrid 463/469 1305 163/174 155/160 152/154 171/171 217/230 150/153 Marsh 469 1321 163/174 155/160 152/154 171/171 217/230 150/153 F1-F25 Cybrid 463/469 1305 163/174 155/160 152/154 171/171 217/230 150/153 Flame 469 1321 163/174 155/160 152/154 171/171 217/230 150/153 N1-N27 Cybrid 463/469 1305 163/174 155/160 152/154 171/171 217/230 150/153 N11-11 469 1321 163/174 155/160 152/154 171/171 217/230 150/153 z EST-SSR primer amplified amplicon size from chromatogram y Amplicon size of nad7i2 mitochondrial primer pair amplified PCR product x Amplicon size of ndhk plastid primer pair amplified PCR product, some cybrid amplified grapefruit band and the others Meiwa band cybrids and 17 ‘Marsh’ cybrids had grapefruit cp ge- (Moreira et al. 2000). Perhaps accumulated mutations in nome markers. All the other cybrids presented the kum- thegenomeofthe‘Meiwa’ suspension culture contrib- quat cp genome markers (Table 5). Thus, cp inheritance uted to this outcome. Although there was not an attempt in the generated cybrids was skewed strongly towards to regenerate plants directly from ‘Meiwa’ kumquat leaf the kumquat parent. This was unexpected as the cp ge- protoplasts, it is known from extensive previous work nome has been shown to be randomly inherited in pre- that plants have never been regenerated directly from vious cybrids from other parental combinations in citrus citrus leaf protoplasts of any genotype (Grosser and

Figure 4 Electrophoretic separation showing polymorphic PCR amplicons of CC363b/364 primers digested with restriction enzyme Hpa products between ‘Meiwa’ kumquat and grapefruit varieties obtained II. M1 100 base pair DNA ladder, M2 DNA Hyperladder II™, R ‘Ruby using cp and mt molecular markers. Ethidium bromide stained Red’ grapefruit amplicon, K ‘Meiwa’ kumquat amplicon, M ‘Marsh’ polyacrylamide gels using (a) plastid primers MRCP17 (ndhk), (b) grapefruit amplicon, F ‘Flame’ grapefruit amplicon, N ‘N11-11’ grape- plastid primer SPCC1 (trnG/trnR), (c) PCR amplicons of SPCC1 fruit amplicon, V ‘Valencia’ sweet orange amplicon, CY Cybrid. All primers digested with restriction enzyme Pac I, (d) mt primers CC497/ cybrids presented in this figure showed kumquat cp and mt sequences. 498 (rrn5/rrn18-1), (e) mt primers CC363b/364b (nad7i2), and (f)PCR 266 OMAR ET AL.

Table 5. Mitochondrial and chloroplast genotype of regenerated cybrids between ‘Meiwa’ kumquat and ‘Marsh,’‘Flame,’ and ‘N11-11’ somaclone of ‘Ruby Red’ grapefruit screened with four different molecular markers.

SPCC1 MRCP17 CC363b/364b CC497/498

Plastid trnG-trnR Igs Plastid ndhk Mitochondrial nad7i2 Mitochondrial rrn5/rrn18-1

Cybrids Grapefruit Kumquat Grapefruit Kumquat Grapefruit Kumquat Grapefruit Kumquat

‘Meiwa’ kumquat + ‘N11-11’ grapefruit 2 24 2 24 0 26 0 26 ‘Meiwa’ kumquat + ‘Flame’ grapefruit 0 21 0 21 0 21 0 21 ‘Meiwa’ kumquat + ‘Marsh’ grapefruit 17 80 17 80 0 97 0 97

Gmitter 1990, Grosser and Gmitter 2011). The results 364b) and mt RNA spacer rrn5-rrn18 (CC497/498), reported herein demonstrate that the standard model cit- produced amplicons that successfully showed polymor- rus somatic hybridization technique can be used to gen- phisms between ‘Meiwa’ kumquat and the grapefruit erate targeted cybrids in citrus as reported previously varieties (Fig. 4 d, e) on polyacrylamide gels. In con- (Guo et al. 2004a,Guoet al. 2013,Alezaet al. trast to cp molecular markers, mt molecular markers 2016). Cybridization is a potential source of genetic showed that all cybrids presented ‘Meiwa’ kumquat mt variability for breeding programs; however, the practical DNA sequences as expected (Table 5). It is expected value of cybrids has not been fully realized, as the that the application of molecular markers and omics- influence of cp and mt genomes on important based techniques for characterization and assessment of horticultural traits is still poorly understood. Satpute new somatic cybrids, will expand our knowledge of et al. (2015) previously reported grapefruit cybrids con- organelle inheritance patterns, interactions with nuclear taining ‘Dancy’ mandarin cytoplasm produce fruit with genomes and associations with fruit quality traits, and higher sugar/acid ratios and an extended harvest period, differential responses to abiotic and biotic stresses. and it resulted in the newly released cultivar N2-28 Possible diploid outcomes of protoplast fusion between (Summer Gold Grapefruit). ‘Meiwa’ kumquat and grapefruit varieties and numbers of The screening of five mt molecular markers revealed successful regenerated cybrids of each outcome are pre- that only two mt markers, mt intron nad7i2 (CC363b/ sented in Table 3. As mentioned, two different patterns of

Figure 5 Sequence alignment of PCR products of ‘Meiwa’ kumquat primers MRCP17 (ndhk), (c) mt primers CC363b/364b (nad7i2), and (Fortunella crassifolia) and ‘Ruby Red’ grapefruit (Citrus paradisi) (d) mt primers CC497/498 (rrn5/rrn18-1). Polymorphism sites are repre- amplified with (a) plastid primers SPCC1 (trnG/trnR), (b) plastid sented in bold. PRODUCTION OF THREE NEW GRAPEFRUIT CYBRIDS 267 cybrids were produced via protoplast fusion between died before whole plants were regenerated. All of the cybrids ‘Meiwa’ kumquat and the three grapefruit varieties exhibited the nuclear genome of grapefruit and the mt genome (Table 3). The first outcome was the cybrid with grape- of kumquat as expected. Most of the cybrids exhibited the cp fruit nuclear genome, kumquat cp genome, and kumquat genome of kumquat, with only a few exhibiting the grapefruit mt genome. The second outcome was a cybrid with grape- cp genome. All of the cybrids reported herein have been prop- fruit nuclear genome, grapefruit cp genome, and kumquat agated and entered into extensive canker resistance assays, mt genome. These results confirmed the previously re- with results to be published in a subsequent manuscript. ported data that citrus somatic hybrids or cybrids always Preliminary results have been quite encouraging. The two acquired the mt genome from the callus/cell suspension categories of cybrids now available will help determine the parent, not from the leaf parent (Grosser et al. 1996, role of both the kumquat mt and cp genomes in any resulting Grosser et al. 2000). The different cybrids reported herein improvement in canker tolerance. A few of the regenerated will provide an opportunity to study the influence of kum- cybrid grapefruits have also been planted in the field in a high quat cp and mt genomes on grapefruit horticultural traits. canker-pressure location. The cybrid grapefruit clones will In addition, the latter cybrid pattern will allow a compar- also be subsequently evaluated for horticultural traits (e.g. ison of the function of kumquat cp versus grapefruit cp in maturity date, sugar/acid ratios), and also for tolerance to the grapefruit cybrids. These new cybrids should also be HLB (Huanglongbing or citrus greening disease). Continued further examined to determine if any kumquat nuclear research should lead to insights regarding nuclear/cytoplasmic DNA has been transferred in the cybridization process. genome interactions, and their manipulation as a tool for breeding improved cultivars. Sequencing The full-length sequencing of the four molecular markers that showed polymorphism between ‘Meiwa’ kumquat and grapefruit varieties allowed detec- Acknowledgements Authors would like to thank the Krezdorn Memorial Fund at University of Florida, the Citrus Research and tion of the polymorphism site (Genbank accession num- Development Foundation (CRDF), New Varieties Development and ber KY385237, KY385238, KY385240, KY385242, Management Corporation (NVDMC) for financial support, and KY385243, KY385244, KY385247 and KY385248). CAPES—Science without Borders Program—which provided funding The polymorphism between ‘Meiwa’ kumquat and for a 3-yr (2013-2016) Graduate Scholarship for 2nd author at University of Florida. grapefruit varieties on plastid molecular marker trnG/ trnR intergenic region (SPCC1) was observed by three single nucleotide polymorphisms (SNPs) and two indels (Fig. 5a). The plastid molecular marker ndhk gene References (MRCP17) showed only one indel of six thymine bases in a repetitive region (Fig. 5b). The mt intron nad7i2 Aleza P, Garcia-Lor A, Juárez J, Navarro L (2016) Recovery of citrus cybrid plants with diverse mitochondrial and chloroplastic genome polymorphism was represented by one SNP and two combinations by protoplast fusion followed by in vitro shoot, root, indels of eight nucleotides (Fig. 5c). The mt RNA spac- or embryo micrografting. Plant Cell Tissue Organ Cult 126:205–217 er rrn5/rrn18-1 also revealed one indel of five nucleo- Bayer RJ, Mabberley DJ, Morton C, Miller CH, Sharma IK, Pfeil BE, tides between ‘Meiwa’ kumquat and grapefruit varieties Rich S, Hitchcock R, Sykes S (2009) A molecular phylogeny of the orange subfamily (Rutaceae: Aurantioideae) using nine cpDNA se- (Fig. 5d). quences. Am J Bot 96:668–685 The polymorphism sites detected by sequencing were used Boscariol RL, Monteiro M, Takahashi EK, Chabregas SM, Vieira MLC, to design restriction enzymes that allowed the use of conven- Vieira LGE, Pereira LFP, Mourao Filho FAA, Cardoso SC, tional agarose gels instead of high cost polyacrylamide gels Christiano RSC (2006) Attacin a gene from Tricloplusia ni reduces susceptibility to Xanthomonas axonopodis pv. citri in transgenic for polymorphism detection. The restriction enzymes were – ‘ ’ Citrus sinensis cv. Hamlin. J Am Soc Hortic Sci 131:530 536 able to produce different band sizes for Meiwa kumquat Cabasson CM, Luro F, Ollitrault P, Grosser JW (2001) Non-random in- and grapefruit varieties (Fig. 4 c, f). The restriction enzymes heritance of mitochondrial genomes in Citrus hybrids produced by Pac IandHpa II were used to digest PCR products of cp trnG/ protoplast fusion. Plant Cell Rep 20:604–609 trnR intergenic region (SPCC1) and mt intron nad7i2 Chen C, Zhou P, Choi YA, Huang S, Gmitter FG Jr (2006) Mining and (CC363b/364b), respectively. characterizing microsatellites from citrus ESTs. Theor Appl Genet 112:1248–1257 Chen C, Grosser JW, Calovic M, Serrano P, Pasquali G, Gmitter J, Gmitter FG Jr (2008a) Verification of Mandarin and Pummelo so- Conclusions matic hybrids by expressed sequence tag–simple sequence repeat marker analysis. J Am Soc Hortic Sci 133:794–800 Following protoplast fusion, numerous cybrid plants were re- Chen C, Bowman KD, Choi YA, Dang PM, Rao MN, Huang S, Soneji JR, McCollum TG, Gmitter FG Jr (2008b) EST-SSR generated, all with typical grapefruit morphology. Only four genetic maps for Citrus sinensis and Poncirus trifoliata.Tree tetraploid somatic hybrid embryos were recovered but they all Genet Genom 4:1–10 268 OMAR ET AL.

Chen CX, Lyon MT, O'Malley D, Federici CT, Gmitter J, Grosser JW, Guo WW, Prasad D, Cheng YJ, Serrano P, Deng XX, Grosser JW Chaparro JX, Roose ML, Gmitter FG Jr (2008c) Origin and frequen- (2004b) Targeted cybridization in citrus: transfer of Satsuma cyto- cy of 2n gametes in Citrus sinensis x Poncirus trifoliata and their plasm to seedy cultivars for potential seedlessness. Plant Cell Rep reciprocal crosses. Plant Sci 174:1–8 22:752–758 Cheng YJ, Guo WW, Deng XX (2003) Molecular characterization Khalaf A, Moore GA, Jones JB, Gmitter FG Jr (2007) New insights into of cytoplasmic and nuclear genomes in phenotypically abnor- the resistance of Nagami kumquat to canker disease. Physiol Mol mal Valencia orange (Citrus sinensis) + Meiwa kumquat Plant Pathol 71:240–250 (Fortunella crassifolia) intergeneric somatic hybrids. Plant Khalaf AA, Gmitter FG Jr, Conesa A, Dopazo J, Moore GA (2011) Cell Rep 21:445–451 Fortunella margarita transcriptional reprogramming triggered by Cheng YJ, De Vicente MC, Meng H, Guo WW, Tao N, Deng X (2005) A Xanthomonas citri subsp. citri. BMC Plant Biol 11:159 set of primers for analyzing chloroplast DNA diversity in Citrus and Laroche J, Li P, Maggia L, Bousquet J (1997) Molecular evolution of related genera. Tree Physiol 25:661–672 angiosperm mitochondrial introns and exons. Proc Natl Acad Sci U Deng XX, Grosser JW, Gmitter FG Jr (1992) Intergeneric somatic hybrid S A 94:5722–5727 plants from protoplast fusion of Fortunella crassifolia cultivar Li D, Xiao X, Guo WW (2014) Production of transgenic ‘Anliucheng’ meiwa with Citrus sinensis cultivar Valencia. Sci Hort 49:55–62 sweet orange (Citrus sinensis Osbeck) with Xa21 gene for potential Duminil J, Pemonge M-H, Petit RJ (2002) A set of 35 consensus primer canker resistance. J Integr Agric 13:2370–2377 pairs amplifying genes and introns of plant mitochondrial DNA. Lorz H, Paszkowshi J, Dierks-Ventling C, Potrykus I (1981) Isolation and – Mol Ecol Notes 2:428 430 characterization of cytoplasts and miniprotoplasts derived from pro- Fu CH, Chen CL, Guo WW, Deng XX (2004) GISH, AFLP and PCR- toplasts of cultured cells. Physiol Plant 53:385–391 RFLP analysis of an intergeneric somatic hybrid combining Goutou Maliga B, Lorz H, Larzar G, Nagy F (1982) Cytoplast-protoplast fusion – sour orange and Poncirus trifoliata. Plant Cell Rep 23:391 396 for interspecific chloroplast transfer in Nicotiana. Mol Gen Genet Fu XZ, Gong XQ, Zhang YX, Wang Y, Liu JH (2012) Different tran- 185:211–215 scriptional response to Xanthomonas citri subsp. citri between kum- Mendes BMJ, Cardoso SC, Boscariol-Camargo RL, Cruz RB, Mourao quat and sweet orange with contrasting canker tolerance. PLoS One Filho FAA, Bergamin Filho A (2010) Reduction in susceptibility to 7:e41790 Xanthomonas axonopodis pv. citri in transgenic Citrus sinensis ex- Ge H, Li Y, Fu H, Long G, Luo L, Li R, Deng Z (2015) Production of pressing the rice Xa21 gene. Plant Pathol 59:68–75 sweet orange somaclones tolerant to citrus canker disease by in vitro Moreira CD, Chase CD, Gmitter FG Jr, Grosser JW (2000) Inheritance of mutagenesis with EMS. Plant Cell Tissue Organ Cult 123:29–38 organelle genomes in citrus somatic cybrids. Mol Breed 6:401–405 Graham JH, Gottwald TR, Cubero J, Achor DS (2004) Xanthomonas Moreira CD, Gmitter FG Jr, Grosser JW, Huang S, Ortega VM, Chase CD axonopodis pv. citri: factors affecting successful eradication of citrus (2002) Inheritance of organelle DNA sequences in a Citrus- canker. Mol Plant Pathol 5:1–15 Poncirus intergeneric cross. J Hered 93:174–178 Green RM, Vardi A, Galun E (1986) The plastome of Citrus: physical Murashige T, Tucker DP (1969) Growth factor requirements of citrus map, variation among Citrus cultivars and species and comparison tissue culture. In: Chapman HD (ed) Proc 1st Internat citrus Symp. with related genera. Theor Appl Genet 72:170–177 University of Claifornia, Riverside, pp 1155–1161 Grosser JW, Gmitter FG Jr (1990) Protoplast fusion and citrus improvement. Plant Breed Rev 8:339–374 Navarro L (1992) Citrus shoot tip grafting in vitro.In:BajajYPS Grosser JW, Gmitter FG Jr (2005) Applications of somatic hybridization (ed) Biotechnology in agriculture and forestry, no 18 high- and cybridization in crop improvement, with citrus as a model. tech and micropropagation II. Springer, Berlin Heidelberg, – In Vitro Cell Dev Biol-Plant 41:220–225 Berlin, pp 327 338 Grosser JW, Gmitter FG Jr (2011) Protoplast fusion for production of Omar AA, Song WY, Grosser JW (2007) Introduction of Xa21, a ‘ ’ tetraploids and triploids: applications for scion and rootstock breed- Xanthomonas-resistance gene from rice, into Hamlin sweet orange ing in citrus. Plant Cell Tissue Organ Cult 104:343–357 [Citrus sinensis (L.) Osbeck] using protoplast-GFP co-transforma- Grosser JW, Ollitrault P, Olivares-Fuster O (2000) Somatic hybridization tion or single plasmid transformation. J Horticult Sci Biotechnol 82: – in citrus: an effective tool to facilitate variety improvement. In Vitro 914 923 Cell Dev Biol-Plant 36:434–449 Peng A, Xu L, He Y, Lei T, Yao L, Chen S, Zou X (2015) Efficient ‘ ’ Grosser JW, Calovic M, Louzada ES (2010a) Protoplast fusion technol- production of marker-free transgenic Tarocco blood orange ogy—somatic hybridization and cybridization. In: Davey MR, (Citrus sinensis Osbeck) with enhanced resistance to citrus canker Anthony P (eds) Plant cell culture: essential methods. Wiley- using a Cre/loxP site-recombination system. Plant Cell Tissue Organ – Blackwell, Oxford, pp 175–198 Cult 123:1 13 Grosser JW, Gmitter FG Jr, Tusa N, Recupero GR, Cucinotta P (1996) Penjor T, Yamamoto M, Uehara M, Ide M, Matsumoto N, Matsumoto R, Further evidence of a cybridization requirement for plant regenera- Nagano Y (2013) Phylogenetic relationships of Citrus and its rela- tion from citrus leaf protoplasts following somatic fusion. Plant Cell tives based on matK gene sequences. PLoS One 8:e62574 Rep 15:672–676 Petit RJ, Duminil J, Fineschi S, Hampe A, Salvini D, Vendramin GG Grosser JW, An HJ, Calovic M, Lee DH, Chen CX, Vasconcellos M, (2005) Comparative organization of chloroplast, mitochondrial and Gmitter FG Jr (2010b) Production of new allotetraploid and autotet- nuclear diversity in plant populations. Mol Ecol 14:689–701 raploid citrus breeding parents: focus on zipperskin mandarins. Rao MN, Soneji JR, Chen C, Huang S, Gmitter FG Jr (2007) Hortscience 45:1160–1163 Characterization of zygotic and nucellar seedlings from sour Grosser M (2011) Plant mitochondrial introns as genetic markers. orange-like citrus rootstock candidates using RAPD and EST-SSR Horticulture Sciences. University of Florida, Gainesville, Florida markers. Tree Genet Genom 4:113–124 (undergraduate thesis). http://ufdc.ufl.edu/ufhonors Sakai T, Imamura J (1990) Intergeneric transfer of cytoplasmic male Guo W-W, Xiao S-X, Deng X-X (2013) Somatic cybrid production via sterility between Raphanus sativus (CMS line) and Brassica napus protoplast fusion for citrus improvement. Sci Hort 163:20–26 through cytoplast-protoplast fusion. Theor Appl Genet 80:421–427 Guo WW, Cai XD, Grosser JW (2004a) Somatic cell cybrids and hybrids Satpute AD, Chen C, Gmitter FG Jr, Ling P, Yu Q, Grosser MR, Grosser in plant improvement. In: Daniell H, Chase CD (eds) Molecular JW, Chase CD (2015) Cybridization of grapefruit with ‘Dancy’ biology and biotechnology of plant organelles. Kluwer Academic mandarin leads to improved fruit characteristics. J Am Soc Hortic Publisher, Dordrecht, pp 635–659 Sci 140:427–435 PRODUCTION OF THREE NEW GRAPEFRUIT CYBRIDS 269

Schubert TS, Rizvi SA, Sun X, Gottwald TR, Graham JH, Dixon WN Wallin A, Glimelius K, Eriksson T (1978) Enucleation of plant proto- (2001) Meeting the challenge of eradicating citrus canker in Florida- plasts by cytochalasin B. Z Pflanzenphsiol 78:333–340 again. Plant Dis 85:340–356 Wang Y, Fu X-Z, Liu J-H, Hong N (2011) Differential structure and Spangenberg G, Osusky M, Oliveira MM, Freydl E, Nagel J, Pais MS, physiological response to canker challenge between ‘Meiwa’ kum- Potrykus I (1990) Somatic hybridization by microfusion of defined quat and ‘Newhall’ navel orange with contrasting resistance. Sci protoplast pairs in Nicotiana: morphological, genetic and molecular Hort 128:115–123 characterization. Theor Appl Genet 80:577–587 Xu S-X, Cai D-F, Tan F-Q, Fang Y-N, Xie K-D, Grosser JW, Guo W-W Tsuruta S, Fumiko H, Otabara T, Hashiguchi M, Yamamoto T, Akashi R (2014) Citrus somatic hybrid: an alternative system to study rapid (2008) Genetic diversity of chloroplast DNA in Zoysia and other structural and epigenetic reorganization in allotetraploid genomes. warm-season turfgrasses. Grassl Sci 54:151–159 Plant Cell Tissue Organ Cult 119:511–522 Tusa N, Grosser JW, Gmitter FG Jr (1990) Plant regeneration of Xu XY, Liu JH, Deng XX (2005) FCM, SSR, and CAPS analysis of ‘ ’ ‘ ’ Valencia sweet orange, Femminello lemon, and the interspecific intergeneric somatic hybrid plants between Changshou kumquat somatic hybrid following protoplast fusion. J Am Soc Hortic Sci and Dancy tangerine. Bot Bull Acad Sin 46:93–98 – 115:1043 1046 Xu XY, Liu JH, Deng XX (2006) Isolation of cytoplasts from Satsuma Vardi A, Breiman A, Galun E (1987) Citrus cybrids: production by donor- mandarin (Citrus unshiu Marc.) and production of alloplasmic hybrid recipient protoplast-fusion and verification by mitochondrial-DNA calluses via cytoplast-protoplast fusion. Plant Cell Rep 25:533–539 restriction profiles. Theor Appl Genet 75:51–58 Yamamoto M, Kobayashi S, Nakamura Y, Yamada Y (1993) Phylogenic Vardi A, Arzee-Gonen P, Frydman-Shani A, Bleichman S, Galun E relationships of citrus revealed by RFLP analysis of mitochondrial (1989) Protoplast-fusion-mediated transfer of organelles from and chloroplast DNA. Jpn J Breed 43:355–365 Microcitrus into Citrus and regeneration of novel alloplasmic trees. Theor Appl Genet 78:741–747