The BCR Gene and Philadelphia Chromosome-Positive Leukemogenesis

[CANCER RESEARCH 61, 2343–2355, March 15, 2001] Review

The BCR Gene and Philadelphia Chromosome-positive Leukemogenesis

Eunice Laurent, Moshe Talpaz, Hagop Kantarjian, and Razelle Kurzrock1 Departments of Bioimmunotherapy [E. L., M. T., R. K.] and Leukemia [H. K., R. K.], University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 Introduction

Recent investigations have rapidly added crucial new insights into BCR-related Genes the complex functions of the normal BCR gene and of the BCR-ABL Several BCR-related pseudogenes (BCR2, BCR3, and BCR4) have chimera and are yielding potential therapeutic breakthroughs in the also been described (34). They are not translated into proteins. All of treatment of Philadelphia (Ph) chromosome-positive leukemias. The these genes have been mapped to chromosome 22q11 by in situ term “breakpoint cluster region (bcr)” was first applied to a 5.8-kb hybridization. The orientation is such that BCR2 is the most centro- span of DNA on the long arm of chromosome 22 (22q11), which is 2 meric, followed by BCR4, then BCR1 (the functional gene) and BCR3. disrupted in patients with CML bearing the Ph translocation [t(9; BCR2 and BCR4 are retained on chromosome 22 during the t(9;22) 22)(q34;q11); Refs. 1–3]. Subsequent studies demonstrated that the translocation. The BCR-related genes all contain 3Ј sequences iden- 5.8-kb fragment resided within a central region of a gene designated tical to those encompassing the last seven exons of the BCR1 gene BCR (4). It is now well established that the breakpoint within BCR can (34, 36). The 5Ј region is highly variable, suggesting that the 3Ј end be variable, and when joined with ABL, results in a hybrid Mr 210,000 of the normal BCR1 gene was inserted into another locus with sub- Bcr-Abl Bcr-Abl Bcr-Abl (p210 )oraMr 190,000 (p 190 protein (p190 ; Fig. sequent duplication of the new locus (36). Another BCR pseudogene, 1; Refs. 5–13). Of interest, p190Bcr-Abl characterizes a phenotypically the chromosomal location of which remains undefined, has also been acute, rather than chronic, leukemia that is often, but not always, of described (37). It was shown to have homology with the 3Ј end of lymphoid (rather than of myeloid) derivation (Refs. 10 and 14; Table exon 3 as well as the 5Ј end of exon 4 (37). 1). Both p210Bcr-Abl and p190Bcr-Abl have constitutive tyrosine kinase There is an additional BCR-related gene located on chromosome activity. Furthermore, the presence of the hybrid proteins perturbs the 17p13.3 (35, 38, 39). This gene is functionally active and has been multiple functions of their normal counterparts. Understanding the designated ABR or active BCR-related gene (35). There is 68% ho- biological sequelae of the molecular aberrations in Ph-positive disease mology between ABR and the central and COOH-terminal regions of has led to development of novel tyrosine kinase inhibitor therapy that BCR (35, 39). is showing remarkable success in clinical trials. Herein, we review the current state of knowledge on the role of BCR alone or when joined The BCR Promoter with ABL in normal and leukemic pathophysiology and the implica- The 5Ј untranslated region of the BCR gene is important because tions of this knowledge for therapy. the fusion gene created by the Ph translocation is placed under the regulation of the BCR promoter (31, 40–42). A region ϳ1-kb up- Genomic Structure of the BCR Gene stream of the transcription start site was demonstrated to be the The BCR Gene principle site of promoter activity (41, 42). Within this region, a CAAT box (conserved sequence upstream of start point of transcrip- BCR is situated in a 5Ј to 3Ј orientation with the 5Ј end closer to the tion, which is recognized by transcription factors) at position Ϫ644 as centromere (4). The entire gene spans 130 kb and contains 23 exons well as an inverted CAAT sequence at position Ϫ718 have been (Ref. 26; Table 2 and Fig. 2). The first intron separating exons 1 and localized. However, neither in vitro nor in vivo studies suggest that 2 was initially shown to span a distance of 68 kb (26) but is now these sequences are key factors for transcriptional regulation of the known to include two additional exons (an alternative exon 1 and an BCR gene (41). There is also a TATA box [conserved sequences in the alternative exon 2; Refs. 28 and 29). Two transcripts, 4.5- and 7.0-kb promoter that specify the position at which transcription is initiated long, have been found (16). The nucleotide sequence contains an open (43)] 120 bp downstream of the CAAT box. This TATA box, TT- reading frame of 3818 nucleotides, which codes for a protein 1271 TAA, is also accompanied by the consensus sequence TCATCG, amino acids in length (31, 36). required for 5Ј capping of the transcript (41). DNA footprinting and gel retardation assays have also been used to discover potential sites for DNA/protein interaction, which might reflect transcription factor activity. Several sites were found including ones containing the consensus sequence GGGCCGG (as well as the Received 8/4/00; accepted 1/12/01. The costs of publication of this article were defrayed in part by the payment of page inverted sequence) for the SP1 transcription factor (41, 42). A unique charges. This article must therefore be hereby marked advertisement in accordance with sequence TAGGGCCTCAGTTTCCCAAAAGGCA, for which no 18 U.S.C. Section 1734 solely to indicate this fact. binding protein is known, was also detected (41). Deletion of that site 1 To whom requests for reprints should be addressed, at Department of Bioimmuno- therapy, Box 422, M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, (versus other potential binding sites) resulted in a significant decrease TX 77030. Phone: (713) 794-1226; Fax: (713) 745-2374. of promoter activity in BCR-ABL-transfected cells (41). 2 The abbreviations used are: CML, chronic myelogenous leukemia; Ph, Philadelphia; The 5Ј untranslated region of the BCR gene is also very rich in GC GEF, guanine nucleotide exchange factor; GTPase, guanine triphosphatase; GAP, GTPase activating protein; XPB, xeroderma pigmentosum group B; SH2, Src homology 2; Grb2, content, which makes up 80% of the nucleotides with“in this stretch growth factor receptor binding protein 2; Bap-1, Bcr-associated protein 1; ALL, acute of the DNA (31, 36). Within this GC-rich region is a segment 18 lymphocytic leukemia; AML, acute myelogenous leukemia; M-bcr, major breakpoint Ϫ Ϫ cluster region; Ship, SH2-containing phosphatidylinositol 3,4,5-triphosphate 5-phospha- nucleotides long at sites 376 to 393, containing the sequence tase; Jak, Janus kinase. GCGGCGGCGGCGGCGGCG with its inverted repeat 363 bp down- 2343

Fig. 1. Schematic representation of BCR, ABL, and BCR-ABL genes and the proteins they encode. Numbers refer to exon number. In the BCR gene, exons 1Ј and 2Ј are alternative exons contained within the first intron. The ABL gene has two alternative first exons denoted 1b and 1a, respectively. A series of different protein products are described based on the fusion transcripts that have been identified. The predicted proteins are illustrated in the right-hand column. (However, not all these proteins have been demonstrated on gels and, therefore, not all of them are given a size.)

Table 1 Molecular events associated with Philadelphia-positive leukemiasa Diagnosis Transcript Protein product Normal 6.0- and 7.0-kb ABL mRNA pl45Abl 4.5- and 6.7-kb BCR mRNA p130Bcr and p160Bcr CMLb 8.5-kb BCR-ABL mRNA (an ABL-BCR mRNA is also expressed in some patients) p210Bcr-Abl ALL 8.5- or 7.0-kb BCR-ABL mRNA (an ABL-BCR mRNA is also expressed in some patients) p210Bcr-Abl or p190Bcr-Abl AML 8.5- or 7.0-kb BCR-ABL mRNA p210Bcr-Abl or p190Bcr-Abl Neutrophilic CML 9.0-kb BCR-ABL mRNA p230Bcr-Abl a Summarized from Refs. 4, 8–12, and 15–25. b Rare expression of 7.0-kb BCR-ABL mRNA and p190Bcr-Abl. stream. These sequences are apt to form secondary stem and loop have short open reading frames because there are stop codons down- structures, with a possible role in translational regulation (36), and are stream of these sites (31, 40). It has been suggested that these short common to many housekeeping genes (43). Other possible start sites transcripts could also play a role in regulating protein translation (40). upstream of the normal AUG codon have been found; however, these Bcr Protein(s) Table 2 BCR: Molecular features Currently, the normal BCR gene is known to code for two major Comments Refs. proteins that are Mr 160,000 and Mr 130,000 in size (17, 25, 30). It is Location Chromosome 22q11 2, 27 possible that these proteins are derived from the 7.0- and 4.5-kb BCR Size of gene 130-kb 26 transcripts, respectively (15, 17, 26). In addition, Li et al. (44) have Number of exons 23 exons 26 (also contains alternative exon 1 and exon 2) 28, 29 described putative Bcr proteins of Mr 190,000/Mr 185,000, Mr Size of transcripts 4.5kb and 6.7kb 4, 15 155,000, M 135,000, M 125,000, and M 108,000. a r r r Size of proteins Mr 130,000 and Mr 160,000 17, 25, 30 BCR expression Ubiquitously expressed 4, 31–33 Highest levels in brain and haematopoietic cells Bcr-related Protein(s) BCR-related genes Pseudogenes BCR2, BCR3, and BCR4 found on 34, 35 chromosome 22q11; ABR (active BCR- related) gene on 17p13 The ABR gene encodes for a Mr 98,000 protein that contains both the a GEF and GAP domains of Bcr (respectively, the central and COOH- Other proteins of Mr, 190,000/Mr 185,000, Mr 155,000, Mr 135,000, Mr 125,000, and Mr 108,000 not firmly established. terminal regions) but lacks the serine/threonine kinase domain found at 2344

Fig. 2. Schematic representation of the Bcr protein. Functional sites include a serine/threonine kinase domain in exon 1, a central GEF domain, and a COOH-terminal GAP domain. SH2-binding sites are also present in exon 1. The two Abl SH2-binding sites are noted in the figure and stretch from amino acids 192–242 and 293–413. Interaction at these sites is mediated via phosphoserine and phosphothreonine. The 14-3-3 protein (Bap-1) also interacts with the latter site. Grb2 associates with an additional proximal SH2-binding site containing a phosphotyrosine at position 177. The GEF domain interacts with the XPB DNA repair protein.

the NH2-terminus (39, 45). Analysis of GAP activity showed that both cytoplasmic protein by immunofluorescence staining and cell fraction- Bcr and Abr acted similarly toward different G proteins, especially ation studies (17, 33, 47). A wealth of studies implicate this protein in members of the Rho subfamily, which includes Cdc42 and Rac (39, 46). cellular signal transduction pathways, especially those regulated by G proteins (discussed below; Ref. 48). Subsequent investigations have, BCR Expression however, shown that the Bcr product can also associate with condensed DNA (49). According to electron microscopic examination of immuno- The BCR gene is expressed ubiquitously (4, 31, 32). In chick gold-labeled cells, Bcr interacts with mitotic DNA as well as the highly embryos, as well as in mouse and human tissues, mRNA levels were condensed heterochromatin in interphase cells (49). In some cell lines, the found to be highest in the brain and hematopoietic cells (32, 41). Mr 130,000 Bcr protein predominates in the nucleus, and the Mr 160,000 Similarly, ABR transcripts are also most prominent in hematopoietic form predominates in the cytoplasm (50). Of interest in this regard, Bcr tissue and brain, with the highest levels in the latter (39, 45). To date, was found recently to be associated with the XPB protein (51, 52). XPB however, the aberrant BCR-ABL gene appears to affect hematopoietic plays a role in DNA repair, general transcription initiation, and cell cycle cells. Of interest, Bcr protein is expressed primarily in the early stages regulation (53). of myeloid differentiation, and levels are reduced significantly as cells Bcr-Abl mature to polymorphonuclear leukocytes (33). Because p210 is Functional Domains of BCR expressed off the BCR promoter, it is not surprising that this protein shows a similar correlation between expression pattern and myeloid The BCR gene is now known to be a complex molecule with many differentiation (33). different functional domains (Ref. 48; Table 3; Fig. 2). Within the first exon of BCR resides a structurally novel protein kinase domain (25, Bcr Subcellular Localization 54). At the COOH-terminus, a GAP domain, which demonstrates activity for the Ras-related GTP-binding protein p21Rac, has been The Bcr-Abl protein is known to be cytoplasmic (36). In addition, the described (65). In addition, the central part of the BCR gene contains normal product of the BCR gene was initially demonstrated to be a sequences homologous to various GEFs (63, 64, 68). These data

Table 3 Function-related characteristics of the Bcr protein Region Comments Refs. Serine/threonine kinase activity Exon 1 Known to phosphorylate histones in vitro; self-phosphorylates 54 Phosphorylates and associates with 14-3-3 proteins 55, 56 Oligomerization domain Exon 1 Can form homotetramers 57 May be essential for transformation by Bcr-Abl 57, 58 SH2-binding region 1 Exon 1 Binds SH2 of Grb-2, a key protein of Ras signal transduction pathway 59 SH2-binding regions 2 and 3 Exon 1 Situated within a serine-rich region 60 Binds to the SH2 domain of Abl in a phosphotyrosine-independent manner 60, 61 Transcriptional suppressor Within introns of M-bcr (major Lack of this region has been postulated to play a role in the different activities of 62 breakpoint cluster region) p210Bcr-Abl and p190Bcr-Abl Guanine nucleotide exchange Exons 3–10 Contains homology to Cdc24, Dbl, and Vav, which are guanine nucleotide 63, 64 factor domain exchange factors Binds to the XPB protein 51, 52 GTPase activity Exons 19–22 Regulates p21Rac, a protein important for cytoskeletal reorganization 65, 66 Bcr plays a role in the regulation of Rac-mediated superoxide production during neutrophil priming and activation in a knockout mouse model Homology to 3BP-1, a COOH-terminus Deletion of Abl SH3 domain activates its transforming activity 67 molecule that binds to Abl SH3 domain Chromatin association Unknown Associates with mitotic chromosomes and with heterochromatin of interphase cells 49 2345

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2001 American Association for Cancer Research. THE BCR GENE AND LEUKEMOGENESIS implicate the participation of BCR in two major intracellular signaling Table 4 ABL: Molecular features and function mechanisms in eukaryotic cells (phosphorylation and GTP-binding). Comments Refs. Location Chromosome 9q34 81 Size of gene Ͼ230 kb 82 First Exon Number of exons 11 exons 15 (There are two alternative exons, 1a and 1b) 7 The first exon of the BCR gene is of critical significance, because Size of transcripts 6.0-kb and 7.0-kb 19 it is the one exon of BCR included in all known Bcr-Abl fusion Size of protein Mr 145,000 18 Bcr-Abl Abl expression Ubiquitously expressed 33 proteins (e.g., the p190 in acute leukemias as well as the Decreases with myeloid maturation Bcr-Abl p210 in CML; Refs. 1, 4, 8–10, 22, 60, 69, and 70; Fig. 1). Cytoplasmic and nuclear localization 80, 83 Within this region of BCR resides the kinase domain, two serine-rich Functions Non-receptor tyrosine kinase (not constitutively active) 18 Nuclear translocation signal 79 boxes containing SH2-binding domains, and an oligomerization do- Interacts with meiotic chromosome 84 main. DNA-binding domain at COOH-terminus; 80 Serine/Threonine Kinase Domain. The Bcr protein has serine/ binds to AAC motif 85, 86 F-Actin-binding domain at COOH-terminus 70 threonine kinase activity within its first exon (25, 30, 54, 71). A Abl inhibited through SH3 domain 87–89 consensus sequence homologous to the ATP-binding site of other Associates with cell cycle proteins Rb, p53, p73, Atm, 90–97 and cyclin D kinases as well as a likely phosphotransferase domain has been Differentially phosphorylated during cell cycle 98 identified (36, 44). Bcr can autophosphorylate on serine and threonine Associates with SH2/SH3 adaptor protein Crkl 99, 100 residues, as well as transphosphorylate casein and histones in vitro Overexpression of Abl leads to G arrest 101 Kinase activity regulated by Abelson interacting 102–105 (54). (The latter are known substrates for serine/threonine kinases.) protein In Ph-positive disease, phosphotyrosines are present on both Bcr and Bcr-Abl (mutually p210Bcr-Abl and p190Bcr-Abl) because of the tyrosine kinase activity of Bcr-Abl (72). The first exon of the Bcr Central Domain component of Bcr-Abl is also phosphorylated on serine/threonine residues (54, 72). Indeed, the majority of autophosphorylation of Central (and COOH-terminal) regions of Bcr appear to interact with Bcr-Abl occurs within the Bcr rather than the Abl portion of the G proteins at multiple levels. These proteins are essential players in protein (72). intracellular signaling, cytoskeletal organization, cell growth, and SH2-binding Domain. There are several SH2-binding domains in normal development (107, 108). G proteins cycle between an inactive the first exon of BCR (60). [SH2 domains are highly conserved, GDP-bound state and an active GTP-bound state, a process that is noncatalytic regions of ϳ100 amino acids that bind SH2-binding sites regulated by GAPs and GEFs (107). GEFs activate G proteins by consisting of three to five amino acids including a phosphotyrosine. exchanging GDP for GTP. In contrast, GAPs inactivate G proteins by This interaction is important in the assembly of signal transduction activating the GTPase of the protein, which in turn down-regulates the complexes (73–75).] Bcr is unique in that SH2 domains of other protein by hydrolysis of GTP (107). proteins can bind to the phosphoamino acid serine, threonine, or GEF-related Domain. The central region of the BCR gene shows tyrosine (rather than only tyrosine) in two of its SH2-binding sites (60, homology to the hematopoietically expressed VAV proto-oncogene (a 61). One SH2 domain that binds to Bcr is that of Abl, and this GEF) as well as with a CDC25 mouse homologue termed CDC25 Mm interaction is mediated via phosphorylated serines and threonines (64, 109). [CDC25 Mm is homologous to the Ras activator CDC25 of (60). Bcr sequences involved in this interaction lie between amino Saccharomyces cerevisiae (64, 109).] In addition, central BCR se- acids 192–242 and 298–413 and are essential for the oncogenic quences demonstrate homology to the yeast cell division cycle gene activation of Bcr-Abl (60). A third Bcr SH2-binding region has also CDC24, as well as its human counterpart, the DBL oncogene, which been found. It interacts through a phosphorylated tyrosine with the codes for a GEF (63, 68). The CDC24 gene codes for a cell division adaptor protein Grb2 (59). The latter is an essential protein in the Ras cycle control protein and also plays a role in cytoskeletal and cyto- signal transduction pathway (Fig. 2). plasmic organization, bud formation in yeast, cell polarity, and acts as Oligomerization Domain. A third functional domain found within a GDP-GTP exchange factor for Ras-like G proteins (68, 110–112). exon 1 of BCR is an oligomerization domain that is characterized by Cdc24 interacts with the product (a GTP-binding protein) of the bud a heptad repeat of hydrophobic residues between amino acids 28 and assembly gene CDC42 and is a member of the Ras superfamily of 68 (57). Bcr and Bcr-Abl have been found to coimmunoprecipitate GTPases (113, 114). To add to the complexity of the BCR gene, the through this domain (76, 77). Mutations within the oligomerization GAP domain at the COOH-terminus contains activity toward the domain attenuate the tyrosine kinase enzymatic activity of Bcr-Abl product of CDC42Hs, the human homologue of CDC42 (68). Taken and abolish the interaction between Bcr and Bcr-Abl (57). Of interest, together, these observations indicate that Bcr has both GAP and GEF TEL (an ETS family gene) can also partner with ABL [t(9;12) trans- functions and hence suggests a dual role for this molecule in G location of acute leukemia] and activate Abl tyrosine kinase activity protein-associated signaling pathways. (78). It has been postulated that, similar to the situation with Bcr, the Interaction with XPB Gene Product. Recent studies using the Tel helix-loop-helix domain facilitates dimerization or oligomeriza- yeast two-hybrid system were performed to identify proteins that tion of the fusion partner to activate its function. could interact with the central Cdc24 homologous region of Bcr (51). The oligomerization domain also affects Bcr-Abl localization. Abl The results yielded one surprising candidate, the DNA repair XPB contains both a nuclear localization and an F-actin-binding (cytoplas- protein (51). Xeroderma pigmentosum is an inherited disorder char- mic) motif (70, 79). Although normal Abl can be found both in the acterized by increased sensitivity to sunlight, coupled with a defect in nucleus and in the cytoplasm (Refs. 33 and 80; Table 4), Bcr-Abl is the DNA repair machinery. The XPB protein is also a component of found to be cytoplasmic and partially associated with the cytoskeleton the transcription factor IIH core complex, which plays a role in (33, 70, 106). Deletion of the oligomerization domain results in initiation of transcription as well as in DNA repair (53). The XPB decreased binding of Bcr-Abl to F-actin, suggesting that this domain protein was found to interact with both normal Bcr as well as with of Bcr enhances the F-actin binding capacity of Bcr-Abl and is at least p210Bcr-Abl (51, 52). Importantly, the Bcr Cdc24 homologous domain partially responsible for the cytoplasmic localization of Bcr-Abl (57). is present in p210Bcr-Abl but absent in p190Bcr-Abl. When XPB is 2346

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2001 American Association for Cancer Research. THE BCR GENE AND LEUKEMOGENESIS coexpressed with p210Bcr-Abl, XPB becomes phosphorylated and is Table 5 Philadelphia-positive leukemias: Percentage of patients with p190 versus a unable to correct a DNA repair defect (51). This phenomenon is not p210 subtype observed in the presence of p190Bcr-Abl (51). It is therefore conceiv- Patients expressing Patients expressing Leukemia p210Bcr-Abl(%) p190Bcr-Abl (%) able that the presence of p210Bcr-Abl interferes with the normal inter- CML Ͼ99 Ͻ1 action between Bcr and XPB, thus leading to defective DNA repair Adult ALL ~50 ~50 and subsequent genomic instability in Bcr-Abl-positive CML. This Pediatric ALL ~10 ~90 mechanism may explain the clonal evolution that occurs in CML and AML ~50 ~50 a drives the inevitable progression of this disease from an easily con- Summarized from Refs. 1, 9–12, 14, 22, 35, and 126–143. trolled “benign” phase to a fatal blast crisis. Structure of the BCR-ABL Gene in CML and Acute Leukemia COOH-Terminal Domain BCR-ABL Genes and Proteins COOH-terminal sequences are also involved in G protein regu- The hallmark of CML is the Ph chromosome, which is a shortened lation. However, whereas the central sequences have GEF homol- chromosome 22 resulting from a translocation, t(9;22)(q34;q11), be- ogy (activates G proteins), the COOH-terminal sequences have tween chromosomes 9 and 22 (2, 27). A cytogenetically identical GAP homology (inactivates G proteins). One of the best-studied G translocation also occurs in about 20% of adult ALL, 5% of pediatric proteins is the oncogene p21RAS (115). The RAS superfamily is ALL, and rare cases of AML (125; Table 5). The involvement of known to have multiple members (116). Members of the RHO chromosome 9 is now known to disrupt the ABL gene (15, 20, 81, subfamily are critical components of signaling pathways that link 144). The actual breakpoint on chromosome 9 may span a large extracellular signals with reorganization of the cytoskeleton as distance. In some cases, the break is 5Ј to the two alternative first well as with membrane ruffling (117). A GAP protein specific for exons of the ABL gene (exons 1a and 1b), whereas in others, the break Rho family GTPases, termed RhoGAP, has structural similarity to occurs within the first intron (1, 126, 145, 146), which extends over the COOH-terminus of Bcr (118). The BcrGAP domain accelerates 200 kb (Ref. 82; Fig. 1). [Regardless, the fusion transcript almost the GTPase activity of Rac in vitro and specifically inhibits Rac- always includes exon 2 of ABL (a2)]. In contrast, in CML, the break induced membrane ruffling in vivo (65, 117). In BCR knockout on chromosome 22 is restricted in most patients to an area of 5.8-kb mice, Bcr regulates Rac-mediated superoxide production during termed the M-bcr (1). M-bcr consists of five exons termed M-bcr neutrophil priming and activation (66). A human brain protein, exons b1–b5. These exons are actually located within the central region of the BCR gene and are equivalent to exons 11–15 (e11–e15) chimaerin, with GAP activity also has homology to COOH-termi- of this gene. Most breaks occur immediately downstream of exon 2 or nal Bcr sequences (119). Interestingly, another protein designated 3 of the M-bcr region (4) and result in b2a2 or b3a2 fusion transcripts. 3BP-1, which also has sequence homology to the COOH-terminus In acute leukemia, however, the breakage can also occur outside of Bcr as well as to RhoGAP, binds the SH3 region of Abl with M-bcr in about half the cases (8, 9, 22, 135, 136, 139), usually within high specificity (67). The Abl SH3 region has an important nega- the 3Ј end of intron 1 of the BCR gene (26, 141), resulting in an e1a2 tive regulatory function in transformation because its deletion fusion transcript. The breakpoint sites in both BCR and ABL appear to activates the transforming potential of Abl. involve Alu sequences (transposable repeat elements found through- out the human genome; Refs. 141 and 147–150). The fusion of BCR and ABL on the Ph chromosome occurs in a Bcr-associated Proteins head-to-tail manner, with the 3Ј end of ABL joined to the 5Ј end of The Bcr protein has been found to complex with several proteins, BCR (4). This configuration places the fusion gene under the control which, as discussed previously, include Abl, Bcr-Abl, the adaptor of the BCR promoter. When the break occurs in the M-bcr region, the protein Grb2, and the XPB protein (51, 52, 59, 60, 76, 77). Included transcript is 8.5-kb long. However, when the break occurs in the first intron of BCR, the transcript is 7.0-kb long (4, 10, 15, 16, 20, 126). among the Bcr-associated proteins are members of a family of acidic Although it was initially felt that BCR-ABL transcripts are specific for proteins termed 14-3-3. These proteins play a role in intracellular leukemia, surprisingly, recent experiments suggest that small amounts signaling pathways (120), cell cycle/DNA damage checkpoint control, of such transcripts can be found in normal individuals if very sensitive and trafficking of the mitotic inducer Cdc25C from the nucleus to the PCR techniques are used (151, 152). It is possible that these tran- cytoplasm (121, 122). Thus far, Bcr is known to interact with two scripts represent “errors” that occur because of the close proximity of isoforms, ␤ and ␶, of this protein family (55, 56). The latter is also chromosomes 9 and 22 during the S to G2 transition of the cell cycle known as Bap-1 (55). Both of these proteins bind Bcr at a region (153–155) and that immune surveillance prevents the emergence of within its first exon, which is rich in serine and threonine, as well as CML in individuals who remain healthy. cysteine residues. Interaction between 14-3-3 proteins and other pro- The protein encoded by the 8.5-kb BCR-ABL mRNA is Mr 210,000 teins occurs through phosphoserine association within a putative and designated p210Bcr-Abl (5–7). The two most common molecular consensus sequence RSxSxP, a sequence present at the site in Bcr variants of p210Bcr-Abl are generated depending on whether the break exon 1 where the 14-3-3 proteins bind (123). When complexed with in M-bcr is centromeric or telomeric to exon 3 of M-bcr (b2a2 versus Bcr, Bap-1 is phosphorylated on its serine/threonine residues by the b3a2; Ref. 8). Therefore, p210Bcr-Abl may or may not contain the kinase domain of Bcr, thus making it a substrate for Bcr (55). 25-amino acid sequence encoded by exon 3. Interestingly, the ␤ isoform of 14-3-3 complexes not only with Bcr but As mentioned above, in Ph-positive acute leukemia patients with also with the serine/threonine kinase Raf (an upstream regulator of the breakpoints in the first intron of BCR, an abnormal BCR-ABL tran- mitogen-activated protein kinase; Ref. 56). It was postulated that script of about 7.0-kb in size is found (10–12). This encodes a pro- ␤ Bcr-Abl 14-3-3 could act as a mediator between Bcr and Raf, possibly tein Mr 190,000 in size (9–13, 133). p190 (also designated through formation of homodimers, a trait associated with 14-3-3 p185Bcr-Abl by some investigators) was initially felt to be involved proteins (56, 124). only in lymphoid lineage leukemia but was eventually also demon- 2347

Table 6 Characteristics of p210Bcr-Abl Comments Refs. Location of gene encoding p210Bcr-Abl Chromosome 22q11 15 Size of gene Varies according to site of breakpoint 132, 142 Break is in central region of BCR gene known as 5.8-kb (M-bcr); 1, 4 [Breaks occur between exons 2 and 3 or exons 3 and 4 of M-bcr (b2-a2 or b3-a2 junction)] Breaks in ABL gene occur upstream of exon 1 15 Size of transcript 8.5-kb BCR-ABL transcript; 15, 16, 20 (An ABL-BCR fusion transcript of uncertain significance is also expressed) 21 Localization Cytoplasmic protein 33 Localizes to cortical F-actin on vesicle-like structures 167 Functions Constitutively activated tyrosine kinase 5, 6 Can bind cytoskeletal actin and microfilaments 70 Expression decreases with myeloid differentiation 33 Substrates may include Ras-related signal transduction molecules 59, 168–170 Complexes with tyrosine phosphoprotein Crkl, an SH2/SH3 adaptor protein 99, 100 Interacts with docking protein p62Dok 171–174 May prevent apoptosis 175–181 Linked to Jak/Stat pathway (especially Stat5) 182–188 Linked to phosphotidylinositol 3-kinase/Akt pathway 189–192 Activates Jun kinase 193 Interacts with and regulates the XPB protein 51 Transforming activity partially mediated via Ras pathway 194, 195 May induce alterations in adhesion properties 196, 197 Down-regulates expression of Ship protein 198

strated in Ph-positive AML (9). In acute leukemia patients with size (19). The distance between exon 2 and exon 1b is greater than 200 breakpoints in the M-bcr, the mRNA (8.5-kb), and protein (p210Bcr- kb, demonstrating the ability of ABL exon 2 to skip over the vast Abl) produced are identical to those in CML (10, 136). expanse of intron 1 to join to the splice donor site of exon 1b (7, 19, In addition to the classic breakpoints found within the major (cen- 82). This ability is maintained in the fusion gene, and the end results tral 5.8-kb region) and minor (first intron of BCR) breakpoint cluster are the joining of ABL splice acceptor site of exon 2 to the splice regions of BCR (respectively termed M-bcr and m-bcr), other unique donor sites of various BCR exons and the excision of ABL exons 1a breakpoint sites have been found. These include a micro 3Ј site termed and 1b. (ABL exons 1a and 1b do not have splice acceptor sites.) ␮ -bcr [BCR exon 19 (c3) to BCR exon 20 (c4)], which can yield a Mr Indeed, even in CML containing breaks within M-bcr, splicing can 230,000 protein (24, 156, 157). Patients with the e19a2 fusion be- occasionally result in a transcript with an e1/a2 junction in addition to tween BCR exon 19 (e19) and ABL exon 2 (a2) were classified as transcripts with a b2a2 or b3a2 junction (143, 166). having neutrophilic CML (157). Because these cases were viewed as being less aggressive than typical CML, it has been suggested that the Bcr-Abl Functional Characteristics amount of BCR sequences present in the fusion transcripts correlate with disease phenotype (23, 157). However, there have been reports of Kinase Activation. Tyrosine kinase activity is essential to cellular patients with classic CML and AML phenotypes who possess the signaling and growth, and constitutively elevated kinase activity has e19a2 fusion transcript (158–161). Reports of other BCR-ABL vari- been associated with oncogenic changes in several systems. The ants include a b3a3, an e6a2, an e2/a1a, and more recently, e8/a2 and Abl protein is a nonreceptor tyrosine kinase, which normally has very e13/a2 fusion transcripts/genes (Refs. 162–165; Fig. 1; Table 5). little constitutive kinase activity (5). Both the p210Bcr-Abl and the The differences in size of BCR-ABL transcripts is not only a p190Bcr-Abl proteins have constitutively activated tyrosine kinase en- reflection of variation in the sites of breakage/fusion but is also a zymatic activity, with higher levels of activity in the p190 protein result of alternative splicing between BCR and ABL and within BCR (Tables 6 and 7). Interestingly, most of the autophosphorylated ty- itself (19, 166). The normal ABL gene is composed of 11 exons, which rosines occur within the Bcr segment of Bcr-Abl (72). The tyrosine include exons 1a and the more proximal exon 1b. These exons can be kinase activity is attributable to the kinase domain found within the alternatively spliced, yielding two different mRNAs of 6- and 7-kb in Abl segment of the fusion proteins (5, 6, 8–10, 200). Indeed, it

Table 7 Characteristics of p190Bcr-Abl Comments Refs. Location of gene encoding Chromosome 22q11 8, 10–12, 135, 136, 138, 139, 199 p190Bcr-Abl

Size of gene Contains NH2-terminal BCR sequences (exon 1 of BCR) and COOH-terminal ABL 8, 10–12, 135, 136, 138, 139, 199 sequences Breaks is in proximal 5Ј region of BCR gene (in the first intron) 8, 10–12, 26, 135, 136, 138, 139, 141, 199 Size of transcript 7.0-kb 10–12 Localization Cytoplasmic protein 33 Functions Constitutively activated tyrosine kinase 10, 200 May prevent apoptosis 181, 195 Linked to Jak/Stat pathway (especially Stat5) 179, 185 Linked to phosphotidylinositol 3-kinase pathway 191 Transforming activity mediated through Ras pathway 194, 195, 201 Induces ubiquitin-dependent degradation of the Abl tyrosine kinase inhibitor, Abelson 103 interacting protein May induce alterations in adhesion properties 196, 197 2348

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2001 American Association for Cancer Research. THE BCR GENE AND LEUKEMOGENESIS appears that the degree of transforming activity of Bcr-Abl correlates Effect on Apoptosis. One proposed mechanism through which the with the degree of tyrosine kinase activity (200), and this activity has activity of Bcr-Abl is mediated is suppression of apoptosis, or pro- been implicated in the growth factor independence that Bcr-Abl grammed cell death. Hematopoietic growth factors are known to confers on cells (202). Furthermore, Bcr-Abl induces the tyrosine suppress apoptosis, and BCR/ABL can abrogate growth factor de- phosphorylation of many cellular proteins including Crkl, Shc, Syp, pendence in a variety of hematopoietic cell lines (226). Suppression of Fes, Vav, and paxillin (99, 100, 170, 203–208). apoptosis by Bcr-Abl may be mediated by inducing the expression of Interaction with Ras-related Pathways. The importance of Ras the antiapoptotic protein, Bcl-2 (perhaps through Stat pathways), by pathways in Bcr-Abl oncogenesis is underscored by experiments phosphorylation of the proapoptotic protein Bad or through Ras- demonstrating that Ras activation is necessary for transformation by dependent pathways (176, 195, 227). both p210Bcr-Abl and p190Bcr-Abl (201, 209). The mechanisms by Effect on Stat5. The growth factor independence demonstrated by which Bcr-Abl interacts with the Ras pathway are complex. Impli- Bcr-Abl-positive cells is, to some extent, mediated through constitu- cated molecules include the adapter protein Grb2, the Ras activator tive activation of the growth factor-dependent signal transducer and SOS (son of sevenless), RasGAP, Crkl (an SH2/SH3 adapter protein), activator of transcription (Stat) proteins, especially Stat5 (182, 184– and the docking protein, p62Dok (59, 99, 100, 168, 169, 171–174). 186, 188, 228, 229). Hematopoiesis is strongly regulated by growth Crkl has also been found to interact with normal Abl (100). It was factors and, in myeloid cells, cytokines such as interleukin 3 and shown recently that p210 BCR-ABL mutants with deletion of the granulocyte/macrophage-colony stimulating factor, upon binding to Grb2-binding site, the SH2 domain, as well as the tetramerization their respective receptors, can elicit the Jak/Stat signaling pathway. domain within the Bcr portion do not have diminished transforming [Phosphorylation on its tyrosine residues can activate the Jak protein, properties in hematopoietic cells, although these mutations drastically and they in turn can activate the Stat proteins also through tyrosine- reduce transforming activity of BCR-ABL in fibroblasts (210). It has phosphorylation. Further downstream, activated Stats are then able to been suggested that Ras activation in cells bearing these BCR-ABL increase the transcriptional expression of cell survival genes (230).] In mutants was mediated by Shc proteins and was critical to transfor- cells transformed by p210Bcr-Abl, Bcr-Abl not only constitutively Ras ␤ mation of hematopoietic cells (210). Finally, p21 is linked to phosphorylates the shared c subunit of the interleukin 3 and granu- pathways that activate downstream Jun kinase, and it appears that this locyte/macrophage-colony stimulating factor receptor in the absence molecule is also a requisite for Bcr-Abl transforming activity (193). of ligand but also coimmunoprecipitates with it (183). Bcr-Abl may Interaction with Ship Proteins. The Ship proteins (Ship1 and also work upstream of the Stat proteins by constitutively phosphor- Ship2) are also downstream targets of Bcr-Abl (211–215). Ship1 has ylating, and thus activating, the Jaks, which in turn activate the Stat been shown to regulate hematopoiesis in mice, and disruption proteins (183, 186, 228). However, because Bcr-Abl can directly of murine Ship results in a myeloproliferative syndrome (216). activate the Stat proteins, the need for the Jaks as a mediator could be p210Bcr-Abl negatively regulates the expression of Ship1, in part, by bypassed (185). reducing its half-life (198). The Ship proteins have also been found to Although both p210Bcr-Abl and p190Bcr-Abl phosphorylate several interact with the adapter proteins Shc and Grb2, which, as discussed members of the Stat proteins in BCR-ABL-positive or BCR-ABL- above, play a role in Ras-mediated signal transduction pathways (211, transformed cells and cell lines, Stat5 appears to be the most promi- 212, 214, 217). Finally, the Bcr-Abl-specific kinase inhibitor STI 571 nent substrate (182, 184–186, 228). In addition, phospho-Stat5 is (CGP 57148B) causes reexpression of Ship, further supporting the required for the growth factor-independent growth and contributed to Bcr-Abl implication that p210 directly, but reversibly, regulates Ship the transformation, as well as the antiapoptotic activity, of BCR-ABL expression (198). cell lines developed from CML patients (186–188). Effect on Adhesion Molecules. Other substrates of the tyrosine Negative Regulation of Bcr-Abl by Bcr. Bcr can form heterotet- kinase activity of Bcr-Abl include the focal adhesion proteins Fak ramers with Bcr-Abl through the NH2-terminal oligomerization do- (focal adhesion kinase) and paxillin (208, 218). Clinically, an in- mains of the two proteins (76, 77). In addition, Bcr binds to SH2 creased expansion of committed myeloid progenitors and precursors, domains of normal Abl and coprecipitates with normal Abl (60). The elevated levels of mature granulocytes, and premature release of the result of interaction between Bcr and Bcr-Abl may be functional progenitor/precursor cells characterize CML. This is postulated to be feedback regulation (71). Indeed, phosphorylation of the tyrosine 360 attributable to defects in the adhesion properties of these cells, perhaps of Bcr by Bcr-Abl inhibits the kinase activity of Bcr, whereas serine because of inside-to-outside disruption of focal adhesion molecule phosphorylation within the first exon of Bcr inhibits the kinase activ- function and subsequent perturbation of adhesion molecules such as ity of Abl (71, 231, 232). integrin ␤1 (196). [Normally, hematopoietic cells can attach to extra- ␣ ␤ cellular matrix such as fibronectin and stroma via integrins (i.e., 4 1 Therapeutic Implications and Future Directions and ␣5␤1), which in turn interacts with cytoskeletal proteins at focal adhesion points (196).] The salutary effect of IFN-␣ in a subset of Recently, molecules that specifically target the BCR-ABL gene CML patients may be attributable to restoration of normal ␤1 integrin product have been developed. One such molecule that has aroused function (196, 219, 220). In addition, inhibition of either the levels or tremendous interest is the Bcr-Abl-specific kinase inhibitor STI 571 the kinase activity of Bcr-Abl can restore ␤1 integrin-mediated adhe- (CGP 57148B). STI 571 is a derivative of 2-phenylaminopyrimidine, sion (221, 222). However, other investigators have disputed these a class of inhibitors believed to function by competing with ATP for results with experiments that demonstrate that expression of Bcr-Abl the ATP-binding site of the kinases (233). This compound was shown in certain cell lines leads to increased adhesion of these cells to to be a potent inhibitor of oncogenic forms of Abl. It suppresses tumor fibronectin-coated surfaces mediated through expression of ␣5␤1 growth in v-Abl-transformed cells as well as in primary cells from integrin (223). It has also been shown that overexpression of Crkl, the CML patients (233–236). In addition, long-term (2–8 weeks) expo- Bcr-Abl substrate, which can act as a mediator between Bcr-Abl and sure of the CML progenitor cells to STI 571 results in a sustained paxillin (224), increases cell adhesion to fibronectin-coated plates inhibition of these cells (236). In addition to its antiproliferative (225). At least some of these experimental disparities may be attrib- attributes, STI 571 also induces apoptosis in Bcr-Abl-positive cells uted to differences in cell type used and/or the use of established cell (235, 237). Subsequent studies demonstrated that the apoptotic effect lines versus bone marrow samples from CML patients. of STI 571 may be mediated by decreased levels of phosphorylated 2349

Stat-5 (238, 239). This in turn leads to down-regulation of Stat-5- cause of the interaction between Bcr and G proteins and the crucial dependent expression of the antiapoptotic protein, Bcl-XL (238, 239). role of Ras-dependent pathways in Bcr-Abl-mediated oncogenesis Several investigators are also examining the in vitro effect of STI 571 (201, 209), Ras is an apt target (256). Activation of Ras depends on when used in conjunction with other established therapies for BCR- the addition of a prenyl group (generally a farnesyl), which allows it ABL-positive leukemias (240–242). These studies demonstrate, for to attach to the cell membrane. Molecules that inhibit farnesyl trans- example, that the combination of STI 571 and IFN-␣ additively ferase, one of the key enzymes responsible for this reaction, are now inhibited proliferation of CML cells (240, 241). entering clinical trials in CML. Currently, STI 571 is in early clinical trials aimed at chronic phase In summary, understanding the molecular genetics of BCR-ABL CML patients who have failed IFN therapy and at blast crisis patients leukemogenesis is leading rapidly toward molecular targeting as a (243–246). Twenty-three of 24 (96%) IFN-refractory chronic phase treatment. Indeed, several vital lessons have been learned from the patients treated with 300–500 mg of STI 571 p.o. on a daily basis development of the Bcr-Abl tyrosine kinase inhibitor (257). These attained complete hematological response (243). Even more striking, include the importance of identifying molecular targets and the fea- many patients had cytogenetic responses, and there was little in the sibility of using novel drug design technology to discover specific and way of side effects. The durability of these responses is not yet clear. selective inhibitors, even for enzymes such as kinases that have Preliminary results of a trial in 234 patients with accelerated phase widespread biological impact. The success of STI 571 in the clinic showed that 78% attained hematological responses at 4 weeks (246). indicates that this approach can and should be used as a paradigm for In addition, 82% of patients with Ph-positive ALL or lymphoid blast applying molecular therapeutics in other cancers. crisis have responded. Fifty-five % of the responses were complete, albeit short-lived. Patients with myeloid blast crisis of CML also References responded. Indeed, 55% of a group of 33 such patients attained response, with 22% of the responses being complete (244, 245). The 1. Groffen, J., Stephenson, J. R., Heisterkamp, N., de Klein, A., Bartram, C. R., and Grosveld, G. Philadelphia chromosomal breakpoints are clustered within a limited latter observations are surprising because by definition, blast crisis region, bcr, on chromosome 22. Cell, 36: 93–99, 1984. patients are presumed to have additional molecular defects beyond 2. Rowley, J. D. A new consistent chromosomal abnormality in chronic myelogenous Bcr-Abl that drive evolution of the disease and growth of the leukemic leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature (Lond.), 243: 290–293, 1973. cells. These findings therefore suggest that inactivation of Bcr-Abl 3. Prakash, O., and Yunis, J. J. High resolution chromosomes of the t(9;22) positive nevertheless interferes with a growth or survival signal in advanced leukemias. Cancer Genet. Cytogenet., 11: 361–367, 1984. disease. These striking results indicate that gene-targeted therapies 4. Heisterkamp, N., Stam, K., Groffen, J., de Klein, A., and Grosveld, G. Structural organization of the BCR gene and its role in the PhЈ translocation. Nature (Lond.), have the potential to control malignant cell proliferation without host 315: 758–761, 1985. toxicities. 5. Konopka, J. B., Watanabe, S. M., and Witte, O. N. An alteration of the human c-Abl protein in K562 leukemia cells unmasks associated tyrosine kinase activity. Cell, 37: Another innovative approach is to target BCR-ABL at the RNA 1035–1042, 1984. level. This can be accomplished by the use of antisense oligonucleo- 6. Kloetzer, W., Kurzrock, R., Smith, L., Talpaz, M., Spiller, M., Gutterman, J., and tides or of catalytic RNAs called ribozymes (247, 248). One require- Arlinghaus, R. The human cellular ABL gene product in the chronic myelogenous leukemia cell line K562 has an associated tyrosine protein kinase activity. Virology, ment for the success of these two strategies is specificity for the target 140: 230–238, 1985. gene. In the case of BCR-ABL, the majority of antisense/ribozyme 7. Ben-Neriah, Y., Bernards, A., Paskind, M., Daley, G. Q., and Baltimore, D. Alter- Ј constructed is targeted toward the junction of BCR-ABL (e.g., b3a2 native 5 exons in c-ABL mRNA. Cell, 44: 577–586, 1986. 8. Kurzrock, R., Kloetzer, W. S., Talpaz, M., Blick, M., Walters, R., Arlinghaus, R. B., junction). Theoretically, this would increase the selective binding of and Gutterman, J. U. Identification of molecular variants of p210Bcr-Abl in chronic the aberrant RNA and lessen the occurrence of nonspecific binding myelogenous leukemia. Blood, 70: 233–236, 1987. 9. Kurzrock, R., Shtalrid, M., Talpaz, M., Kloetzer, W. S., and Gutterman, J. U. toward normal BCR or ABL RNA. However, the incidence of non- Expression of c-Abl in Philadelphia-positive acute myelogenous leukemia. Blood, specific cleavage of other RNAs as well as poor uptake of the 70: 1584–1588, 1987. nucleotides are some of the problems encountered with these kind of 10. Kurzrock, R., Shtalrid, M., Romero, P., Kloetzer, W. S., Talpaz, M., Trujillo, J. M., Blick, M., Beran, M., and Gutterman, J. U. A novel c-Abl protein product in strategies. These difficulties have led to the exploration of modified Philadelphia-positive acute lymphoblastic leukaemia. Nature (Lond.), 325: 631– oligonucleotides and ribozymes (248–251), as well as alternative 635, 1987. forms of catalytic RNA. This includes the use of M1 RNA (the 11. Chan, L. C., Karhi, K. K., Rayter, S. I., Heisterkamp, N., Eridani, S., Powles, R., Lawler, S. D., Groffen, J., Foulkes, J. G., Greaves, M. F., and Wiedemann, L. M. A catalytic RNA subunit of RNase P from Escherichia coli), a ribozyme novel Abl protein expressed in Philadelphia chromosome positive acute lympho- that can be easily modified to target specific mRNA sequence, blastic leukaemia. Nature (Lond.), 325: 635–637, 1987. 12. Hermans, A., Heisterkamp, N., von Lindern, M., van Baal, S., Meijer, D., van der through the addition of a guide sequence against a specific site of the Plas, D., Wiedemann, L. M., Groffen, J., Bootsma, D., and Grosveld, G. Unique target mRNA (e.g., BCR-ABL junction; Ref. 252). Targeting BCR- fusion of BCR and c-ABL genes in Philadelphia chromosome positive acute lym- ABL at the RNA level may be best applicable to ex vivo purging of phoblastic leukemia. Cell, 51: 33–40, 1987. 13. Walker, L. C., Ganesan, T. S., Dhut, S., Gibbons, B., Lister, T. A., Rothbard, J., and bone marrow cells from patients with CML (253). Young, B. D. Novel chimaeric protein expressed in Philadelphia positive acute Another potentially unique direction using Bcr fragments as ther- lymphoblastic leukaemia. Nature (Lond.), 329: 851–853, 1987. apy is based on the observation that high levels of Bcr in Bcr-Abl- 14. Kurzrock, R., Gutterman, J. U., and Talpaz, M. The molecular genetics of Phila- delphia chromosome-positive leukemias. N. Engl. J. Med., 319: 990–998, 1988. transformed cells attenuate the kinase activity of Bcr-Abl (254). In 15. Shtivelman, E., Lifshitz, B., Gale, R. P., and Canaani, E. Fused transcript of ABL and addition, a Bcr peptide fragment containing a mutated (S354 to E354) BCR genes in chronic myelogenous leukaemia. Nature (Lond.), 315: 550–554, 1985. or phosphorylated serine 354 greatly inhibits the tyrosine kinase 16. Stam, K., Heisterkamp, N., Grosveld, G., de Klein, A., Verma, R. S., Coleman, M., activity of both Abl and Bcr-Abl (231, 255). Similarly, a peptide Dosik, H., and Groffen, J. Evidence of a new chimeric BCR/c-ABL mRNA in containing the Bcr oligomerization domain (amino acids 1–160) patients with chronic myelocytic leukemia and the Philadelphia chromosome. N. Engl. J. Med., 313: 1429–1433, 1985. has been demonstrated to reverse the transformed phenotype of 17. Dhut, S., Dorey, E. L., Horton, M. A., Ganesan, T. S., and Young, B. D. Identifi- p210Bcr-Abl-positive 32D myeloid leukemia cells (58). On the basis of cation of two normal BCR gene products in the cytoplasm. Oncogene, 3: 561–566, these results, it has been hypothesized that these peptide fragments, or 1988. 18. Konopka, J. B., and Witte, O. N. Detection of c-Abl tyrosine kinase activity in vitro even a truncated Bcr containing exon 1, could be used as a therapeutic permits direct comparison of normal and altered ABL gene products. Mol. Cell. agent for Bcr-Abl-positive leukemias (58, 71). Biol., 5: 3116–3123, 1985. 19. Shtivelman, E., Lifshitz, B., Gale, R. P., Roe, B. A., and Canaani, E. Alternative Finally, direct suppression of Bcr-Abl by interference with down- splicing of RNAs transcribed from the human ABL gene and from the BCR-ABL stream pathways critical to transformation merits exploration. Be- fused gene. Cell, 47: 277–284, 1986. 2350

20. Gale, R. P., and Canaani, E. An 8-kilobase ABL RNA transcript in chronic myelog- 50. Laurent, E., Talpaz, M., Wetzler, M., and Kurzrock, R. Cytoplasmic and nuclear enous leukemia. Proc. Natl. Acad. Sci. USA, 81: 5648–5652, 1984. localization of the 130 and 160 kDa Bcr proteins. Leukemia (Baltimore), 14: 21. Melo, J. V., Gordon, D. E., Cross, N. C. P., and Goldman, J. M. The ABL-BCR 1892–1897, 2000. fusion gene is expressed in chronic myeloid leukemia. Blood, 81: 158–165, 1993. 51. Takeda, N., Shibuya, M., and Maru, Y. The Bcr-Abl oncoprotein potentially inter- 22. Kurzrock, R., Shtalrid, M., Gutterman, J. U., Koller, C. A., Walters, R., Trujillo, acts with the xeroderma pigmentosum group B protein. Proc. Natl. Acad. Sci. USA, J. M., and Talpaz, M. Molecular analysis of chromosome 22 breakpoints in adult 96: 203–207, 1999. Philadelphia-positive acute lymphoblastic leukaemia. Br. J. Haematol., 67: 55–59, 52. Maru, Y., Kobayashi, T., Tanaka, K., and Shibuya, M. Bcr binds to the xeroderma 1987. pigmentosum group B protein. Biochem. Biophys. Res. Commun., 260: 309–312, 23. Melo, J. V. The diversity of Bcr-Abl fusion proteins and their relationship to 1999. leukemia phenotype. Blood, 88: 2375–2384, 1996. 53. Frit, P., Bergmann, E., and Egly, J-M. Transcription factor IIH: a key player in the 24. Saglio, G., Guerrasio, A., Rosso, C., Zaccaria, A., Tassinari, A., Serra, A., Rege- cellular response to DNA damage. Biochimie, 81: 27–38, 1999. Cambrin, G., Mazza, U., and Gavosto, F. New type of BCR/ABL junction in 54. Maru, Y., and Witte, O. N. The BCR gene encodes a novel serine/threonine kinase Philadelphia chromosome-positive chronic myelogenous leukemia. Blood, 76: activity within a single exon. Cell, 67: 459–468, 1991. 1819–1824, 1990. 55. Reuther, G. W., Fu, H., Cripe, L. D., Collier, R. J., and Pendergast, A-M. Associ- 25. Stam, K., Heisterkamp, N., Reynolds, F. H., Jr., and Groffen, J. Evidence that the ation of the protein kinases c-Bcr and Bcr-Abl with proteins of the 14-3-3 family. PHL gene encodes a 160,000-dalton phosphoprotein with associated kinase activity. Science (Washington DC), 266: 129–133, 1994. Mol. Cell. Biol., 7: 1955–1960, 1987. 56. Braselmann, S., and McCormick, F. Bcr and Raf form a complex in vivo via 14-3-3 26. Heisterkamp, N., Knoppel, E., and Groffen, J. The first BCR gene intron contains proteins. EMBO J., 14: 4839–4848, 1995. 57. McWhirter, J. R., Galasso, D. L., and Wang, J. Y. J. A coiled-coil oligomerization breakpoints in Philadelphia chromosome positive leukemia. Nucleic Acids Res., 16: domain of Bcr is essential for the transforming function of Bcr-Abl oncoproteins. 10069–10081, 1988. Mol. Cell. Biol., 13: 7587–7595, 1993. 27. Nowell, P. C., and Hungerford, D. A. A minute chromosome in human chronic 58. Guo, X. Y. D., Cuillerot, J-M., Wang, T., Wu, Y., Arlinghaus, R., Claxton, D., granulocytic leukemia. Science (Washington DC), 132: 1197, 1960. Bachier, C., Greenberger, J., Colombowala, I., and Deisseroth, A. B. Peptide 28. Romero, P., Beran, M., Shtalrid, M., Andersson, B., Talpaz, M., and Blick, M. containing the BCR oligomerization domain (AA 1–160) reverses the transformed Alternative 5Ј end of the BCR-ABL transcript in chronic myelogenous leukemia. phenotype of p210Bcr-Abl positive 32D myeloid leukemia cells. Oncogene, 17: Oncogene, 4: 93–98, 1989. 825–833, 1998. 29. National Center for Biotechnology Information. Entrez Nucleotide Query. http:// 59. Pendergast, A-M., Quilliam, L. A., Cripe, L. D., Bassing, C. H., Dai, Z., Li, N., www.ncbi.nlm.nih.gov/Entrez/, 1999. Batzer, A., Rabun, K. M., Der, C. J., Schlessinger, J., and Gishizky, M. L. BCR- 30. Amson, R. B., Marcelle, C., and Telerman, A. Identification of a 130Kda BCR ABL-induced oncogenesis is mediated by direct interaction with the SH2 domain of related gene product. Oncogene, 4: 243–247, 1989. the Grb-2 adaptor protein. Cell, 75: 175–185, 1993. 31. Hariharan, I. K., and Adams, J. M. cDNA sequence for human BCR, the gene that 60. Pendergast, A-M., Muller, A. J., Havlik, M. H., Maru, Y., and Witte, O. N. Bcr translocates to the ABL oncogene in chronic myeloid leukaemia. EMBO J., 6: sequences essential for transformation by the BCR-ABL oncogene bind to the Abl 115–119, 1987. SH2 regulatory domain in a nonphosphotyrosine-dependent manner. Cell, 66: 161– 32. Collins, S., Coleman, H., and Groudine, M. Expression of BCR and BCR-ABL fusion 171, 1991. transcripts in normal and leukemic cells. Mol. Cell. Biol., 7: 2870–2876, 1987. 61. Muller, A. J., Pendergast, A-M., Havlik, M. H., Puil, L., Pawson, T., and Witte, 33. Wetzler, M., Talpaz, M., Van Etten, R. A., Hirsh-Ginsberg, C., Beran, M., and O. N. A limited set of SH2 domains binds Bcr through a high-affinity phosphoty- Kurzrock, R. Subcellular localization of Bcr, Abl, and Bcr-Abl proteins in normal rosine-independent interaction. Mol. Cell. Biol., 12: 5087–5093, 1992. and leukemic cells and correlation of expression with myeloid differentiation. 62. Stewart, M. J., Cox, G., Reifel-Miller, A., Kim, S. Y., Westbrook, C. A., and J. Clin. Investig., 92: 1925–1939, 1993. Leibowitz, D. S. A novel transcriptional suppressor located within a downstream 34. Croce, C. M., Huebner, K., Isobe, M., Fainstain, E., Lifshitz, B., Shtivelman, E., and intron of the BCR gene. J. Biol. Chem., 269: 10820–10829, 1994. Canaani, E. Mapping of four distinct BCR-related loci to chromosome region 22q11: 63. Ron, D., Zannini, N., Levis, M., Wickner, R. B., Hunt, L. T., Graziani, G., Tronick, order of BCR loci relative to chronic myelogenous leukemia and acute lymphoblastic S. R., Aaronson, S. A., and Eva, A. A region of proto-dbl essential for its trans- leukemia breakpoints. Proc. Natl. Acad. Sci. USA, 84: 7174–7178, 1987. forming activity shows sequence similarity to a yeast cell cycle gene CDC24, and 35. Heisterkamp, N., Morris, C., and Groffen, J. ABR, an active BCR-related gene. the human breakpoint cluster gene, BCR. New Biol., 3: 372–379, 1991. Nucleic Acids Res., 17: 8821–8831, 1989. 64. Adams, J. M., Houston, H., Allen, J., Lints, T., and Harvey, R. The hematopoieti- 36. Lifshitz, B., Fainstein, E., Marcelle, C., Shtivelman, E., Amson, R., Gale, R. P., and cally expressed VAV proto-oncogene shares homology with the DBL GDP-GTP Canaani, E. BCR genes and transcripts. Oncogene, 2: 113–117, 1988. exchange factor, the BCR gene, and a yeast gene (CDC24) involved in cytoskeletal 37. Marcelle, C., Gale, R. P., Prokocimer, M., Berrebi, A., Merle-Beral, H., and organization. Oncogene, 7: 611–618, 1992. Canaani, E. Analysis of BCR-ABL mRNA in chronic myelogenous leukemia patients 65. Diekmann, D., Brill, S., Garrett, M. D., Totty, N., Hsuan, J., Monfries, C., Hall, C., and identification of a new BCR-related sequence in human DNA. Genes Chromo- Lim, L., and Hall, A. BCR encodes a GTPase-activating protein for p21Rac. Nature somes Cancer, 1: 172–179, 1989. (Lond.), 351: 400–402, 1991. 38. DiSilvestre, D., Morris, C., Heisterkamp, N., and Groffen, J. A hypervariable RFLP 66. Voncken, J. W., van Schaick, H., Kaartinen, V., Deemer, K., Coates, T., Landing, within the ABR gene. Nucleic Acids Res., 18: 5924, 1990. B., Pattengale, P., Dorseuil, O., Bokoch, G. M., Groffen, J., and Heisterkamp, N. 39. Tan, E-C., Leung, T., Manser, E., and Lim, L. The human active breakpoint cluster Increased neutrophil respiratory burst in BCR-null mutants. Cell, 80: 719–728, region-related gene encodes a brain protein with homology to guanine nucleotide 1995. exchange proteins and GTPase-activating proteins. J. Biol. Chem., 268: 27291– 67. Cicchetti, P., Mayer, B. J., Thiel, G., and Baltimore, D. Identification of a protein 27298, 1993. that binds to the SH3 region of Abl and is similar to Bcr and GAP-rho. Science 40. Muller, A. J., and Witte, O. N. The 5Ј noncoding region of the human leukemia- (Washington DC), 257: 803–806, 1992. associated oncogene BCR/ABL is a potent inhibitor of in vitro translation. Mol. Cell. 68. Hart, M. J., Eva, A., Evans, T., Aaronson, S. A., and Cerione, R. A. Catalysis of Biol., 9: 5234–5238, 1989. guanine nucleotide exchange on the Cdc42Hs protein by the DBL oncogene product. 41. Zhu, Q-S., Heisterkamp, H., and Groffen, J. Unique organization of the human BCR Nature (Lond.), 354: 311–314, 1991. 69. Muller, A. J., Young, J. C., Pendergast, A-M., Pondel, M., Landau, N. R., Littman, gene promoter. Nucleic Acids Res., 18: 7119–7125, 1990. D. R., and Witte, O. N. BCR first exon sequences specifically activate the BCR/ABL 42. Shah, N. P., Witte, O. N., and Denny, C. T. Characterization of the BCR promoter tyrosine kinase oncogene of Philadelphia chromosome-positive human leukemias. in Philadelphia chromosome-positive and -negative cell lines. Mol. Cell. Biol., 11: Mol. Cell. Biol., 11: 1785–1792, 1991. 1854–1860, 1991. 70. McWhirter, J. R., and Wang, J. Y. J. Activation of tyrosine kinase and microfila- 43. Watson, J. D., Hopkins, N. H., Roberts, J. W., Steitz, J. A., and Weiner, A. M. The ment-binding functions of c-Abl by Bcr sequences in Bcr/Abl fusion proteins. Mol. functioning of higher eucaryotic genes. In: J. R. Gillen (ed.), Molecular Biology of Cell. Biol., 11: 1553–1565, 1991. the Gene, Ed. 4, pp. 676–744. Menlo Park, California: Benjamin/Cummings, 1988. 71. Arlinghaus, R. B. The involvement of Bcr in leukemias with the Philadelphia 44. Li, W., Dreazen, O., Kloetzer, W., Gale, R. P., and Arlinghaus, R. B. Characteriza- chromosome. Crit. Rev. Oncog., 9: 1–18, 1998. tion of BCR gene products in hematopoietic cells. Oncogene, 4: 127–138, 1989. 72. Liu, J., Campbell, M., Guo, J. Q., Lu, D., Xian, Y. M., Andersson, B. S., and 45. Heisterkamp, N., Kaartinen, V., van Soest, S., Bokoch, G. M., and Groffen, J. Rac Arlinghaus, R. B. BCR-ABL tyrosine kinase is autophosphorylated or transphosphor- Human ABR encodes a protein with GAP activity and homology to the DBL ylates p160 Bcr on tyrosine predominantly within the first Bcr exon. Oncogene, 8: nucleotide exchange factor domain. J. Biol. Chem., 268: 16903–16906, 1993. 101–109, 1992. 46. Chuang, T-H., Xu, X., Kaartinen, V., Heisterkamp, N., Groffen, J., and Bokoch, 73. Sadowski, I., Stone, J. C., and Pawson, T. A noncatalytic domain conserved among G. M. Abr and Bcr are multifunctional regulators of the Rho GTP-binding protein cytoplasmic protein-tyrosine kinases modifies the kinase function and transforming family. Proc. Natl. Acad. Sci. USA, 92: 10282–10286, 1995. activity of Fujinami sarcoma virus p130Gag-Fps. Mol. Cell. Biol., 6: 4396–4408, 47. Dhut, S., Chaplin, T., and Young, B. D. Bcr-Abl and Bcr proteins. Biochemical 1986. characterization and localization. Leukemia (Baltimore), 4: 745–750, 1990. 74. Koch, C. A., Anderson, D., Moran, M. F., Ellis, C., and Pawson, T. SH2 and SH3 48. Arlinghaus, R. B. Multiple BCR-related gene products and their proposed involve- domains: elements that control interactions of cytoplasmic signaling proteins. Sci- ment in ligand-induced signal transduction pathways. Mol. Carcinog., 5: 171–173, ence (Washington DC), 252: 668–674, 1991. 1992. 75. Margolis, B. Proteins with SH2 domains: transducers in the tyrosine kinase signaling 49. Wetzler, M., Talpaz, M., Yee, G., Stass, S. A., Van Etten, R. A., Andreeff, M., pathway. Cell Growth Differ., 3: 73–80, 1992. Goodacre, A. M., Kleine, H-D., Mahadevia, R. K., and Kurzrock, R. Cell cycle- 76. Pendergast, A-M., Clark, R., Kawasaki, E. S., McCormick, F. P., and Witte, O. N. related shifts in subcellular localization of Bcr: association with mitotic chromo- Baculovirus expression of functional p210 BCR-ABL oncogene product. Oncogene, somes and with heterochromatin. Proc. Natl. Acad. Sci. USA, 92: 3488–3492, 1995. 4: 759–766, 1989. 2351

77. Campbell, M. L., Li, W., and Arlinghaus, R. B. p210 Bcr-Abl is complexed to p160 105. Juang, J-L., and Hoffmann, F. M. Drosophila Abelson interacting protein (dAbi) is Bcr and Ph-p53 proteins in K562 cells. Oncogene, 5: 773–776, 1990. a positive regulator of Abelson tyrosine kinase activity. Oncogene, 18: 5138–5147, 78. Okuda, K., Golub, T. R., Gilliland, D. G., and Griffin, J. D. p210 BCR/ABL, p190 1999. BCR/ABL, and TEL/ABL activate similar signal transduction pathways in hemato- 106. McWhirter, J. R., and Wang, J. Y. J. An actin-binding function contributes to poietic cell lines. Oncogene, 13: 1147–1152, 1996. transformation by the Bcr-Abl oncoprotein of Philadelphia chromosome-positive 79. van Etten, R. A., Jackson, P., and Baltimore, D. The mouse type IV c-ABL gene human leukemias. EMBO J., 12: 1533–1546, 1993. product is a nuclear protein, and activation of transforming ability is associated with 107. Gibbs, J. B., Schaber, M. D., Garsky, V. M., Vogel, U. S., Scolnick, E. M., Dixon, cytoplasmic localization. Cell, 58: 669–678, 1989. R. A. F., and Marshall, M. S. Structure/function relationships of Ras and guanosine 80. Kipreos, E. T., and Wang, J. Y. J. Cell cycle-regulated binding of c-Abl tyrosine triphosphatase-activating protein. In: N. M. Nathanson and T. K. Harden (eds.), G kinase to DNA. Science (Washington DC), 256: 382–385, 1992. proteins and Signal Transduction: Society of General Physiologists, 43rd Annual 81. Heisterkamp, N., Groffen, J., Stephenson, J. R., Spurr, N. K., Goodfellow, P. N., Symposium, pp. 77–85. New York: Rockefeller University Press, 1990. Solomon, E., Carritt, B., and Bodmer, W. F. Chromosomal localization of human 108. van Aelst, L., and D’Souza-Schorey, C. Rho GTPases and signaling networks. cellular homologues of two viral oncogenes. Nature (Lond.), 299: 747–749, 1982. Genes Dev., 11: 2295–2322, 1997. 82. Bernards, A., Rubin, C. M., Westbrook, C. A., Paskind, M., and Baltimore, D. The 109. Cen, H., Papageorge, A. G., Zippel, R., Lowy, D. R., and Zhang, K. Isolation of first intron in the human c-ABL gene is at least 200 kilobases long and is a target for multiple mouse cDNAs with coding homology to Saccharomyces cerevisiae translocations in chronic myelogenous leukemia. Mol. Cell. Biol., 7: 3231–3236, CDC25: identification of a region related to BCR, VAV, DBL, and CDC24. EMBO 1987. J., 11: 4007–4015, 1992. 83. Dhut, S., Chaplin, T., and Young, B. D. Normal c-ABL gene protein–a nuclear 110. Sloat, B. F., Adams, A., and Pringle, J. R. Roles of the CDC24 gene product in cellular morphogenesis during the Saccharomyces cerevisiae cell cycle. J. Cell Biol., component. Oncogene, 6: 1459–1464, 1991. 89: 395–405, 1981. 84. Kharbanda, S., Pandey, P., Morris, P. L., Whang, Y., Xu, Y., Sawant, S., Zhu, L-J., 111. Chant, J., and Pringle, J. R. Budding and cell polarity in Saccharomyces cerevisiae. Kumar, N., Yuan, Z-M., Weichselbaum, R., Sawyers, C. L., Pandita, T. K., and Curr. Opin. Genet. Dev., 1: 342–350, 1991. Kufe, D. Functional role for the c-Abl tyrosine kinase in meiosis I. Oncogene, 16: 112. Ziman, M., O’Brien, J. M., Ouellette, L. A., Church, W. R., and Johnson, D. I. 1773–1777, 1998. Mutational analysis of CDC42Sc,aSacchromyces cerevisiae gene that encodes a 85. David-Cordonnier, M-H., Hamdane, M., Bailly, C., and D’Halluin, J-C. Determi- putative GTP-binding protein involved in the control of cell polarity. Mol. Cell. nation of the human c-Abl consensus DNA binding site. FEBS Lett., 424: 177–182, Biol., 11: 3537–3544, 1991. 1998. 113. Johnson, D. I., and Pringle, J. R. Molecular characterization of CDC42,aSacchro- 86. David-Cordonnier, M-H., Hamdane, M., Bailly, C., and D’Halluin, J-C. The DNA myces cerevisiae gene involved in the development of cell polarity. J. Cell Biol., binding domain of the human c-Abl tyrosine kinase preferentially binds to DNA 111: 143–152, 1990. sequences containing an AAC motif and to distorted DNA structures. Biochemistry, 114. Ziman, M., and Johnson, D. I. Genetic evidence for a functional interaction between 37: 6065–6076, 1998. Saccharomyces cerevisiae CDC24 and CDC42. Yeast, 10: 463–474, 1994. 87. Franz, W. M., Berger, P., and Wang, J. Y. J. Deletion of an N-terminal regulatory 115. Hall, A. The cellular functions of small GTP-binding proteins. Science (Washington domain of the c-Abl tyrosine kinase activates its oncogenic potential. EMBO J., 8: DC), 249: 635–640, 1990. 137–147, 1989. 116. Hall, A. Ras-related proteins. Curr. Opin. Cell Biol., 5: 265–268, 1993. 88. Jackson, P., and Baltimore, D. N-terminal mutations activate the leukemogenic 117. Ridley, A. J., and Hall, A. The small GTP-binding protein Rho regulates the potential of the myristylated form of c-Abl. EMBO J., 8: 449–456, 1989. assembly of focal adhesions and actin stress fibers in response to growth factors. 89. Barila, D., and Superti-Furga, G. An intramolecular SH3-domain interaction regu- Cell, 70: 389–399, 1992. lates c-Abl activity. Nat. Genet., 18: 280–282, 1998. 118. Lancaster, C. A., Taylor-Harris, P. M., Self, A. J., Brill, S., van Erp, H. E., and Hall, 90. Welch, P. J., and Wang, J. Y. J. A c-terminal protein-binding domain in the A. Characterization of RhoGAP. A GTPase-activating protein for Rho-related small retinoblastoma protein regulates nuclear c-Abl tyrosine kinase in the cell cycle. Cell, GTPases. J. Biol. Chem., 269: 1137–1142, 1994. 75: 779–790, 1993. 119. Hall, C., Monfries, C., Smith, P., Lim, H. H., Kozma, R., Ahmed, S., 91. Goga, A., Liu, X., Hambuch, T. M., Senechal, K., Major, E., Berk, A. J., Witte, Vanniasingham, V., Leung, T., and Lim, L. Novel human brain cDNA encoding a

O. N., and Sawyers, C. L. p53 dependent growth suppression by the c-Abl nuclear 34,000 Mr protein n-chimaerin, related to both the regulatory domain of protein tyrosine kinase. Oncogene, 11: 791–799, 1995. kinase C and Bcr, the product of the breakpoint cluster region gene. J. Mol. Biol., 92. Afar, D. E. H., McLaughlin, J., Sherr, C. J., Witte, O. N., and Roussel, M. F. 211: 11–16, 1990. Signaling by ABL oncogenes through cyclin D1. Proc. Natl. Acad. Sci. USA, 92: 120. Aitken, A. 14-3-3 proteins on the MAP. Trends Biochem. Sci., 20: 95–97, 1995. 9540–9544, 1995. 121. Ford, J. C., Al-Khodairy, F., Fotou, E., Sheldrick, K. S., Griffiths, D. J. F., and Carr, 93. Shafman, T., Khanna, K. K., Kedar, P., Spring, K., Kozlov, S., Yen, T., Hobson, K., A. M. 14-3-3 protein homologs required for the DNA damage checkpoint in fission Gatei, M., Zhang, N., Watters, D., Egerton, M., Shiloh, Y., Kharbanda, S., Kufe, D., yeast. Science (Washington DC), 265: 533–535, 1994. and Lavin, M. F. Interaction between Atm protein and c-Abl in response to DNA 122. Lopez-Girona, A., Furnari, B., Mondesert, O., and Russell, P. Nuclear localization damage. Nature (Lond.), 387: 520–523, 1997. of Cdc25 is regulated by DNA damage and a 14-3-3 protein. Nature (Lond.), 397: 94. Baskaran, R., Wood, L. D., Whitaker, L. L., Canman, C. E., Morgan, S. E., Xu, Y., 172–175, 1999. Barlow, C., Baltimore, D., Wynshaw-Boris, A., Kastan, M. B., and Wang, J. Y. J. 123. Muslin, A. J., Tanner, J. W., Allen, P. M., and Shaw, A. S. Interaction of 14-3-3 with Ataxia telangiectasia mutant protein activates c-Abl tyrosine kinase in response to signaling proteins is mediated by the recognition of phosphoserine. Cell, 84: ionizing radiation. Nature (Lond.), 387: 516–519, 1997. 889–897, 1996. 95. Agami, R., Blandino, G., Oren, M., and Shaul, Y. Interaction of c-Abl and p73␣ and 124. Jones, D. H., Ley, S., and Aitken, A. Isoforms of 14-3-3 protein can form homo- and their collaboration to induce apoptosis. Nature (Lond.), 399: 809–813, 1999. heterodimers in vivo and in vitro: implications for function as adapter proteins. 96. Yuan, Z. M., Shioya, H., Ishiko, T., Sun, X., Gu, J., Huang, Y. Y., Lu, H., FEBS Lett., 368: 55–58, 1995. Kharbanda, S., Weichselbaum, R., and Kufe, D. p73 is regulated by tyrosine kinase 125. Catovsky, D., Pittman, S., O’Brien, M., Cherchi, M., Costello, C., Foa, R., Pearce, c-Abl in the apoptotic response to DNA damage. Nature (Lond.), 399: 814–817, E., Hoffbrand, A. V., Janossy, G., Ganeshaguru, K., and Greaves, M. F. Multipa- 1999. rameter studies in lymphoid leukemias. Am. J. Clin. Pathol., 72: 736–745, 1979. 126. Collins, S. J. Breakpoints on chromosome 9 and 22 in Philadelphia chromosome- 97. Gong, J. G., Costanzo, A., Yang, H-Q., Melino, G., Kaelin, W. G., Jr., Levrero, M., positive chronic myelogenous leukemia (CML). J. Clin. Investig., 78: 1392–1396, and Wang, J. Y. The tyrosine kinase c-Abl regulates p73 in apoptotic response to 1986. cisplatin-induced DNA damage. Nature (Lond.), 399: 806–809, 1999. 127. Schaefer-Rego, K., Dudek, H., Popenoe, D., Arlin, Z., Mears, J. G., Bank, A., and 98. Kipreos, E. T., and Wang, J. Y. J. Differential phosphorylation of c-Abl in cell cycle Leibowitz, D. CML patients in blast crisis have breakpoints localized to a specific determined by Cdc2 kinase and phosphatase activity. Science (Washington DC), region of the. BCR. Blood, 70: 448–455, 1987. 248: 217–220, 1990. 128. Boehm, T. L., and Drahovsky, D. Application of a BCR-specific probe in the 99. Nichols, G. L., Raines, M. A., Vera, J. C., Lacomis, L., Tempst, P., and Golde, P. W. classification of human leukaemia. J. Cancer Res. Clin. Oncol., 113: 267–272, 1987. Identification of Crkl as the constitutively phosphorylated 39-kD tyrosine phospho- 129. Benn, P., Soper, L., Eisenberg, A., Silver, R. T., Coleman, M., Cacciapaglia, B., protein in chronic myelogenous leukemia cells. Blood, 84: 2912–2918, 1994. Bennett, L., Baird, M., Silverstein, M., Berger, C., and Bernhardt, B. Utility of 100. Oda, T., Heaney, C., Hagopian, J. R., Okuda, K., Griffin, J. D., and Druker, B. J. molecular genetic analysis of BCR rearrangement in the diagnosis of chronic Crkl is the major tyrosine-phosphorylated protein in neutrophils from patients with myeloid leukemia. Cancer Genet. Cytogenet., 29: 1–7, 1987. chronic myelogenous leukemia. J. Biol. Chem., 269: 22925–22928, 1994. 130. Selleri, L., Narni, F., Emilia, G., Colo, A., Zucchini, P., Venturelli, D., Donelli, A., 101. Sawyers, C. L., McLaughlin, J., Goga, A., Havlik, M., and Witte, O. N. The nuclear Torelli, U., and Torelli, G. Philadelphia-positive chronic myeloid leukemia with a tyrosine kinase c-Abl negatively regulates cell growth. Cell, 77: 121–131, 1994. chromosome 22 breakpoint outside the breakpoint cluster region. Blood, 70: 1659– 102. Dai, Z., and Pendergast, A-M. Abi-2, a novel SH3-containing protein interacts with 1664, 1987. the c-Abl tyrosine kinase and modulates c-Abl transforming activity. Genes Dev., 9: 131. Hirosawa, S., Aoki, N., Shibuya, M., and Onozawa, Y. Breakpoints in Philadelphia 2569–2582, 1995. chromosome (Ph1)-positive leukemias. Jpn. J. Cancer Res., 78. 590–595, 1987. 103. Dai, Z., Quackenbush, R. C., Courtney, K. D., Grove, M., Cortez, D., Reuther, 132. Shtalrid, M., Talpaz, M., Kurzrock, R., Kantarjian, H., Trujillo, J., Gutterman, J., G. W., and Pendergast, A. M. Oncogenic Abl and Src tyrosine kinases elicit the Yoffe, G., and Blick, M. Analysis of breakpoints within the BCR gene and their ubiquitin-dependent degradation of target proteins through a Ras-independent path- correlation with the clinical course of Philadelphia-positive chronic myelogenous way. Genes Dev., 12: 1415–1424, 1998. leukemia. Blood, 72: 485–490, 1988. 104. Shi, Y., Alin, K., and Goff, S. P. Abl-interactor-1, a novel SH3 protein binding to 133. Clark, S. S., McLaughlin, J., Crist, W. M., Champlin, R., and Witte, O. N. Unique the carboxy-terminal portion of the Abl protein, suppresses v-Abl transforming forms of the Abl tyrosine kinase distinguish Ph1-positive CML from Ph1-positive activity. Genes Dev., 9: 2583–2597, 1995. ALL. Science (Washington DC), 235: 85–88, 1987. 2352

134. Rodenhuis, S., Smets, L. A., Slater, R. M., Behrendt, H., and Veerman, A. J. P. molecular characterization of a novel leukemic cell line with Philadelphia chromo- Distinguishing the Philadelphia chromosome of acute lymphoblastic leukemia from some expressing p230 Bcr/Abl fusion protein. Cancer Res., 55: 3192–3196, 1995. its counterpart in chronic myelogenous leukemia. N. Engl. J. Med., 313: 51–52, 157. Pane, F., Frigeri, F., Sindona, M., Luciano, L., Ferrara, F., Cimino, R., Meloni, G., 1985. Saglio, G., Salvatore, F., and Rotoli, B. Neutrophilic-chronic myeloid leukemia: a 135. Erikson, J., Griffin, C. A., ar-Rushdi, A., Valtieri, M., Hoxie, J., Finan, J., Emanuel, distinct disease with a specific molecular marker (BCR-ABL with c3a2 junction). B. S., Rovera, G., Nowell, P. C., and Croce, C. M. Heterogeneity of chromosome 22 Blood, 88: 2410–2414, 1996. breakpoint in Philadelphia-positive (Phϩ) acute lymphocytic leukemia. Proc. Natl. 158. Emilia, G., Luppi, M., Marasca, R., and Torelli, G. Relationship between Bcr/Abl Acad. Sci. USA, 83: 1807–1811, 1986. fusion proteins and leukemia phenotype. Blood, 89: 3889, 1997. 136. de Klein, A., Hagemeijer, A., Bartram, C. R., Houwen, R., Hoefsloot, L., Carbonell, 159. Mittre, H., Leymarie, P., Macro, M., and Leporrier, M. A new case of chronic F., Chan, L., Barnett, M., Greaves, M., Kleihauer, E., Heisterkamp, N., Groffen, J., myeloid leukemia with c3/a2 BCR/ABL junction. Is it really a distinct disease? and Grosveld, G. BCR rearrangement and translocation of the c-ABL oncogene in Blood, 89: 4239–4241, 1997. Philadelphia positive acute lymphoblastic leukemia. Blood, 68: 1369–1375, 1986. 160. Briz, M., Vilches, C., Cabrera, R., Fore`s, R., and Ferna´ndez, M. N. Typical chronic 137. Okabe, M., Matsushima, S., Morioka, M., Kobayashi, M., Abe, S., Sakurada, K., myelogenous leukemia with e19a2 junction BCR/ABL transcript. Blood, 90: 5024– Kakinuma, M., and Miyazaki, T. Establishment and characterization of a cell line, 5025, 1997. TOM-1, derived from a patient with Philadelphia chromosome-positive acute lym- 161. Haskovec, C., Ponzetto, C., Polak, J., Maritano, D., Zemanova, Z., Serra, A., phocytic leukemia. Blood, 69: 990–998, 1987. Michalova, K., Klamova, H., Cermak, J., and Saglio, G. p230 Bcr/Abl protein may 138. Fainstein, E., Marcelle, C., Rosner, A., Canaani, E., Gale, R. P., Dreazen, O., Smith, be associated with an acute leukaemia phenotype. Br. J. Haematol., 103: 1104– S. D., and Croce, C. M. A new fused transcript in Philadelphia chromosome positive 1108, 1998. acute lymphocytic leukaemia. Nature (Lond.), 330: 386–388, 1987. 162. Inukai, T., Sugita, K., Suzuki, T., Ijima, K., Goi, K., Tezuka, T., Kojika, S., 139. ar-Rushdi, A., Negrini, M., Kurzrock, R., Huebner, K., and Croce, C. M. Fusion of Hatakeyama, K., Kagami, K., Mori, T., Okazaki, T., Mizutani, S., and Nakazawa, S. the BCR and the c-ABL genes in PhЈ-positive acute lymphocytic leukemia with no A novel 203 kD aberrant BCR-ABL product in a girl with Philadelphia chromosome rearrangement in the breakpoint cluster region. Oncogene, 2: 353–357, 1988. positive acute lymphoblastic leukaemia. Br. J. Haematol., 85: 823–825, 1993. 140. Saglio, G., Guerrasio, A., Tassinari, A., Ponzetto, C., Zaccaria, A., Testoni, P., 163. Hochhaus, A., Reiter, A., Skladny, H., Melo, J. V., Sick, C., Berger, U., Guo, J. Q., Celso, B., Rege-Cambrin, G., Serra, A., Pegoraro, L., Avanzi, G. C., Attadia, V., Arlinghaus, R. B., Hehlmann, R., Goldman, J. M., and Cross, N. C. P. A novel Falda, M., and Gavosto, F. Variability of the molecular defects corresponding to the BCR-ABL fusion gene (e6a2) in a patient with Philadelphia chromosome-negative presence of a Philadelphia chromosome in human hematologic malignancies. Blood, chronic myelogenous leukemia. Blood, 88: 2236–2240, 1996. 72: 1203–1208, 1988. 164. Byrne, J. L., Carter, G. I., Davies, J. M., Haynes, A. P., Russell, N. H., and Cross, 141. Chen, S. J., Chen, Z., Font, M-P., d’Auriol, L., Larsen, C-J., and Berger, R. N. C. P. A novel BCR-ABL fusion gene (e2/1a) in a patient with Philadelphia- Structural alterations of the BCR and ABL genes in Ph1 positive acute leukemias positive chronic myelogenous leukaemia and an aggressive clinical course. Br. J. with rearrangements in the BCR gene first intron: further evidence implicating Alu Haematol., 103: 791–794, 1998. sequences in the chromosome translocation. Nucleic Acids Res., 17: 7631–7642, 165. How, G. F., Lim, L. C., Kulkarni, S., Tan, L. T., Tan, P., and Cross, N. C. P. Two 1989. patients with novel BCR/ABL fusion transcripts (e8/a2 and e13/a2) resulting from 142. Popenoe, D. W., Schaefer-Rego, K., Mears, J. G., Bank, A., and Leibowitz, D. translocation breakpoints within BCR exons. Br. J. Haematol., 105: 434–436, 1999. Frequent and extensive deletion during the 9,22 translocation in CML. Blood, 68: 166. Lichty, B. D., Keating, A., Callum, J., Yee, K., Croxford, R., Corpus, G., 1123–1128, 1986. Nwachukwu, B., Kim, P., Guo, J., and Kamel-Reid, S. Expression of p210 and p190 143. Dhingra, K., Talpaz, M., Kantarjian, H., Ku, S., Rothberg, J., Gutterman, J. U., and BCR-ABL due to alternative splicing in chronic myelogenous leukaemia. Br. J. Kurzrock, R. Appearance of acute leukemia-associated p190Bcr-Abl in chronic Haematol., 103: 711–715, 1998. myelogenous leukemia may correlate with disease progression. Leukemia (Balti- 167. Skourides, P. A., Perera, S. A., and Ren, R. Polarized distribution of Bcr-Abl in more), 5: 191–195, 1991. migrating myeloid cells and co-localization of Bcr-Abl and its target proteins. 144. de Klein, A., van Kessel, A. G., Grosveld, G., Bartram, C. R., Hagemeijer, A., Oncogene, 18: 1165–1176, 1999. Bootsma, D., Spurr, N. K., Heisterkamp, N., Groffen, J., and Stephenson, J. R. A 168. Druker, B., Okuda, K., Matulonis, U., Salgia, R., Roberts, T., and Griffin, J. D. cellular oncogene is translocated to the Philadelphia chromosome in chronic mye- Tyrosine phosphorylation of rasGAP and associated proteins in chronic myeloge- locytic leukaemia. Nature (Lond.), 300: 765–767, 1982. nous leukemia cell lines. Blood, 79: 2215–2220, 1992. 145. Heisterkamp, N., Stephenson, J. R., Groffen, J., Hansen, P. F., de Klein, A., Bartram, 169. Simon, M. A., Dodson, G. S., and Rubin, G. M. An SH3-SH2-SH3 protein is C. R., and Grosveld, G. Localization of the c-ABL oncogene adjacent to a translo- required for p21Ras1 activation and binds to Sevenless and Sos protein in vitro. Cell, cation break point in chronic myelocytic leukaemia. Nature (Lond.), 306: 239–242, 73: 169–177, 1993. 1983. 170. Tauchi, T., Boswell, H. S., Leibowitz, D., and Broxmeyer, H. E. Coupling between 146. Leibowitz, D., Schaefer-Rego, K., Popenoe, D. W., Mears, G., and Bank, A. p210Bcr-Abl and Shc and Grb2 adaptor proteins in hematopoietic cells permits Variable breakpoints on the Philadelphia chromosome in chronic myelogenous growth factor receptor-independent link to Ras activation pathway. J. Exp. Med., leukemia. Blood, 66: 243–245, 1985. 179: 167–175, 1994. 147. Papadopoulos, P. C., Greenstein, A. M., Gaffney, R. A., Westbrook, C. A., and 171. Wisniewski, D., Strife, A., Wojciechowicz, D., Lambek, C., and Clarkson, B. A Wiedemann, L. M. Characterization of the translocation breakpoint sequences in 62-kilodalton tyrosine phosphoprotein constitutively present in primary chronic Philadelphia-positive acute lymphoblastic leukemia. Genes Chromosomes Cancer, phase chronic myelogenous leukemia enriched lineage negative blast populations. 1: 233–239, 1990. Leukemia (Baltimore), 8: 688–693, 1994. 148. Zhang, J. G., Goldman, J. M., and Cross, N. C. Characterization of genomic 172. Carpino, N., Wisniewski, D., Strife, A., Marshak, D., Kobayashi, R., Stillman, B., BCR-ABL breakpoints in chronic myeloid leukaemia by PCR. Br. J. Haematol., 90: and Clarkson, B. p62Dok. A constitutively tyrosine-phosphorylated, GAP-associated 138–146, 1995. protein in chronic myelogenous leukemia progenitor cells. Cell, 88: 197–204, 1997. 149. Chissoe, S. L., Bodenteich, A., Wang, Y-F., Wang, Y-P., Burian, D., Clifton, S. W., 173. Yamanashi, Y., and Baltimore, D. Identification of the Abl- and RasGAP-associated Crabtree, J., Freeman, A., Iyer, K., Jian, L., Ma, Y., McLaury, H-J., Pan, H-Q., 62 kDa protein as a docking protein, Dok. Cell, 88: 205–211, 1997. Sarhan, O. H., Toth, S., Wang, Z., Zhang, G., Heisterkamp, N., Groffen, J., and Roe, 174. Bhat, A., Johnson, K. J., Oda, T., Corbin, A. S., and Druker, B. J. Interactions of B. A. Sequence and analysis of the human ABL gene, the BCR gene, and regions p62Dok with p210Bcr-Abl and Bcr-Abl-associated proteins. J. Biol. Chem., 273: involved in the Philadelphia chromosomal translocation. Genomics, 27: 67–82, 32360–32368, 1998. 1995. 175. Bedi, A., Barber, J. P., Bedi, G. C., El-Deiry, W. S., Sidransky, D., Vala, M. S., 150. Jeffs, A. R., Benjes, S. M., Smith, T. L., Sowerby, S. J., and Morris, C. M. The BCR Akhtar, A. J., Hilton, J., and Jones, R. J. BCR-ABL-mediated inhibition of apoptosis gene recombines preferentially with Alu elements in complex BCR-ABL transloca- with delay of G2/M transition after DNA damage: a mechanism of resistance to tions of chronic myeloid leukaemia. Hum. Mol. Genet., 7: 767–776, 1998. multiple anticancer agents. Blood, 86: 1148–1158, 1995. 151. Biernaux, C., Loos, M., Sels, A., Huez, G., and Stryckmans, P. Detection of major 176. Sanchez-Garcia, I., and Grutz, G. Tumorigenic activity of the BCR-ABL oncogenes BCR-ABL gene expression at a very low level in blood cells of some healthy is mediated by BCL2. Proc. Natl. Acad. Sci. USA, 92: 5287–5291, 1995. individuals. Blood, 86: 3118–3122, 1995. 177. McGahon, A., Bissonnette, R., Schmitt, M., Cotter, K. M., Green, D. R., and Cotter, 152. Bose, S., Deininger, M., Gora-Tybor, J., Goldman, J. M., and Melo, J. V. The T. G. BCR-ABL maintains resistance of chronic myelogenous leukemia cells to presence of typical and atypical BCR-ABL fusion genes in leukocytes of normal apoptotic cell death. Blood, 83: 1179–1187, 1994. individuals: biologic significance and implications for the assessment of minimal 178. McGahon, A. J., Nishioka, W. K., Martin, S. J., Mahboubi, A., Cotter, T. G., and residual disease. Blood, 92: 3362–3367, 1998. Green, D. R. Regulation of the Fas apoptotic cell death pathway by Abl. J. Biol. 153. Kozubek, S., Lukasova, E., Ryznar, L., Kozubek, M., Liskova, A., Govorun, R. D., Chem., 270: 22625–22631, 1995. Krasavin, E. A., and Horneck, G. Distribution of ABL and BCR genes in cell nuclei 179. Amarante-Mendes, G. P., Kim, C. N., Liu, L., Huang, Y., Perkins, C. L., Green, of normal and irradiated lymphocytes. Blood, 89: 4537–4545, 1997. D. R., and Bhalla, K. Bcr-Abl exerts its anti-apoptotic effect against diverse 154. Neves, H., Ramos, C., da Silva, M. G., Parreira, A., and Parriera, L. The nuclear apoptotic stimuli through blockage of mitochondrial release of cytochrome c and topography of ABL, BCR, PML, and RAR␣ genes: evidence for gene proximity in activation of caspase-3. Blood, 91: 1700–1705, 1998. specific phases of the cell cycle and stages of hematopoietic differentiation. Blood, 180. Dubrez, L., Eymin, B., Sordet, O., Droin, N., Turhan, A. G., and Solary, E. Bcr-Abl 93: 1197–1207, 1999. delays apoptosis upstream of procaspase-3 activation. Blood, 91: 2415–2422, 1998. 155. Anastasi, J., Moinuddin, R., and Daugherty, C. The juxtaposition of ABL with BCR 181. Reuther, J. Y., Reuther, G. W., Cortez, D., Pendergast, A-M., and Baldwin, A. S., and risk for fusion may come at a time of BCR replication in late S-phase. Blood, Jr. A requirement for NF-␬B activation in Bcr-Abl-mediated transformation. Genes 94: 1137–1145, 1999. Dev., 12: 968–981, 1998. 156. Wada, H., Mizutani, S., Nishimura, J., Usuki, Y., Kohsaki, M., Komai, M., Kaneko, 182. Carlesso, N., Frank, D. A., and Griffin, J. D. Tyrosyl phosphorylation and DNA H., Sakamoto, S., Delia, D., Kanamaru, A., and Kakishita, E. Establishment and binding activity of signal transducers and activators of transcription (Stat) proteins 2353

in hematopoietic cell lines transformed by Bcr/Abl. J. Exp. Med., 183: 811–820, and Steel factor and is constitutively increased by p210Bcr/Abl. EMBO J., 14: 1996. 257–265, 1995. 183. Wilson-Rawls, J., Xie, S., Liu, J., Laneuville, P., and Arlinghaus, R. B. p210 208. Salgia, R., Li, J-L., Lo, S. H., Brunkhorst, B., Kansas, G. S., Sobhany, E. S., Sun, ␤ Bcr-Abl interacts with the interleukin 3 receptor c subunit and constitutively Y., Pisick, E., Hallek, M., Ernst, T., Tantravahi, R., Chen, L. B., and Griffin, J. D. induces its tyrosine phosphorylation. Cancer Res., 56: 3426–3430, 1996. Molecular cloning of human paxillin, a focal adhesion protein phosphorylated by 184. Frank, D. A., and Varticovski, L. Bcr/Abl leads to the constitutive activation of Stat p210Bcr/Abl. J. Biol. Chem., 270: 5039–5047, 1995. proteins, and shares an epitope with tyrosine phosphorylated Stats. Leukemia 209. Mandanas, R. A., Leibowitz, D. S., Gharehbaghi, K., Tauchi, T., Burgess, G. S., (Baltimore), 10: 1724–1730, 1996. Miyazawa, K., Jayaram, H. N., and Boswell, H. S. Role of p21 Ras in p210 Bcr-Abl Bcr/Abl 185. Ilaria, R. L., and van Etten, R. A. p210 and p190 induce the tyrosine transformation of murine myeloid cells. Blood, 82: 1838–1847, 1993. phosphorylation and DNA binding activity of multiple specific STAT family mem- 210. Tauchi, T., Okabe, S., Miyazawa, K., and Ohyashiki, K. The tetramerization do- bers. J. Biol. Chem., 271: 31704–31710, 1996. main-independent Ras activation by Bcr-Abl oncoprotein in hematopoietic cells. Int. 186. Shuai, K., Halpern, J., ten Hoeve, J., Rao, X., and Sawyers, C. L. Constitutive J. Oncol., 12: 1269–1276, 1998. activation of Stat5 by the BCR-ABL oncogene in chronic myelogenous leukemia. 211. Damen, J. E., Liu, L., Rosten, P., Humphries, R. K., Jefferson, A. B., Majerus, P. W., Oncogene, 13: 247–254, 1996. and Krystal, G. The 145-kDa protein induced to associate with Shc by multiple 187. Nieborowska-Skorska, M., Wasik, M. A., Slupianek, A., Salomoni, P., Kitamura, T., cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-triphosphate Calabretta, B., and Skorski, T. Signal transducer and activator of transcription 5-phosphatase. Proc. Natl. Acad. Sci. USA, 93: 1689–1693, 1996. (Stat)5 activation by BCR/ABL is dependent on intact Src homology (SH)3 and SH2 212. Lioubin, M. N., Algate, P. A., Tsai, S., Carlberg, K., Aebersold, R., and domains of BCR/ABL and is required for leukemogenesis. J. Exp. Med., 189: Rohrschneider, L. R. p150Ship, a signal transduction molecule with inositol polyphos- 1229–1242, 1999. phate-5-phosphatase activity. Genes Dev., 10: 1084–1095, 1996. 188. de Groot, R. P., Raaijmakers, J. A. M., Lammers, J-W. J., Jove, R., and 213. Kavanaugh, W. M., Pot, D. A., Chin, S. M., Deuter-Reinhard, M., Jefferson, A. B., Koenderman, L. Stat5 activation by Bcr-Abl contributes to transformation of K562 Norris, F. A., Masiarz, F. R., Cousens, L. S., Majerus, P. W., and Williams, L. T. leukemia cells. Blood, 94: 1108–1112, 1999. Multiple forms of an inositol polyphosphate 5-phosphatase form signaling com- 189. Varticovski, L., Daley, G. Q., Jackson, P., Baltimore, D., and Cantley, L. C. plexes with Shc and Grb2. Curr. Biol., 6: 438–445, 1996. Activation of phosphatidylinositol 3-kinase in cells expressing ABL oncogene vari- 214. Odai, H., Sasaki, K., Iwamatsu, A., Nakamoto, T., Ueno, H., Yamagata, T., Mitani, ants. Mol. Cell. Biol., 11: 1107–1113, 1991. 190. Skorski, T., Kanakaraj, P., Nieborowska-Skorska, M., Ratajczak, M. Z., Wen, S-C., K., Yazaki, Y., and Hirai, H. Purification and molecular cloning of SH2- and Zon, G., Gewirtz, A. M., Perussia, B., and Calabretta, B. Phosphatidylinositol-3 SH3-containing inositol polyphosphate-5-phosphatase, which is involved in the kinase activity is regulated by BCR/ABL and is required for the growth of Philadel- signaling pathway of granulocyte-macrophage colony-stimulating factor, erythro- phia chromosome-positive cells. Blood, 86: 726–736, 1995. poietin, and Bcr-Abl. Blood, 89: 2745–2756, 1997. 191. Sattler, M., Salgia, R., Okuda, K., Uemura, N., Durstin, M. A., Pisick, E., Xu, G., 215. Pesesse, X., Deleu, S., de Smedt, F., Drayer, L., and Erneux, C. Identification of a Li, J-L., Prasad, K. V., and Griffin, J. D. The proto-oncogene product p120Cbl and second SH2-domain-containing protein closely related to the phosphatidylinositol the adaptor proteins Crkl and c-Crk link c-Abl, p190Bcr/Abl, and p210Bcr/Abl to the polyphosphate 5-phosphatase SHIP. Biochem. Biophys. Res. Commun., 239: 697– phosphatidylinositol-3Ј kinase pathway. Oncogene, 12: 839–846, 1996. 700, 1997. 192. Skorski, T., Bellacosa, A., Nieborowska-Skorska, M., Majewski, M., Martinez, R., 216. Helgason, C. D., Damen, J. E., Rosten, P., Grewal, R., Sorensen, P., Chappel, S. M., Choi, J. K., Trotta, R., Wlodarski, P., Perrotti, D., Chan, T. O., Wasik, M. A., Borowski, A., Jirik, F., Krystal, G., and Humphries, R. K. Targeted disruption of Tsichlis, P. N., and Calabretta, B. Transformation of hematopoietic cells by BCR/ SHIP leads to hemopoietic perturbations, lung pathology, and a shortened life span. ABL requires the activation of a PI-3k/Akt-dependent pathway. EMBO J., 16: Genes Dev., 12: 1610–1620, 1998. 6151–6161, 1997. 217. Wisniewski, D., Strife, A., Swendeman, S., Erdjument-Bromage, H., Geromanos, S., 193. Raitano, A. B., Halpern, J. R., Hambuch, T. M., and Sawyers, C. L. The Bcr-Abl Kavanaugh, W. M., Tempst, P., and Clarkson, B. A novel SH2-containing phos- leukemia oncogene activates Jun kinase and requires Jun for transformation. Proc. phatidylinositol 3,4,5-triphosphate 5-phosphatase (Ship2) is constitutively tyrosine Natl. Acad. Sci. USA, 92: 11746–11750, 1995. phosphorylated and associated with Src homologous and collagen gene (SHC)in 194. Puil, L., Liu, J., Gish, G., Mbamalu, G., Bowtell, D., Pelicci, P. G., Arlinghaus, R., chronic myelogenous leukemia progenitor cells. Blood, 93: 2707–2720, 1999. and Pawson, T. Bcr-Abl oncoproteins bind directly to activators of the Ras signalling 218. Gotoh, A., Miyazawa, K., Ohyashiki, K., Tauchi, T., Boswell, H. S., Broxmeyer, pathway. EMBO J., 13: 764–773, 1994. H. E., and Toyama, K. Tyrosine phosphorylation and activation of focal adhesion 195. Cortez, D., Stoica, G., Pierce, J. H., and Pendergast, A-M. The Bcr-Abl tyrosine kinase (p125Fak) by Bcr-Abl oncoprotein. Exp. Hematol., 23: 1153–1159, 1995. kinase inhibits apoptosis by activating a Ras-dependent signaling pathway. Onco- 219. Bhatia, R., Wayner, E. A., McGlave, P. B., and Verfaillie, C. M. Interferon-␣ gene, 13: 2589–2594, 1996. restores normal adhesion of chronic myelogenous leukemia hematopoietic progen- 196. Verfaillie, C. M., Hurley, R., Lundell, B. I., Zhao, C., and Bhatia, R. Integrin- itors to bone marrow stroma by correcting impaired ␤1 integrin receptor function. mediated regulation of hematopoiesis: do Bcr/Abl-induced defects in integrin func- J. Clin. Investig., 94: 384–391, 1994. tion underlie the abnormal circulation and proliferation of CML progenitors? Acta 220. Bhatia, R., McCarthy, J. B., and Verfaillie, C. M. Interferon-␣ restores normal ␤1 Haematol., 97: 40–52, 1997. integrin-mediated inhibition of hematopoietic progenitor proliferation by the marrow 197. Bhatia, R., Munthe, H. A., and Verfaillie, C. M. Role of abnormal integrin- microenvironment in chronic myelogenous leukemia. Blood, 87: 3883–3891, 1996. cytoskeletal interactions in impaired ␤1 integrin function in chronic myelogenous 221. Bhatia, R., and Verfaillie, C. M. Inhibition of Bcr-Abl expression with antisense leukemia hematopoietic progenitors. Exp. Hematol., 27: 1384–1396, 1999. oligodeoxynucleotides restores ␤1 integrin-mediated adhesion and proliferation 198. Sattler, M., Verma, S., Byrne, C. H., Shrikhande, G., Winkler, T., Algate, P. A., inhibition in chronic myelogenous leukemia hematopoietic progenitors. Blood, 91: Rohrschneider, L. R., and Griffin, J. D. Bcr/Abl directly inhibits expression of Ship, 3414–3422, 1998. an SH2-containing polyinositol-5-phosphatase involved in the regulation of hema- 222. Bhatia, R., Munthe, H. A., and Verfaillie, C. M. Tyrphostin AG957, a tyrosine topoiesis. Mol. Cell. Biol., 19: 7473–7480, 1999. kinase inhibitor with anti-Bcr/Abl tyrosine kinase activity restores ␤1 integrin- 199. van der Feltz, M. J. M., Shivji, M. K. K., Grosveld, G., and Wiedmann, L. M. mediated adhesion and inhibitory signaling in chronic myelogenous leukemia he- Characterization of the translocation breakpoint in a patient with Philadelphia matopoietic progenitors. Leukemia (Baltimore), 12: 1708–1717, 1998. positive, BCR negative acute lymphoblastic leukaemia. Oncogene, 3: 215–219, 223. Kramer, A., Horner, S., Willer, A., Fruehauf, S., Hochhaus, A., Hallek, M., and 1988. Hehlmann, R. Adhesion to fibronectin stimulates proliferation of wild-type and 200. Lugo, T. G., Pendergast, A-M., Muller, A. J., and Witte, O. N. Tyrosine kinase BCR/ABL-transfected murine hematopoietic cells. Proc. Natl. Acad. Sci. USA, 96: activity and transformation potency of BCR-ABL oncogene products. Science 2087–2092, 1999. (Washington DC), 247: 1079–1082, 1990. 224. Salgia, R., Uemura, N., Okuda, K., Li, J-L., Pisick, E., Sattler, M., de Jong, R., 201. Sawyers, C. L., McLaughlin, J., and Witte, O. N. Genetic requirement for Ras in the Druker, B., Heisterkamp, N., Chen, L. B., Groffen, J., and Griffin, J. D. CRKL links transformation of fibroblasts and hematopoietic cells by the BCR-ABL oncogene. BCR/ABL J. Exp. Med., 181: 307–313, 1995. p210 with paxillin in chronic myelogenous leukemia cells. J. Biol. Chem., 202. Anderson, S. M., and Mladenovic, J. The BCR-ABL oncogene requires both kinase 270: 29145–29150, 1995. activity and src-homology 2 domain to induce cytokine secretion. Blood, 87: 225. Uemura, N., Salgia, R., Ewaniuk, D. S., Little, M-T., and Griffin, J. D. Involvement 238–244, 1996. of the adapter protein Crkl in integrin-mediated adhesion. Oncogene, 18: 3343– 203. ten Hoeve, J., Arlinghaus, R. B., Guo, J. Q., Heisterkamp, N., and Groffen, J. 3353, 1999. Tyrosine phosphorylation of Crkl in Philadelphiaϩ leukemia. Blood, 84: 1731– 226. Chung, S-W., Daniel, R., Wong, B. Y., and Wong, P. M. C. The ABL genes in 1736, 1994. normal and abnormal cell development. Crit. Rev. Oncog., 7: 33–48, 1996. 204. Ernst, T. J., Slattery, K. E., and Griffin, J. D. p210Bcr/Abl and p160v-Abl induce an 227. Sanchez-Garcia, I., and Martin-Zanca, D. Regulation of BCL-2 gene expression by increase in the tyrosine phosphorylation of p93c-Fes. J. Biol. Chem., 269: 5764– Bcr-Abl is mediated by Ras. J. Mol. Biol., 267: 225–228, 1997. 5769, 1994. 228. Chai, S. K., Nichols, G. L., and Rothman, P. Constitutive activation of JAKs and 205. Tauchi, T., Feng, G-S., Shen, R., Song, H. Y., Donner, D., Pawson, T., and Stats in BCR-ABL-expressing cell lines and peripheral blood cells derived from Broxmeyer, H. E. SH2-containing phosphotyrosine phosphatase Syp is a target of leukemic patients. J. Immunol., 159: 4720–4728, 1997. p210Bcr-Abl tyrosine kinase. J. Biol. Chem., 269: 15381–15387, 1994. 229. Ahmed, M., Dusanter-Fourt, I., Bernard, M., Mayeux, P., Hawley, R. G., Bennardo, 206. Matsuguchi, T., Salgia, R., Hallek, M., Eder, M., Druker, B., Ernst, T. J., and Griffin, T., Novault, S., Bonnet, M. L., Gisselbrecht, S., Varet, B., and Turhan, A. G. J. D. Shc phosphorylation in myeloid cells is regulated by granulocyte macrophage BCR-ABL and constitutively active erythropoietin receptor (cEpoR) activate distinct colony-stimulating factor, interleukin-3, and Steel factor and is constitutively in- mechanisms for growth factor-independence and inhibition of apoptosis in Ba/F3 creased by p210Bcr/Abl. J. Biol. Chem., 269: 5016–5021, 1994. cell line. Oncogene, 16: 489–496, 1998. 207. Matsuguchi, T., Inhorn, R. C., Carlesso, N., Xu, G., Druker, B., and Griffin, J. D. 230. Darnell, J. E., Jr. STATs and gene regulation. Science (Washington DC), 277: Tyrosine phosphorylation of p95Vav in myeloid cells is regulated by GM-CSF, IL-3, 1630–1635, 1997. 2354

231. Liu, J., Wu, Y., and Arlinghaus, R. B. Sequences within the first exon of BCR inhibit inhibitor as targeted therapy for chronic myelogenous leukemia. Blood, 94 (Suppl. the activated tyrosine kinase of c-Abl and the Bcr-Abl oncoprotein. Cancer Res., 56: 1): 368a, 1999. 5120–5124, 1996. 244. Druker, B. J., Kantarjian, H., Sawyers, C. L., Resta, D., Reese, S. F., Ford, J., and 232. Liu, J., Wu, Y., Ma, G. Z., Lu, D., Haataja, L., Heisterkamp, N., Groffen, J., and Talpaz, M. Activity of an Abl specific tyrosine kinase inhibitor in patients with Arlinghaus, R. B. Inhibition of Bcr serine kinase by tyrosine phosphorylation. Mol. BCR-ABL positive acute leukemias, including chronic myelogenous leukemia in Cell. Biol., 16: 998–1005, 1996. blast crisis. Blood, 94 (Suppl. 1): 697a, 1999. 233. Buchdunger, E., Zimmermann, J., Mett, H., Meyer, T., Muller, M., Druker, B. J., and 245. Talpaz, M., Sawyers, C. L., Kantarjian, H., Resta, D., Reese, S. F., Ford, J., and Lydon, N. B. Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a Druker, B. J. Activity of an Abl specific tyrosine kinase inhibitor in patients with 2-phenylaminopyrimidine derivative. Cancer Res., 56: 100–104, 1996. BCR-ABL positive acute leukemias, including chronic myelogenous leukemia in 234. Druker, B. J., Tamura, S., Buchdunger, E., Ohno, S., Segal, G. M., Fanning, S., blast crisis. Proc. Am. Soc. Clin. Oncol., 19: 4a, 2000. Zimmermann, J., and Lydon, N. B. Effects of a selective inhibitor of the Abl tyrosine 246. Talpaz, M., Silver, R. T., Druker, B., Paquette, R., Goldman, J. M., Reese, S. F., and kinase on the growth of Bcr-Abl positive cells. Nat. Med., 2: 561–566, 1996. Capdeville, R. A Phase II study of STI 571 in adult patients with Philadelphia 235. Beran, M., Cao, X., Estrov, Z., Jeha, S., Jin, G., O’Brien, S., Talpaz, M., Arlinghaus, chromosome positive chronic myeloid leukemia in accelerated phase. Blood, 96 R. B., Lydon, N. B., and Kantarjian, H. Selective inhibition of cell proliferation and (Vol. 11, Part 1): 487a, 2000. 247. James, H. A., and Gibson, I. The therapeutic potential of ribozymes. Blood, 91: Bcr-Abl phosphorylation in acute lymphoblastic leukemia cells expressing Mr 190,000 Bcr-Abl protein by a tyrosine kinase inhibitor (CGP-57148). Clin. Cancer 371–382, 1998. Res., 4: 1661–1672, 1998. 248. Galderisi, U., Cascino, A., and Giordano, A. Antisense oligonucleotides as thera- 236. Kasper, B., Fruehauf., S., Schiedlmeier, B., Buchdunger, E., Ho, A. D., and Zeller, peutic agents. J. Cell. Physiol., 181: 251–257, 1999. 249. Kuwabara, T., Warashina, M., Tanabe, T., Tani, K., Asano, S., and Taira, K. A novel W. J. Favorable therapeutic index of a p210(Bcr-Abl)-specific tyrosine kinase allosterically trans-activated ribozyme, the maxizyme, with exceptional specificity inhibitor; activity on lineage-committed and primitive chronic myelogenous leuke- in vitro and in vivo. Mol. Cell, 2: 617–627, 1998. mia progenitors. Cancer Chemother. Pharmacol., 44: 433–438, 1999. 250. Warashina, M., Kuwabara, T., Nakamatsu, Y., and Taira, K. Extremely high and 237. Dan, S., Naito, M., and Tsuruo, T. Selective induction of apoptosis in Philadelphia specific activity of DNA enzymes in cells with a Philadelphia chromosome. Chem. chromosome-positive chronic myelogenous leukemia cells by an inhibitor of Bcr- Biol., 5: 237–250, 1999. Abl tyrosine kinase, CGP 57148. Cell Death Differ., 5: 710–715, 1998. 251. Wu, Y., Yu, L., McMahon, R., Rossi, J. J., Forman, S. J., and Snyder, D. S. 238. Prosper, F., Horita, M., Andreu, E. J., Benito, A., Arbona, C., Sanz, C., Benet, I., and Inhibition of BCR-ABL oncogene expression by novel deoxyribozymes Fernandez-Luna, J. L. Blockade of the Bcr-Abl kinase activity induces apoptosis of (DNAzymes). Hum. Gene Ther., 10: 2847–2857, 1999. CML cells by suppressing STAT5 dependent expression of BCL-XL. Blood, 94 252. Cobaleda, C., and Sanchez-Garcia, I. In vivo inhibition by a site-specific catalytic (Suppl. 1): 102a, 1999. RNA subunit of Rnase P designed against the BCR-ABL oncogenic products: a novel 239. Donato, N. J., Wu, J. Y., Kantarjian, H. M., and Talpaz, M. Inhibition of Bcr-Abl approach for cancer treatment. Blood, 95: 731–737, 2000. induces apoptosis through effects on downstream signaling cascades: death through 253. Kronenwett, R., and Haas, R. Specific BCR-ABL-directed antisense nucleic acids abrogation of survival signals. Blood, 94 (Suppl. 1): 102a, 1999. and ribozymes: a tool for the treatment of chronic myelogenous leukemia? Recent 240. Thiesing, J. T., Ohno-Jones, S., Kolibaba, K. S., and Druker, B. J. Efficacy of an Abl Results Cancer Res., 144: 127–138, 1998. tyrosine kinase inhibitor in conjunction with other antineoplastic agents against 254. Wu, Y., Ma, G., Lu, D., Lin, F., Xu, H. J., Liu, J., and Arlinghaus, R. B. Bcr: a BCR-ABL positive cells. Blood, 94 (Suppl. 1): 100a, 1999. negative regulator of the Bcr-Abl oncoprotein. Oncogene, 18: 4416–4424, 1999. 241. Barteneva, N., Stiouf, I., Donato, N., Kornblau, S., Van, N., Domain, D., and Talpaz, 255. Liu, J., Hawk, N., Lin, F., Arlinghaus, R. Phosphoserine peptides from the serine- M. Altered interferon-␣ responsiveness in K562 cells pretreated with Abl-tyrosine rich B box of the Bcr first exon inhibit the Abl and Bcr-Abl kinases. Blood, 94 kinase inhibitor CGP57148B. Blood, 94 (Suppl. 1): 272b, 1999. (Suppl. 1): A453, 1999. 242. Topaly, J., Zeller, W. J., Ho, A. D., and Fruehauf, S. Combination therapy of chronic 256. Beaupre, D. M., and Kurzrock, R. RAS and leukemia: from basic mechanisms to myelogenous leukemia employing Bcr/Abl specific tyrosine kinase inhibition. gene-directed therapy. J. Clin. Oncol., 17: 1071–1079, 1999. Blood, 94 (Suppl. 1): 281b, 1999. 257. Druker, B. J., and Lydon, N. B. Lessons learned from the development of an Abl 243. Druker, B. J., Talpaz, M., Resta, D., Peng, B., Buchdunger, E., Ford, J., and tyrosine kinase inhibitor for chronic myelogenous leukemia. J. Clin. Investig., 105: Sawyers, C. L. Clinical efficacy and safety of an Abl specific tyrosine kinase 3–7, 2000.

2355

Eunice Laurent, Moshe Talpaz, Hagop Kantarjian, et al.

Cancer Res 2001;61:2343-2355.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/61/6/2343

Cited articles This article cites 248 articles, 110 of which you can access for free at: http://cancerres.aacrjournals.org/content/61/6/2343.full#ref-list-1

Citing articles This article has been cited by 12 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/61/6/2343.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/61/6/2343. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.