DOCSLIB.ORG

The BCR Gene and Philadelphia Chromosome-Positive Leukemogenesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The BCR Gene and Philadelphia Chromosome-Positive Leukemogenesis [CANCER RESEARCH 61, 2343–2355, March 15, 2001] Review The BCR Gene and Philadelphia Chromosome-positive Leukemogenesis Eunice Laurent, Moshe Talpaz, Hagop Kantarjian, and Razelle Kurzrock1 Departments of Bioimmunotherapy [E. L., M. T., R. K.] and Leukemia [H. K., R. K.], University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 Introduction Recent investigations have rapidly added crucial new insights into BCR-related Genes the complex functions of the normal BCR gene and of the BCR-ABL Several BCR-related pseudogenes (BCR2, BCR3, and BCR4) have chimera and are yielding potential therapeutic breakthroughs in the also been described (34). They are not translated into proteins. All of treatment of Philadelphia (Ph) chromosome-positive leukemias. The these genes have been mapped to chromosome 22q11 by in situ term “breakpoint cluster region (bcr)” was first applied to a 5.8-kb hybridization. The orientation is such that BCR2 is the most centro- span of DNA on the long arm of chromosome 22 (22q11), which is 2 meric, followed by BCR4, then BCR1 (the functional gene) and BCR3. disrupted in patients with CML bearing the Ph translocation [t(9; BCR2 and BCR4 are retained on chromosome 22 during the t(9;22) 22)(q34;q11); Refs. 1–3]. Subsequent studies demonstrated that the translocation. The BCR-related genes all contain 3Ј sequences iden- 5.8-kb fragment resided within a central region of a gene designated tical to those encompassing the last seven exons of the BCR1 gene BCR (4). It is now well established that the breakpoint within BCR can (34, 36). The 5Ј region is highly variable, suggesting that the 3Ј end be variable, and when joined with ABL, results in a hybrid Mr 210,000 of the normal BCR1 gene was inserted into another locus with sub- Bcr-Abl Bcr-Abl Bcr-Abl (p210 )oraMr 190,000 (p 190 protein (p190 ; Fig. sequent duplication of the new locus (36). Another BCR pseudogene, 1; Refs. 5–13). Of interest, p190Bcr-Abl characterizes a phenotypically the chromosomal location of which remains undefined, has also been acute, rather than chronic, leukemia that is often, but not always, of described (37). It was shown to have homology with the 3Ј end of lymphoid (rather than of myeloid) derivation (Refs. 10 and 14; Table exon 3 as well as the 5Ј end of exon 4 (37). 1). Both p210Bcr-Abl and p190Bcr-Abl have constitutive tyrosine kinase There is an additional BCR-related gene located on chromosome activity. Furthermore, the presence of the hybrid proteins perturbs the 17p13.3 (35, 38, 39). This gene is functionally active and has been multiple functions of their normal counterparts. Understanding the designated ABR or active BCR-related gene (35). There is 68% ho- biological sequelae of the molecular aberrations in Ph-positive disease mology between ABR and the central and COOH-terminal regions of has led to development of novel tyrosine kinase inhibitor therapy that BCR (35, 39). is showing remarkable success in clinical trials. Herein, we review the current state of knowledge on the role of BCR alone or when joined The BCR Promoter with ABL in normal and leukemic pathophysiology and the implica- The 5Ј untranslated region of the BCR gene is important because tions of this knowledge for therapy. the fusion gene created by the Ph translocation is placed under the regulation of the BCR promoter (31, 40–42). A region ϳ1-kb up- Genomic Structure of the BCR Gene stream of the transcription start site was demonstrated to be the The BCR Gene principle site of promoter activity (41, 42). Within this region, a CAAT box (conserved sequence upstream of start point of transcrip- BCR is situated in a 5Ј to 3Ј orientation with the 5Ј end closer to the tion, which is recognized by transcription factors) at position Ϫ644 as centromere (4). The entire gene spans 130 kb and contains 23 exons well as an inverted CAAT sequence at position Ϫ718 have been (Ref. 26; Table 2 and Fig. 2). The first intron separating exons 1 and localized. However, neither in vitro nor in vivo studies suggest that 2 was initially shown to span a distance of 68 kb (26) but is now these sequences are key factors for transcriptional regulation of the known to include two additional exons (an alternative exon 1 and an BCR gene (41). There is also a TATA box [conserved sequences in the alternative exon 2; Refs. 28 and 29). Two transcripts, 4.5- and 7.0-kb promoter that specify the position at which transcription is initiated long, have been found (16). The nucleotide sequence contains an open (43)] 120 bp downstream of the CAAT box. This TATA box, TT- reading frame of 3818 nucleotides, which codes for a protein 1271 TAA, is also accompanied by the consensus sequence TCATCG, amino acids in length (31, 36). required for 5Ј capping of the transcript (41). DNA footprinting and gel retardation assays have also been used to discover potential sites for DNA/protein interaction, which might reflect transcription factor activity. Several sites were found including ones containing the consensus sequence GGGCCGG (as well as the Received 8/4/00; accepted 1/12/01. The costs of publication of this article were defrayed in part by the payment of page inverted sequence) for the SP1 transcription factor (41, 42). A unique charges. This article must therefore be hereby marked advertisement in accordance with sequence TAGGGCCTCAGTTTCCCAAAAGGCA, for which no 18 U.S.C. Section 1734 solely to indicate this fact. binding protein is known, was also detected (41). Deletion of that site 1 To whom requests for reprints should be addressed, at Department of Bioimmuno- therapy, Box 422, M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, (versus other potential binding sites) resulted in a significant decrease TX 77030. Phone: (713) 794-1226; Fax: (713) 745-2374. of promoter activity in BCR-ABL-transfected cells (41). 2 The abbreviations used are: CML, chronic myelogenous leukemia; Ph, Philadelphia; The 5Ј untranslated region of the BCR gene is also very rich in GC GEF, guanine nucleotide exchange factor; GTPase, guanine triphosphatase; GAP, GTPase activating protein; XPB, xeroderma pigmentosum group B; SH2, Src homology 2; Grb2, content, which makes up 80% of the nucleotides with“in this stretch growth factor receptor binding protein 2; Bap-1, Bcr-associated protein 1; ALL, acute of the DNA (31, 36). Within this GC-rich region is a segment 18 lymphocytic leukemia; AML, acute myelogenous leukemia; M-bcr, major breakpoint Ϫ Ϫ cluster region; Ship, SH2-containing phosphatidylinositol 3,4,5-triphosphate 5-phospha- nucleotides long at sites 376 to 393, containing the sequence tase; Jak, Janus kinase. GCGGCGGCGGCGGCGGCG with its inverted repeat 363 bp down- 2343 Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2001 American Association for Cancer Research. THE BCR GENE AND LEUKEMOGENESIS Fig. 1. Schematic representation of BCR, ABL, and BCR-ABL genes and the proteins they encode. Numbers refer to exon number. In the BCR gene, exons 1Ј and 2Ј are alternative exons contained within the first intron. The ABL gene has two alternative first exons denoted 1b and 1a, respectively. A series of different protein products are described based on the fusion transcripts that have been identified. The predicted proteins are illustrated in the right-hand column. (However, not all these proteins have been demonstrated on gels and, therefore, not all of them are given a size.) Table 1 Molecular events associated with Philadelphia-positive leukemiasa Diagnosis Transcript Protein product Normal 6.0- and 7.0-kb ABL mRNA pl45Abl 4.5- and 6.7-kb BCR mRNA p130Bcr and p160Bcr CMLb 8.5-kb BCR-ABL mRNA (an ABL-BCR mRNA is also expressed in some patients) p210Bcr-Abl ALL 8.5- or 7.0-kb BCR-ABL mRNA (an ABL-BCR mRNA is also expressed in some patients) p210Bcr-Abl or p190Bcr-Abl AML 8.5- or 7.0-kb BCR-ABL mRNA p210Bcr-Abl or p190Bcr-Abl Neutrophilic CML 9.0-kb BCR-ABL mRNA p230Bcr-Abl a Summarized from Refs. 4, 8–12, and 15–25. b Rare expression of 7.0-kb BCR-ABL mRNA and p190Bcr-Abl. stream. These sequences are apt to form secondary stem and loop have short open reading frames because there are stop codons down- structures, with a possible role in translational regulation (36), and are stream of these sites (31, 40). It has been suggested that these short common to many housekeeping genes (43). Other possible start sites transcripts could also play a role in regulating protein translation (40). upstream of the normal AUG codon have been found; however, these Bcr Protein(s) Table 2 BCR: Molecular features Currently, the normal BCR gene is known to code for two major Comments Refs. proteins that are Mr 160,000 and Mr 130,000 in size (17, 25, 30). It is Location Chromosome 22q11 2, 27 possible that these proteins are derived from the 7.0- and 4.5-kb BCR Size of gene 130-kb 26 transcripts, respectively (15, 17, 26). In addition, Li et al. (44) have Number of exons 23 exons 26 (also contains alternative exon 1 and exon 2) 28, 29 described putative Bcr proteins of Mr 190,000/Mr 185,000, Mr Size of transcripts 4.5kb and 6.7kb 4, 15 155,000, M 135,000, M 125,000, and M 108,000. a r r r Size of proteins Mr 130,000 and Mr 160,000 17, 25, 30 BCR expression Ubiquitously expressed 4, 31–33 Highest levels in brain and haematopoietic cells Bcr-related Protein(s) BCR-related genes Pseudogenes BCR2, BCR3, and BCR4 found on 34, 35 chromosome 22q11; ABR (active BCR- related) gene on 17p13 The ABR gene encodes for a Mr 98,000 protein that contains both the a GEF and GAP domains of Bcr (respectively, the central and COOH- Other proteins of Mr, 190,000/Mr 185,000, Mr 155,000, Mr 135,000, Mr 125,000, and Mr 108,000 not firmly established.
Load more

Recommended publications
  • Paxillin Binding to the Cytoplasmic Domain of CD103 Promotes Cell Adhesion and Effector
    Author Manuscript Published OnlineFirst on October 11, 2017; DOI: 10.1158/0008-5472.CAN-17-1487 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Paxillin binding to the cytoplasmic domain of CD103 promotes cell adhesion and effector functions for CD8+ resident memory T cells in tumors Ludiane Gauthier1, Stéphanie Corgnac1, Marie Boutet1, Gwendoline Gros1, Pierre Validire2, Georges Bismuth3 and Fathia Mami-Chouaib1 1 INSERM UMR 1186, Integrative Tumor Immunology and Genetic Oncology, Gustave Roussy, EPHE, Fac. de médecine - Univ. Paris-Sud, Université Paris-Saclay, 94805, Villejuif, France 2 Institut Mutualiste Montsouris, Service d’Anatomie pathologique, 75014 Paris, France. 3 INSERM U1016, CNRS UMR8104, Université Paris Descartes, Institut Cochin, 75014 Paris. S Corgnac, M Boutet and G Gros contributed equally to this work. M Boutet current address: Department of Microbiology and Immunology Albert Einstein College of Medecine, NY 10461 USA. Corresponding author: Fathia Mami-Chouaib, INSERM UMR 1186, Gustave Roussy. 39, rue Camille Desmoulins, F-94805 Villejuif. Phone: +33 1 42 11 49 65, Fax: +33 1 42 11 52 88, e-mail: [email protected] and [email protected] Running title: CD103 signaling in human TRM cells Key words: TRM cells, CD103 integrin, T-cell function and signaling, paxillin. Abbreviations: IS: immune synapse; LFA: leukocyte function-associated antigen; FI: fluorescence intensity; mAb: monoclonal antibody; phospho: phosphorylated; Pyk2: proline- rich tyrosine kinase-2; NSCLC: non-small-cell lung carcinoma; r: recombinant; sh-pxn: shorthairpin RNA-paxillin; TCR: T-cell receptor; TIL: tumor-infiltrating lymphocyte; TRM: tissue-resident memory T.
    [Show full text]
  • Paxillin: a Focal Adhesion-Associated Adaptor Protein
    Oncogene (2001) 20, 6459 ± 6472 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc Paxillin: a focal adhesion-associated adaptor protein Michael D Schaller*,1 1Department of Cell and Developmental Biology, Lineberger Comprehensive Cancer Center and Comprehensive Center for In¯ammatory Disorders, University of North Carolina, Chapel Hill, North Carolina, NC 27599, USA Paxillin is a focal adhesion-associated, phosphotyrosine- The molecular cloning of paxillin revealed a number containing protein that may play a role in several of motifs that are now known to function in mediating signaling pathways. Paxillin contains a number of motifs protein ± protein interactions (see Figure 1) (Turner that mediate protein ± protein interactions, including LD and Miller, 1994; Salgia et al., 1995a). The N-terminal motifs, LIM domains, an SH3 domain-binding site and half of paxillin contains a proline-rich region that SH2 domain-binding sites. These motifs serve as docking could serve as an SH3 domain-binding site. Several sites for cytoskeletal proteins, tyrosine kinases, serine/ tyrosine residues conforming to SH2 domain binding threonine kinases, GTPase activating proteins and other sites were also noted. In addition, the N-terminal adaptor proteins that recruit additional enzymes into domain of paxillin contains ®ve copies of a peptide complex with paxillin. Thus paxillin itself serves as a sequence, called the LD motif, which are now known docking protein to recruit signaling molecules to a to function as binding sites for other proteins (see speci®c cellular compartment, the focal adhesions, and/ Table 1) (Brown et al., 1998a). The C-terminal half of or to recruit speci®c combinations of signaling molecules paxillin is comprised of four LIM domains, which are into a complex to coordinate downstream signaling.
    [Show full text]
  • Download PDF to Print
    MOLECULAR INSIGHTS IN PATIENT CARE A Cryptic BCR-PDGFRB Fusion Resulting in a Chronic Myeloid Neoplasm With Monocytosis and Eosinophilia: A Novel Finding With Treatment Implications Sanjeev Kumar Gupta, MD1,*; Nitin Jain, MD1,*; Guilin Tang, MD, PhD2; Andrew Futreal, PhD3; Sa A. Wang, MD2; Joseph D. Khoury, MD2; Richard K. Yang, MD, PhD2; Hong Fang, MD2; Keyur P.Patel, MD, PhD2; Rajyalakshmi Luthra, PhD2; Mark Routbort, MD, PhD2; Bedia A. Barkoh, MS2; Wei Chen, MS2; Xizeng Mao, PhD3; Jianhua Zhang, PhD3; L. Jeffrey Medeiros, MD2; Carlos E. Bueso-Ramos, MD, PhD2; and Sanam Loghavi, MD2 Background ABSTRACT Myeloid and lymphoid neoplasms with eosinophilia and gene rearrangement constitute a distinct group RNA-seq was used to identify the partner gene and confirm the of hematologic neoplasms in the current WHO clas- BCR-PDGFRB fi presence of a fusion. Identi cation of this fusion sification for hematopoietic neoplasms.1 Included in product resulted in successful treatment and long-term remission of this myeloid neoplasm. Based on our results, we suggest that despite this category are neoplasms harboring abnormal current WHO recommendations, screening for PDGFRB rearrange- gene fusions involving PDGFRA, PDGFRB,andFGFR1 ment in cases of leukocytosis with eosinophilia and no other etiologic or PCM1-JAK2. These fusions result in constitutive explanation is necessary, even if the karyotype is normal. activation of respective tyrosine kinases that can J Natl Compr Canc Netw 2020;18(10):1300–1304 be targeted using specific kinase inhibitors. There doi: 10.6004/jnccn.2020.7573 are multiple recognized partner genes for PDGFRA, PDGFRB, FGFR1, and JAK2. PDGFRB located at chro- mosome 5q32 has .25knownfusionpartners,with ETV6 the most common.2–8 Although PDGFRA re- arrangements often can be cryptic and not readily observed on routine karyotyping studies,9,10 PDGFRB rearrangements are believed to be nearly always vis- ible on routine karyotype.
    [Show full text]
  • Real-Time Quantification of BCR-ABL Mrna Transcripts Using the Lightcycler-T(9;22) Quantification Kit
    real-time-quantification 09.05.2000 19:18 Uhr Seite 8 Real-time Quantification of BCR-ABL mRNA Transcripts Using the LightCycler-t(9;22) Quantification Kit Heiko Wittor 1, Hermann Leying 1, Andreas Hochhaus 2, and Rob van Miltenburg 1 1 Roche Molecular Biochemicals, Penzberg, Germany 2 III. Medizinische Universitätsklinik, Fakultät für Klinische Medizin Mannheim der Universität Heidelberg, Mannheim, Germany ly different starting concentrations, so that the initial Introduction target concentration can be determined in a single PCR. The concentration of BCR-ABL transcripts is determi- Literature indicates that in 95 % of all subjects with ned relative to the number of transcripts of a control chronic myeloid leukemia (CML) and in 25-30 % of gene, glucose-6-phosphate dehydrogenase (G6PDH). subjects with acute lymphoblastic leukemia (ALL) a The entire procedure from sample preparation to reciprocal translocation between the long arms of quantitative result is performed in 4.5 hours. chromosome 9 and chromosome 22 [t(9;22)] can be found. This translocation or the resulting fusion pro- duct can be detected by a number of techniques, CLER including fluorescent in situ hybridization, Southern CY blotting, western blotting and reverse transcriptase TThe LightCycler System polymerase chain reaction (RT-PCR). Of these techni- The LightCycler System is based on the amplification LIGHT ques, RT-PCR for the chimeric fusion transcript BCR- of target sequences using alternating heated and ABL has received most attention in relation to the ambient temperature cycles. Samples are contained in detection of minimal residual disease because of its glass capillaries with high surface-to-volume ratio, high sensitivity (1).
    [Show full text]
  • Regulation of B Cell Receptor-Dependent NF-Κb Signaling by the Tumor Suppressor KLHL14
    Regulation of B cell receptor-dependent NF-κB signaling by the tumor suppressor KLHL14 Jaewoo Choia, James D. Phelana, George W. Wrightb, Björn Häuplc,d,e, Da Wei Huanga, Arthur L. Shaffer IIIa, Ryan M. Younga, Zhuo Wanga, Hong Zhaoa, Xin Yua, Thomas Oellerichc,d,e, and Louis M. Staudta,1 aLymphoid Malignancies Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; bBiometric Research Branch, Division of Cancer Diagnosis and Treatment, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; cDepartment of Medicine II, Hematology/Oncology, Goethe University, 60590 Frankfurt, Germany; dGerman Cancer Consortium/German Cancer Research Center, 69120 Heidelberg, Germany; and eDepartment of Molecular Diagnostics and Translational Proteomics, Frankfurt Cancer Institute, 60596 Frankfurt, Germany Contributed by Louis M. Staudt, January 29, 2020 (sent for review December 4, 2019; reviewed by Shiv Pillai and Michael Reth) The KLHL14 gene acquires frequent inactivating mutations in ma- by ibrutinib, suggesting that it may be a critical target of this ture B cell malignancies, especially in the MYD88L265P, CD79B mu- drug (8). tant (MCD) genetic subtype of diffuse large B cell lymphoma Genetic analysis revealed recurrent mutations of the KLHL14 (DLBCL), which relies on B cell receptor (BCR) signaling for survival. gene in DLBCL, often in ABC tumors of the MCD genetic However, the pathogenic role of KLHL14 in DLBCL and its molec- subtype (2) and in PCNSL (6, 9). KLHL14 (also known as ular function are largely unknown. Here, we report that KLHL14 is in Printor) (10) belongs to the Kelch-like family of proteins that can close proximity to the BCR in the endoplasmic reticulum of MCD cell serve as subunits of Cullin-RING ubiquitin ligase (CRL) com- line models and promotes the turnover of immature glycoforms of plex (reviewed in ref.
    [Show full text]
  • Abnormality of C-Kit Oncoprotein in Certain Patients with Chronic
    Leukemia (2002) 16, 170–177 2002 Nature Publishing Group All rights reserved 0887-6924/02 $25.00 www.nature.com/leu Abnormality of c-kit oncoprotein in certain patients with chronic myelogenous leukemia – potential clinical significance K Inokuchi, H Yamaguchi, M Tarusawa, M Futaki, H Hanawa, S Tanosaki and K Dan Division of Hematology, Department of Internal Medicine, Nippon Medical School, Tokyo, Japan Chronic myelogenous leukemia (CML) is characterized by the patients, there are two bcr/abl mRNAs for P210BCR/ABL, one Philadelphia (Ph) chromosome and bcr/abl gene rearrangement with and one without exon b3 (b3-a2 type and b2-a2 type).4 which occurs in pluripotent hematopoietic progenitor cells expressing the c-kit receptor tyrosine kinase (KIT). To elucidate In a smaller number of CML patients, there are two other types the biological properties of KIT in CML leukemogenesis, we of bcr/abl mRNAs based on the breakpoint positions of the performed analysis of alterations of the c-kit gene and func- bcr gene, ie m-bcr and ␮-bcr for P190BCR/ABL and P230BCR/ABL, tional analysis of altered KIT proteins. Gene alterations in the respectively.5,6 Extensive studies have been performed on the c-kit juxtamembrane domain of 80 CML cases were analyzed subtypes of the bcr/abl gene and their relation to the prognosis by reverse transcriptase and polymerase chain reaction-single and clinical features.7,8 The established findings regarding the strand conformation polymorphism (RT-PCR-SSCP). One case had an abnormality at codon 564 (AAT→AAG, Asn→Lys), and influence of the subtype of the bcr/abl gene (b3-a2 or b2-a2) six cases had the same base abnormality at codon 541 on the clinical characteristics have been similar for each sub- (ATG→CTG, Met→Leu) in the juxtamembrane domain.
    [Show full text]
  • Protein Tyrosine Kinases: Their Roles and Their Targeting in Leukemia
    cancers Review Protein Tyrosine Kinases: Their Roles and Their Targeting in Leukemia Kalpana K. Bhanumathy 1,*, Amrutha Balagopal 1, Frederick S. Vizeacoumar 2 , Franco J. Vizeacoumar 1,3, Andrew Freywald 2 and Vincenzo Giambra 4,* 1 Division of Oncology, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada; [email protected] (A.B.); [email protected] (F.J.V.) 2 Department of Pathology and Laboratory Medicine, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada; [email protected] (F.S.V.); [email protected] (A.F.) 3 Cancer Research Department, Saskatchewan Cancer Agency, 107 Wiggins Road, Saskatoon, SK S7N 5E5, Canada 4 Institute for Stem Cell Biology, Regenerative Medicine and Innovative Therapies (ISBReMIT), Fondazione IRCCS Casa Sollievo della Sofferenza, 71013 San Giovanni Rotondo, FG, Italy * Correspondence: [email protected] (K.K.B.); [email protected] (V.G.); Tel.: +1-(306)-716-7456 (K.K.B.); +39-0882-416574 (V.G.) Simple Summary: Protein phosphorylation is a key regulatory mechanism that controls a wide variety of cellular responses. This process is catalysed by the members of the protein kinase su- perfamily that are classified into two main families based on their ability to phosphorylate either tyrosine or serine and threonine residues in their substrates. Massive research efforts have been invested in dissecting the functions of tyrosine kinases, revealing their importance in the initiation and progression of human malignancies. Based on these investigations, numerous tyrosine kinase inhibitors have been included in clinical protocols and proved to be effective in targeted therapies for various haematological malignancies.
    [Show full text]
  • And an Imatinib-Responsive Myeloproliferative Disorder1
    [CANCER RESEARCH 64, 2673–2676, April 15, 2004] Advances in Brief NIN, a Gene Encoding a CEP110-Like Centrosomal Protein, Is Fused to PDGFRB in a Patient with a t(5;14)(q33;q24) and an Imatinib-Responsive Myeloproliferative Disorder1 Jose´L. Vizmanos,1 Francisco J. Novo,1 Jose´P. Roma´n,1 E. Joanna Baxter,2 Idoya Lahortiga,1 Marı´a J. Larra´yoz,1 Marı´a D. Odero,1 Pilar Giraldo,3 Marı´a J. Calasanz,1 and Nicholas C. P. Cross2 1Department of Genetics, University of Navarra, Pamplona, Spain; 2Wessex Regional Genetics Laboratory, Salisbury and Human Genetics Division, University of Southampton, Southampton, United Kingdom; and 3Haematology Service, Miguel Servet Hospital, Zaragoza, Spain Abstract mesylate (4–7) although this drug is inactive against FGFR1 fusions (8). Consequently, identification of patients with PDGFRB rearrange- We describe a new PDGFRB fusion associated with a t(5;14)(q33;q24) ments is very important for their clinical management. Rearrangement in a patient with a longstanding chronic myeloproliferative disorder with of PDGFRB was first described in patients with the t(5;12)(q31;p12), eosinophilia. After confirmation of PDGFRB involvement and definition of the chromosome 14 breakpoint by fluorescence in situ hybridization, leading to the formation of the ETV6-PDGFRB fusion (9). Subse- candidate partner genes were selected on the basis of the presence of quently, PDGFRB has been found fused to CEV14/TRIP11 by the predicted oligomerization domains believed to be an essential feature of t(5;14)(q31;p12) (Ref. 10); HIP1 by the t(5;7)(q33;q11.2) (Ref.
    [Show full text]
  • Imatinib Independent Aberrant Methylation of NOV/CCN3 In
    Vatanmakanian et al. Cell Communication and Signaling (2019) 17:38 https://doi.org/10.1186/s12964-019-0350-6 RESEARCH Open Access Imatinib independent aberrant methylation of NOV/CCN3 in chronic myelogenous leukemia patients: a mechanism upstream of BCR-ABL1 function? Mousa Vatanmakanian, Mahmood Tavallaie and Shirin Ghadami* Abstract Background: The NOV gene product, CCN3, has been reported in a diverse range of tumors to serve as a negative growth regulator, while acting as a tumor suppressor in Chronic Myelogenous Leukemia (CML). However, the precise mechanism of its silencing in CML is poorly understood. In the current study, we aimed to query if the gene regulation of CCN3 is mediated by the promoter methylation in the patients with CML. In addition, to clarify whether the epigenetic silencing is affected by BCR-ABL1 inhibition, we assessed the methylation status in the patients at different time intervals following the tyrosine kinase inhibition using imatinib therapy, as the first-line treatment for this type of leukemia. Methods: To address this issue, we applied bisulfite-sequencing technique as a high-resolution method to study the regulatory segment of the CCN3 gene. The results were analyzed in newly diagnosed CML patients as well as following imatinib therapy. We also evaluated the correlation of CCN3 promoter methylation with BCR-ABL1 levels. Results: Our findings revealed that the methylation occurs frequently in the promoter region of CML patients showing a significant increase of the methylated percentage at the CpG sites compared to normal individuals. Interestingly, this hypermethylation was indicated to be independent of BCR-ABL1 titers in both groups, which might suggest a mechanism beyond the BCR-ABL1 function.
    [Show full text]
  • BCR Gene BCR, Rhogef and Gtpase Activating Protein
    BCR gene BCR, RhoGEF and GTPase activating protein Normal Function The BCR gene provides instructions for making a protein whose function is not completely understood. Studies show that the BCR protein may act as a GTPase activating protein (GAP). GAPs turn off (inactivate) proteins called GTPases, which play an important role in chemical signaling within cells. Often referred to as molecular switches, GTPases can be turned on and off. They are turned on (active) when they are attached (bound) to a molecule called GTP and are turned off when they are bound to another molecule called GDP. The BCR protein inactivates a GTPase known as Rac1 by stimulating a reaction that turns the attached GTP into GDP. Through this activity, the BCR protein helps regulate the movement (migration) and function of cells. The BCR protein can also act as a kinase, which is an enzyme that changes the activity of other proteins by adding a cluster of oxygen and phosphorus atoms (a phosphate group) at specific positions. BCR's kinase activity is likely involved in regulating signaling within cells, although its exact role is unclear. Health Conditions Related to Genetic Changes Chronic myeloid leukemia A genetic rearrangement (translocation) involving the BCR gene causes a type of cancer of blood-forming cells called chronic myeloid leukemia. This slow-growing cancer leads to an overproduction of abnormal white blood cells. Common features of the condition include excessive tiredness (fatigue), fever, weight loss, and an enlarged spleen. The translocation involved in this condition, written as t(9;22), fuses part of the ABL1 gene from chromosome 9 with part of the BCR gene from chromosome 22, creating an abnormal fusion gene called BCR-ABL1.
    [Show full text]
  • Myeloproliferative Neoplasms Panel by FISH
    Myeloproliferative Neoplasms Panel by FISH Indications for Ordering Eosinophilia Panel by FISH 2002378 • Diagnosis, prognosis, and monitoring of eosinophilic • Aids in diagnosis and classification of specific leukemias myeloproliferative neoplasms (MPNs) with eosinophilia in • Probes target: conjunction with cytogenetic testing: o FGFR1 translocations o Chronic myelogenous leukemia (CML): BCR-ABL1 o FIP1L1-PDGFRA region rearrangements positive o PDGFRB translocations o Myeloid and lymphoid neoplasms with eosinophilia and Chromosome FISH, Interphase 2002298 abnormalities of PDGFRA, PDGFRB, or FGFR1 • Specific FISH probes must be requested and include: • Monitor minimal residual disease (MRD) in MPNs o PDGFRA Test Description o PDGFRB o FGFR1 • Performed on bone marrow (BM) o BCR-ABL1 o Peripheral blood may be used but not preferred o inv(16) • Probes target: Myeloid Malignancies Mutation Panel by Next Generation o BCR-ABL1 fusion Sequencing 2011117 o FGFR1 translocations • Assess for single gene mutations, including substitutions o FIP1L1-PDGFRA region rearrangements and insertions and deletions that may have diagnostic, o PDGFRB translocations prognostic, and/or therapeutic significance • Each probe can be run as a panel or individually Disease Overview Tests to Consider Diagnostic issues Primary test • FISH analysis has several advantages over chromosome Myeloproliferative Disorders Panel by FISH 2002360 studies in MPN diagnosis • Limited role in the workup of myeloproliferative o More rapid turnaround time neoplasms in the setting of
    [Show full text]
  • Adult Precursor B-ALL with BCR/ABL Gene Rearrangements Displays A
    Leukemia (2001) 15, 406–414 2001 Nature Publishing Group All rights reserved 0887-6924/01 $15.00 www.nature.com/leu Adult precursor B-ALL with BCR/ABL gene rearrangements displays a unique immunophenotype based on the pattern of CD10, CD34, CD13 and CD38 expression MD Tabernero1, AM Bortoluci1, I Alaejos2,MCLo´pez-Berges2, A Rasillo1, R Garcı´a-Sanz2, M Garcı´a1, JM Sayague´s1, M Gonza´lez2, G Mateo2, JF San Miguel2 and A Orfao1 1Servicio General de Citometrı´a, Departamento de Medicina, and Centro de Investigaciones del Cancer, University of Salamanca; and 2Servicio de Hematologı´a, Hospital Universitario, Salamanca, Spain + The Philadelphia chromosome (Ph ) reflects a balanced stratification and treatment decision making. Unfortunately, a reciprocal translocation between the long arms of chromo- rapid screening method, displaying a high sensitivity and somes 9 and 22 [t(9;22)(q34;q11.2] involving the BCR and ABL + genes. At present, detection of BCR/ABL gene rearrangements specificity, for identification of BCR/ABL precursor-B-ALL is mandatory in precursor-B-ALL patients at diagnosis for cases is not currently available. Although an association prognostic stratification and treatment decision. In spite of the between BCR/ABL gene rearrangements and a common (BII) clinical impact, no screening method, displaying a high sensi- phenotype has long been reported22 it is well-established that tive and specificity, is available for the identification of ␮ + reactivity for CD10 in the absence of cIg and sIg expression – BCR/ABL precursor-B-ALL cases. The aim of the present a common, BII phenotype – is also present in around half of study was to explore the immunophenotypic characteristics of − 22,23 precursor B-ALL cases displaying BCR/ABL gene rearrange- all BCR/ABL precursor-B-ALL cases.
    [Show full text]