[CANCER RESEARCH 61, 2343–2355, March 15, 2001] Review The BCR Gene and Philadelphia Chromosome-positive Leukemogenesis Eunice Laurent, Moshe Talpaz, Hagop Kantarjian, and Razelle Kurzrock1 Departments of Bioimmunotherapy [E. L., M. T., R. K.] and Leukemia [H. K., R. K.], University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 Introduction Recent investigations have rapidly added crucial new insights into BCR-related Genes the complex functions of the normal BCR gene and of the BCR-ABL Several BCR-related pseudogenes (BCR2, BCR3, and BCR4) have chimera and are yielding potential therapeutic breakthroughs in the also been described (34). They are not translated into proteins. All of treatment of Philadelphia (Ph) chromosome-positive leukemias. The these genes have been mapped to chromosome 22q11 by in situ term “breakpoint cluster region (bcr)” was first applied to a 5.8-kb hybridization. The orientation is such that BCR2 is the most centro- span of DNA on the long arm of chromosome 22 (22q11), which is 2 meric, followed by BCR4, then BCR1 (the functional gene) and BCR3. disrupted in patients with CML bearing the Ph translocation [t(9; BCR2 and BCR4 are retained on chromosome 22 during the t(9;22) 22)(q34;q11); Refs. 1–3]. Subsequent studies demonstrated that the translocation. The BCR-related genes all contain 3Ј sequences iden- 5.8-kb fragment resided within a central region of a gene designated tical to those encompassing the last seven exons of the BCR1 gene BCR (4). It is now well established that the breakpoint within BCR can (34, 36). The 5Ј region is highly variable, suggesting that the 3Ј end be variable, and when joined with ABL, results in a hybrid Mr 210,000 of the normal BCR1 gene was inserted into another locus with sub- Bcr-Abl Bcr-Abl Bcr-Abl (p210 )oraMr 190,000 (p 190 protein (p190 ; Fig. sequent duplication of the new locus (36). Another BCR pseudogene, 1; Refs. 5–13). Of interest, p190Bcr-Abl characterizes a phenotypically the chromosomal location of which remains undefined, has also been acute, rather than chronic, leukemia that is often, but not always, of described (37). It was shown to have homology with the 3Ј end of lymphoid (rather than of myeloid) derivation (Refs. 10 and 14; Table exon 3 as well as the 5Ј end of exon 4 (37). 1). Both p210Bcr-Abl and p190Bcr-Abl have constitutive tyrosine kinase There is an additional BCR-related gene located on chromosome activity. Furthermore, the presence of the hybrid proteins perturbs the 17p13.3 (35, 38, 39). This gene is functionally active and has been multiple functions of their normal counterparts. Understanding the designated ABR or active BCR-related gene (35). There is 68% ho- biological sequelae of the molecular aberrations in Ph-positive disease mology between ABR and the central and COOH-terminal regions of has led to development of novel tyrosine kinase inhibitor therapy that BCR (35, 39). is showing remarkable success in clinical trials. Herein, we review the current state of knowledge on the role of BCR alone or when joined The BCR Promoter with ABL in normal and leukemic pathophysiology and the implica- The 5Ј untranslated region of the BCR gene is important because tions of this knowledge for therapy. the fusion gene created by the Ph translocation is placed under the regulation of the BCR promoter (31, 40–42). A region ϳ1-kb up- Genomic Structure of the BCR Gene stream of the transcription start site was demonstrated to be the The BCR Gene principle site of promoter activity (41, 42). Within this region, a CAAT box (conserved sequence upstream of start point of transcrip- BCR is situated in a 5Ј to 3Ј orientation with the 5Ј end closer to the tion, which is recognized by transcription factors) at position Ϫ644 as centromere (4). The entire gene spans 130 kb and contains 23 exons well as an inverted CAAT sequence at position Ϫ718 have been (Ref. 26; Table 2 and Fig. 2). The first intron separating exons 1 and localized. However, neither in vitro nor in vivo studies suggest that 2 was initially shown to span a distance of 68 kb (26) but is now these sequences are key factors for transcriptional regulation of the known to include two additional exons (an alternative exon 1 and an BCR gene (41). There is also a TATA box [conserved sequences in the alternative exon 2; Refs. 28 and 29). Two transcripts, 4.5- and 7.0-kb promoter that specify the position at which transcription is initiated long, have been found (16). The nucleotide sequence contains an open (43)] 120 bp downstream of the CAAT box. This TATA box, TT- reading frame of 3818 nucleotides, which codes for a protein 1271 TAA, is also accompanied by the consensus sequence TCATCG, amino acids in length (31, 36). required for 5Ј capping of the transcript (41). DNA footprinting and gel retardation assays have also been used to discover potential sites for DNA/protein interaction, which might reflect transcription factor activity. Several sites were found including ones containing the consensus sequence GGGCCGG (as well as the Received 8/4/00; accepted 1/12/01. The costs of publication of this article were defrayed in part by the payment of page inverted sequence) for the SP1 transcription factor (41, 42). A unique charges. This article must therefore be hereby marked advertisement in accordance with sequence TAGGGCCTCAGTTTCCCAAAAGGCA, for which no 18 U.S.C. Section 1734 solely to indicate this fact. binding protein is known, was also detected (41). Deletion of that site 1 To whom requests for reprints should be addressed, at Department of Bioimmuno- therapy, Box 422, M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, (versus other potential binding sites) resulted in a significant decrease TX 77030. Phone: (713) 794-1226; Fax: (713) 745-2374. of promoter activity in BCR-ABL-transfected cells (41). 2 The abbreviations used are: CML, chronic myelogenous leukemia; Ph, Philadelphia; The 5Ј untranslated region of the BCR gene is also very rich in GC GEF, guanine nucleotide exchange factor; GTPase, guanine triphosphatase; GAP, GTPase activating protein; XPB, xeroderma pigmentosum group B; SH2, Src homology 2; Grb2, content, which makes up 80% of the nucleotides with“in this stretch growth factor receptor binding protein 2; Bap-1, Bcr-associated protein 1; ALL, acute of the DNA (31, 36). Within this GC-rich region is a segment 18 lymphocytic leukemia; AML, acute myelogenous leukemia; M-bcr, major breakpoint Ϫ Ϫ cluster region; Ship, SH2-containing phosphatidylinositol 3,4,5-triphosphate 5-phospha- nucleotides long at sites 376 to 393, containing the sequence tase; Jak, Janus kinase. GCGGCGGCGGCGGCGGCG with its inverted repeat 363 bp down- 2343 Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2001 American Association for Cancer Research. THE BCR GENE AND LEUKEMOGENESIS Fig. 1. Schematic representation of BCR, ABL, and BCR-ABL genes and the proteins they encode. Numbers refer to exon number. In the BCR gene, exons 1Ј and 2Ј are alternative exons contained within the first intron. The ABL gene has two alternative first exons denoted 1b and 1a, respectively. A series of different protein products are described based on the fusion transcripts that have been identified. The predicted proteins are illustrated in the right-hand column. (However, not all these proteins have been demonstrated on gels and, therefore, not all of them are given a size.) Table 1 Molecular events associated with Philadelphia-positive leukemiasa Diagnosis Transcript Protein product Normal 6.0- and 7.0-kb ABL mRNA pl45Abl 4.5- and 6.7-kb BCR mRNA p130Bcr and p160Bcr CMLb 8.5-kb BCR-ABL mRNA (an ABL-BCR mRNA is also expressed in some patients) p210Bcr-Abl ALL 8.5- or 7.0-kb BCR-ABL mRNA (an ABL-BCR mRNA is also expressed in some patients) p210Bcr-Abl or p190Bcr-Abl AML 8.5- or 7.0-kb BCR-ABL mRNA p210Bcr-Abl or p190Bcr-Abl Neutrophilic CML 9.0-kb BCR-ABL mRNA p230Bcr-Abl a Summarized from Refs. 4, 8–12, and 15–25. b Rare expression of 7.0-kb BCR-ABL mRNA and p190Bcr-Abl. stream. These sequences are apt to form secondary stem and loop have short open reading frames because there are stop codons down- structures, with a possible role in translational regulation (36), and are stream of these sites (31, 40). It has been suggested that these short common to many housekeeping genes (43). Other possible start sites transcripts could also play a role in regulating protein translation (40). upstream of the normal AUG codon have been found; however, these Bcr Protein(s) Table 2 BCR: Molecular features Currently, the normal BCR gene is known to code for two major Comments Refs. proteins that are Mr 160,000 and Mr 130,000 in size (17, 25, 30). It is Location Chromosome 22q11 2, 27 possible that these proteins are derived from the 7.0- and 4.5-kb BCR Size of gene 130-kb 26 transcripts, respectively (15, 17, 26). In addition, Li et al. (44) have Number of exons 23 exons 26 (also contains alternative exon 1 and exon 2) 28, 29 described putative Bcr proteins of Mr 190,000/Mr 185,000, Mr Size of transcripts 4.5kb and 6.7kb 4, 15 155,000, M 135,000, M 125,000, and M 108,000. a r r r Size of proteins Mr 130,000 and Mr 160,000 17, 25, 30 BCR expression Ubiquitously expressed 4, 31–33 Highest levels in brain and haematopoietic cells Bcr-related Protein(s) BCR-related genes Pseudogenes BCR2, BCR3, and BCR4 found on 34, 35 chromosome 22q11; ABR (active BCR- related) gene on 17p13 The ABR gene encodes for a Mr 98,000 protein that contains both the a GEF and GAP domains of Bcr (respectively, the central and COOH- Other proteins of Mr, 190,000/Mr 185,000, Mr 155,000, Mr 135,000, Mr 125,000, and Mr 108,000 not firmly established.