DOCSLIB.ORG

Blood Group Antigens Stenfelt, Linn

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Blood Group Antigens Stenfelt, Linn Elucidating Genetic and Biochemical Aspects of the P1 and Sda Carbohydrate Histo- Blood Group Antigens Stenfelt, Linn 2020 Document Version: Publisher's PDF, also known as Version of record Link to publication Citation for published version (APA): a Stenfelt, L. (2020). Elucidating Genetic and Biochemical Aspects of the P1 and Sd Carbohydrate Histo-Blood Group Antigens. Lund University, Faculty of Medicine. Total number of authors: 1 General rights Unless other specific re-use rights are stated the following general rights apply: Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal Read more about Creative commons licenses: https://creativecommons.org/licenses/ Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. LUND UNIVERSITY PO Box 117 221 00 Lund +46 46-222 00 00 Elucidating Genetic and Biochemical Aspects of the P1 and Sda Carbohydrate Histo-Blood Group Antigens LINN STENFELT FACULTY OF MEDICINE | LUND UNIVERSITY At the beginning of the 20th century Karl Landsteiner discovered the ABO histo-blood group system. This discovery became the cornerstone for prediction of safe human-to- human blood transfusions in modern medicine. Today, close to 40 blood group systems have been acknowledged by the International Society of Blood Transfusion (ISBT). Donor- patient matching can be achieved by traditional serological hemagglutination methods as well as newly developed blood group genotyping techniques. Genotyping requires an understanding of the underlying locus and genetic variations that determine blood group status. The aim of this thesis was to establish the molecular mechanisms and genetic bases of the carbohydrate histo-blood group antigens P1 and Sda. In addition, the biochemical carriers of the antigenic structures were investigated. The findings presented here open up for genotypic prediction of these blood groups and also allowed ISBT to establish the SID histo-blood group system. Lund University, Faculty of Medicine 199527 Doctoral Dissertation Series 2020:90 ISBN 978-91-7619-952-7 789176 ISSN 1652-8220 9 Elucidating Genetic and Biochemical Aspects of the P1 and Sda Carbohydrate Histo-Blood Group Antigens Elucidating Genetic and Biochemical Aspects of the P1 and Sda Carbohydrate Histo-Blood Group Antigens Linn Stenfelt DOCTORAL DISSERTATION by due permission of the Faculty of Medicine, Lund University, Sweden. To be defended September 18 at 13.15 in Belfragesalen, BMC, Lund Faculty opponent Professor Steven L. Spitalnik, M.D. Department of Pathology & Cell Biology, Columbia University, New York City, NY, USA Organization Document name LUND UNIVERSITY DOCTORAL DISSERTATION Department of Laboratory Medicine Date of issue Division of Hematology and Transfusion Medicine September 18th 2020 Author Linn Stenfelt Sponsoring organization Title and subtitle Elucidating Genetic and Biochemical Aspects of the P1 and Sda Carbohydrate Histo-Blood Group Antigens Abstract Human histo-blood groups are inherited polymorphic variants that occur in the molecular structures on the human red blood cell (RBC) surface. Introducing foreign RBCs into a recipient lacking an antigen may activate the humoral defence leading to a hemolytic transfusion reaction. Antigenic differences can also cause hemolytic disease of the fetus and newborn (HDFN). Blood group antigens are implicated as receptors in pathogen invasion and their expression are often altered in cancerous tissues. Blood group antigens are carried by protein or carbohydrate structures. Carbohydrate antigens are synthesized stepwise by glycosyltransferases and are carried on glycosphingolipids or glycoproteins anchored into the RBC membrane. The aim of this work was to elucidate the molecular genetic mechanisms behind the P1 and Sda antigens, as well as to study their glycan structures. The P1 antigen belongs to the P1PK blood group system. Silencing of A4GALT causes the null phenotype (Pk–, P1–) of this k k system. However, the consequence of the genetic differences between the P1 (P+, P1+) and P2 (P+, P1–) phenotypes, i.e. the molecular mechanism underlying how P1 antigen is expressed, has remained unknown. Additionally, there have been divided views regarding the molecular carriers of the P1 antigen, Galα1-4Galβ1- 4GlcNAc-R. The Sda antigen GalNAcβ1-4(NeuAcα2-3)Gal-R was associated with the B4GALNT2 gene already in 2003. However, the genetic basis of the Sd(a–) phenotype was never revealed. Through EMSA experiments the Runt-related transcription factor 1 (RUNX1) was identified to bind P1 alleles specifically, dependent on rs5751348 in A4GALT. Knock-down of RUNX1 decreased the A4GALT mRNA levels, establishing its effect as a P1/P2-discriminating factor. Based on these findings a genotyping assay was implemented at the Nordic Reference Laboratory for Genomic Blood Group Typing in Lund, Sweden. P1 was also established to be carried on glycoproteins in N-glycan conjugates, in addition to glycosphingolipids. Sequencing of B4GALNT2 in nine Sd(a–) individuals identified the missense mutation rs7224888 as highly associated with the phenotype. Additionally, the splice-site polymorphism rs72835417, and the rare missense variants rs148441237 and rs61743617 were encountered in the Sd(a–) cohort. In silico studies identified a close correlation between expression of B4GALNT2 and the cancer-associated lncRNA RP11-708H21.4 locus, located directly downstream of the gene. Finally, the Sd(a–) associated SNP rs7224888 was shown to abolish Sda synthase activity in over-expression experiments. The epitope was evaluated with DBA lectin binding, fluorescence microscopy, enzyme immunoblots and mass spectrometry. The latter confirmed that the glycotransferase utilizes substrates on both on N- and O-glycan elongation. Understanding the molecular mechanism underlying the P1 antigen as well as defining the genetic background of the Sd(a–) phenotype has enabled genotyping approaches for clinical practice. Additionally, the confirmation of B4GALNT2 expressing the Sda synthase, has allowed the International Society of Blood Transfusion (ISBT) to move the Sda antigen from the series of high-frequency antigens to its own, new blood group system designated SID, no. 038. Key words Blood group, P1 antigen, Sda antigen, A4GALT, B3GALNT2, glycosyltransferase, red blood cell, transfusion medicine Classification system and/or index terms (if any) Supplementary bibliographical information Language English ISSN 1652-8220 ISBN 978-91-7619-952-7 Recipient’s notes Number of pages 76 Price Security classification I, the undersigned, being the copyright owner of the abstract of the above-mentioned dissertation, hereby grant to all reference sources permission to publish and disseminate the abstract of the above-mentioned dissertation. Signature Date 2020-08-27 Elucidating Genetic and Biochemical Aspects of the P1 and Sda Carbohydrate Histo-Blood Group Antigens Linn Stenfelt Cover by Linn Stenfelt Copyright Linn Stenfelt Paper 1 © by The American Society of Hematology Paper 2 © by John Wiley & Sons Paper 3 © by Elsevier Paper 4 © by the Authors (Manuscript unpublished) Faculty of Medicine Department of Laboratory Medicine ISBN 978-91-7619-952-7 ISSN 1652-8220 Lund University, Faculty of Medicine Doctoral Dissertation Series 2020:90 Printed in Sweden by Media-Tryck, Lund University Lund 2020 Table of Contents Table of Contents .................................................................................................... 7 Abbreviations .......................................................................................................... 9 List of publications ............................................................................................... 11 Abstract ................................................................................................................. 13 Introduction .......................................................................................................... 15 Transfusion medicine ................................................................................... 15 The need of blood in modern medicine ............................................... 16 Histo-blood groups and the immune response .................................... 17 Transfusion-related complications ...................................................... 20 Other medical implications where histo-blood groups play a role ...... 21 Blood groups and infectious disease ................................................... 23 Blood group characterization .............................................................. 24 Erythropoiesis .............................................................................................. 25 Genetic regulation of RBC formation ................................................. 27 Glycosylation ............................................................................................... 29 Carbohydrate blood group
Load more

Recommended publications
  • Other Blood Group Systems—Diego,Yt, Xg, Scianna, Dombrock
    Review: other blood group systems—Diego, Yt, Xg, Scianna, Dombrock, Colton, Landsteiner- Wiener, and Indian K.M. B YRNE AND P.C. B YRNE Introduction Diego Blood Group System This review was prepared to provide a basic The Diego blood group system (ISBT: DI/010) has overview of “Other Blood Groups.” Some of the more expanded from its humble beginnings to now include major blood group systems, i.e., ABO, Rh, Kell, Duffy, up to 21 discrete antigens (Table 1). 3 Band 3, an anion and Kidd, are also reviewed in this issue and are not exchange, multi-pass membrane glycoprotein, is the covered here. The sheer mass of data on the MNS basic structure that carries the Diego system antigenic blood group system is so extensive and complicated determinants. 4 The gene that encodes the Band 3 that it justifies a review all of its own, and it is therefore protein is named SLC4A1 and its chromosomal location not discussed in this article. However, various aspects is 17q12–q21. 4 of MNS were described in recent papers in Di a and Di b are antithetical, resulting from a single Immunohematology. 1,2 nucleotide substitution (2561T>C) that gives rise to The blood group systems that are covered are those amino acid changes in the Band 3 protein (Leu854Pro). that most workers believe to have some degree of To date, the Di(a–b–) phenotype has not been clinical importance or interesting features: Diego (DI), described. The Di a and Di b antigens are resistant to Yt (YT), Xg (XG), Scianna (SC), Dombrock (DO), Colton treatment with the following enzymes/chemicals: (CO), Landsteiner-Wiener (LW), and Indian (IN).
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease
    The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease by Sepehr Ehsani A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto © Copyright by Sepehr Ehsani 2012 The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease Sepehr Ehsani Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto 2012 Abstract The cellular prion protein (PrPC) is unique amongst mammalian proteins in that it not only has the capacity to aggregate (in the form of scrapie PrP; PrPSc) and cause neuronal degeneration, but can also act as an independent vector for the transmission of disease from one individual to another of the same or, in some instances, other species. Since the discovery of PrPC nearly thirty years ago, two salient questions have remained largely unanswered, namely, (i) what is the normal function of the cellular protein in the central nervous system, and (ii) what is/are the factor(s) involved in the misfolding of PrPC into PrPSc? To shed light on aspects of these questions, we undertook a discovery-based interactome investigation of PrPC in mouse neuroblastoma cells (Chapter 2), and among the candidate interactors, identified two members of the ZIP family of zinc transporters (ZIP6 and ZIP10) as possessing a PrP-like domain. Detailed analyses revealed that the LIV-1 subfamily of ZIP transporters (to which ZIPs 6 and 10 belong) are in fact the evolutionary ancestors of prions (Chapter 3).
    [Show full text]
  • The Membrane Complement Regulatory Protein CD59 and Its Association with Rheumatoid Arthritis and Systemic Lupus Erythematosus
    Current Medicine Research and Practice 9 (2019) 182e188 Contents lists available at ScienceDirect Current Medicine Research and Practice journal homepage: www.elsevier.com/locate/cmrp Review Article The membrane complement regulatory protein CD59 and its association with rheumatoid arthritis and systemic lupus erythematosus * Nibhriti Das a, Devyani Anand a, Bintili Biswas b, Deepa Kumari c, Monika Gandhi c, a Department of Biochemistry, All India Institute of Medical Sciences, New Delhi 110029, India b Department of Zoology, Ramjas College, University of Delhi, India c University School of Biotechnology, Guru Gobind Singh Indraprastha University, India article info abstract Article history: The complement cascade consisting of about 50 soluble and cell surface proteins is activated in auto- Received 8 May 2019 immune inflammatory disorders. This contributes to the pathological manifestations in these diseases. In Accepted 30 July 2019 normal health, the soluble and membrane complement regulatory proteins protect the host against Available online 5 August 2019 complement-mediated self-tissue injury by controlling the extent of complement activation within the desired limits for the host's benefit. CD59 is a membrane complement regulatory protein that inhibits the Keywords: formation of the terminal complement complex or membrane attack complex (C5b6789n) which is CD59 generated on complement activation by any of the three pathways, namely, the classical, alternative, and RA SLE the mannose-binding lectin pathway. Animal experiments and human studies have suggested impor- Pathophysiology tance of membrane complement proteins including CD59 in the pathophysiology of rheumatoid arthritis Disease marker (RA) and systemic lupus erythematosus (SLE). Here is a brief review on CD59 and its distribution, structure, functions, and association with RA and SLE starting with a brief introduction on the com- plement system, its activation, the biological functions, and relations of membrane complement regu- latory proteins, especially CD59, with RA and SLE.
    [Show full text]
  • Mcleod Neuroacanthocytosis Syndrome
    NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health. Pagon RA, Adam MP, Ardinger HH, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993- 2017. McLeod Neuroacanthocytosis Syndrome Hans H Jung, MD Department of Neurology University Hospital Zurich Zurich, Switzerland [email protected] Adrian Danek, MD Neurologische Klinik Ludwig-Maximilians-Universität München, Germany ed.uml@kenad Ruth H Walker, MD, MBBS, PhD Department of Neurology Veterans Affairs Medical Center Bronx, New York [email protected] Beat M Frey, MD Blood Transfusion Service Swiss Red Cross Schlieren/Zürich, Switzerland [email protected] Christoph Gassner, PhD Blood Transfusion Service Swiss Red Cross Schlieren/Zürich, Switzerland [email protected] Initial Posting: December 3, 2004; Last Update: May 17, 2012. Summary Clinical characteristics. McLeod neuroacanthocytosis syndrome (designated as MLS throughout this review) is a multisystem disorder with central nervous system (CNS), neuromuscular, and hematologic manifestations in males. CNS manifestations are a neurodegenerative basal ganglia disease including (1) movement disorders, (2) cognitive alterations, and (3) psychiatric symptoms. Neuromuscular manifestations include a (mostly subclinical) sensorimotor axonopathy and muscle weakness or atrophy of different degrees. Hematologically, MLS is defined as a specific blood group phenotype (named after the first proband, Hugh McLeod) that results from absent expression of the Kx erythrocyte antigen and weakened expression of Kell blood group antigens. The hematologic manifestations are red blood cell acanthocytosis and compensated hemolysis. Allo-antibodies in the Kell and Kx blood group system can cause strong reactions to transfusions of incompatible blood and severe anemia in newborns of Kell-negative mothers.
    [Show full text]
  • Association Between ABO and Duffy Blood Types and Circulating Chemokines and Cytokines
    Genes & Immunity (2021) 22:161–171 https://doi.org/10.1038/s41435-021-00137-5 ARTICLE Association between ABO and Duffy blood types and circulating chemokines and cytokines 1 2 3 4 5 6 Sarah C. Van Alsten ● John G. Aversa ● Loredana Santo ● M. Constanza Camargo ● Troy Kemp ● Jia Liu ● 4 7 8 Wen-Yi Huang ● Joshua Sampson ● Charles S. Rabkin Received: 11 February 2021 / Revised: 30 April 2021 / Accepted: 17 May 2021 / Published online: 8 June 2021 This is a U.S. government work and not under copyright protection in the U.S.; foreign copyright protection may apply 2021, corrected publication 2021 Abstract Blood group antigens are inherited traits that may play a role in immune and inflammatory processes. We investigated associations between blood groups and circulating inflammation-related molecules in 3537 non-Hispanic white participants selected from the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. Whole-genome scans were used to infer blood types for 12 common antigen systems based on well-characterized single-nucleotide polymorphisms. Serum levels of 96 biomarkers were measured on multiplex fluorescent bead-based panels. We estimated marker associations with blood type using weighted linear or logistic regression models adjusted for age, sex, smoking status, and principal components of p 1234567890();,: 1234567890();,: population substructure. Bonferroni correction was used to control for multiple comparisons, with two-sided values < 0.05 considered statistically significant. Among the 1152 associations tested, 10 were statistically significant. Duffy blood type was associated with levels of CXCL6/GCP2, CXCL5/ENA78, CCL11/EOTAXIN, CXCL1/GRO, CCL2/MCP1, CCL13/ MCP4, and CCL17/TARC, whereas ABO blood type was associated with levels of sVEGFR2, sVEGFR3, and sGP130.
    [Show full text]
  • Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS
    Journal of Blood Group Serology and Molecular Genetics VOLUME 34, N UMBER 1, 2018 This issue of Immunohematology is supported by a contribution from Grifols Diagnostics Solutions, Inc. Dedicated to advancement and education in molecular and serologic immunohematology Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS S EROLOGIC M ETHOD R EVIEW 1 Warm autoadsorption using ZZAP F.M. Tsimba-Chitsva, A. Caballero, and B. Svatora R EVIEW 4 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai A brief overview of clinical significance of blood group antibodies M.J. Gandhi, D.M. Strong, B.I. Whitaker, and E. Petrisli C A S E R EPORT 7 Management of pregnancy sensitized with anti-Inb with monocyte monolayer assay and maternal blood donation R. Shree, K.K. Ma, L.S. Er and M. Delaney R EVIEW 11 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai A review of in vitro methods to predict the clinical significance of red blood cell alloantibodies S.J. Nance S EROLOGIC M ETHOD R EVIEW 16 Recovery of autologous sickle cells by hypotonic wash E. Wilson, K. Kezeor, and M. Crosby TO THE E DITOR 19 The devil is in the details: retention of recipient group A type 5 years after a successful allogeneic bone marrow transplant from a group O donor L.L.W.
    [Show full text]
  • Genes and Human History
    Genes and human history Gil McVean, Department of Statistics, Oxford Contact: [email protected] 2 3 • Where does the variation come from? • How old are the genetic differences between us? • Are these differences important? How different are our genomes? 5 Serological techniques for detecting variation Rabbit Anti-A antibodies Human A A B AB O 6 Blood group systems in humans • 28 known systems – 39 genes, 643 alleles System Genes Alleles Knops CR1 24+ ABO ABO 102 Landsteiner- ICAM4 3 Wiener Colton C4A, C4B 7+ Lewis FUT3, FUT6 14/20 Chido-rodgers AQP1 7 Lutheran LU 16 Colton DAF 10 MNS GYPA,GYPB,G 43 Diego SLC4A1 78 YPE Dombrock DO 9 OK BSG 2 Duffy FY 9 P-related A4GALT, 14/5 Gerbich GYPC 9 B3GALT3 GIL AQP3 2 RAPH-MER2 CD151 3 H/h FUT1, FUT2 27/22 Rh RHCE, RHD, 129 I GCNT2 7 RHAG Indian CD44 2 Scianna ERMAP 4 Kell KEL, XK 33/30 Xg XG, CD99 - Kidd SLC14A1 8 YT ACHE 4 http://www.bioc.aecom.yu.edu/bgmut/summary.htm 7 Protein electroporesis • Changes in mass/charge ratio resulting from amino acid substitutions in proteins can be detected Starch or agar gel -- +- + +- - - - -- - + - + +- -- Direction of travel • In humans, about 30% of all loci show polymorphism with a 6% chance of a pair of randomly drawn alleles at a locus being different Lewontin and Hubby (1966) Harris(1966) 8 The rise of DNA sequencing GATAAGACGGTGATACTCACGCGACGGGCTTGGGCGCCGACTCGTTCAGACGGTGACCCAACTTATCCGATCGACCC CGGGTCCCGATTTAGACTCGGTATCATTTCTGGTGATTATCGCCTGCAGGTTCAAGAACACGTTTGCAGCAAGAAGT GAGGGATTTTGTCAGTGATCCCAGTCTACGGAGCCAGTCACCTCTGGTAGTGAAATTTTATTCGTTCATCTTCATAT AAGTCGCAGACCGCACGATGGGGGACAGAATACTCGCACAGGAAGAACCGCGATGAACCGAGGTAACCTAACATCCT
    [Show full text]
  • Guidelines for Transfusion and Patient Blood Management, and Discuss Relevant Transfusion Related Topics
    Guidelines for Transfusion and Community Transfusion Committee Patient Blood Management Community Transfusion Committee CHAIR: Aina Silenieks, M.D., [email protected] MEMBERS: A.Owusu-Ansah, M.D. S. Dunder, M.D. M. Furasek, M.D. D. Lester, M.D. D. Voigt, M.D. B. J. Wilson, M.D. COMMUNITY Juliana Cordero, Blood Bank Coordinator, CHI Health Nebraska Heart REPRESENTATIVES: Becky Croner, Laboratory Services Manager, CHI Health St. Elizabeth Mackenzie Gasper, Trauma Performance Improvement, Bryan Medical Center Kelly Gillaspie, Account Executive, Nebraska Community Blood Bank Mel Hanlon, Laboratory Specialist - Transfusion Medicine, Bryan Medical Center Kyle Kapple, Laboratory Quality Manager, Bryan Medical Center Lauren Kroeker, Nurse Manager, Bryan Medical Center Christina Nickel, Clinical Laboratory Director, Bryan Medical Center Rachael Saniuk, Anesthesia and Perfusion Manager, Bryan Medical Center Julie Smith, Perioperative & Anesthesia Services Director, Bryan Medical Center Elaine Thiel, Clinical Quality Improvement/Trans. Safety Officer, Bryan Med Center Kelley Thiemann, Blood Bank Lead Technologist, CHI Health St. Elizabeth Cheryl Warholoski, Director, Nebraska Operations, Nebraska Community Blood Bank Jackie Wright, Trauma Program Manager, Bryan Medical Center CONSULTANTS: Jed Gorlin, M.D., Innovative Blood Resources [email protected] Michael Kafka, M.D., LifeServe Blood Center [email protected] Alex Smith, D.O., LifeServe Blood Center [email protected] Nancy Van Buren, M.D., Innovative
    [Show full text]
  • Endothelial LRP1 Transports Amyloid-Β1–42 Across the Blood- Brain Barrier
    Endothelial LRP1 transports amyloid-β1–42 across the blood- brain barrier Steffen E. Storck, … , Thomas A. Bayer, Claus U. Pietrzik J Clin Invest. 2016;126(1):123-136. https://doi.org/10.1172/JCI81108. Research Article Neuroscience According to the neurovascular hypothesis, impairment of low-density lipoprotein receptor–related protein-1 (LRP1) in brain capillaries of the blood-brain barrier (BBB) contributes to neurotoxic amyloid-β (Aβ) brain accumulation and drives Alzheimer’s disease (AD) pathology. However, due to conflicting reports on the involvement of LRP1 in Aβ transport and the expression of LRP1 in brain endothelium, the role of LRP1 at the BBB is uncertain. As global Lrp1 deletion in mice is lethal, appropriate models to study the function of LRP1 are lacking. Moreover, the relevance of systemic Aβ clearance to AD pathology remains unclear, as no BBB-specific knockout models have been available. Here, we developed transgenic mouse strains that allow for tamoxifen-inducible deletion of Lrp1 specifically within brain endothelial cells (Slco1c1- CreERT2 Lrp1fl/fl mice) and used these mice to accurately evaluate LRP1-mediated Aβ BBB clearance in vivo. Selective 125 deletion of Lrp1 in the brain endothelium of C57BL/6 mice strongly reduced brain efflux of injected [ I] Aβ1–42. Additionally, in the 5xFAD mouse model of AD, brain endothelial–specific Lrp1 deletion reduced plasma Aβ levels and elevated soluble brain Aβ, leading to aggravated spatial learning and memory deficits, thus emphasizing the importance of systemic Aβ elimination via the BBB. Together, our results suggest that receptor-mediated Aβ BBB clearance may be a potential target for treatment and prevention of Aβ brain accumulation in AD.
    [Show full text]
  • Immuno 2014 No. 1
    Journal of Blood Group Serology and Molecular Genetics VOLUME 30, N UMBER 1, 2014 Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 30, Number 1, 2014 CONTENTS R EPORT 1 Indirect antiglobulin test-crossmatch using low-ionic-strength saline–albumin enhancement medium and reduced incubation time: effectiveness in the detection of most clinically significant antibodies and impact on blood utilization C.L. Dinardo, S.L. Bonifácio, and A. Mendrone, Jr. R EV I EW 6 Raph blood group system M. Hayes R EPORT 11 I-int phenotype among three individuals of a Parsi community from Mumbai, India S.R. Joshi C A SE R EPORT 14 Evans syndrome in a pediatric liver transplant recipient with an autoantibody with apparent specificity for the KEL4 (Kpb) antigen S.A. Koepsell, K. Burright-Hittner, and J.D. Landmark R EV I EW 18 JMH blood group system: a review S.T. Johnson R EPORT 24 Demonstration of IgG subclass (IgG1 and IgG3) in patients with positive direct antiglobulin tests A. Singh, A. Solanki, and R. Chaudhary I N M EMOR ia M 28 George Garratty, 1935–2014 Patricia A. Arndt and Regina M. Leger 30 A NNOUNCEMENTS 34 A DVERT I SEMENTS 39 I NSTRUCT I ONS FOR A UTHORS E D I TOR - I N -C H I EF E D I TOR ia L B OA RD Sandra Nance, MS, MT(ASCP)SBB Philadelphia, Pennsylvania Patricia Arndt, MT(ASCP)SBB Paul M. Ness, MD Pomona, California Baltimore, Maryland M A N AG I NG E D I TOR James P.
    [Show full text]
  • In Vitro Selection for Adhesion of Plasmodium Falciparum-Infected Erythrocytes to ABO Antigens Does Not Affect Pfemp1 and RIFIN
    www.nature.com/scientificreports OPEN In vitro selection for adhesion of Plasmodium falciparum‑infected erythrocytes to ABO antigens does not afect PfEMP1 and RIFIN expression William van der Puije1,2, Christian W. Wang 4, Srinidhi Sudharson 2, Casper Hempel 2, Rebecca W. Olsen 4, Nanna Dalgaard 4, Michael F. Ofori 1, Lars Hviid 3,4, Jørgen A. L. Kurtzhals 2,4 & Trine Staalsoe 2,4* Plasmodium falciparum causes the most severe form of malaria in humans. The adhesion of the infected erythrocytes (IEs) to endothelial receptors (sequestration) and to uninfected erythrocytes (rosetting) are considered major elements in the pathogenesis of the disease. Both sequestration and rosetting appear to involve particular members of several IE variant surface antigens (VSAs) as ligands, interacting with multiple vascular host receptors, including the ABO blood group antigens. In this study, we subjected genetically distinct P. falciparum parasites to in vitro selection for increased IE adhesion to ABO antigens in the absence of potentially confounding receptors. The selection resulted in IEs that adhered stronger to pure ABO antigens, to erythrocytes, and to various human cell lines than their unselected counterparts. However, selection did not result in marked qualitative changes in transcript levels of the genes encoding the best-described VSA families, PfEMP1 and RIFIN. Rather, overall transcription of both gene families tended to decline following selection. Furthermore, selection-induced increases in the adhesion to ABO occurred in the absence of marked changes in immune IgG recognition of IE surface antigens, generally assumed to target mainly VSAs. Our study sheds new light on our understanding of the processes and molecules involved in IE sequestration and rosetting.
    [Show full text]