Expression of Calbindin-D28K in Motoneuron Hybrid Cells After Retroviral Infection with Calbindin-D28K Cdna Prevents Amyotrophic
Total Page：16
File Type：pdf, Size：1020Kb
Proc. Natl. Acad. Sci. USA Vol. 93, pp. 6796-6801, June 1996 Medical Sciences Expression of calbindin-D28K in motoneuron hybrid cells after retroviral infection with calbindin-D28K cDNA prevents amyotrophic lateral sclerosis IgG-mediated cytotoxicity (calcium-binding proteins/motoneuron degeneration) BAO-KUAN Ho*, MARIA E. ALEXIANU*, Luis V. COLOM*, A. HABIB MOHAMED*, FERNANDO SERRANOt, AND STANLEY H. APPEL*- Departments of *Neurology and tMolecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030 Communicated by Salih J. Wakil, Baylor College of Medicine, Houston, TX, February 27, 1996 (received for review October 30, 1995) ABSTRACT Calbindin-D28K and/or parvalbumin appear follows: total RNA was extracted from rat brain by the to influence the selective vulnerability of motoneurons in guanidinium/cesium chloride method (8). Poly(A)+ RNA was amyotrophic lateral sclerosis (ALS). Their immunoreactivity purified by oligo(dT) cellulose (Collaborative Research, Bed- is undetectable in motoneurons readily damaged in human ford, MA) affinity chromatography. The entire coding se- ALS, and in differentiated motoneuron hybrid cells [ventral quence (786 bp) of calbindin-D28K was synthesized from the spinal cord (VSC 4.1 cells)] that undergo calcium-dependent poly(A)+ RNA by reverse transcriptase (GIBCO/BRL)- apoptotic cell death in the presence ofALS immunoglobulins. polymerase chain reaction (PCR, Perkin-Elmer/Cetus) and To provide additional evidence for the role of calcium-binding cloned into the BamHI site of plasmid pGEM-3Z (Promega). proteins in motoneuron vulnerability, VSC 4.1 cells were The sequences of the oligomers for PCR are TTCGGATCC- infected with a retrovirus carrying calbindin-D28K cDNA ATGGCAGAATCCCACCTGCA for the 5' forward primer under the control of the promoter of the phosphoglycerate and AAAGGATCCTAGTTGTCCCCAGCAGAGAGAAT kinase gene. Differentiated calbindin-D28K cDNA-infected for the 3' reverse primer (the oligomers were synthesized at the cells expressed high calbindin-D28K and demonstrated in- Department of Cell Biology, Baylor College of Medicine). A creased resistance to ALS IgG-mediated toxicity. Treatment clone containing the correct complete calbindin-D28K se- with calbindin-D28K antisense oligodeoxynucleotides, which quence was identified by dideoxynucleotide sequencing (9). significantly decreased calbindin-D28K expression, rendered The calbindin-D28K cDNA was obtained from the clone these cells vulnerable again to ALS IgG toxicity. pGEM-calbindin by BamHI digestion and cloned into the SmaI site of pPGKbpA (derived from pPGKneo) after fill- Despite extensive investigations of superoxide dismutase mu- ing-in of ends by treatment with the Klenow fragment of DNA tations in familial amyotrophic lateral sclerosis (ALS) and polymerase I (Promega). As shown in Fig. 1, this enabled excitotoxicity and autoimmunity in sporadic ALS, our under- insertion of the calbindin-D28K cDNA downstream of the PGK standing of the factors dictating selective vulnerability of promoter/enhancer sequence and upstream of a polyadeny- motoneurons are incompletely understood (1-5). Calbindin- lylation signal of the growth hormone gene. Orientation of the D28K and/or parvalbumin have been implicated in ALS patho- cDNA was determined by digestion with EcoRI. The resulting genesis since immunoreactivity for these calcium binding construct was digested with XhoI, treated with Klenow poly- proteins is absent in neurons early and severely affected in merase, and subsequently, digested with HindIII. The resulting ALS such as ventral horn motoneurons and is present in mixture of fragments were ligated into Stul- and HindlIl- neurons late or infrequently affected such as oculomotor digested vector pStMCS. The plasmid pStMCS (kindly pro- neurons or Onufs neurons (6, 7). In addition, motoneuron vided by John Belmont, Baylor College of Medicine, Houston, hybrid cells that are selectively killed by ALS IgG have little or TX) is a retroviral vector, containing Moloney murine leuke- absent immunoreactivity for calbindin-D28K and parvalbumin mia virus long terminal repeats. The orientation of the calbi- whereas cells not affected by ALS IgG, including undifferen- ndin expression cassette is opposite to that of the long terminal tiated motoneuron hybrid cells and the parent neuroblastoma repeat sequences in the final pStMCS-PGK-calbindin (pSt- N18TG2 cells, have high levels of calbindin-D28K and parval- MCS-PCalb) plasmid (Fig. 1). bumin (7). Production of Recombinant Retrovirus and Infection of We report herein that retroviral infection of motoneuron VSC 4.1 Cells with Calbindin-D28K-Expressing Retrovirus. hybrid cells with calbindin-D28K cDNA induces increased The plasmid pPGKneo and the ecotropic virus packing cell calbindin-D28K expression that is maintained after cAMP line GP+E86 were provided by John Belmont. Cells were differentiation and prevents ALS IgG-induced toxicity. Con- cultured in Dulbecco's modified Eagle's medium (DMEM) versely, inhibition ofcalbindin-D28K expression by treatment of with 10% fetal calf serum in 10% C02/90% air. calbindin-D28K-infected ventral spinal cord (VSC) 4.1 cells Twenty micrograms of pStMCS-PCalb and 1 ,g of pPGK- (I-VSC 4.1 cells) with calbindin-D28K antisense oligode- neo were cotransfected into 3.5 x 106 ecotropic packing GP + oxynucleotides restores vulnerability to ALS IgG-mediated E86 cells by electroporation (Invitrogen electroporator II) at toxicity. oofl, 1000 AF, and 280 V. Transfection efficiency varied from 7 to more than 200 neomycin-resistant clones per electropo- ration. Several hundred neomycin (GIBCO/BRL, 4 ,ug/ml)- MATERIALS AND METHODS resistant clones were obtained. The recombinant virus pro- Construction of pStMCS-PCalb for Retrovirus Packaging. The calbindin-D28K cDNA was cloned from rat brain as Abbreviations: ALS, amyotrophic lateral sclerosis; ODN, oligode- oxynucleotides; PGK, phosphoglycerate kinase; VSC, ventral spinal cord. The publication costs of this article were defrayed in part by page charge *To whom reprint requests should be addressed at: Department of payment. This article must therefore be hereby marked "advertisement" in Neurology, Baylor College of Medicine, 6501 Fannin, NB302, Hous- accordance with 18 U.S.C. §1734 solely to indicate this fact. ton, TX 77030. 6796 Mvedical Sciences: Ho et al. Proc. Natl. Acad. Sci. USA 93 (1996) 6797 the coding region for amino acids 31-41 of the calbindin-D28K gene sequence (12). The 5'-3' sequence of the antisense ODN used was CTGGATCAAGTTCTGCAGCTCCTTTCCT- TCCAG. The hybridization was performed by the instructions in the Amersham kit. The in situ buffer provided by Amersham contained 50% formamide, 2x SSC, 1 x Denhardt's solution, herring testes DNA (300 gxg/ml), and an enhancement com- pound. Fifty microliters of hybridization solution with a final probe concentration of 50 ng/ml was applied on each coverslip and the incubation was performed for 5 h at 37°C. The slides were washed in lx SSC/0.1% SDS at room temperature and then in 0.2x SSC/0.1% SDS at 37°C. Signal was detected with a biotinylated anti-fluorescein antibody (Molecular Probes) followed by avidin-biotin complex (Vector Laboratories) and 3,3'-diaminobenzidine (Sigma). Control experiments were carried out to assure the speci- ficity of the probes and the appropriateness of the hybridiza- tion conditions and detection methods as follows: To control for the specificity of the effect of calbindin-D28K expression, we investigated the levels of mRNA for a cytoskeletal protein FIG. 1. Construction of retroviral vector for expression of the (heavy-chain neurofilament) (13) and for another calcium- calbindin-D28K gene under the regulation of the promoter of the kinase binding protein normally expressed in VSC 4.1 cells (parval- phosphoglycerate (PGK) gene. bumin) (14). Experimental procedures performed with fluo- duced by transient expression of the infected GP + E86 cells rescein-labeled sense ODN, complementary to the antisense was harvested after 48 h from conditioned medium by filtra- probes for calbindin-D28K, parvalbumin, and neurofilament, tion through 0.45-,um (pore size) Millipore filters. As this virus respectively, or experiments without the hybridization buffer, does not a selectable marker, we the diluted or omitting the antibody against fluorescein resulted in com- carry amplified absence of supernatant by ping-pong infection in a mixture of 50% GP + plete any signal. envAml2 and 50% GP + E86 cells and titrated the virus by Cell Culture Conditions and Assessment of the Effects scoring the wells positive to retroviral sequences by PCR. The Produced by Calbindin-D28K Gene Transfection. General cell VSC 4.1 cells were infected to virus with a titer of growth, cAMP, and aphidocolin differentiation conditions as by exposure well as the for and 106 virus particles per ml for 4 h in the presence of Polybrene preparation survival/cytotoxicity assays at 4 neutralize cell surface the immunohistochemical experiments were performed as de- ,Lg/ml (to charge). Among scribed in our studies 15, multiple PGK-calbindin retrovirus-infected cell lines, we have previous (7, 16). chosen the line named I-VSC 4.1, since after differentiation To reverse the effect of calbindin-D28K gene transfection, with cAMP and the level of calbindin the I-VSC 4.1 cells were treated after differentiation with 20 dibutyryl aphidocolin, ,iM calbindin-D28K antisense oligodeoxynucleotides (Geno- immunoreactivity did not decrease as it does in noninfected VSC 4.1 cells. We have used the