(Sylvilagus Transitionalis) and Cross‑Amplifcation in the Eastern Cottontail (S

King et al. BMC Res Notes (2017) 10:741 https://doi.org/10.1186/s13104-017-3062-2 BMC Research Notes

RESEARCH NOTE Open Access Microsatellite marker development from next‑generation sequencing in the New England cottontail (Sylvilagus transitionalis) and cross‑amplifcation in the eastern cottontail (S. foridanus) Timothy L. King1, Michael Eackles1, Aaron Aunins2*, Thomas J. McGreevy Jr.3, Thomas P. Husband3, Anthony Tur4 and Adrienne I. Kovach5

Abstract Objective: The New England cottontail (Sylvilagus transitionalis) is a species of high conservation priority in the Northeastern United States, and was a candidate for federal listing under the Endangered Species Act until a recent decision determined that conservation actions were sufcient to preclude listing. The aim of this study was to develop a suite of microsatellite loci to guide future research eforts such as the analysis of population genetic structure, genetic variation, dispersal, and genetic mark-recapture population estimation. Results: Thirty-fve microsatellite markers containing tri- and tetranucleotide sequences were developed from shotgun genomic sequencing of tissue from S. transitionalis, S. obscurus, and S. foridanus. These loci were screened in n 33 wild S. transitionalis sampled from a population in eastern Massachusetts, USA. Thirty-two of the 35 loci were polymorphic= with 2–6 alleles, and observed heterozygosities of 0.06–0.82. All loci conformed to Hardy–Weinberg Equilibrium proportions and there was no evidence of linkage disequilibrium or null alleles. Primers for 33 of the 35 loci amplifed DNA extracted from n 6 eastern cottontail (S. foridanus) samples, of which nine revealed putative species-diagnostic alleles. These loci =will provide a useful tool for conservation genetics investigations of S. transitionalis and a potential diagnostic species assay for diferentiating sympatric eastern and New England cottontails. Keywords: Microsatellites, Cross-amplifcation, Sylvilagus transitionalis, Sylvilagus foridanus, Sylvilagus obscurus, Next- generation sequencing

Introduction [5]. Remnant New England cottontail populations are Te New England cottontail (Sylvilagus transitionalis) is found today in < 14% of the species’ historical range a narrow niche specialist that relies on the dense under- and occur in fve geographically and genetically distinct story vegetation of early successional or shrubland habi- populations located in southern Maine and southeast- tats [1]. Tese ephemeral habitats have declined steeply ern New Hampshire, central New Hampshire, eastern in recent decades in the Northeastern United States Massachusetts on Cape Cod, eastern Connecticut and [2–4]. As a result, many shrubland species, including the Rhode Island, and western Connecticut and New York New England cottontail, face severe population declines [5]. Within these areas, cottontails face the consequences of population isolation and loss of genetic diversity [6, 7]. *Correspondence: [email protected] As a result of uncertainty in long-term species’ viability, 2 Natural Systems Analysts, Leetown Science Center, 11649 Leetown the New England cottontail is a high priority for conser- Road, Kearneysville, WV 25430, USA Full list of author information is available at the end of the article vation in the Northeastern United States. To help recover

© The Author(s) 2017. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. King et al. BMC Res Notes (2017) 10:741 Page 2 of 7

the species, state and Federal natural resource managers A universal M13 sequence was added to the 5′ end of collaborated with academicians and other stakehold- either the forward or reverse primer of each primer pair ers to develop and implement a conservation strategy to enabling an M13 FAM labeled fuorescent dye comple- improve the outlook for the species [8]. As a result, the mentary to the universal tail to be incorporated into the United States Fish and Wildlife Service determined list- polymerase chain reaction (PCR) product [13]. Polymer- ing of the species under the Endangered Species Act was ase chain reactions were performed in 25 μl volumes, no longer warranted [9]. Despite this decision, much consisting of 10 ng of DNA, 1 X PCR Bufer (Promega, uncertainty remains about the species’ viability and pop- Madison, WI), 0.25 μM of labeled forward primer, ulation status [7, 10]. To evaluate the efectiveness of the 0.5 μM of unlabeled reverse primer, 0.1 μM of labeled conservation strategy and inform adaptive modifcations M13, 2.0 mM MgCl 2, 0.2 mM of each dNTP, 0.25 units/μl to improve outcomes, extensive population monitoring Bovine Serum Albumin (New England Biolabs, Ipswich, and research into population structure and genetic diver- MA), and 0.06 units/μl of Taq polymerase (Promega), sity are needed [8]. To this end, our goal was to develop a using the following cycling conditions: 94 °C for 15 min, suite of microsatellite markers to aid future conservation 29 cycles of 94 °C for 1 min, 58 °C for 45 s, and 72 °C for genetics research on the New England cottontail as well 45 s, 5 cycles of 94 °C for 1 min, 52 °C for 45 s, and 72 °C as other Sylvilagus species. for 45 s, all followed by 72 °C for 10 min. PCR products for each locus were electrophoresed separately on an ABI Main text 3130 Genetic Analyzer (TermoFisher Scientifc) auto- Methods mated DNA sequencer. Alleles were called using Gen- For microsatellite marker development, total genomic eMapper (ver. 4) (TermoFisher Scientifc) following the DNA was extracted from tissue samples obtained from protocols described in [14]. 13 New England cottontail, one eastern cottontail (S. Loci that amplifed consistently and were easily score- foridanus), and two Appalachian cottontail (S. obscurus) able on the sample of n = 8 wild New England cottontails using the DNEasy Blood and Tissue kit (Qiagen, Ger- were then tested on DNA extracted from an additional mantown, MD). We chose to sequence multiple species sample of n = 33 New England cottontails from a wild to maximize the number of microsatellites available for population in eastern Massachusetts, on Cape Cod. In screening in the target species S. transitionalis. Sequenc- addition, DNA extracted from a sample of n = 6 sympa- ing libraries were created from these genomic DNA sam- tric eastern cottontails, also collected from eastern Mas- ples for sequencing on the Ion Torrent PGM and Ion sachusetts were tested for cross-species amplifcation. Proton (TermoFisher Scientifc, Frederick, MD). For each sequencing library, the extracted DNA was quanti- Data analyses fed with a Nanodrop spectrophotometer (TermoFisher Genotype data from the Cape Cod New England cot- Scientifc), and 100 ng of DNA from each individual was tontail collection (n = 33) were analyzed for null alleles, used for construction of multiple 200 base pair libraries large allele dropout, and scoring errors using MICRO- following the manufacturer’s protocol. For libraries with CHECKER (ver 2.2.3) [15]. Genetic diversity and het- multiple individuals in one run, equimolar proportions of erozygosity were quantifed using GenAlEx 6.5 [16, 17]. each library were pooled prior to chip loading. Exact tests in GENEPOP [18] were used to determine Sequence reads from each completed run were if genotypes at each locus conformed to Hardy–Wein- imported into Qiagen CLC Genomics Workbench (ver. berg equilibrium (HWE). Multi-locus tests of conform- 7) for processing. Reads were length trimmed to a mini- ance to HWE were completed using Fisher’s method in mum size of 30 bp, and the quality trimming threshold GENEPOP. Linkage disequilibrium (LD) was tested for was set to 0.01 corresponding to a Phred score of 20. all pairs of loci using contingency tables in GENEPOP. Sequence reads from each of the 5 separate runs were All tests of HWE and LD tests in GENEPOP used the then screened individually for all possible di-, tri-, tetra, default Markov chain parameters. Signifcance levels for penta-, and hexanucleotide microsatellite repeat motifs HWE and LD tests were adjusted using the sequential with a minimum repeat length of fve with the program Bonferroni correction [19]. QDD (ver. 3) [11]. Primers were designed for each puta- To evaluate the utility of these loci for population tive microsatellite locus within QDD using the integrated genetic studies, multiple analyses were performed with PRIMER 3 code [12]. Seventy-fve tri- and tetra nucleo- the n = 33 New England cottontail collection. All multi- tide loci identifed by QDD with predicted amplifed locus genotypes were subjected to analysis via GENECAP lengths between 100 and 250 bp were selected for screen- [20] to identify matching samples, calculate match prob- ing within a collection of n = 8 wild-caught New Eng- abilities, and estimate the sibling probability of identity land cottontails sampled from across the species range. (PIsibs) [21]. To assess the randomness of the collection King et al. BMC Res Notes (2017) 10:741 Page 3 of 7

(e.g., to ensure the collection did not consist of a small and therefore all individuals from the n = 33 collection number of families), we analyzed for the presence of full- were retained for subsequent analyses. Tree loci were sibling families using the program COLONY v2.0 [22]. monomorphic in the Massachusetts wild New England Settings for COLONY analyses included the assumption cottontail population, while the remaining 32 loci aver- of male and female polygamy, no per locus genotyping aged 3.1 alleles per locus (range 2–6; Table 1). Unique error information, no inbreeding, long run length with multilocus genotypes were generated for each individ- −8 full likelihood analysis, high likelihood precision, no ual with the probability of 6.4 × 10 that two siblings allele frequency updates, and no sibship prior. Individ- would share identical genotypes (PIsibs; [21]). Expected ual New England cottontails were analyzed as ofspring heterozygosity (He) ranged widely across loci from 6.0% without assignment of individuals as candidate males (StrQ23, StrQ48) to 75.0% (StrQ30) and averaged 47.0% (fathers) or females (mothers), as these data were not for the Massachusetts wild New England cottontail popu- available. While the inference of family relationships is lation. Tests for conformance to HWE revealed that locus weakened in this situation with no sex, age, relationship StrQ19 was not in HWE (P = 0.016), though this result information, and the assumption of polygamy for both did not remain signifcant after sequential Bonferroni sexes, COLONY is predicted to be more accurate than correction. In addition, no statistically signifcant linkage pairwise estimates of relationships [22]. Statistical signif- disequilibrium (GENEPOP) was detected after sequential cance of any full-sib relationships was assessed through Bonferroni correction. the P values reported by COLONY. Within a sample of COLONY estimated the Ne (and 95% confdence lim- individuals taken at random (with respect to kin) from a its) for the Massachusetts collection to be 48 (30–80), population, the frequencies of full and half sib dyads can and BOTTLENECK indicated a statistically signifcant be used to estimate the current efective size (Ne) of the heterozygote excess for the Massachusetts collection population. Terefore, COLONY was also used to esti- (P < 0.001; Wilcoxon signed-rank test), suggesting a mate Ne and associated 95% confdence interval utilizing recent reduction in the efective population size. Tese the estimates from the sibship assignment full likelihood results are consistent with previous work, showing that method. To estimate whether the Ne has remained con- New England cottontails in eastern Massachusetts have stant (i.e., achieved mutation-drift equilibrium; see [23]), low efective population sizes and have undergone a we conducted analyses with BOTTLENECK [24], imple- recent population decline [6, 26]. menting a two-phased model of mutation (5% IAM; 95% All but two loci amplifed in the eastern cottontail SMM; [25]). Statistical signifcance of the BOTTLE- samples, and an additional three loci were monomor- NECK analyses was determined with a Wilcoxon signed- phic (including two that were also monomorphic in New rank test performed by the software. England cottontails). Te remaining 30 loci had two to six alleles in eastern cottontail. Eight polymorphic loci Results and discussion (StrQ23, Str25, Str41, Str42, Str43, Str44, Str48, and Within the 44,084,987 million sequence reads analyzed Str63) had species-specifc amplifcation patterns with across fve runs of the Ion Torrent PGM and Ion Pro- no overlapping alleles across the screened individuals. ton platforms, 1,420,351 million were identifed by QDD In additional, StrQ72 was monomorphic for a diferent software as containing microsatellites using our chosen allele in each species. Tese results suggest a subset of fltering criteria. Of the 75 loci selected from among these loci will be useful as a diagnostic screening tool for these sequences for screening in the sample of n = 8 New samples collected during noninvasive genetic monitoring England cottontails, all but three amplifed consistently. surveys [10, 27]. However, more extensive testing of sam- An additional 24 loci were monomorphic. Of the remain- ples throughout the range where New England cottontail ing 48 loci, 17 had two alleles, 16 had three alleles, 10 and eastern cottontail are sympatric is needed to confrm had four alleles, three had fve alleles, and two had seven these results. alleles. From this set of loci, we selected the 35 most pol- In conclusion, the markers developed in this study ymorphic, including all with three to seven alleles and could prove useful for future population monitoring and a few with two alleles for additional testing in the wild conservation genetics research of New England cotton- collection of n = 33 New England Cottontails and n = 6 tail. Te high discriminatory power of these loci indi- eastern cottontails from the same population to test for cate that they will be particularly useful for noninvasive cross-specifc amplifcation. Te primer sequences of genetic surveys, where robust individual identifcation these 35 loci are provided in Table 1. from a small panel of markers is required. Further, the Microchecker reported no instances of large allele cross amplifcation in eastern cottontails will facilitate dropout or scoring errors. Analyses of family structure in use of these markers in this species as well as possibly COLONY indicated the presence of no full sibling dyads, others in the Sylvilagus genus. King et al. BMC Res Notes (2017) 10:741 Page 4 of 7 Number of alleles in S. foridanus 0 5 5* 4 6 5 4 5 5 0 5 6 4 4 6 3 6 3 3* 4 N/A 0.436 0.726 0.631 0.107 0.806 1.000 0.623 0.813 0.184 1.000 1.000 0.110 0.677 0.173 0.016 1.000 0.484 1.000 0.752 P value N/A 0.02 0.08 0.09 0.08 0.04 0.12 0.01 0.32 0.13 F − 0.04 − 0.03 − 0.02 − 0.03 − 0.08 − 0.07 − 0.11 − 0.12 − 0.03 − 0.03 o H 0.73 0.46 0.30 0.61 0.65 0.39 0.64 0.66 0.00 0.47 0.15 0.12 0.58 0.64 0.58 0.31 0.39 0.42 0.06 0.61 e 0.75 0.50 H 0.30 0.68 0.71 0.39 0.63 0.65 0.00 0.50 0.14 0.12 0.67 0.58 0.59 0.47 0.36 0.50 0.06 0.60 e 3.8 2.0 1.4 3.0 A 3.4 1.6 2.7 2.8 1.0 2.0 1.2 1.1 2.9 2.4 2.4 1.9 1.5 2.0 1.1 2.4 6 2 3 5 A 5 2 4 6 1 4 2 2 5 3 3 3 2 2 2 4 102–138 130–134 127–135 129–153 Allele size size Allele range 144–160 116–122 142–154 149–169 200 120–132 188–192 132–135 177–193 144–152 215–221 154–166 201–217 188–192 207–211 200–212 KX530837 KX530838 KX530833 KX530819 Genbank accession Genbank accession number KX530834 KX530820 KX530835 KX530821 KX530836 KX530822 KX530823 KX530824 KX530825 KX530826 KX530827 KX530828 KX530829 KX530830 KX530831 KX530832 AAGG AAGG AGAT AGC Repeat motif Repeat AAGG ACT AAGG AGAT AAGG AGAT ATCC ATC AGAT AGAT ACT ATCC ATCC ATCC AGAT AGAT CACTCCTGACTCGT n = 6 S. foridanus in and cross-amplifcation transitionalis loci in n = 33 Sylvilagus Characteristics of 35 microsatellite F* TGCATATTTGTCTTTCATTCTCTGA R: AACAATGACAAATTACACAGCCA R: CCTCTTTCTCTCACTAATGCTGTT CCTTCTATTCCTTCTTTCTTCCTTC R: F: *TGTCTGGCTTATGAGAAAGGG F: R: ACTGCGGGACTTCATACTGC Primer sequences Primer F: *TCAAGCACAGAACAGAGCAG F: - R: CCTACAG F* CCTCTCTGAAACTATGCCTTTC F: *TCGCTCTCTGTCTCTGCCTT R: GCCTGCACTCTCTAGCTTGG F:*TTCATCATCTTGTTATTTCATAGAGAA R: TGGAGCTCTTGGAGTCTAATGTG F: *TCCTGCCTTTGAGAGCATTTF: R: TGGGTGATGCCTCACTTAAT F: *GGAAGAAAGGAAGAAAGGAAGA F: R: GGAGACTTGGATTGAATTCTGG F: TGATAGGAAGGTAAGTCAGTGGG F: R: *TGCTCTCAAGAACCCAGGAG F:*CTTAATTGTAAGGAGGGTAGGAAA F: *ATCGAATTTCGTCTGCATCC F: R: AAGGGTAGCTCTCAAACACCA F: TGATTCGGAGTGGTTATGAAGA F: R: *ATTGCAATGCCCAACACTG F: *GATGGTGGATAAGATAGAGGACA F: R: TATGGCTGGACCACACTCTG F: *CAGATTGACGTTGAGCAGA F: R: TGCTTGCCTCTTTCAAATAAA F: *ACTCAGAGATAATGCACCAAA F: R: AAGGGTTAGATGGCAAGGGT F: ACCATCCATGACTGGTGAAA F: R: *GCACATGGGACATAGAAGGC F: TGATTGCCCAGAGAATTAGTACC F: R: *AGGTCTTCAGACTCACTCTGGT F: *TTCAATTTGCACCAAGAAGC F: R: CACAAGGTAGCATACTGTGGC F: *AGCCTGCATCCTTTAGGG F: R: GCATAAAGGTTAATGAATAAGATTGC F: TGCGACTATTTCCAAAGCAT F: R: *TTGTTAGTTTCTCACAGTGCTGC StrQ2 1 Table Locus StrQ31 StrQ26 StrQ7 StrQ27 StrQ8 StrQ28 StrQ10 StrQ30 StrQ11 StrQ12 StrQ15 StrQ16 StrQ18 StrQ19 StrQ20 StrQ21 StrQ23 StrQ24 StrQ25 King et al. BMC Res Notes (2017) 10:741 Page 5 of 7 ), e (A Number of alleles in S. foridanus 3* 1 5 4* 4 3* 6 4* 2 1 3 2* 1 2* 2 N/A N/A 0.468 0.768 0.253 0.415 0.637 0.123 0.551 0.135 0.359 1.000 0.178 0.467 1.000 P value N/A N/A 0.18 0.04 0.05 0.28 0.06 0.29 0.14 0.10 F − 0.15 − 0.13 − 0.20 − 0.03 − 0.12 o H 0.42 0.00 0.61 0.82 0.58 0.55 0.24 0.24 0.33 0.00 0.70 0.06 0.58 0.21 0.24 e H 0.52 0.00 0.64 0.72 0.62 0.49 0.34 0.26 0.48 0.00 0.59 0.06 0.68 0.24 0.22 e 2.1 1.0 2.7 A 3.5 2.5 1.9 1.5 1.3 1.9 1.0 2.4 1.1 3.0 1.3 1.3 4 1 5 A 4 3 3 2 2 2 1 6 2 4 2 3 196–216 136 182–198 Allele size size Allele range 120–132 148–156 218–230 94–106 230–234 192–196 124 120–144 118–122 120–132 126–130 246–254 KX530843 KX530853 KX530839 Genbank accession Genbank accession number KX530844 KX530840 KX530845 KX530841 KX530846 KX530842 KX530847 KX530848 KX530849 KX530850 KX530851 KX530852 AAGG AATC AAGG Repeat motif Repeat AAGG AAGG AAGG AAGC AAGG AAGC AAGG AACT AACC AAAT AATT AATG value reported across loci from Genepop using Fisher’s Genepop using Fisher’s loci from reported is the P value P value across Hardy–Weinberg The the GenAlEx software. output by index (F) were ), and fxation o (H ), observed heterozygosity e (H continued F: *CCCTCTCTGTAACTCTGTCTTTCA R: TGAGGTACATTCAGCAGCCA F: *GCCTCTGCTTCTCTGTAACTTTG R: GGTTGGGAGGAGGCTTAGAG F:*TGTAACTCTGCCTTCCAAATAAATAA R: GGCTGTTTAACTTGCCATGC Primer sequences Primer F:*AGAAATAAAGAATAGCTTGGATAAATG R: CCTTCCTTCGTTCCTTCGTT F:*TTAGAACGAACAAGAAAGAAAGAAA R: TCAAGTGGGAAAGGAATATCAA F: *GTATCTGCCGAATGAAGTGGA F: R: TAGGTACAGATAATTCACTTTGGACA F: *TTGTATGTGAACTTTGCACCG F: R: CACAGTCTAACTCTATCTGTCAAGAAA F:*TTATTTATTGGAAAGGTAGATAGGTGA R: TGGGTTATTGGCACTCACAA F: *TCAAAGCACTTAATTCAAATCCC F: R: GTCTCTCCAAGCCTCCTCCT F: *CGACTAGGATAAATGCCACAGA F: R: CCCAATCCCTACACAACTAACAC F:*AAATGAGGAATATTTGTTGAATGC R: AGAATGAACCAGCAAATGGG F: *GGGTTTGATGCTGAGGTCC F: R: TACATCCAGTGCACATTCGC F: *ATCTTAGTGGAGAGAGTGGCTTG F: R: AAGTTCACCAGGCTAACTAGAGGA F:*AAACAAGGAGATGTCACAGTAGTTTAG R: CATCCCTCTCTGTAACCTTGACTT F: *TCTTGTCAAGTTTGTAACATGTGC F: R: TCAGCTTAACCCACTGTGCC unbiased heterozygosity unbiased heterozygosity StrQ32 1 Table Locus number of alleles efective number of alleles (A), The which primer tagged with an M13 tail. was with a * denote sequences Primers sequence. containing the microsatellite to the name assigned to refers Locus , where a * denotes a putatively species specifc amplifcation pattern not observed pattern species specifc amplifcation in S. transitionalis a putatively each locus observed a * denotes the number of alleles at , where in S. foridanus refers Number of alleles in S. foridanus The method. StrQ42 StrQ34 StrQ43 StrQ37 StrQ44 StrQ39 StrQ45 StrQ41 StrQ46 StrQ48 StrQ49 StrQ63 StrQ67 StrQ72 King et al. BMC Res Notes (2017) 10:741 Page 6 of 7

Limitations University Mammal Museum from a historical sample collected in 1998. Tissue samples of S. foridanus were provided by Anthony Tur of the USFWS, whom Tese loci have been thoroughly screened in one of the obtained the samples from licensed hunters. geographically distinct populations of New England cot- Funding tontails. Given efects of population isolation and genetic Funding for this study was provided by a U.S. Fish and Wildlife Service—U.S. drift, it is likely that these markers may have diferent lev- Geological Survey Science Support Partnership Grant. els of polymorphism or null alleles in other geographic populations across the species range. Future work should Publisher’s Note screen the loci carefully in each geographic area prior Springer Nature remains neutral with regard to jurisdictional claims in pub- to embarking on a new study. In addition, while we did lished maps and institutional afliations. not assess the genotyping error rate for these loci, future Received: 31 August 2017 Accepted: 2 December 2017 studies using them could measure this parameter to ensure accuracy of the genotype data. Authors’ contributions TLK performed bioinformatics analyses, helped conceive the study, and References helped draft the manuscript. He passed away before completion of the 1. Litvaitis JA. Response of early successional vertebrates to historic changes fnal draft. His contributions to the feld of conservation genetics are noted, in land use. Conserv Biol. 1993;7:866–73. and he will be missed. ME carried out the high throughput sequencing and 2. Litvaitis JA. Are pre-Columbian conditions relevant baselines for laboratory screening of the markers and helped draft the manuscript. TJM managed forest in the northeastern United States? For Ecol Manag. helped in the development of the study, conducted quality control screening 2003;185:113–26. of the markers and helped write the manuscript. AA performed bioinformatic 3. Bufum W, McWilliams SR, August PV. A spatial analysis of forest man- analyses and helped write the manuscript. TPH helped in the development agement and its contribution to maintaining the extent of shrubland of the study, secure funding for the project, and provided samples. AT helped habitat in southern New England, United States. For Ecol Manag. in the development of the study, assisted with sample collection, and edited 2011;262:1775–85. the manuscript. AIK helped conceive the study and write the manuscript. All 4. King DI, Schlossberg S. Synthesis of the conservation value of the early authors read and approved the fnal manuscript. successional stage in forests of eastern North America. For Ecol Manag. 2014;324(1):86–195. Author details 5. Litvaitis JA, Tash JP, Litvaitis MK, Marchand MN, Kovach AI, Innes R. A 1 U.S. Geological Survey, Leetown Science Center, 11649 Leetown Road, Kear- range-wide survey to determine the current distribution of New England neysville, WV 25430, USA. 2 Natural Systems Analysts, Leetown Science Center, cottontails. Wildl Soc Bull. 2006;34:1190–7. 11649 Leetown Road, Kearneysville, WV 25430, USA. 3 Department of Natural 6. Fenderson LE, Kovach AI, Litvaitis JA, Litvaitis MK. Population genetic Resources Science, University of Rhode Island, 1 Greenhouse Road, Kingston, structure and history of fragmented remnant populations of the RI 02881, USA. 4 United States Fish and Wildlife Service, 300 Westgate Center New England cottontail (Sylvilagus transitionalis). Conserv Genet. Drive, Hadley, MA 01035, USA. 5 Department of Natural Resources and the 2011;12:943–58. Environment, University of New Hampshire, 56 College Road, Durham, NH 7. Fenderson LE, Kovach AI, Litvaitis JA, O’Brien KM, Boland KM, Jakubas 03824, USA. WR. A multiscale analysis of gene fow for the New England cottontail, an imperiled habitat specialist in a fragmented landscape. Ecol Evol. Acknowledgements 2014;4:1853–75. Mary Sullivan (University of Rhode Island) helped process New England cot- 8. Fuller S, Tur A. Conservation strategy for the New England cottontail tontail samples. We would like to thank the following individuals and their (Sylvilagus transitionalis). 2012. http://newenglandcottontail.org/sites/ afliates for providing New England cottontail samples, as the study would default/fles/conservation_strategy_fnal_12-3-12.pdf. Accessed 3 April not have been possible without their eforts: Eileen McGourty (USFWS), Annie 2017. Curtis (MA Army National Guard), David Scarpitti (MA Division of Fish and 9. United States Department of interior (USDOI). US Fish and Wildlife Service Wildlife), Howard Kilpatrick (CT Department of Energy and Environmental 12-month fnding on a petition to list the New England Cottontail as an Protection), Heidi Holman (NH Fish and Game Department), Wally Jakubas (ME endangered or threatened species. 2015. https://www.gpo.gov/fdsys/ Department of Inland Fisheries and Wildlife), Michael McBride and Lou Perrotti pkg/FR-2015-09-15/pdf/2015-22885.pdf. Accessed 10 January 2017. (Roger Williams Park Zoo), Jacob McCumber (MA Army National Guard), Tony 10. Brubaker DR, Kovach AI, Ducey MJ, Jakubas W, O’Brien KM. Factors infu- Perry (Mashpee Wampanoag Tribe). Use of trade, product, or frm names does encing detection in occupancy surveys of a threatened lagomorph. Wildl not imply endorsement by the US Government. Soc Bull. 2014;38:513–23. 11. Meglécz E, Costedoat C, Dubut V, Gilles A, Malausa T, Pech N, Martin J-F. Competing interests QDD: a user-friendly program to select microsatellite markers and design The authors declare that they have no competing interests. primers from large sequencing projects. Bioinformatics. 2010;26(3):403–4. 12. Rozen S, Skaletsky H. Primer 3 on the WWW for general users and for Availability of data and materials biologist programmers. Methods Mol Biol. 2000;132:365–86. The microsatellite sequences generated from this study are available through 13. Boutin-Ganache I, Raposo M, Raymond M, Deschepper CF. M13-tailed NCBI’s GenBank (https://www.ncbi.nlm.nih.gov/genbank/) and are accessible primers improve the readability and usability of microsatellite analyses via the GenBank Accession Numbers KX530819–KX530853. performed with two diferent allele-sizing methods. Biotechniques. 2001;31(1):24–8. Consent for publication 14. King TL, Eackles MS, Chapman DC. Tools for assessing kinship, population Not applicable. structure, phylogeography, and interspecifc hybridization in Asian carps invasive to the Mississippi River, USA: isolation and characterization of Ethics approval and consent to participate novel tetranucleotide microsatellite DNA loci in silver carp Hypophthal- Tissue samples of wild S. transitionalis were collected under the University of michthys molitrix. Conserv Genet Resour. 2011;3:397–401. Rhode Island Institutional Animal Care and Use Committee approved protocol 15. Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. MICRO-CHECKER: number AN11-12-011. One DNA sample from S. obscurus was kindly provided software for identifying and correcting genotyping errors in microsatel- by Marian Litvaitis (University of New Hampshire), and the other S. obscurus lite data. Mol Ecol Notes. 2004;4:535–8. tissue sample (specimen 2235-KB) was provided by the Frostburg State King et al. BMC Res Notes (2017) 10:741 Page 7 of 7

16. Peakall R, Smouse PE. GENALEX 6: genetic analysis in Excel. Popula- 23. Davies N, Villablanca FX, Roderick GK. Determining the source of individu- tion genetic software for teaching and research. Mol Ecol Notes. als: multilocus genotyping in non-equilibrium population genetics. 2006;6:288–95. Trends Ecol Evol. 2001;14:17–21. 17. Peakall R, Smouse PE. GENALEX 6.5: genetic analysis in Excel. Population 24. Piry S, Luikart G, Cornuet J-M. BOTTLENECK: a computer program for genetic software for teaching and research—an update. Bioinformatics. detecting reductions in the efective population size using allele fre- 2012;28:2537–9. quency data. J Hered. 1999;90:502–3. 18. Rousset F. GENEPOP’007: a complete re-implementation of the genepop 25. Cornuet JM, Luikart G. Description and power analysis of two tests for software for Windows and Linux. Mol Ecol Resour. 2008;8:103–6. detecting recent population bottlenecks from allele frequency data. 19. Rice WR. Analyzing tables of statistical tests. Evolution. 1989;43:223–5. Genetics. 1996;144:2001–14. 20. Wilberg MJ, Dreher BP. GENECAP: a program for analysis of multilocus 26. Papanastassiou K. A landscape genetics approach for comparing con- genotype data for non-invasive sampling and capture–recapture popula- nectivity across the range of the New England cottontail. Masters thesis. tion estimation. Mol Ecol Notes. 2004;4:783–5. University of New Hampshire, Natural Resources Department; 2015. 21. Evett IW, Weir BS. Interpreting DNA evidence: statistical genetics for 27. Kovach AI, Litvaitis MK, Litvaitis JA. Evaluation of fecal mtDNA analysis as forensic scientists. Maine: Sinauer Associates, Inc.; 1998. a method to determine the geographic distribution of a rare lagomorph. 22. Wang J, Santure AW. Parentage and sibship inference from multilocus Wildl Soc Bull. 2003;31:1061–5. genotype data under polygamy. Genetics. 2009;181(4):1579–94.

Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries • Our selector tool helps you to ﬁnd the most relevant journal • We provide round the clock customer support • Convenient online submission • Thorough peer review • Inclusion in PubMed and all major indexing services • Maximum visibility for your research

Submit your manuscript at www.biomedcentral.com/submit