The Evolution of Sociality in the Genus Gobiodon and Its Maintenance Under a Changing Climate

University of Wollongong Research Online

University of Wollongong Thesis Collection 2017+ University of Wollongong Thesis Collections

2019

The evolution of sociality in the genus Gobiodon and its maintenance under a changing climate

Martin L. Hing

Follow this and additional works at: https://ro.uow.edu.au/theses1

University of Wollongong Copyright Warning You may print or download ONE copy of this document for the purpose of your own research or study. The University does not authorise you to copy, communicate or otherwise make available electronically to any other person any copyright material contained on this site. You are reminded of the following: This work is copyright. Apart from any use permitted under the Copyright Act 1968, no part of this work may be reproduced by any process, nor may any other exclusive right be exercised, without the permission of the author. Copyright owners are entitled to take legal action against persons who infringe their copyright. A reproduction of material that is protected by copyright may be a copyright infringement. A court may impose penalties and award damages in relation to offences and infringements relating to copyright material. Higher penalties may apply, and higher damages may be awarded, for offences and infringements involving the conversion of material into digital or electronic form. Unless otherwise indicated, the views expressed in this thesis are those of the author and do not necessarily represent the views of the University of Wollongong.

Research Online is the open access institutional repository for the University of Wollongong. For further information contact the UOW Library: [email protected]

The evolution of sociality in the genus Gobiodon and its maintenance under a changing climate Martin L. Hing

Supervisors: Marian Y.L. Wong, Mark Dowton, O. Selma Klanten

This thesis is presented as part of the requirement for the conferral of the degree: Doctor of Philosophy

This research has been conducted with the support of the Australian Government Research Training Program Scholarship

The University of Wollongong

School of Biological Sciences

October 2019

i Certification

I, Martin Hing, declare that this thesis submitted in fulfillment of the requirements for the conferral of the degree Doctor of Philosophy, from the University of Wollongong, is wholly my own work unless otherwise referenced or acknowledged. This documenthasnotbeensubmittedforqualificationsatanyother academic institution.

Martin Louis Hing 30 October 2019

Abstract

Group living behavior has evolved in every major taxonomic classification including plants, bacteria, birds, mammals, insects, reptiles and fish. The widespread nature of this behavior is inherently interesting because the mechanisms behind its evolution are highly variable, even between closely related species, and are not always immediately obvious. Cooperative breeding theory was developed to study groups in which subordinates cooperate to help raise the offspring of dominant breeders. The hypotheses which make up cooperative breeding theory are also useful for examining the evolution of sociality in groups with social systems other than cooperative breeding. Thus cooperative breeding theory provides a rich framework with which to assess social evolution in an extensive range of species. Cooperative breeding theory was initially developed based on data from terrestrial species living in family groups (that is, with high kinship). In such groups, helpers may gain indirect benefits from helping to raise the offspring of related breeders. However, a number of taxa are now known to form groups of unrelated individuals and the genetic benefits conferred to helpers are either substantially reduced or non-existent. There must, therefore be alternative benefits which outweigh the costs (e.g. delayed breeding) of group living. The initial focus on terrestrial taxa has lead to a taxonomic bias in the literature, tilted toward terrestrial animals. While great advances have been made in our understanding of the factors involved in social evolution using these model terrestrial systems, we are, nonetheless limited to understanding sociality through a terrestrial lens. Aquatic taxa have received far less attention in the sociality literature as they have historically been overlooked as either non-social or only exhibiting very basic group-forming behavior. A good body of research has since been conducted on freshwater cichlids and this has resulted in a much broader comprehension of social group evolution and maintenance. However, cichlids still conform to the terrestrial paradigm of congregating in family groups. Many marine fishes on the other hand, have a pelagic larval phase. This life-history characteristic means that groups of these fishes generally have low relatedness. Other life-history characteristics such as sex-change are commonplace in many lineages of marine fishes and are rarely observed in terrestrial taxa. Such abilities conceivably alter the various costs and benefits of group living, making marine fishes a very interesting model system for social evolution and maintenance. In chapter 2, I therefore aimed to reduce the taxonomic bias in the literature by investigating the evolution and maintenance of sociality in habitat-specialist coral reef fishes (genus Gobiodon). These fishes are demersal spawners with a pelagic larval phase and thus are suspected to form non-family groups. I achieved this aim by first demonstrating the taxonomic bias present in the field through a critical review of the literature on social evolution. I also suggest a cohesive framework with which to progress research in this field. I then use this framework in the following chapters to address the taxonomic bias by examining social evolution and providing a solid foundation for future research in a new model system of marine fishes.

In chapter 3, I set the foundation for future work on social evolution in the genus by providing a multifaceted description of sociality in each species of Gobiodon present at Lizard Island, Australia. I collected

iv data on group sizes, host-coral (habitat) sizes and fish length and took tissue samples for genetic analyses from each species of Gobiodon. The vast majority of studies examining sociality use group size as a metric for sociality. My description of sociality involved quantifying sociality by two methods (group size and a more complex sociality index), examining social structure within groups, assessing constraints on group size and investigating the distribution and ancestral states of sociality throughout the genus. I verified group size as a reasonable proxy for sociality in Gobiodon, which, to my knowledge, has not been attempted in any other study of sociality. I also found there was good evidence for size based hierarchies in the more social species of Gobiodon by regressing fish length against size rank. In the analysis of constraints on group size, coral size (habitat) was a significant predictor of group size in the majority of the group-forming goby species. Lastly, I built a phylogeny specific to the Gobiodon species at Lizard Island and reconstructed the ancestral states of sociality. I found that sociality was randomly distributed throughout the genus suggesting that factors other than phylogenetic constraint were likely responsible for the evolution of sociality in the genus. I reinforced this finding in chapter 4, by conducting an analysis of phylogenetic signal of sociality in Gobiodon, which provided ambiguous results. These results did however suggest that if there was a phylogenetic signal of sociality in the genus, it was weak and likely had little effect on social evolution. I therefore conducted an examination of the evolution of sociality in the genus with phylogenetically controlled comparative analyses of ecological (coral size and host generalization) and life-history (average body size) traits. I found a combination of coral size and body size best predicted sociality in the genus.

During the course of my research, two cyclones impacted my study sites. In chapter 5, I used these disturbances to develop an understanding of how severe weather events might affect social organization in this genus of marine fishes. This is the first study to assess the effects of severe weather events on sociality in marine fishes. Social organization is an important aspect of a species’ survival through its effects on reproductive output, foraging efficiency and predator detection and evasion in a range of animal groups. There are also well documented links between sociality and ecology. Likewise, the effects of severe weather events on marine ecosystems are generally well established. It therefore seems likely that severe weather events could affect sociality and thus survival of a species following these events. However, this link in the chain has not been assessed in marine species. I examined social organization and habitat (coral) size before and after both events and determined that benefits of philopatry most likely drove the maintenance of sociality following these destructive episodes. I observed decreases in sociality in the group-forming species following each event but no change in social organization of pair-forming species. The group-forming species showed some sign of returning to their pre-cyclone group sizes several months following the first event. This may indicate some level of social plasticity in these species. However, a similar increase in group sizes was not evident following the second cyclone indicating that multiple severe weather events have longer lasting effects on sociality in these species. Severe weather events are projected to increase in frequency and intensity under a changing climate. It is therefore increasingly important to understand the full extent of the effects of these events and the flow-on impacts to species.

v In conclusion, this thesis contains the first study on the effects of severe weather events on social organization in marine fishes. It will be crucial to follow this study with others like it if we are to fully comprehend and hopefully mitigate some of the effects these events will have in the future. In addition to this I have offered significant insight into the evolution and maintenance of sociality in the genus Gobiodon and in so doing, improved the taxonomic bias in the sociality literature and provided the foundation for future research in these model species. Future work should concentrate on confirming my findings on size hierarchies, determining within-group relatedness for each species and observing how the different species’ social organization affects recovery following the severe disturbances that occurred over the course of this thesis.

Acknowledgments

A thesis does not happen in isolation. I would first and foremost like to thank my wonderful partner, Kylie Brown. Not only for her help in the field and graphic design expertise, but for her tolerance, fighting spirit, enthusiasm and encouragement, without which I would not have been able to complete this work. Thank you for doing all the heavy lifting and taking care of our home while I sat in the study agonizing over seemingly endless streams of data, fish stuff, and reviewer comments.

My supervisors Maz, Selma and Mark for the excellent advice and technical expertise you’ve imparted to me over the last five years. Maz, for introducing me to the world of animal behavior and for many, many excellent writing tips. My academic writing has improved out of sight with your guidance. Selma, for your technical advice and guidance throughout the molecular components of the project and unwavering encouragement to keep going. Mark, for taking me on as a student with barely a memory of undergraduate genetics and building me up to a level where I could confidently discuss molecular techniques and analyses. I learned a lot from you all and I hope we have the opportunity to collaborate in the future.

Thanks also to Grant Cameron, Karen Hing and Shona Rankin for sacrificing their time to help me on fieldwork. Many thanks are also owed to Tracy Gibson for her guidance in the lab. Your assistance was invaluable and this work could not have taken place without your combined support.

I would also like to thank the Directors, Caretakers and volunteers of the Lizard Island Research Station. This facility provided a friendly, clean and helpful base from which to conduct our work. I can’t thank you enough for feeding us when our food didn’t arrive on the barge and most of all for keeping us in high spirits throughout our fieldwork. I have never met anyone who didn’t enjoy their fieldwork at Lizard Island. This is a true testament to the dedication and leadership of Anne and Lyle Vail.

Thanks also to my various employers over the last few years. The off-scholarship years would have been much more difficult financially without this employment. Dave Albright and Dave Western at Sikorsky Australia for taking a chance on me and giving me a taste of the aviation industry. Nathan Knott at NSW Fisheries for your encouragement, lively banter and allowing me to take time off to work on this thesis.

To the many PhD and Masters students in Biological Sciences for the much needed coffee breaks and download sessions. Sharing a workspace with you all will remain one of the most inspirational times of my life. I wish you all the best success and hope I have the opportunity to work with you in the future.

Finally, my friends and family who still talk to me after many (so, so many) missed phone calls, texts, emails, meet-ups etc. Thank you all for your understanding and support. My shout next time we meet up!

vii Table of Contents

Contents Certification ...... ii Statement of Candidate Contribution ...... iii Abstract ...... iv Acknowledgments ...... vii Table of Contents...... viii List of Tables ...... xii List of Figures ...... xiii List of Appendices ...... xvi 1 General Introduction ...... 1 1.1 Environmental impacts on sociality ...... 3 1.2 Fish as model organisms for the study of social evolution ...... 4 1.3 Thesis structure ...... 8 1.3.1 Chapter 2 – An evaluation of the methodological approaches to understanding the evolution and maintenance of sociality ...... 8 1.3.2 Chapter 3 – Quantification of sociality in Gobiodon ...... 9 1.3.3 Chapter 4 – The evolution of sociality in Gobiodon ...... 9 1.3.4 Chapter 5 – Effects of severe weather events on sociality ...... 10 2 The Right Tools for the Job: The Cooperative Breeding Framework and an Evaluation of the Methodological Approaches to Understanding the Evolution and Maintenance of Sociality ...... 11 2.1 Abstract ...... 11 2.2 Introduction ...... 11 2.3 Theoretical framework ...... 14 2.3.1 Group living as a major transition ...... 14 2.3.2 Reproductive Skew ...... 15 2.3.3 Cooperative Breeding Framework ...... 15 2.4 Methodological approaches ...... 19 2.4.1 Comparative analyses and syntheses ...... 19 2.4.1.1 Monogamy and kinship ...... 21 2.4.1.2 Life-history hypothesis ...... 22 2.4.1.3 Ecological factors ...... 23 2.4.1.4 Other Hypotheses...... 25 2.4.1.5 Multiple factors ...... 26 2.4.2 Observational studies ...... 27 2.4.2.1 Monogamy and kinship ...... 28

viii 2.4.2.2 Life-history hypothesis ...... 30 2.4.2.3 Ecological factors ...... 31 2.4.2.4 Other hypotheses ...... 33 2.4.3 Manipulative experiments ...... 33 2.4.3.1 Monogamy and kinship ...... 34 2.4.3.2 Life-history ...... 35 2.4.3.3 Ecological factors ...... 36 2.5 Combining methods ...... 37 2.6 Conclusion ...... 38 3 Beyond group size: A general quantitative assessment of sociality in coral-dwelling fishes (genus Gobiodon) ...... 40 3.1 Abstract ...... 40 3.2 Introduction ...... 40 3.3 Methods ...... 43 3.3.1 Statement of ethics and permits ...... 43 3.3.2 Study site ...... 43 3.3.3 Coral measurement ...... 45 3.3.4 Fish capture and processing ...... 45 3.3.5 Sociality metrics ...... 45 3.3.6 Size hierarchies ...... 46 3.3.7 Constraints on group size ...... 46 3.3.8 Ancestral Reconstruction ...... 48 3.4 Results ...... 48 3.4.1 Mean group size...... 48 3.4.2 Sociality index ...... 49 3.4.3 Comparison of mean group size and sociality index ...... 50 3.4.4 Size Hierarchies ...... 51 3.4.5 Constraints on group size ...... 54 3.4.6 Ancestral state reconstruction ...... 56 3.5 Discussion ...... 58 3.5.1 Comparison of quantification methods ...... 59 3.5.2 Social organization ...... 60 3.5.3 Constraints on group size and social organization ...... 60 3.5.4 Ancestral state reconstruction ...... 62 3.6 Conclusions ...... 63 4 Drivers of sociality in Gobiodon fishes: An assessment of phylogeny, ecology and life-history ...... 64 4.1 Abstract ...... 64 4.2 Introduction ...... 64 4.3 Methods ...... 66 4.3.1 Ethics approvals and research permits ...... 66

4.3.2 Field Sampling ...... 67 4.3.3 Ecological and life-history factors ...... 69 4.3.4 Sociality index ...... 69 4.3.5 DNA extraction, amplification and sequencing ...... 70 4.3.6 Sequence Alignment ...... 71 4.3.7 Phylogenetic analysis ...... 71 4.3.8 Phylogenetic signal ...... 72 4.3.9 Phylogenetic Generalized Least Squares models ...... 72 4.3.10 Gobiodon spilophthalmus ...... 73 4.4 Results ...... 75 4.4.1 Phylogenetic inference ...... 75 4.4.2 Phylogenetic signal ...... 76 4.4.3 Phylogenetic generalized least squares ...... 76 4.4.4 Gobiodon spilophthalmus ...... 79 4.5 Discussion ...... 80 4.5.1 Comparison of taxonomic structure...... 83 4.5.2 Gobiodon spilophthalmus ...... 83 4.6 Conclusion ...... 84 5 Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes ...... 85 5.1 Abstract ...... 85 5.2 Introduction ...... 85 5.3 Materials and methods ...... 88 5.3.1 Ethics Statement ...... 88 5.3.2 Study area and survey sites ...... 89 5.3.3 Cyclone activity and sampling periods ...... 90 5.3.4 Survey methods ...... 90 5.3.5 Sociality in Gobiodon ...... 91 5.3.6 Group size ...... 92 5.3.7 Coral size and abundance of empty corals ...... 92 5.3.8 Proportion of inhabited corals and probability of coral occupancy ...... 93 5.4 Results ...... 93 5.4.1 Categorization of social organization ...... 93 5.4.2 Group size ...... 94 5.4.3 Coral Size ...... 95 5.4.4 Proportion of inhabited corals and probability of occupation ...... 98 5.5 Discussion ...... 100 5.5.1 Effects of cyclones on social organization and coral size ...... 100 5.5.2 Implications for pair- and group-forming species ...... 101 5.5.3 Ecological Constraints and Benefits of Philopatry ...... 102

5.6 Conclusion ...... 103 6 General Discussion ...... 104 6.1 Introduction ...... 104 6.2 Summary of key results ...... 106 6.3 Key results ...... 106 6.3.1 Chapter 2 – A general framework for research programs on social evolution ...... 106 6.3.2 Chapter 3 – Quantifying sociality in Gobiodon ...... 107 6.3.3 Chapter 4 - How did sociality evolve in coral gobies? ...... 110 6.3.4 Chapter 5 - Does sociality change with disturbance? ...... 111 6.4 Conclusion ...... 112 References ...... 114 Appendices ...... 130 Appendix 1: Manuscripts published as a result of this thesis ...... 130 Appendix 2: Additional publications during PhD candidature ...... 170 Supplementary Materials ...... 171 Supplementary Tables ...... 171 Supplementary Figures ...... 197 Supplementary phylogenetic trees (Newick format) ...... 200

List of Tables Table 2.1: Four of the major hypotheses of the Cooperative Breeding framework and the respective key factors proposed to influence the evolution of sociality. Hamilton’s rule describes the conditions under which a cooperative action will be favored: Xi + rYi + fZi > Xj + rYj + fZj, where X, Y and Z are present direct benefits, indirect benefits and future direct benefits respectively. r is the relatedness between the actor and recipient of an action and f is the probability of inheritance. i and j denote the effects of a cooperative act (e.g. staying and helping) and non-cooperative act (e.g. dispersing) respectively. Parentheses in the Key Factors column indicate the relevant parameters of Hamilton’s rule ...... 17 Table 3.1: Summary table of species metrics used in analyses. Abbreviations are: number of groups (n), sociality index (SI), group size (GS), standard length of the largest fish (SLα), coral size (CS). All length measurements are in cm ...... 47 Table 3.2: Overall results of effects from all models. Significant effects are shown with significance levels: P < 0.05 (*), P < 0.01 (**). NS indicates no significant effects in the model. AIC values are given in brackets below. No AIC is given for the SLα ~ coral size model as it would not be comparable to the other models ...... 55 Table 3.3: Social categorization of each species for different cut-off values of the sociality index. Bold type indicates species which changed from pair-forming to group-forming when the sociality index cut- off value was changed ...... 57 Table 4.1: Goby species observed at Lizard Island with number of tissue samples obtained. Number of host- coral species was used as a measure of host-generalization. Mean standard length (SL) and host- coral size (CS) were calculated for each species ...... 70 Table 5.1: Gobiodon species observed at Lizard Island with their social index. The number of individuals and groups of each species recorded during the February 2014 survey are provided. Species were categorized as group-forming (below dotted line) if their social index was greater than 0.5. Otherwise they were categorized as pair-forming (above dotted line) ...... 94 Supplementary Table 2.1 ...... 171 Supplementary Table 3.1 ...... 175 Supplementary Table 3.2 ...... 177 Supplementary Table 3.3 ...... 179 Supplementary Table 3.4 ...... 180 Supplementary Table 4.1 ...... 181 Supplementary Table 4.2 ...... 181 Supplementary Table 5.1 ...... 184 Supplementary Table 5.2.1 ...... 189 Supplementary Table 5.2.2 ...... 190 Supplementary Table 5.2.3 ...... 190 Supplementary Table 5.2.4 ...... 191 Supplementary Table 5.3 ...... 196

xii List of Figures

Fig 1.1: Examples of group living animals representing a range of taxa ...... 1 Fig 1.2: Continuum of social systems. Pictures from left to right: solitary polar bear; monogamous pair of albatross; feeding aggregation of bison, family group of meerkats; two distinct castes of a eusocial ant colony ...... 2 Fig 1.3: Gobiodon aoyagii on a gloved hand, showing typical size and body shape of Gobiodon species ...... 5 Fig 1.4: Extreme habitat fidelity. Gobiodon histrio in its host coral (Acropora millepora) above water at low tide ...... 7 Fig 2.1: Approximate number of articles published on major animal groups focusing on four key hypotheses of cooperative breeding. Abbreviations are: Kinship (Kin); Monogamy (Monog); Life-history (LH); Ecological Constraints (EC); Benefits of Philopatry (BoP); Freshwater (FW); Marine (M). Search parameters are available in supplementary Table 2.1. Numbers presented here are intended as approximations only as search parameters were not completely mutually exclusive or exhaustive .... 14 Fig 2.2: Approximate number of articles published on each of the major hypotheses using comparative, observational and experimental methodologies. Abbreviations are: Kinship (Kin); Monogamy (Monog); Life-history (LH); Ecological Constraints (EC); Benefits of Philopatry (BoP). Search parameters are available in supplementary table 2.1. Numbers presented here are intended as approximations only as search parameters were not completely mutually exclusive or exhaustive .... 26 Fig 2.3: Approximate number of publications on cooperative breeding for each methodology. The number articles published in the last five years is shown in dark gray and is included in the total count. Search parameters are available in supplementary table 2.1. Numbers presented here are intended as approximations only as search parameters were not completely mutually exclusive or exhaustive .... 34 Fig 3.1: Map of the survey sites. Dotted light grey line is the outline of reef areas around Lizard Island. All study sites are indicated on map (regular font), specific reefs in the Lizard Island lagoon are numbered: Big Vickey’s Reef (1); Vickey’s Reef (2); Horse Shoe Reef (3); Palfrey Reef (4 – 4a); Loomis Reef (5); Trawler (6); Picnic Beach (7); Ghost Beach (8); Bird Island Reef (9); Entrance Bommie (10); Bird Bommie (11); Lizard Head Reef (12) ...... 44 Fig 3.2: Mean group size of each species observed at Lizard Island. Error bars are standard error. Raw data are displayed as jittered points in blue. Dashed line indicates a mean group size of 2 individuals. Species above this line likely have a greater tendency to form larger groups (more social) than those below this line ...... 49 Fig 3.3: Sociality index calculated for each species. Dashed line at index value 0.5 indicates half-way between theoretically perfect social and solitary living species ...... 50 Fig 3.4: Correlation of ranked sociality of each species calculated using group size (GS) and the sociality index. Low rank represents most social, high rank represents least social (SI). Dashed line represents a 1:1 correlation. Blue line is the linear line of best fit: y = 2.64 + 0.65x ...... 51 Fig 3.5: Relationship between body size (standard length, SL) and rank for each species. Black lines join the individuals of each group. Red line indicates the linear line of best fit (± SE) between body size and ranks ≥ 2 ...... 53 Fig 3.6: Significant effect of coral size on group size for (a) G. fuscoruber, (b) G. oculolineatus and (c) G. rivulatus. Line and standard error ribbon are the modelled group size – coral size relationship with SLα held constant at its estimated marginal mean (2.864 ± 0.311, 2.420 ± 0.336, 2.008 ± 0.288 respectively). Raw data are shown as points ...... 54 Fig 3.7. Phylogenies of Gobiodon at Lizard Island showing the ancestral state of sociality with a sociality index cut-off value of 0.5 (i) and 0.4 (ii). Pie-charts at nodes show the posterior probability of either pair- (red) or group-forming (blue) ancestors. Colour of species names indicates the extant state of

xiii sociality as either pair- (red) or group-forming (blue) ...... 58 Fig 4.1: Map of study sites at Lizard Island, Australia. Dotted lines indicate reef structure. Site names are in regular font. Numbered sites are: Big Vickey’s Reef (1); Vickey’s Reef (2); Horse Shoe Reef (3); Palfrey Reef (4 – 4a); Loomis Reef (5); Trawler (6); Picnic Beach (7); Ghost Beach (8); Bird Island Reef (9); Entrance Bommie (10); Bird Bommie (11); Lizard Head Reef (12) ...... 68 Fig 4.2: Gobiodon spilophthalmus as depicted by Munday et al. (1999) (i) and G. heterospilos sample deposited by Steinke et al. (2017) on the BOLD database, record LIFS847-08 (ii). Specimens from our collection matching descriptions of juvenile G. spilophthalmus collected in 2014 from Seriatopora hystrix (iii) and Echinopora horrida (iv). A small G. ceramensis transitioning from the suspected juvenile spots and stripes pattern to the uniform black adult phase (v) ...... 74 Fig 4.3: Phylogeny of Gobiodon present at Lizard Island based on 7 molecular markers (4 mtDNA; COI, cytb, 12S, 16S and 3 nuclear DNA; RAG1, ZIC1, S7I1) produced with Bayesian (i) and maximum likelihood (ii) methods. Node values in (i) are posterior probability where * indicates a value of 1. Node values in (ii) are bootstrap percentages where * indicates a value of 100 ...... 76 Fig 4.4: Model predictions for the interacting effects of host-coral size and fish length on sociality index. Raw data are pair-forming species (circles) and group-forming species (triangles). Modelled species sizes, indicated by different line types (figure legend), range from 1.5 cm (solid) to 3.5 cm (dotted)...... 77 Fig 4.5: Interacting effects of mean coral size and host-generalization (a) and mean fish length and host- generalization (b) on sociality. Lines in a) are different average coral sizes from 10 cm (solid line) to 75 cm (dotted line). Lines in b) are different mean fish length from 1.5 cm (solid line) to 3.5 cm (dotted line). Both (a) and (b) raw data are individual species conforming to group-forming (triangles) or pair-forming (circles) strategies ...... 78 Fig 4.6: Phylogenetic tree produced with Bayesian analysis showing G. acicularis grouping with specimens resembling G. spilophthalmus, and the two groups of G. ceramensis also recovered with specimens resembling G. spilophthalmus. Node values are posterior probabilities. Values for internal nodes of each species group are not displayed as the placement of individuals within each group is irrelevant. Species names are abbreviated to acic (G. acicularis), spil (G. spilophthalmus c.f.), cera (G. ceramensis) and the outgroup, oki (G. okinawae). Letters immediately following each species abbreviation indicates the coral species the specimen was collected from; Echinopora horrida (E), Seriatopora hystrix (h) and Stylophora pistillata (p). The last three characters are an individual identifier. The outgroup was a consensus sequence (cons) of the COI gene ...... 80 Fig 5.1: Map of the survey sites. Dotted light grey line is the outline of reef areas around Lizard Island. All study sites are indicated on map (regular font), specific reefs in the Lizard Island lagoon are numbered: Big Vickey’s Reef (1); Vickey’s Reef (2); Horse Shoe Reef (3); Palfrey Reef (4 – 4a); Loomis Reef (5); Trawler (6); Picnic Beach (7); Ghost Beach (8); Bird Island Reef (9); Entrance Bommie (10); Bird Bommie (11); Lizard Head Reef (12) ...... 89 Fig 5.2: Timeline of data collection. Timeline shows year and month of data collection (fish, dashed black arrow) and cyclone activity (cyclone, blue arrow). In total, data on group size, coral size and proportion of corals occupied were collected at 4 time points for 13 species of Gobiodon ...... 90 Fig 5.3: Variation in group size of PF and GF species in response to cyclone activity. Modeled mean group size of pair-forming (circles, pink dotted line) and group-forming (triangles, blue dashed line) species at the four survey times. Error bars are 95% CI. Cyclone symbols show when each cyclone impacted the research sites. Raw data for pair- (pink) and group-forming (blue) species are shown as jittered point clouds. Six observations of group sizes greater than 10 are not shown here, but were included in the model ...... 95 Fig 5.4: Mean coral size over the four survey times. Modeled mean coral diameter inhabited by pair-forming (circles, pink dotted line), group-forming (triangles, blue dashed line) species and vacant corals (squares, green solid line). Error bars are 95% CI. Cyclone symbols show when each cyclone impacted the research sites. Raw data of empty corals (green), pair- and group-forming species (pink

xiv and blue, respectively) are shown as jittered point clouds. Eight observations of corals larger than 100 cm mean diameter were omitted from this figure but were included in the model ...... 97 Fig 5.5: Mean proportion of corals inhabited by pair-forming species (triangles, pink dotted line), group- forming species (circles, blue dashed line) and remaining vacant (squares, green solid line) over the four surveys. Error bars indicate standard error. Raw data are shown as jittered point clouds for vacant (green), pair- (pink) and group-forming (blue) species ...... 98 Fig 5.6: Probability that a coral of given size would remain vacant or be inhabited by either a pair- or group- forming species of Gobiodon. Probabilities are shown for each survey time: Feb 2014 (orange, unbroken), Aug 2014 (green, dotted), Jan 2015 (blue, dashed), Jan 2016 (purple, dot-dash) ...... 100 Supplementary Fig 5.1: Sociality index for each species of Gobiodon observed at Lizard Island ...... 197 Supplementary Fig 5.2: Gobiodon juvenile abundance at Lizard Island ...... 198

xv List of Appendices

Appendix 1: Manuscripts published as a result of this thesis ...... 129 Appendix 2: Additional publications during PhD candidature ...... 170

xvi 1 General Introduction

Group living can be readily observed in all major taxonomic groupings of animals, from plants (Baluška and Mancuso, 2009) and bacteria (Whiteley et al., 2017) to birds, mammals, reptiles and insects (Chapple, 2003, Toth and Rehan, 2017, Cockburn, 1998, Jennions and Macdonald, 1994; Fig 1.1). From a genetic perspective, we might assume the most efficient way to ensure our genes endure, is to breed as soon as possible and as many times as possible. Why then are there so many documented cases of species which routinely delay or completely forgo independent breeding in order to remain within a group (reviewed in Hing et al., 2017; Fig 1.1)? The question of how sociality first evolved and is subsequently maintained in animals is of substantial interest to biologists as it is not immediately obvious how this behaviour could be evolutionarily stable (Kutsukake, 2009, Alexander, 1974). As with any phenotypic trait, sociality must have evolved because the net benefits of group living outweigh those of solitary living (Silk, 2007). Thus, there have been many studies focusing on these costs and benefits in a variety of taxa (reviewed in Rubenstein and Abbot, 2017).

Fig 1.1: Examples of group living animals representing a range of taxa

Sociality is a complex concept and is not easily defined (Kappeler, 2019). Perhaps the simplest definition is “group living” (Alexander, 1974). However the term ‘sociality’ not only applies to the phenomenon of group living, but also to affiliative behaviours that underlie group formation and maintenance (Goodson, 2013). For example, from the perspective of group size, monogamous pairing could be considered the simplest form of sociality. However, if we consider the affiliative behaviours required to maintain a stable relationship between monogamous individuals, we may regard this social system to be more

1 complex than, say, an ephemeral feeding aggregation. The social behaviours that maintain these structures are generally cooperative in nature and hence, cooperation and sociality are often studied together (e.g. Gromov, 2017, Kingma et al., 2014). In fact, sociality could not have evolved without cooperation (van Veelen et al., 2010). In nature, there are a range of social systems, breeding systems and social structuring (see Chapter 1, published as Hing et al., 2017, for a more comprehensive overview). Social systems can be viewed as a continuum of group size (Fig 1.2). They vary in the number of animals in the group, breeding system and social behaviours. The examples below give a broad illustration of various social systems (Fig 1.2). However, many animal groups do not fit neatly into these artificial categorizations because of natural variation within species in their tendency to form particular social systems (see Chapter 2). For example, “group-forming” species may often be observed in pairs. Moreover, combinations of mating systems and social structures can be present within these categorizations. For example, social monogamy and dominance hierarchies can be found in both pair-forming and group-forming social systems. This simplified continuum also does not deal well with behavioural complexity, as illustrated by the complexity of behaviours required to maintain monogamous pairing discussed previously. Nevertheless, this continuum is useful for understanding the range of social systems and is consistent with the model of social evolution proposed by the major transitions hypothesis (Szathmáry and Maynard Smith, 1995).

Fig 1.2: Continuum of social systems. Pictures from left to right: solitary polar bear; monogamous pair of albatross; feeding aggregation of bison, family group of meerkats; two distinct castes of a eusocial ant colony

Reproductive skew is a measure of the degree of reproductive bias in a group (Johnstone, 2000, Nonacs, 2000). This bias is a product of the social and mating system of the species. That is, group living where breeding is restricted to a monogamous pair signifies high reproductive skew and conversely, group living where multiple individuals breed, signifies low reproductive skew. Cooperative breeding as an example of group living with high reproductive skew. It is a combination of a group living social system, monogamous breeding and a social dominance hierarchy. Cooperative breeding is a complex form of sociality as subordinates behave altruistically by delaying or completely foregoing their own breeding opportunities to help raise the offspring of the dominant breeders. Eusociality is an extreme cooperative breeding system which may contain completely sterile individuals (Sherman et al., 1995). The social evolution and maintenance literature comprises a number of explanations for the complexity

2 of sociality (See Chapter 2, published as Hing et al., 2017). Among these explanations, the cooperative breeding model offers a rich framework to examine social evolution. The hypotheses that make up cooperative breeding theory may be more broadly applied to many group-living social systems (expanding beyond cooperative breeding systems alone; Hing et al., 2017). Cooperative breeding is derived from Hamilton’s rule and has proven to be a valuable and versatile framework to study social evolution (see Chapter 1, published as Hing et al., 2017). Hamilton’s rule (rb > c) was a significant breakthrough in the study of social behaviour as it provided a generalized set of conditions under which sociality could be evolutionarily stable (Bourke, 2014, Hamilton, 1964b). In fact, Hamilton’s rule reconciled Darwin’s conundrum, regarding infertile worker castes, with social evolution by showing that even infertile individuals gain indirect (genetic) benefits from helping the group to reproduce (Darwin, 1859, Hamilton, 1964b). Each hypothesis of the cooperative breeding framework deals with particular factors which may act to alter each of the components of Hamilton’s rule (relatedness, benefit to the recipient and cost to the actor). For example, the kinship hypothesis looks at how monogamy may precede the evolution of sociality in many terrestrial taxa because it increases relatedness among offspring (Boomsma, 2009, Cornwallis et al., 2010, Hughes et al., 2008, Lukas and Clutton-Brock, 2012a). Relatedness between the actor and recipient of a social action is central to Hamilton’s rule. It is therefore unsurprising that kinship has been suggested as a major evolutionary force driving sociality (Hamilton, 1964b). However, a number of cases are now emerging of groups with low relatedness (e.g. Riehl and Strong, 2015). In such cases, the r in Hamilton’s rule is greatly reduced and c (i.e. direct fitness benefits) must therefore make up the difference in order for sociality to evolve. In other cases, genetic relatedness may not fully explain variation in particular social behaviours (e.g. helping effort; Field et al., 2006). In these cases, the costs and benefits must again be emphasized. Ecological factors may provide direct fitness benefits to individuals by enhancing the benefits of remaining within a group (benefits of philopatry hypothesis; Stacey and Ligon, 1991) or increasing the costs of leaving the group (ecological constraints hypothesis; Emlen, 1982a). These two hypotheses are often viewed as two sides of the same coin (Emlen, 1994, Hing et al., 2018). However each hypothesis views the evolution of sociality from opposing points of view and hence, both are valuable in their own right as they emphasize different ecological aspects of sociality (Hing et al., 2018, Hatchwell and Komdeur, 2000). Life-history factors are also considered to predispose some species to social living (e.g. Arnold and Owens, 1998). It should, however, be recognised that life-history and ecological factors are inextricably linked. For example, longevity (a life-history factor) can lead to high levels of habitat saturation (an ecological factor) (Chapple, 2003, Hatchwell and Komdeur, 2000, Ricklefs, 1975).

1.1 Environmental impacts on sociality It is widely recognised that ecology has a strong influence on sociality in many taxa. It therefore seems likely that changes in ecology caused by environmental disturbance should affect sociality. However, this

3 relationship has rarely been tested. While there are a small number of studies on the effects of habitat fragmentation on foraging and group size, this is mostly restricted to the primate literature (e.g. Sterck, 1999, Umapathy et al., 2011, Irwin, 2007). Likewise, a small body of literature exists on within-group social structuring following disturbance, but is mostly limited to cetaceans (e.g. Elliser and Herzing, 2014, Herzing et al., 2017). At the time of writing, there appears to be little published research (aside from Hing et al. (2018), published as part of this thesis) on how extreme weather events might affect group sizes and social organization across multiple species (but see Rymer et al., 2013). Instead, studies of environmental disturbance tend to focus heavily on population and community level effects (e.g. Bellwood et al., 2006, Cheal et al., 2002). However, sociality may be critical for a species reproduction and survival following disturbance and hence would affect abundances and distributions of the species, in turn affecting population and community level dynamics (Anthony and Blumstein, 2000, Wong, 2012). Extreme weather events are expected to increase in intensity and frequency in response to a warming climate (Knutson et al., 2010). Under a regime of intensifying natural disturbance, research into conservation is becoming increasingly important and many authors are recognising sociality as an important aspect of conservation biology (Chapman and Bourke, 2001, Wong, 2012, Anthony and Blumstein, 2000, Smith et al., 2016). In Chapter 5 (published as Hing et al., 2018) I demonstrate how theories of social evolution can be used to explain observed changes in social organization following extreme weather events.

1.2 Fish as model organisms for the study of social evolution Recently, aquatic taxa have been providing interesting insights into the evolution of sociality (see reviews by: Buston and Wong, 2014, Taborsky and Wong, 2017, Wong and Buston, 2013, Wong and Balshine, 2011, Hing et al., 2017). There are many similarities in the factors thought to promote sociality between terrestrial and aquatic social systems. For example, ecological constraint of dispersal is thought to promote social living in African mole-rats (family Bathyergidae) as well as fresh water cichlids (Faulkes et al., 1997, Heg et al., 2004a respectively). While, fresh water cichlids conform to some familiar characteristics of social terrestrial species (within group relatedness, overlapping generations), they have provided novel insight into the evolution of group living and cooperative breeding (reviewed by Wong and Balshine, 2011). This body of research provides an excellent example of a highly targeted research effort which has resulted in great advances in our understanding of social evolution. For example, Dierkes et al. (2005) ascertained that relatedness between helpers and breeders decreased with helper age in the cooperatively breeding cichlid Nelamprologus pulcher. Heg et al. (2011) then demonstrated that N. pulcher prefer to settle in non-kin groups when dispersal constraints were relaxed, consistent with Dierkes et al. (2005), but contrasting with many terrestrial group-forming species. Heg et al. (2011) went on to reveal that the extent of cooperative breeding in N. pulcher was determined by habitat saturation and benefits of philopatry. Groenewoud et al. (2016) recently found that predation risk is a strong selective driver of complex sociality in N. pulcher. Predation risk has rarely been assessed in terrestrial

4 studies of sociality. These findings clearly demonstrate the value of testing theories of social evolution under novel circumstances. Despite some similarities to terrestrial social systems, marine taxa vary remarkably in their life histories. For example, a pelagic larval phase, exhibited by many marine organisms means that groups composed of close kin are unlikely (Avise and Shapiro, 1986, Buston et al., 2007, but see Buston et al., 2009). Sex- change (sequential or both-ways) is a reasonably common phenomenon in marine taxa which could alter the costs and benefits of group living (Cole and Hoese, 2001, Munday et al., 1998, Nakashima et al., 1996, Wong et al., 2005). For example, the ability to change sex, may increase the benefit of remaining in a group and queuing for a breeding position since a subordinate could assume a breeding position if either of the dominant individuals disappears. These life-history disparities (from terrestrial and freshwater taxa) make marine organisms ideal systems to test social evolution theories under novel conditions. Habitat specialist fishes in particular are emerging as an intriguing system for the study of social evolution because they are easily observable as they occupy discrete habitat patches and many species are widely distributed (Brandl et al., 2018, Buston and Wong, 2014, Wong and Buston, 2013). They also exhibit the unconventional life-histories outlined above (pelagic larval phase and sex change; Munday et al., 1998, Buston et al., 2007, Avise and Shapiro, 1986, Nakashima et al., 1995, Nakashima et al., 1996).

Fig 1.3: Gobiodon aoyagii on a gloved hand, showing typical size and body shape of Gobiodon species.

In this thesis, I examined sociality in habitat specialist fishes of the genus Gobiodon. There are at least 30 nominal species of Gobiodon, although Harold et al. (2008) recognise 19 species as valid. They are one

5 of at least four genera in the Gobiidae family with an obligate association with living host corals (Herler et al., 2009, Agorreta et al., 2013, Harold et al., 2008). Gobiodon species evolved this association relatively recently compared to the evolutionary history of their coral hosts (Duchene et al., 2013). This association is thought to be mutualistic, with the host-coral providing protection and in some cases a source of food (Brooker et al., 2010, Munday, 2001), while the gobies offer protection to the coral by grazing on toxic algae (Dixson and Hay, 2012). This close association means that host corals are a limited resource for coral gobies and the potential to inherit good quality habitat could be a considerable benefit conferred to subordinate group members. Gobiodon species are generally small fishes (3-6 cm) with body forms ranging from generalized to deep- bodied, laterally-compressed (Harold et al., 2008, Untersteggaber et al., 2014; Fig 1.3). As a genus, these variable body forms have allowed them to occupy a range of branching corals, mostly from the Acropora genus, with varying architecture (Untersteggaber et al., 2014). However, at the species level, host-coral preferences range from highly specialized (e.g. G. acicularis) to quite general (e.g. G. fuscoruber) (Dirnwöber and Herler, 2007, Munday, 2004a, Munday, 2002). Habitat generalization has been proposed as a driver of sociality in other species, but has not been tested in habitat specialist fishes (Brooks et al., 2017, Burt, 1996, Tammone et al., 2012). The observed variation in habitat generalization in coral gobies presents an opportunity to test whether this is a factor in their social evolution. Coral gobies likely suffer high mortality outside of their host-corals (Brandl et al., 2018, Munday and Jones, 1998). Predation risk is therefore likely to be an ecological constraint on dispersal in these species. However, they have evolved a number of defensive mechanisms such as skin toxins (Schubert et al., 2003) and hypoxia tolerance (Nilsson et al., 2004, Nilsson et al., 2007). The latter facilitates extreme habitat philopatry, with some species remaining in their host coral for hours while exposed to air during low tides (Figure x; Nilsson et al., 2004, Nilsson et al., 2007). This extreme habitat fidelity with host- corals means that changes in coral community structure are likely to lead to changes in Gobiodon abundance and community structure (Munday, 2002, Munday, 2004b, Munday et al., 1997).

Fig 1.4: Extreme habitat fidelity. Gobiodon histrio in its host coral (Acropora millepora) above water at low tide.

Gobiodon species are substrate spawners, exhibiting paternal egg care (Nakashima et al., 1996) with a pelagic larval phase (Cipresso Pereira et al., 2015). They have life-spans of 2-4 years (Herler et al., 2011, Munday, 2001) of which they spend the majority in their host coral (Munday, 2004a). While adults are capable of moving between coral heads (Wall and Herler, 2009, Nakashima et al., 1996), mortality is likely high for such movements (Brandl et al., 2018, Munday and Jones, 1998). Highly host-specific species prefer to stay within the protection of the branches rather than emigrating, even when corals are degraded (Feary, 2007). Many individuals will also preferentially remain within a group rather than dispersing to take advantage of potential independent breeding opportunities available in nearby vacant corals following habitat disturbance (Hing et al., 2018). Strategic growth modification has been reported in subordinate Paragobiodon (Wong et al., 2008b), the sister genus to Gobiodon (Duchene et al., 2013, Harold et al., 2008), as well as other habitat specialist fishes exhibiting size-based social hierarchies in order to prevent social conflict between ranks (Buston, 2003b, Hamilton and Heg, 2008). Size based hierarchies within Gobiodon groups have not yet been conclusively demonstrated. However, size structuring has been observed (pers. obs.) and growth rate modification appears to be possible, at least in some species (Nakashima et al., 1996, Munday et al., 2006). At the time of writing, there have been few explicit studies on Gobiodon sociality, other than those

7 presented in this thesis (published as Hing et al., 2018, Hing et al., 2019, but see also Hobbs and Munday, 2004). A number of studies have assessed group size, but these have generally been in relation to ecology (e.g. Thompson et al., 2007). Here, I aim to promote fishes of the genus Gobiodon as an ideal model species to study social evolution. As demonstrated above, Gobiodon species are widely distributed, easily observable over long periods and their ecology, physiology and phylogenetic relationships are reasonably well researched. These are all valuable traits for model species in the study of social evolution (Hing et al., 2017).

1.3 Thesis structure Although group formation (e.g. Thompson et al., 2007) and monogamous pair formation (e.g. Munday et al., 2006) has been reported in Gobiodon, there have been no specific studies of sociality in the genus (with the exception of the published research resulting from this thesis: Hing et al., 2018, Hing et al., 2017, Hing et al., 2019). Prior to writing this thesis, the extant social states for each species had not been well defined and the distribution of sociality throughout the genus was unknown. There was some mention of social structure in two species of Gobiodon but little detailed evidence in the other species (Thompson et al., 2007). The aims of this thesis therefore were to provide a solid basis for future research on sociality in the genus and to test theories of social evolution using Gobiodon as model system. I achieved this by: Critically reviewing the methodology used in the study of social evolution and proposing a novel framework for future research in Chapter 2; In chapter 3, presenting a comprehensive description of sociality for each species in the genus; Assessing the phylogenetic signal of sociality in the genus and examining possible ecological and life- history correlates of sociality in Chapter 4; and In Chapter 5, investigating whether environmental disturbance was capable of altering sociality. 1.3.1 Chapter 2 – An evaluation of the methodological approaches to understanding the evolution and maintenance of sociality

Published in Frontiers in Ecology and Evolution as: Hing, M.L., Klanten, O.S., Dowton, M., Wong, M.Y.L., 2017. The Right Tools for the Job: Cooperative Breeding Theory and an Evaluation of the Methodological Approaches to Understanding the Evolution and Maintenance of Sociality. 5:100

In this chapter, I review the major theories employed to study the evolution of sociality in a diverse range of taxa. I critically review the methodology used in this field and advocate for a more cohesive approach to the study of sociality. The vast majority of literature available on social evolution is based upon terrestrial taxa. I highlight the advantages of using marine fishes, mostly due to their unconventional life histories which allows a novel perspective on terrestrially derived theories.

8 1.3.2 Chapter 3 – Quantification of sociality in Gobiodon Prepared for publication in Journal of Evolutionary Biology

There is a distinct lack of literature examining sociality in the genus Gobiodon as a whole. Furthermore, the available literature on group sizes in coral gobies assumes a social state with little quantitative support. This information is important for future research on sociality in Gobiodon species. I therefore adopted a multifaceted approach and assessed ‘sociality’ in Gobiodon species using multiple methods. More broadly, when ‘sociality’ is quantified in studies of other animals, it is usually done so using a singular measure such as group size. I highlight that group size is only a single aspect of a very complex subject and validate the use of group size as a measure of sociality in Gobiodon by comparing it to a more complex sociality index developed by Avilés and Harwood (2012). Structuring within groups likely indicates more complex sociality as it requires specialized behaviours to remain stable. I therefore determined whether there was evidence of group structure, in the form of size based hierarchies in each species of Gobiodon. Next, I assessed whether sociality was constrained by ecological or life-history factors in each species. I hypothesized that the interaction between habitat size and size of the largest fish would best predict group size in the more social species and that there would be no relationship between these variables and group size in the species favouring pair formation (based on studies of other habitat specialist fishes with size hierarchies Buston, 2003a, Kuwamura et al., 1994, Mitchell, 2005, Wong, 2011). Finally, I determined the distribution of group-forming behaviour throughout the genus and assessed the ancestral states of sociality. Given knowledge of the phylogenetic relationships of each species (Duchene et al., 2013, Harold et al., 2008, Herler et al., 2009) and my own preliminary observations of sociality, I predicted sociality would be randomly distributed throughout the phylogeny. 1.3.3 Chapter 4 – The evolution of sociality in Gobiodon

Published in Molecular Phylogenetics and Evolution as Hing, M.L., Klanten, O.S., Wong, M.Y.L., Dowton, M., 2019. Drivers of sociality in Gobiodon fishes: An assessment of phylogeny, ecology and life-history. 137, 263-273

In this chapter I took a broad look at how sociality might have evolved within the genus. Given the current understanding of the phylogenetic relationships of each species (Duchene et al., 2013) and my own observations of sociality in each species, I considered phylogenetic constraint to be an unlikely explanation for the evolution of sociality in each genus. To verify this, I assessed the strength of the phylogenetic signal for sociality. I then investigated whether ecological factors or life-history traits were likely predictors of sociality in the genus. Previous studies on closely related fishes (Wong, 2010) and my own work in Chapter 2 demonstrated that coral size was likely to be a factor of interest. Fish size has also been shown to be an important factor for maintaining sociality in some species (Buston, 2003b, Wong, 2011). Lastly, I looked at the effect that host generalization had on the evolution of sociality. Although, not previously assessed in habitat specialist fishes as a correlate of sociality, I was interested in this

9 variable because I had observed greater variation in host generalization following a major disturbance. Theoretically, more habitat-specialist species could be prone to social living if their particular niches are patchily distributed. This should increase dispersal constraints, especially for species like coral gobies which face substantial predation pressure when moving between corals (Brandl et al., 2018, Munday and Jones, 1998). These three ecological and life-history traits were regressed against sociality while controlling for phylogeny in phylogenetic generalized least squares (PGLS) analyses. Whilst conducting the phylogenetic analyses, I encountered some confusion around the identification and validity of the species Gobiodon spilophthalmus. I conducted additional analyses in an attempt to clarify these issues. The results of these analyses are presented and discussed in this chapter. 1.3.4 Chapter 5 – Effects of severe weather events on sociality

Published in PLoS One as Hing, M.L., Klanten, O.S., Dowton, M., Brown, K.R., Wong, M.Y.L., 2018. Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes. 13(9)

Having explored the extant sociality of each species of Gobiodon and the broader evolutionary predictors of sociality in the genus, I then assessed how sociality was likely to change under extreme environmental disturbance. During the course of my research, two cyclones impacted my study sites. As devastating as these impacts were, they provided a unique opportunity to assess whether social organization would change as a response. Few studies have assessed how sociality changes under extreme weather events. Sociality is an important determinant of a species’ survival and fitness. Severe weather events are also predicted to increase in frequency in the future (Knutson et al., 2010). It is therefore vitally important to gain an understanding of how these events might affect the social structure of species. There are well established links between ecology and sociality (Emlen, 1982a, Stacey and Ligon, 1991). I therefore expected that changes in the environment (and hence the ecology of the system) would have detectable impacts upon the sociality of each species. I was also able to test whether benefits of philopatry or ecological constraints were more likely driving group cohesion under these extreme circumstances.

10 2 The Right Tools for the Job: The Cooperative Breeding Framework and an Evaluation of the Methodological Approaches to Understanding the Evolution and Maintenance of Sociality

Published as: Hing, M. L., Klanten, O. S., Dowton, M., & Wong, M. Y. L. (2017). The Right Tools for the Job: Cooperative Breeding Theory and an Evaluation of the Methodological Approaches to Understanding the Evolution and Maintenance of Sociality. [Review]. Frontiers in Ecology and Evolution, 5(100).

2.1 Abstract Why do we observe so many examples in nature in which individuals routinely delay or completely forgo their own reproductive opportunities in order to join and remain within a group? The cooperative breeding framework provides a rich structure with which to study the factors that may influence the costs and benefits of remaining philopatric as a non-breeder. This is often viewed as an initial step in the development of costly helping behavior provided by non-breeding subordinates. Despite many excellent empirical studies testing key concepts of the framework, there is still debate regarding the relative importance of various evolutionary forces, suggesting that there may not be a general explanation but rather a dynamic and taxonomically varied combination of factors influencing the evolution and maintenance of sociality. Here, we explore two potential improvements in the study of sociality that could aid in the progress of this field. The first addresses the fact that empirical studies of social evolution are typically conducted using either: comparative, observational or manipulative methodologies. Instead, we suggest a holistic approach, whereby observational and experimental studies are designed with the explicit view of advancing comparative analyses of sociality for the taxon, and in tandem, where comparative work informs targeted research effort on specific (usually understudied) species within the lineage. A second improvement relates to the broadening of tests of the cooperative breeding framework to include taxa where subordinates do not necessarily provide active cooperation within the group. The original bias towards ‘helpful subordinates’ arose from a focus on terrestrial taxa. However, recent consideration of other taxa, especially marine taxa, is slowly revealing that the framework can and should encompass a continuum of cooperative social systems, including those where subordinates do not actively help. This review summarizes the major hypotheses of the cooperative breeding framework, one of the dominant explanations to examine social evolution, and highlights the potential benefits that a combined methodological approach and a broader application could provide to the study of sociality.

2.2 Introduction The animal kingdom contains many examples of species, including our own, which form surprisingly complex social structures (Munday et al., 1998, Purcell, 2011, Grueter et al., 2012, Chapais, 2013,

11 Johnson et al., 2013, Taborsky and Wong, 2017). The size, structure and composition of these groups can vary both within and between species, from pair-bonding monogamous partners (Kleiman, 2011, Servedio et al., 2013) to large and highly complex societies exhibiting social hierarchies and division of labor (Duffy and Macdonald, 2010, Nandi et al., 2013). Such variation in social structure is intriguing as it suggests that there may be a great diversity of underlying social, ecological or life history factors that influence the evolution of stable groups and their maintenance over many generations.

One of the most fascinating cases within the broad spectrum of sociality is the formation of groups where individuals delay or forgo their own reproductive opportunities (Clutton-Brock et al., 2001, Buston, 2003b, Faulkes and Bennett, 2013, Margraf and Cockburn, 2013). Subordinate members of such groups often but not always, provide help in raising the offspring of dominant breeders. When this alloparental care is present in the group the social system is often referred to as “cooperative breeding”. Delayed dispersal is widely believed to be the first step in the evolution of cooperative breeding (Emlen, 1982a, Brown, 1987). Importantly, the factors influencing an individual’s decision to delay its dispersal and breeding are often the same as the factors that select for the evolution of subsequent cooperative actions, such as alloparental care, territory defense or nest maintenance. For example, high predation pressure can act as a constraint on dispersal, driving group formation (as shown experimentally by Heg et al., 2004a). This same pressure may then select for individuals who contribute to the collective defense of the group by increasing their individual chances of survival and future reproduction (e.g. Heg and Taborsky, 2010, Groenewoud et al., 2016).

Besides explaining the evolution of group-living and helpful cooperation in groups, we propose that the cooperative breeding framework can also be applied to explain the evolution and maintenance of group living even for species where there is no helpful cooperation. In such groups subordinate group members may exhibit behaviors that offset or avoid inflicting costs on dominants (Kokko et al., 2002, Buston and Balshine, 2007, Wong et al., 2007) such that their overall effect on dominant fitness is neutral (termed 'peaceful cooperation'; Wong et al., 2007). While such actions may not increase dominant fitness, it still represents a cost to a subordinate who must assess this against the benefits gained from remaining within the group. That is, subordinates in groups, whether or not they actively cooperate must weigh the costs and benefits of group membership. It is these costs and benefits that the hypotheses that make up the cooperative breeding framework focus on. Thus, studies investigating the determinants of group living need not be restricted to applying this framework only to species where helping actively occurs.

Notwithstanding the excellent empirical and theoretical work conducted in this field (e.g. Emlen, 1994, Cockburn, 1996, Arnold and Owens, 1998, Hatchwell and Komdeur, 2000, Pen and Weissing, 2000, Buston and Balshine, 2007), the relative importance of the evolutionary forces at play which influence the decision of non-breeders to forego their own reproductive opportunities and remain within a group are still the subject of much discussion. Advances in understanding have so far been made through either comparative studies, focusing on a broad group of taxa, or through more narrowly focused observational

12 or manipulative work on a more restricted subset of species in a generally piecemeal fashion. Each methodology provides important insights into the study system, but they also have their own unique limitations. A combination of methodologies will address many of these limitations and give a more general understanding of the system (Brown, 1974). Indeed, comparative studies often use data from focused observational and experimental studies and many researchers have combined observational and manipulative methodologies to provide powerful results. However, we contend that combining all three methodologies under a single framework provides the most comprehensive approach to studying the evolution of sociality. The fresh water cichlid Neolamprologus pulcher provides an excellent example of how many comparative, observational and experimental studies have provided an extremely robust view of social evolution and maintenance and challenged terrestrially derived theories, such as kinship based mechanisms, in being involved in social evolution (e.g. Wong and Balshine, 2011). But what does the evolution of sociality in N. pulcher, tell us about sociality in the (roughly) 50 other species in the Neolamprologus genus? Can these results be generalized to all social freshwater fishes or indeed all vertebrates? Interspecies comparative analyses are the only way that we can answer such broad evolutionary questions. Obviously, gathering the observational and experimental data for comparative analysis of 50 species would represent an extremely time consuming and costly process. Carefully coordinated collaborations between research groups could help to spread the research effort. In order to maximize the impact of any individual piece of research, focused observational and experimental work should be targeted toward species within the given lineage which are lacking in data and designed with the express view of contributing to future comparative work. Mapping sociality and traits of interest onto a phylogeny for the lineage would help to identify suitable species and can be used to study questions about the evolutionary origins of sociality and how those traits might have contributed. Manipulative studies should then be undertaken for the purpose of assigning causality to the findings of the comparative work. This approach will allow the comparison of multiple traits across a lineage and will allow researchers to provide robust answers to broad evolutionary questions about sociality.

The great variation in factors contributing to social evolution is likely to differ among species. For this reason it is imperative that research effort is spread across a large number of species in order to gain a truly comprehensive understanding of the role that these factors play in the evolution of sociality. Comparisons across multiple species would be best performed when focused observational or experimental data has been gathered under the same theoretical framework. The majority of studies of social group living have so far focused on species of birds, mammals and insects with comparatively little attention given to ectothermic vertebrates with the exception of one notable family of freshwater fishes (Elgar, 2015; Fig 2.1). Inclusion of understudied animal groups is important for our ability to assess the universality of frameworks of social evolution and to gain novel insights as a result, especially when these species display uncommon traits or unconventional life-histories. For instance, the ability of many social marine fishes to change sex may have interesting implications for hypotheses regarding an

13 individual’s ability to acquire a mate and hence on its decision disperse or remain within a group. Likewise, comparisons of long-lived social reptiles and avian lineages could lend support to hypotheses examining the role that longevity plays in the evolution of sociality. In this review, we assess the major theoretical framework in this field, highlight the advantages and disadvantages of the different methodologies used to test existing theory, and discuss developments made in less-well studied social systems with the aim of galvanizing a more holistic integration of multiple techniques and taxa into future studies of social evolution.

Fig 2.1: Approximate number of articles published on major animal groups focusing on four key hypotheses of cooperative breeding. Abbreviations are: Kinship (Kin); Monogamy (Monog); Life-history (LH); Ecological Constraints (EC); Benefits of Philopatry (BoP); Freshwater (FW); Marine (M). Search parameters are available in supplementary Table 2.1. Numbers presented here are intended as approximations only as search parameters were not completely mutually exclusive or exhaustive.

2.3 Theoretical framework 2.3.1 Group living as a major transition The evolution of sociality in animals may be considered as one of the most recent evolutionary transitions according to Szathmáry and Smith (1995). This theory examines the idea that major evolutionary transitions occur when groups of ‘individuals’ come together to form more complex forms of life. This explanation describes the evolution of all life from individual biological molecules through to colonies of eusocial multicellular animals (Bourke, 2011). The evolution of cooperation was a necessary step along the path toward eusociality. There is a continuum of cooperation among group members in animal societies and the degree of cooperation displayed is likely to depend on a range of life-history, social and ecological factors (Kokko et al., 2002, Buston and Balshine, 2007).

14 2.3.2 Reproductive Skew Reproductive skew offers a potential general theory for social evolution through competitive effects and conflict resolution. Reproductive skew considers reproduction as a limited resource and focuses on the distribution of reproductive shares within the group (Emlen, 1982b, Reeve and Ratnieks, 1993, Johnstone, 2000). Groups with one or a few dominant breeders fall at the ‘highly skewed’ end of the spectrum while aggregations where any individual can breed with any other individual would be considered to have ‘low skew’. In this review we will restrict our discussion to groups with dominant breeders and one or more non-breeding subordinates i.e. high reproductive skew societies.

2.3.3 Cooperative Breeding Framework The theory behind cooperative breeding (Brown, 1974) was derived from Hamilton’s rule (Hamilton, 1964b, Grafen, 1982, Bourke, 2014) and described the evolution of social systems in which reproductively mature individuals delay their own independent breeding in order to remain within a group as non-breeding subordinates and help to raise the offspring of dominant breeders. Cooperative breeding groups are generally characterized by high reproductive skew. Offspring of such groups often, but not always remain on the natal territory and many groups are therefore comprised of subordinates related to the dominant breeders, in which case relatedness is high (in Hamilton’s rule) and the likelihood of cooperative actions being selectively favored is raised (Bourke, 2014). However, a growing number of studies have revealed social systems where non-breeding subordinates disperse to other groups and are unrelated to the dominant breeders (Double and Cockburn, 2003, Gardner et al., 2003, Awata et al., 2005, Dierkes et al., 2005, Wong, 2010, Riehl, 2013). In these cases, cooperative rearing of young may still take place as well as other forms of cooperative behavior in order to avoid conflict and maintain a stable group structure (Gardner et al., 2003, Wong et al., 2007). While these latter groups may not strictly fit the definition of a cooperatively breeding group if they do not provide alloparental care, the cooperative breeding framework forms a rich structure with which to assess the circumstances that could lead to an individuals’ decision to forgo its own reproductive opportunities and remain in a group as a non-breeding subordinate (Emlen et al., 1991, Koenig et al., 1992). The cooperative breeding framework encompasses several non-mutually exclusive hypotheses for the evolution of sociality (Table 2.1). It can be applied to two broad areas of social behavior - the evolution of group living and the evolution of cooperation (Koenig et al., 1992). This review will focus primarily on those studies addressing the evolution of group living so as to incorporate studies where subordinate individuals remain in groups but do not provide any active forms of help to dominant breeders (e.g. Eden, 1987, Gardner et al., 2003, Wong and Buston, 2013, Buston and Wong, 2014, Drobniak et al., 2015). In groups where subordinates do not provide active help, dominant group members may still tolerate their presence. Actions such as regulation of growth may facilitate group stability in groups where active subordinate help is absent (e.g. Wong et al., 2007). Whether or not help is later provided, the first step of this evolutionary strategy is an individuals’ decision of whether to disperse and pursue its own breeding opportunities or to delay such opportunities in order to obtain the benefits of group living (Emlen,

15 1982a). Furthermore, the factors involved in the evolution and maintenance of sociality and in the development of helping behavior are often the same (e.g. Groenewoud et al., 2016). The hypotheses comprised within the cooperative breeding framework may therefore be useful to study social systems in which non-breeding subordinate members cooperate in some form regardless of relatedness or whether active help is provided in the care of offspring.

16 1 Table 2.1: Four of the major hypotheses of the Cooperative Breeding framework and the respective key factors proposed to influence the evolution of sociality.

2 Hamilton’s rule describes the conditions under which a cooperative action will be favored: Xi + rYi + fZi > Xj + rYj + fZj, where X, Y and Z are present direct benefits, 3 indirect benefits and future direct benefits respectively. r is the relatedness between the actor and recipient of an action and f is the probability of inheritance. i and j 4 denote the effects of a cooperative act (e.g. staying and helping) and non-cooperative act (e.g. dispersing) respectively. Parentheses in the Key Factors column indicate 5 the relevant parameters of Hamilton’s rule.

Hypothesis Description Key Factors Key Predictions Key References

Observational Experimental

Monogamy: Monogamy and natal Within-group Subordinate helpers should Removal of subordinates Hamilton (1964b) Kinship philopatry should result in relatedness (rY) be closely related to breeders should reduce fitness of Bourke (2014)

groups of closely related breeders Boomsma (2009) Subordinates should individuals providing a Subordinates should Cornwallis et al. (2010) preferentially provide help to context which may promote preferentially choose to Hughes et al. (2008) close kin cooperative breeding settle with or provision kin Lukas and Clutton-Brock over unrelated group (2012b) members

Life History Certain suites of life history Reproductive output (X) Species characterized by low Subordinate removal or Rowley and Russell (1990) traits of a species or lineage, life span (Z) mortality rates and low addition should have an Arnold and Owens (1998) such as low fecundity and growth rate (Z) fecundity should be more impact on life-history traits Hatchwell and Komdeur low mortality rates, lead to age at first reproduction social than those (2000) Supplemental feeding may habitat saturation and a (Z) characterized by higher alter growth rates, survival shortage of suitable breeding birth rate : mortality mortality rates and high or longevity sites, which may predispose ratio (X, Z) fecundity a species or lineage to sociality

17 Ecological Costs of dispersing due to Predation risk (X) Sociality will be more Increasing ecological Emlen (1982a) ecological pressures, such as prevalent in species or constraints should promote Selander (1964) Factors: Habitat saturation (X) Costs of high predation rates or low populations experiencing philopatry and increasing Brown (1974) Mate availability (X) Dispersal resource availability promote high constraints on dispersal sociality Kokko et al. (2002) delayed dispersal and thereby Resource availability Gaston (1978) Sociality will be less Decreasing ecological restraint from independent (X) prevalent in species or constraints should promote breeding and helping populations experiencing dispersal and decreasing relaxed constraints on sociality dispersal

Ecological Direct benefits of remaining Habitat size (X) Social species will live in Subordinates should delay Stacey and Ligon (1991)

on the natal site, such as environments with high dispersal when other Kokko and Ekman (2002) Factors: Habitat variability (X, Benefits of increased protection and variance in habitat quality available habitats are of Woolfenden (1975) Z) Philopatry: access to high quality habitat and high levels of predation lower quality relevant to Taborsky (2016) Life span (Z) direct and following the death of risk the current habitat indirect dominant, promote sociality Fecundity (X) Less social species will live Subordinates should Indirect benefits of inheritance of breeding in environments with low disperse to pursue remaining on the natal site, status (Z) variance in habitat quality independent breeding such as increased fitness and opportunities when higher Offspring fitness (Z) Social species will be found survival of offspring quality habitat is available Offspring survival (Z) in areas with high predation risk

Subordinates should inherit breeding status and/or gain survival benefits

18 2.4 Methodological approaches Many studies have focused on testing four key hypotheses of the cooperative breeding framework (Table 2.1) using broad comparisons of relevant ecological, social and life history variables across multiple species of birds, mammals and insects (Cockburn, 1996, Arnold and Owens, 1998, Johnson et al., 2002, Purcell, 2011). Essentially, these studies have investigated the evolution of sociality by phylogenetic comparative analysis, comparing differences in key variables between multiple social and asocial species within a given lineage. While such contrasts enable broad generalizations to be made, they fall short of identifying causality of effects. In contrast to this methodology, studies that have tested these hypotheses through refined experimental manipulation of characteristics associated with the evolution of sociality (Komdeur, 1992, Baglione et al., 2002, Wong, 2010) do demonstrate causality, but their necessary focus on just one or a few species greatly reduces the ability to draw general conclusions. Therefore, it is through using a combination of these approaches for a given lineage that holds the potential to provide an insight into the generality and causality of sociality across a broad range of species (Figures 1, 2). While many studies do combine observational and experimental methodologies (e.g. Komdeur, 1992, Stiver et al., 2005) we suggest that great advances could be made by following such work with comparative studies. This would work most efficiently if the observational and experimental studies were specifically designed with comparative analysis in mind.

2.4.1 Comparative analyses and syntheses Comparative analyses are used to compare traits across multiple taxa or populations across multiple geographic locations and may range in taxonomic scale from studies within a genus to studies across phyla (e.g. Blumstein and Armitage, 1999, Boomsma, 2009, Jetz and Rubenstein, 2011). They may draw upon the findings of other observational and/or manipulative studies (Cockburn, 2006) or they may make use of novel data (Du Plessis et al., 1995). Combining this comparative approach with phylogenetic information is arguably one of the most powerful methods with which to examine broad evolutionary trends and patterns (Arnold and Owens, 1998, Briga et al., 2012). Comparing ecological, life-history, morphological and/or behavioral traits across multiple taxa in a molecular phylogenetic context may allow researchers to examine the evolutionary history of many different attributes and identify ecological, social, morphological and behavioral differences between social and non-social species (Pagel and Harvey, 1988, Arnold and Owens, 1998, Ford et al., 1988, Cornwallis et al., 2010). In turn, the differences that are detected may provide an insight to the conditions under which sociality (or other traits) may have evolved. In this way, future observational and experimental studies could be targeted at specific sets of species within the lineage showing variation in sociality and traits of interest. Understanding the causes of these variations (only achievable through experimental manipulations) could provide specific mechanisms that have caused the observed social systems in these socially contrasting species.

One issue arising from the comparison of a trait across multiple taxa within a given lineage is that the individual species are part of a hierarchical structure. That is, they are related by a common ancestor and

19 therefore not independent. Felsenstein (1985) discussed this issue and proposed a method to overcome the non-independence of species which he terms “phylogenetically independent contrasts”. Essentially, while the species themselves may not be independent, the contrast (or difference) between pairs of species in the trait being measured is independent. This method requires a fully resolved phylogeny of the lineage and a model of evolutionary change. Other authors have since improved upon this method to enable the use of partially resolved phylogenies (Garland et al., 1992, Pagel, 1999, Freckleton et al., 2002). For this reason, comparative analyses are particularly well suited to taxa with well-studied phylogenies or for which genetic material can be easily obtained. Thus far, the majority of comparative studies have focused on terrestrial taxa which have resulted in many great advancements in the field (Brown, 1974, Arnold and Owens, 1998, Boomsma, 2009, Riehl, 2013). However, marine organisms are relatively understudied in terms of comparative work, which is unfortunate as they offer a rich diversity of social organization and varied ecological niches and life-history strategies with which to explore the various hypotheses of social evolution and maintenance (McLaren, 1967, Gowans et al., 2001, Duffy and Macdonald, 2010, Wong and Buston, 2013). Given the great variety of social organization displayed in these organisms, there is clearly enormous potential to test and challenge terrestrially derived cooperative breeding hypotheses under novel conditions.

A variety of studies have so far demonstrated the increasing availability and ease of phylogenetic analyses as a powerful tool to conduct comparisons across multiple taxa. Arnold and Owens (1998) employed this technique in a comparative analysis of 9672 bird species representing 139 families to demonstrate that cooperative breeding was not randomly distributed amongst avian taxa, and in fact showed an uneven geographic distribution of ‘hotspots’ of cooperatively breeding species which the authors considered could infer some common biological predisposition to this system. Similarly, Edwards and Naeem (1993) found that cooperative breeding in birds was not randomly distributed among taxa in a meta-analysis of avian cooperative breeding including phylogenetic simulations of ancestral states. Most recently, this non- random phylogenetic distribution of cooperative breeding amongst avian taxa has been confirmed in a comprehensive review of modes of parental care amongst the avian phylogeny (Cockburn, 2006). Another phylogenetic comparison of 44 species of mammals found that there was a strong phylogenetic signal for allomaternal care (multiple females assisting a dominant female in maternal care duties), in other words, that cooperative breeding in the form of allomaternal care was strongly clustered (Briga et al., 2012). This finding is similar to the non-random phylogenetic distribution of cooperative breeding observed in birds (Edwards and Naeem, 1993, Arnold and Owens, 1998, Cockburn, 2006) suggesting that cooperative breeding is strongly clustered in birds and mammals. These studies demonstrate the effectiveness of phylogenetic comparative analyses for uncovering broad trends across multiple species. With molecular genetic techniques becoming increasingly available, it is more feasible for researchers to conduct phylogenetic comparative studies and to incorporate them into a research program alongside observational and experimental studies. The piecemeal approach widely used at the time of writing, while highly

20 effective at advancing our knowledge of the evolution of sociality, could be made more efficient if finer scale observations and experiments were specifically designed around planned comparative work. This comparative work can then be used to more effectively target research effort on sets of species which contrast in their degree of sociality and in other traits of interest.

2.4.1.1 Monogamy and kinship Studies of the relationship between monogamy, kinship and sociality have championed the use of phylogenetic comparative analysis to test entrenched theory. In particular, the idea that monogamous breeding systems lead to high levels of relatedness amongst subordinates which in turn promotes sociality has been suggested comparatively for insect, bird and mammalian societies (Hughes et al., 2008, Boomsma, 2009, Cornwallis et al., 2010, Lukas and Clutton-Brock, 2012b). For example, Cornwallis et al. (2010) conducted a comparative analysis of 267 birds and showed that species displaying high levels of promiscuity (i.e. polygamous species) were less likely to transition to cooperatively breeding systems. Furthermore, this study showed that lineages that evolved cooperative breeding systems and subsequently reverted to independent breeding systems had more promiscuous ancestors (Cornwallis et al., 2010). Similarly, Hughes et al. (2008) concluded that monogamy was critical in the evolution of eusociality in a comparative analysis of 267 species of eusocial bees, ants and wasps. Boomsma (2009) later reviewed monogamy and eusociality in insects and found that all of the evidence at the time of writing indicated that eusocial insect societies with sterile worker castes only arose in lineages with monogamous parents.

High levels of kinship due to monogamous associations may certainly predispose a species to cooperative breeding, but the emerging number of cases of cooperative breeding amongst unrelated group members suggests that direct benefits from group living and cooperation must be considered (Riehl, 2013, Bourke, 2014). In a review of 213 cooperatively breeding birds, Riehl (2013) suggested that as much as 15% of these species nest with unrelated individuals. These individuals are clearly not gaining inclusive fitness benefits and must therefore be accruing sufficient direct benefits, either presently or in the future, to offset the costs associated with group living. However, the majority of species in this study did nest with related individuals. Therefore, monogamy and kinship likely played a significant role in the evolution of cooperative breeding in these species. It should also be noted that living in groups of close kin may involve costs due to deleterious inbreeding effects and many group living species have developed behaviors to avoid this (costs of inbreeding are discussed in Lubin and Bilde, 2007). Thus far little comparative work has taken place to examine the evolution of sociality amongst groups of unrelated individuals (but see Groenewoud et al., 2016 for an intraspecific comparative analysis). Social marine species with a pelagic larval stage present an excellent avenue for future comparative work in this area as the mixing of larvae in the water column makes settlement in family groups highly unlikely.

Comparative studies have substantially contributed to our understanding of the role that kinship and monogamy has played in promoting the evolution of sociality. However, there is a bias toward terrestrial taxa in the comparative literature which confines our understanding of the factors involved in the evolution

21 of group living to relatively conventional breeding strategies (Fig 2.1). Social marine fishes are particularly interesting as many species undergo a pelagic stage in their life-cycles, whereby larvae are mixed in the water column and eventually settle onto a habitat. This mixing of larvae means that social groups formed by these species are unlikely to consist of related individuals (Avise and Shapiro, 1986, Buston et al., 2007, Buston et al., 2009). Cooperative rearing of young does not appear to occur in the species studied to date which supports the idea that kinship is a major factor in the evolution of helping but may be less influential in the development of group living. Direct fitness benefits however, likely play a greater role in social group formation and maintenance in these species (Wong and Buston, 2013, Buston and Wong, 2014) and there is a need for more comparative studies focusing on these benefits and their role in the evolution of sociality. In any case, such examples of non-kin social groups are the minority in terrestrial systems which have typically shown strong support for monogamy and kin selection as key factors in the evolution of group living and cooperative breeding.

2.4.1.2 Life-history hypothesis Akin to the reasoning that monogamy creates the necessary conditions for cooperative breeding to evolve through kinship based mechanisms, life-history traits such as longevity are thought to promote favorable ecological conditions for the evolution of sociality. Comparative work in this field has informed much of the debate surrounding the life-history hypothesis. Based on their comparative analysis, Arnold and Owens (1998) proposed that low annual mortality was the main factor predisposing avian species to cooperative breeding – a key prediction of the life-history hypothesis (Table 2.1). This proposition was questioned by Blumstein and Moller (2008) based on their comparative study of 257 North American birds. Their study controlled for body mass, sampling effort, latitude, mortality rate, migration distance and age at first reproduction (factors which Arnold and Owens (1998) had not accounted for), and found no association between sociality and increased longevity per se. Blumstein and Moller (2008) note however, that longevity and sociality are often confounded with other life-history factors, such as reproductive suppression, delayed breeding, increased parental care and survival, suggesting the need for further comparative research into these factors. Similarly, a more recent comparative meta-analysis of mammalian phylogenies found no support for longevity playing a part in the transition from independent breeding to cooperative breeding in mammals (Lukas and Clutton-Brock, 2012b). Instead, they found that cooperative breeding only occurred in mammalian lineages displaying monogamy and polytocy (multiple offspring per birth). However, using Australian Scincid lizards (genus Egernia) as model species, Chapple (2003) demonstrated that several species of this genus were shown to exhibit life-history traits (increased longevity and age at maturity) associated with similar levels of sociality to those found in avian taxa, suggesting that life history traits could still play a role in some vertebrate groups. From these varied results it seems clear that the role that life-history plays in the evolution of group living is likely to be taxonomically specific which highlights the need to assess life-history factors and sociality across a broad range of taxa and to incorporate species which display unusual life-history strategies.

22 Besides the latter example, there appears to be relatively little support for the life history hypothesis, at least from comparative studies. However, the majority of comparative analyses have focused on the relationship between longevity and sociality, a single case among a myriad of potential life-history traits that could have influenced the evolution of sociality (Blumstein and Moller, 2008). Given the potential role that life-history traits may have played in setting the stage for the evolution of sociality, phylogenetically independent contrasts across multiple species combined with more focused observational and experimental (where possible) studies would be a useful method for future research in this area. Also, species with less conventional life-history strategies, such as small body size, high mortality rates, sex change and indeterminate growth, all traits exhibited by a range of marine fishes (Munday et al., 1998, Munday and Jones, 1998, Wong et al., 2005, Depczynski and Bellwood, 2006), have thus far received little attention (Fig 2.1). To this end, social habitat specialist fishes would make particularly good study species for comparative analysis, especially given that several groups have already well resolved phylogenies (e.g. Herler et al., 2009, Thacker and Roje, 2011, Duchene et al., 2013).

2.4.1.3 Ecological factors While monogamy and life-history traits may create ideal conditions for social evolution, ecological factors may ultimately determine which species display social behavior. Comparative analyses are ideal for the study of large scale environmental influences on the evolution of sociality since their very aim is to compare patterns across multiple taxa or within a single species over large geographic areas. Such analyses have demonstrated that there is a non-random geographic distribution of sociality in a variety of taxa (Jetz and Rubenstein, 2011, Purcell, 2011). For example, Purcell (2011) conducted an extensive review of the literature pertaining to arthropod sociality along latitudinal and altitudinal gradients, and reanalyzed five previous case studies of social spiders and four ant subfamilies. It was found that climatic factors were correlated with variation in colony size, with social arthropod species occurring more frequently at lower latitudes. Such geographic hot-spotting of cooperative breeding was also recognized by Jetz and Rubenstein (2011), who conducted a global comparative analysis of sociality for 95% of the world’s bird species. They found that temporal (among-year) variability in precipitation was a major predictor of the occurrence of cooperative breeding. Together, these studies demonstrate the effectiveness of comparative analyses in identifying likely environmental factors involved in the evolution of sociality, suggesting that broad scale environmental characteristics, such as rainfall, temperature, predator abundance and the size and availability of food resources may be important in the evolution of sociality in a diverse range of animals.

Some comparative studies have also shown that cooperative breeders are more likely to occur in temporally variable (unstable) environments (Rowley, 1968, Grimes, 1976, Jetz and Rubenstein, 2011). In contrast, other studies have shown a greater occurrence of cooperatively breeding species in less temporally variable (stable) environments (Brown, 1974, Ricklefs, 1975, Woolfenden, 1975, Ford et al., 1988). Emlen (1982a) sought to reconcile this discrepancy in ecological observations of cooperatively breeding birds with his

23 ecological constraints model. The ecological constraints hypothesis focuses on the ecological characteristics of a species’ environment that may prevent group members from dispersing (Emlen, 1982a). Emlen (1982a) proposed that the common thread in these opposing observations was that individuals were faced with the decision of either dispersing to pursue independent breeding opportunities or to remain at the nest as a non-breeding subordinate. Either environmental condition (stable or unstable) could sufficiently restrict an individual’s success in dispersing and pursuing independent breeding opportunities and thus “force” them to remain at the nest. For example, in stable environments, populations of animals may expand and preferable breeding habitat could quickly become saturated (e.g. Schradin and Pillay, 2005). In this situation, dispersal due to limited opportunities for successful independent breeding options is constrained. Alternatively, in unstable environments, the benefits of remaining at the nest may be greater than dispersing and rearing young independently, which is what Stacey and Ligon (1991) subsequently coined as the benefits of philopatry hypothesis.

Environmental variability is likely linked to the availability of food resources which has also been shown to be a constraint on dispersal and hence a factor of interest in the evolution of cooperative breeding (Rubenstein and Lovette, 2007). A comparative analysis conducted by Du Plessis et al. (1995) investigated 217 South African birds comprising 175 non-cooperative breeding species and 25 obligate and 17 facultative cooperative breeding species. Based on the findings of their study, Du Plessis et al. (1995) proposed that obligate and facultative cooperative breeding systems had evolved independently under different ecological circumstances. Obligate cooperative breeders tended to live in predictable habitats where year-round food availability was sufficient to sustain permanent groups and benefited by increasing survival from predation. Facultative cooperative breeders, on the other hand, lived in less predictable environments where food limitations negated the formation of stable groups, with cooperative breeding occurring in years of higher food availability, suggesting that benefits gained were predominantly related to reproduction rather than survival.

Many of the comparative analyses discussed thus far have focused on broad scale environmental patterns, and the availability of resources. One area that appears to be distinctly lacking is risks of dispersal. One notable exception to this observation is an intraspecific comparative analysis of the African cichlid Neolamprologus pulcher by Groenewoud et al. (2016) which examined predation risk and its interaction with other ecological factors such as shelter availability and population density across eight populations. This study concluded that predation risk was a significant driver of group formation and the evolution of complex social behavior. Comparative analyses appear to be well suited to examine risks of dispersal as a mechanism of ecological constraint on dispersal. For example, one might expect that dispersal would be more risky in arid environments where foraging success is enhanced by group size, as predicted in the aridity food-distribution hypothesis (Faulkes et al., 1997, Spinks et al., 2000, Ebensperger, 2001). Aridity is a large-scale environmental factor linked to precipitation which, as previously discussed, has been well studied through comparative analyses. While the paucity of comparative studies specifically addressing

24 dispersal risk appears to be a significant gap in the literature, it should be noted that some comparative analyses may touch on risks of dispersal through other mechanisms such as increased benefits of philopatry gained through predator defense (e.g. Ebensperger, 2001). Such constraints on dispersal may also increase the benefits of remaining philopatric through increased survival.

Benefits of philopatry can be gained through either direct fitness benefits (e.g. survival, growth, predator detection, dilution or competitive advantage) or indirect benefits (e.g. increased fitness and survival of offspring). While many comparative analyses have examined the ecological factors that constrain dispersal and hence promote natal philopatry (Emlen, 1994, Hatchwell and Komdeur, 2000, Lucia et al., 2008), none have explicitly focused on the benefits of philopatry hypothesis on its own. Instead, discussion of benefit based mechanisms of social evolution and maintenance are from studies examining the effects of multiple ecological factors. Much support for benefit based models has come from the mammalian literature, especially rodents, particularly in relation to the thermoregulatory benefits of huddling (Hayes, 2000, Ebensperger, 2001, Solomon, 2003). Ebensperger (2001) suggested that comparative methods should be used for future studies of the evolution of rodent sociality and that they should simultaneously weigh the constraints and benefits associated with group living. The concept that these hypotheses are not mutually exclusive led Hayes (2000) to propose a ‘pup defense – animal density hypothesis’ in a review of communal nesting in rodents. This hypothesis explores the idea that the benefit of pup defense generally increases with group size (Manning et al., 1995), but this benefit must be weighed against the potential constraint of the increased probability of infanticide by conspecifics locating the nest, which is more likely at higher animal densities (Wolff, 1997).

It is clear that ecological factors are influential in determining the costs and benefits of remaining philopatric and hence group-living, though much debate remains over which particular ecological factors provide sufficient benefits or constraints for sociality and subsequent cooperative breeding to evolve and be maintained. Comparative analyses have proven a useful tool with which to identify these benefits and constraints as cooperative breeding species likely share similar benefits or occupy similar ecological niches.

2.4.1.4 Other Hypotheses Much of the work discussed thus far has focused on the roles of kinship, life-history and ecological factors. While these factors tend to dominate the literature (Fig 2.2), there are alternative hypotheses such as group augmentation (Kokko et al., 2001), which examines the benefits conferred to breeders in the group from maintaining a number of subordinate helpers at the nest (i.e. breeders actively recruit or even kidnap subordinate group members) rather than focusing on constraints placed upon subordinate dispersal from a group, or the ecologically-associated benefits conferred to subordinates of remaining at the nest. Such alternative hypotheses should also be considered when examining mechanisms of social evolution. Thus far, no comparative analyses have explicitly addressed group augmentation as a mechanism of social evolution and maintenance, but the hypothesis was the subject of a review by Kingma et al. (2014) who

25 formalized a clear conceptual framework to guide future empirical work in the area. Several comparative studies have also alluded to group augmentation effects such as increased survival (and hence greater lifetime reproductive output) through group defense or predator detection (the ‘many eyes hypothesis’) (Ebensperger, 2001, Ridley and van den Heuvel, 2012).

Fig 2.2: Approximate number of articles published on each of the major hypotheses using comparative, observational and experimental methodologies. Abbreviations are: Kinship (Kin); Monogamy (Monog); Life-history (LH); Ecological Constraints (EC); Benefits of Philopatry (BoP). Search parameters are available in supplementary table 2.1. Numbers presented here are intended as approximations only as search parameters were not completely mutually exclusive or exhaustive.

2.4.1.5 Multiple factors Although the ecological constraints, benefits of philopatry and life-history hypotheses have so far been dealt with separately in this review, it is important to note, as many of these studies have done, that ecological and life-history factors are not mutually exclusive and often act in concert and alongside other evolutionary selective forces. Multiple factors likely have varying influences on different species. It is therefore paramount that these factors are studied in concert across a range of lineages if we are to gain a truly representative view of how sociality evolved and is maintained. Comparative analyses and syntheses are well placed to advance the study of social evolution in this way.

For example, the comparative analysis conducted by Arnold and Owens (1998) suggested that while life- history traits such as longevity predisposed avian lineages to cooperative breeding, ecological constraints might then determine which species would benefit from cooperative breeding behavior (and hence

26 determine whether cooperative breeding was actually expressed in a given lineage). While this explanation accounted for the patchy phylogenetic distribution of cooperative breeding, it did not fully explain why species within the same lineages varied so markedly in their social behavior. Hatchwell and Komdeur (2000) coined a ‘broad constraints hypothesis’, whereby life-history traits and ecological constraints acted together causing a broad constraint on the turn-over of breeding opportunities of a species, a concept originally proposed by Ricklefs (1975). This broad constraints approach was also echoed by Solomon (2003) in a review of factors influencing philopatry in rodents. These studies show that broad constraints on breeding opportunities explain the variation in cooperative behavior observed in species exhibiting similar life histories and inhabiting similar ecological niches. Blumstein and Armitage (1999) argued that ecological factors such as harsh environmental conditions, and food availability drove life-history characteristics such as growth rates and age of maturation. They found that marmots living in harsh environments delayed dispersal past a reproductive maturity index which resulted in the formation of extended family groups, further highlighting the link between ecological factors and life-history in the formation of family groups.

Although these examples demonstrate the effectiveness of comparative analyses in studying multiple factors of social evolution, to date they have only focused on the interplay of ecological and life-history traits. There is clearly a need for more comparative studies focusing on integrating additional factors as well, such as kinship and group augmentation (Fig 2.2). Furthermore comparative studies are not capable of showing causation. To gain this level of understanding researchers should aim to follow comparative work with manipulative experiments. The comparative analysis can be used to target these experiments at sets of species contrasting in sociality.

2.4.2 Observational studies Observational studies covered in this section refer to those that are correlative and focus on a small subset of species, often a single species, as opposed to the comparative analyses which examine broad scale patterns across multiple taxa or manipulative experiments which are capable of demonstrating causality. For these reasons, observational studies should be augmented by comparative and experimental work to gain a holistic view of social evolution. Observational studies are particularly well suited to investigating animals which live in groups on discrete habitat patches or well defined territories (e.g. Nam et al., 2010, Marino et al., 2012). Similar to comparative analyses, there is a pervading taxonomic bias in observational studies leaning toward terrestrial taxa (Fig 2.1). Species with less conventional life-histories, often seen in marine taxa, are relatively understudied yet could shed new light on the evolution and maintenance of sociality. Habitat specialist fish are particularly well suited to observational work as they are widely distributed on coral reefs, display a wide variety of social organization and live on discrete habitat patches (Buston, 2003b, Wong et al., 2005). Additionally, many are demersal spawners and as such provide a convenient measure of fecundity through egg counts (Herler et al., 2011).

Finer scale observational studies are useful for examining intraspecific variation in cooperative breeding

27 behavior, which may be overlooked in comparative analyses (Schradin and Pillay, 2005, Sorato et al., 2012). Additionally, the comparative analyses discussed above often rely on the data provided by finer scale observational studies. For example, Cockburn’s (1996) breeding data was compiled from 20 different studies in order to compare ecological correlates of cooperative breeding in a group of Australian birds (Cockburn, 1996 - Table 2.1). Alternatively, other studies such as Ridley and van den Heuvel (2012) have used comparative methods to identify a trend to focus on and subsequently conduct finer scale observational analyses. In both methodologies, detailed observational data from a subset of species has played a key role in informing discussion on the evolution of sociality. Furthermore, many observational studies can be performed over large temporal scales (e.g. Rubenstein, 2011, Marino et al., 2012), which is often logistically impractical for experimental manipulations and typically outside of the aims of such research (though multi-generational experimental manipulations may be an option for researchers wishing to demonstrate evolutionary mechanisms). Such long-term data is extremely important in the study of sociality, especially when species are subjected to seasonal or other temporal fluctuations in their ecology or behavior.

2.4.2.1 Monogamy and kinship Kinship based models of cooperative breeding propose that helpers should maximize their indirect genetic benefits by preferentially helping descendent or close kin. Testing this hypothesis requires knowledge of the relatedness of individuals in a population. This can be achieved through observation of group history of the study population or by inferring relatedness by comparing genetic markers. Microsatellite markers have thus far tended to be the preferred tool for genetic inference of relatedness. However, more recently, single nucleotide polymorphisms (SNP’s) have emerged as a potential alternative as the markers tend to be cheaper and easier to develop than microsatellites (Weinman et al., 2015). Genetic inference of pedigree is not always straightforward, especially when researchers have difficulty in determining the relative frequency of kin/non-kin in the population, which is often the case in wild populations in which the dispersal or settlement of offspring cannot be directly observed (e.g. fish with a pelagic larval phase). Combining observations of group history with genetic inference is an effective method of determining relatedness and many studies have used this approach (e.g. Wright et al., 1999, Legge, 2000, Clutton-Brock et al., 2001, Dierkes et al., 2005). However, when such observational data is not available, researchers must rely on genetic tools alone (e.g. Buston et al., 2009). A number of estimators of pair-wise relatedness have been proposed (Lynch and Ritland, 1999, Van De Casteele et al., 2001), but these estimators still rely on sound knowledge of the true frequency distribution of relationship in the population in order to determine the likelihood that two individuals are indeed related (Buston et al., 2009 supplementary material). If this requirement can be fulfilled, genetic inference of relatedness is a powerful method for studying the effects of kinship on the evolution of sociality.

These methods have been used to demonstrate preferential provisioning of close kin in many species such as long-tailed tits (Nam et al., 2010), carrion crows (Canestrari et al., 2005), and grey mouse lemurs (Eberle

28 and Kappeler, 2006). However there is some ambiguity as to whether related individuals actively choose to remain philopatric and provision care to related young in order to maximize indirect benefits, or whether family groups form due to some direct benefit of remaining at the natal habitat and the provision of help to close kin is merely a result of nesting in family groups. Observational studies have played a key role in informing this debate. For example, Nam et al. (2010) examined the investment of helpers of the cooperatively breeding long-tailed tit, Aegithalos caudatus, using group history pedigrees and microsatellite genotypes from a 14 year field study to show that investment by helpers increased with relatedness. Likewise, Bruintjes et al. (2011) found that subordinate cichlids, Neolamprologus pulcher, raised their levels of helping behavior when they had bred successfully and their offspring were present in the clutch. In another observational study, Canestrari et al. (2005) found that among a cooperative breeding population of carrion crows, Corvus corone corone, genetic parents fed chicks at greater rates than helpers with no parentage. However, the nests often contained the offspring of several breeding individuals, and the amount of feeding was not proportional to the number of offspring in the nest. This may indicate that carrion crows do not have a mechanism to recognize close kin and/or that costs associated with provisioning unrelated chicks may be low.

Conversely, in mammalian lineages, cooperative breeding in the form of allosuckling represents a high energetic investment to mothers. Eberle and Kappeler (2006) documented this behavior during a long-term observational study of a population of gray mouse lemurs (Microcebus murinus). Microsatellite analyses showed that groups consisted of related individuals and their observations showed a high mortality rate of both adults and juveniles in this species. Eberle and Kappeler’s (2006) study indicated that female gray mouse lemurs possess a kin recognition mechanism, regularly discriminating their own offspring over the offspring of other females in communal nests, but provisioned allomaternal care and in some instances, adopted the young of other related individuals in the case of their mother’s death. The provision of care however, was more often directed toward direct descendent pups and pups suckled more at their own mothers. Eberle and Kappeler (2006) concluded that kin selection was most likely the main selective force behind this cooperative breeding system which provided ‘family insurance’ in the face of high mortality risk in this species.

In contrast, other observational studies have found little evidence to support a relationship between relatedness and helping behavior (Wright et al., 1999, Legge, 2000, Clutton-Brock et al., 2001, Wong et al., 2012). For example, in a six year observational study of meerkats (Suricata suricatta), Clutton-Brock et al. (2001) assessed the individual contributions of helpers toward relatives. They found that individual variation in the amount of food that helpers gave to pups was related to individual foraging success, sex and age rather than relatedness to the pups. Similarly, in a population of Arabian babblers, Turdiodes squamiceps, Wright et al. (1999) found little effect of relatedness on feeding rates or load sizes using three different measures of relatedness. Cooperatively breeding kookaburras (Dacelo novaeguineae) also did not invest in higher provisioning or incubation at nests of related individuals (Legge, 2000). Instead,

29 individuals in larger groups provisioned less food to chicks regardless of relatedness. Since food provision represents a high energetic cost in this species, Legge (2000) believed that larger groups of kookaburras may gain direct fitness benefits through higher survival and hence greater life-time reproduction by ‘load lightening’ when more helpers were available rather than indirect genetic benefits via kin selection. Similarly, Wong et al. (2012) found that while helpers were indeed more related to breeders in monogamous than polygynous mating systems, they did not provide more help in the cooperatively breeding cichlid, Neolamprologus pulcher. However, Stiver et al. (2005) found that other factors acted alongside kinship effects to determine helping behavior in the same species. They showed that relatedness, although not the only driver in helping behavior, still plays a role in the amount of help provided by subordinate N. pulcher.

It is evident from these studies and others that the evolution of sociality through kinship based processes is likely to be species specific. However, the true specificity of these processes cannot be determined unless subsequent comparative work is undertaken. Furthermore, the question of whether the provisioning of close kin is a cause or a consequence of kinship based group formation can only be disentangled using manipulative experiments. Nevertheless, these observational studies highlight the importance of the relationship between genetic relatedness and helping behavior, uncovered using either group history information, genetic inference or both, to examine whether kinship might have been a driver of sociality in these species.

2.4.2.2 Life-history hypothesis The importance of longevity in the evolution of cooperative breeding has been demonstrated by Rowley and Russell (1990) in a long term observational study of Splendid Fairy-Wrens (Malurus splendens). In this study, Rowley and Russell (1990) monitored color banded groups of Splendid Fairy-wrens (long-lived cooperative breeders) between 1973 and 1987. Rowley and Russell (1990) pointed out that the available habitat tends to become saturated in longer lived species which restricts independent breeding opportunities. In a study conducted on Australian skinks, Egernia stokesii, Duffield and Bull (2002) highlighted the similarity in life-history characteristics and group formation in cooperatively breeding birds and mammals. Duffield and Bull (2002) considered that the longevity of these skinks caused the finite number of available rock crevices to become saturated, constraining dispersal and promoting group living. Kent and Simpson (1992) also describe eusociality in a particularly long lived beetle, Autroplatypus incompertus, though it is not clear whether this longevity is a cause of the social structure.

Theoretically, the rate of development may also influence the evolution of sociality through delayed dispersal as animals exhibiting slower development and lower growth rates likely require extended parental care (Solomon, 2003). While there is some support for this hypothesis (Burda, 1990), several observational studies of growth rates in mammals tend to view this life-history trait as a consequence of sociality rather than a potential cause (Oli and Armitage, 2003, Hodge, 2005). Nevertheless, these studies show the usefulness of observational methodology in informing discussions surrounding the role that life-history

30 traits may or may not have played in the evolution of sociality. However as observational studies are not able to show causality, it is difficult to determine whether changes in life-history are a cause or a consequence of sociality. This limitation may be mitigated if the observational work is later tested with experimental manipulations. Supplemental feeding or food restriction experiments (e.g. Wong et al., 2008b, Bruintjes et al., 2010 respectively) may be capable of altering growth rates or overall body condition and hence longevity in some species and as such may be capable of disentangling cause from consequence especially if it is possible to maintain over multiple generations. The relative ease with which observational studies can be conducted over long periods makes them a valuable method to use to study the role of life- history traits in the evolution of group living and complex social behavior.

2.4.2.3 Ecological factors Finer scale observational studies are also excellent for examining ecological correlates of sociality such as predation risk and habitat saturation. Since such studies usually occur in situ, they are valuable for providing a view of the relationship between sociality and ecology under natural conditions. Sorato et al. (2012) investigated the effects of predation risk on foraging behavior and group size in the chestnut- crowned babbler, Pomatostomus ruficeps, and found that larger groups were less likely to be attacked by a predator. Sorato et al. (2012) proposed that predation was therefore likely to be a key factor promoting the evolution of group living in Pomatostomus ruficeps. Curry (1989) examined patterns of sociality and habitat availability amongst four species of allopatric Galapagos mockingbirds (Nesomimus spp.) and found that species constrained by a lack of available habitat maintained cooperatively breeding social groups. Similarly, Schradin and Pillay (2005) found that group formation in arid populations of the African striped mouse, Rhabdomys pumilio, was likely caused by habitat saturation. They also suggest that group living benefits such as increased vigilance against predators and thermoregulation could be important factors in promoting philopatric behavior.

As is the case for comparative analyses, there appear to be fewer observational studies examining the effects of dispersal risk on delayed dispersal in terrestrial taxa. Waser et al. (1994) pointed out the absence of a parameter estimating the probability of dispersing successfully in the cooperative breeding literature. However the authors believe that estimates of the survival rate of emigrants and philopatric animals could be calculated from existing census data and behavioral observations to estimate such a parameter. Waser et al. (1994) demonstrated the effectiveness of this approach using data from a number of observational studies on dwarf mongooses, Helogale parvula (Rood, 1983, Rood, 1987, Rood, 1990, Creel and Waser, 1994). This study showed that in this species, older and more experienced individuals had greater dispersal success. Surprisingly, given that dwarf mongooses are monomorphic, the study also showed that males had greater survival after dispersing than females indicating a lower dispersal risk for males than for females. Therefore, census and behavioral observation data will certainly be vital for continued advancement in this field, as risks of dispersal are likely to play a role in group formation in a range of taxa.

Habitat specialist fishes for example, provide an excellent opportunity to test such hypotheses under novel

31 circumstances as many of these species are sequential or bi-directional hermaphrodites (Nakashima et al., 1996, Buston, 2004b) and few congregate in groups of related individuals. Such a varied life-history, rarely observed in terrestrial taxa, means that indirect genetic benefits are unlikely to be key factors in the evolution and maintenance of sociality in these species. As such, these species provide a novel system in which to explore the enhanced role that ecological constraints and direct benefits could contribute to the evolution and maintenance of sociality. For example, a recent observational study by Groenewoud et al. (2016) showed that predation risk was a significant constraint on dispersal in the cooperatively breeding cichlid Neolamprologus pulcher. A lack of available habitat to disperse to may also pose a substantial risk to a subordinate considering dispersal. Buston (2003a) showed that dominant clown anemonefish (Amphiprion percula) strictly regulate the number of subordinates in their group. A subordinate considering dispersal from the group would therefore need to gauge its likelihood of being allowed entry to a new group. Buston (2004b) further showed that subordinate A. percula form a perfect queue for a breeding position in the group and stand to inherit the breeding territory. In this species and likely other habitat specialist fish which form dominance hierarchies, the benefits of remaining philopatric (territory inheritance) may help to explain the evolution of group formation, especially when there are substantial risks of dispersal (Buston, 2004b, Wong, 2011, but see Mitchell, 2005). The ability of many species of habitat specialist fish to change sex could be a key element in the development of social queuing and increase the benefit of remaining in the group in these species because once a breeding position is obtained, the previously subordinate individual can change to the appropriate sex to facilitate breeding. This ability may also mitigate the risk of dispersing and not finding a mate of the opposite sex. The effects of sex changing ability on the costs and benefits of dispersal are largely untested and these habitat specialist marine fishes represent exciting opportunities for future studies (but see Munday et al., 1998). Furthermore, these species also tend to congregate on discrete habitat patches enabling long term observation of social behavior (Herler et al., 2011, Wong and Buston, 2013).

The benefits of philopatry hypothesis provides an excellent example of how the combination of many smaller scale observational studies have significantly advanced our understanding of this particular hypothesis of the cooperative breeding framework. Notably, Stacy and Ligon (1991) initially conceived this hypothesis by drawing upon observational data from several long term studies of acorn woodpeckers (Stacey, 1979a, Stacey, 1979b, Stacey and Ligon, 1987), green woodhoopoes (Ligon and Ligon, 1978, Ligon and Ligon, 1990) and mountain chickadee (McCallum, 1988). Support for this hypothesis has gained momentum through observational studies of mammalian species. Marino et al. (2012) conducted a long term observational study in Ethiopian wolves (Canis simensis) which form large packs in areas of high prey abundance, but are only found in pairs in areas where prey was limited. While this observation may be characteristic of an ecological constraint, groups of wolves gained benefits through defense of high quality habitat against neighboring packs. Additionally, Marino et al. (2012) found that even when habitat saturation was relaxed following an outbreak of rabies in the population, subordinate individuals remained

32 philopatric, taking advantage of the enhanced foraging success of the group. This indicates that subordinate individuals are not likely to be constrained by ecological factors in this species, but are in fact receiving direct benefits (increased foraging success) related to remaining philopatric. Marino et al.’s (2012) study highlights the importance of long term observational studies in providing evidence to tease apart different hypotheses of the cooperative breeding framework.

2.4.2.4 Other hypotheses Other observational studies have questioned the life-history and ecological constraints hypotheses as explanations for delayed dispersal. Doerr and Doerr (2006) investigated two sympatric species of treecreepers (Climacteris picumnus and Cormobates leucophaea) and suggested that the life-history and ecological constraints hypotheses did not explain why some bird species remain at the nest while others adopt a range of ‘floater strategies’. Instead, Doerr and Doerr (2006) proposed an ‘anti-predator tactics’ hypothesis based upon their findings to explain the divergence between group and solitary living in these species. Group augmentation, where advantages are positively related to group size, has also been raised as a mechanism promoting the formation of social groups (reviewed in Kingma et al., 2014). Few observational studies have specifically focused on this mechanism, although several have mentioned its effects whilst focusing on alternative cooperative breeding hypotheses (Clutton-Brock et al., 1999, Wright et al., 1999, Balshine et al., 2001, Marino et al., 2012) or allee effects (Courchamp and Macdonald, 2001, Heg et al., 2005).

2.4.3 Manipulative experiments While the literature discussed so far has been extremely important in supporting debate regarding a number of social, life-history and ecological correlates of sociality, we must keep in mind that these comparative and observational methods are not able to provide causal explanations of sociality. Brockmann (1997) pointed out an apparent lack of data with which to study the ecological constraints model at the time, deeming the majority of evidence to be correlational. This finding may have changed since Brockmann (1997) wrote her review, with manipulative studies leading observational and comparative studies in publication numbers in the last five years (Fig 2.3). While experimental manipulation is an extremely powerful tool for examining factors of social evolution, it must be considered that the time and expense involved in altering aspects of an individuals’ social or ecological environment may be prohibitive to long term study. It is no surprise then that the majority of manipulative studies are ‘snap-shots’ and care should be taken in the interpretation of results in an evolutionary timeframe. Because of the logistical constraints of manipulative experiments, many studies have focused on smaller species which are more easily housed or species with habitats that can be easily manipulated in situ. Social marine or freshwater fish make excellent study species for this methodology as they tend to congregate on discrete habitat patches which can be easily picked up and moved or simulated in aquaria, making experimental manipulations of ecological factors highly feasible (Wong, 2010). Many are also demersal spawners which provide a convenient measure of reproductive success and fecundity (Buston, 2004a, Wong et al., 2008a, Wong et al.,

33 2012). Recent experimental manipulations on these fish are pushing the boundaries of our understanding of the evolution and maintenance of sociality (Wong, 2011, Buston and Wong, 2014, reviewed in Wong and Buston, 2013).

Fig 2.3: Approximate number of publications on cooperative breeding for each methodology. The number articles published in the last five years is shown in dark gray and is included in the total count. Search parameters are available in supplementary table 2.1. Numbers presented here are intended as approximations only as search parameters were not completely mutually exclusive or exhaustive.

2.4.3.1 Monogamy and kinship Monogamy is thought to be directly related to the formation of close family groups and hence sets the stage for cooperative breeding to occur (Boomsma, 2009, Cornwallis et al., 2010). In these close family groups, individuals are expected to increase their indirect genetic benefits by provisioning close kin. While much support for kin selection models has been gained through observational and comparative studies, several experimental studies have questioned kin selection as a mechanism driving sociality. Clutton-Brock et al. (2001) conducted a supplemental feeding manipulation in a population of meerkats (Suricata suricatta) to test whether relatedness of helpers to a litter predicted the amount of food they provisioned to the litter. They found that the provision of food to the litter was related to the foraging success of the individual helpers, regardless of relatedness to the litter. Similarly, Riehl and Strong (2015) cross-fostered broods of nestlings between pairs of nests ensuring that none of the broods were related to the provisioning adults. Feeding rates did not differ at cross-fostered nests compared to those of sham-manipulated control nests (where nestlings were removed and then returned to their original nests), suggesting that provisioning was not influenced by relatedness. Furthermore, Carter and Wilkinson (2013) demonstrated that food sharing in

34 vampire bats, Desmodus rotundus, was predicted more by reciprocation than relatedness (that is, food donors were more likely to share food with a recipient if the recipient had previously donated food, regardless of relatedness).

A similar lack of kinship effect has also been demonstrated in three independent experiments of artificially formed groups of African cichlids, Neolamprologus pulcher (Stiver et al., 2005, Le Vin et al., 2011, Zöttl et al., 2013). All three studies compared groups of cichlids under laboratory conditions where helpers were either related or unrelated to an adult pair and showed that kinship was not related to the amount or type of help that subordinates performed. While these findings may appear to contradict kin selection based models, it is possible that related and unrelated helpers are provisioning help for different reasons. Le Vin et al. (2011) Stiver et al. (2005) and Zöttl et al. (2013) all pointed out that related helpers may help their relatives in order to receive indirect genetic benefits while unrelated helpers may have to ‘pay to stay’ (i.e. provide help to avoid eviction) in order to enjoy the direct fitness benefits of group living (see Quiñones et al., 2016 for a model based on this species showing that negotiations in a pay to stay scenario can result in higher levels of cooperation than relatedness). These studies highlight the importance of using experimental studies to demonstrate causality of effects described using observational data.

2.4.3.2 Life-history While much support for the life-history hypothesis has been gained from observational and comparative analyses, life-history traits are generally difficult or in some cases impossible to manipulate experimentally. It is not surprising therefore that the majority of manipulative experiments designed to examine the evolution of sociality, have focused on manipulating ecological and social variables. However, Heg et al. (2011) performed a series of manipulative experiments on N. pulcher, and concluded that although ecological and social factors were responsible for the extent of cooperative breeding, a life-history approach could best integrate the environmental and social factors that influenced an individual’s decision of whether to join a group as a subordinate helper or disperse to pursue independent breeding opportunities. Despite this, there is clearly a distinct lack of experimental studies focused on the life-history hypothesis. Manipulating sociality by subordinate removal or addition for example, could be an effective way of determining whether measurable life-history traits, such as longevity or growth rates, are a consequence rather than cause of sociality. While not specifically designed to test this hypothesis, growth rate adjustment has been experimentally induced by breeder or helper removal or replacement experiments in a species of African cichlid (Neolamprologus pulcher; synonymous with N. brichardi, Duftner et al., 2007) and in a social marine fish (Amphiprion percula) (Taborsky, 1984, Heg et al., 2004b, Bergmüller et al., 2005, Buston, 2003b respectively). However to specifically test the life-history hypothesis experiments would necessitate considerably long time scales and the arrival or premature departure of subordinates would need to be tightly controlled. Such experiments would therefore be best suited to fast growing, short lived species or animals which could be easily housed in a captive setting. Several studies have used supplemental feeding which has resulted in altered growth rates and increased survival of subordinates

35 (Cole and Batzli, 1978, Boland et al., 1997, Wong et al., 2008b). While not designed to test the life-history hypothesis, these short-term experiments have coincidentally changed life-history factors and this method may be worthy of investigation for future experimentation in this field. There is also a need for long-term experimentation in order to detect changes in sociality over the temporal scale of the life-history trait in question. Habitat specialist marine fishes would make good study species as they display a variety of life- history traits such as indeterminate growth rates and sex-change, a life-history trait rarely observed in terrestrial taxa and many species are short lived and have rapid growth rates (Munday et al., 1998, Munday and Jones, 1998, Wong et al., 2005, Depczynski and Bellwood, 2006).

2.4.3.3 Ecological factors Ecological variables such as rainfall, and temperature can vary substantially with latitude (Tewksbury et al., 2008). Reciprocal transplant experiments over large latitudinal gradients are therefore useful for assessing the role that ecological factors could play in promoting sociality in broadly distributed taxa. For example, Baglione et al. (2002) demonstrated a clear link between sociality and environmental factors in carrion crows, Corvus corone corone, via a transplant experiment where eggs from asocial nests in Switzerland were moved to social nests in Spain. Offspring of non-cooperative crows which were reared in the cooperative population in Spain displayed cooperative behavior and delayed dispersal. Although Baglione et al. (2002) suspected that habitat saturation was not a factor contributing to cooperative breeding in crows, habitat saturation as a constraint on dispersal has been well supported in many species through experimental manipulation (Curry, 1989, Schradin and Pillay, 2005). In contrast, Riechert and Jones (2008) found that a species of spider, Anelosimus studiosus, which is only social at high latitudes, maintained its social structure regardless of location when transplanted between social and asocial nests, demonstrating that sociality in this species does not change in response to ecological factors.

Experimental studies can be used to tease apart the relative effects of individual benefits and constraints, or examine their interactions. Indeed, many experimental studies have examined the combined effects of ecological constraints on dispersal and benefits of philopatry, similar to comparative and observational analyses of this hypothesis. For example, Heg et al. (2011) examined the effects of habitat saturation, benefits of philopatry and kin-selection on the extent of helping in the cichlid, Neolamprologus pulcher. They found that habitat saturation and benefits of philopatry were responsible for helping but contrary to the kin selection model, found that individuals preferred to settle with unrelated fish in an absence of dispersal constraints. Previous experimental studies in freshwater fish have also supported the idea that ecological constraints and benefits are responsible for delayed dispersal in cooperatively breeding cichlids (Heg et al., 2004a, Bergmüller et al., 2005, Heg et al., 2008, Jungwirth et al., 2015). Predation risk in particular has been shown to be a crucial ecological constraint on dispersal in these species (Taborsky, 1984, reviewed in Taborsky, 2016). Komdeur (1992) showed that habitat saturation and benefits of philopatry were important factors in the dispersal of Seychelles warblers by experimentally introducing individuals to unoccupied islands. Two years after the initial introduction of warblers, all of the high

36 quality territory was occupied, and yearlings born on these territories began to stay and help instead of pursuing independent breeding opportunities on still vacant lower quality habitat. Komdeur’s (1992) results showed that while habitat saturation constrained young birds from leaving high quality habitat, the benefits of remaining at a high quality nest resulted in higher life-time reproductive success. Similarly, Wong (2010) used field and laboratory experiments to demonstrate that subordinate dispersal in a coral reef fish, Paragobiodon xanthosoma, was affected by a combination of ecological constraints (habitat saturation and risk of movement) and benefits of philopatry (coral size – a proxy for habitat quality in this species), but not by social factors (social rank and forcible eviction). Ligon et al. (1991) also tested the effects of several ecological factors on cooperative breeding in groups of superb fairy wrens, Malurus cyaneus. They examined the effects of mate availability, habitat saturation and group augmentation. Ligon et al. (1991) found that their study population of M. cyaneus was not constrained by a lack of breeding partners, or by limitations of available breeding habitat and that subordinate presence was not related to reproductive success. Ligon et al. (1991) concluded that benefits of remaining on a higher quality habitat were responsible for natal philopatry in male M. cyaneus. These examples demonstrate the power of experimental manipulation in identifying multiple factors which may have affected the evolution and maintenance of sociality.

Experimental work, both on larger and smaller scales, has been extremely important in identifying species which have evolved sociality in response to ecological factors. These studies have demonstrated that ecological factors relating to sociality have proven relatively amenable to manipulation, either in the field or the laboratory, for a range of species. It is clear from these examples that the role that ecological factors have played in the evolution of sociality is species specific, and that other factors are likely to play a role in determining whether a species exhibits social behavior. The relative effects and causality of these factors can only be teased apart using robust manipulative experiments.

2.5 Combining methods The discussion so far has highlighted the benefits and pitfalls of each individual methodology. We suggest that a combination of these methodologies will provide an efficient and comprehensive view of social evolution. This combination should start with sourcing or building a phylogeny for the taxa. Building the phylogeny would involve collection of genetic material from all of the species within the lineage. Observational data on sociality and associated ecological, life-history and behavioral factors could also be collected at the same time. This data can then be mapped onto the phylogeny and correlations between sociality and these factors can be determined. This mapping can then be used to target experimental work on sets of species varying in sociality and other factors of interest to determine whether causality can be assigned to any particular factors.

In many cases, phylogenies will already be fully resolved and relevant social observational work may have been undertaken for some species. In such cases research effort should be directed to ‘filling in the blanks’

37 for any species lacking in data. Research effort is often directed at a ‘popular’ subset of species within a lineage because field techniques have been well established. While such research is valuable for examining sociality at the species level, the results are less meaningful at higher taxonomic levels. For this reason, we encourage researchers to design observational and experimental studies with the express view of contributing to future interspecific comparative work. Observations and manipulative experiments should be conducted using similar methods to previous work so that meaningful comparisons can be made.

2.6 Conclusion In this review, we explored the factors influencing the evolution of social systems containing non-breeding subordinates, from the perspective of the methodological approaches that have been used to test multiple hypotheses. Great advances in the field have been made through comparative work (Brockmann, 1997, Arnold and Owens, 1998, Clutton-Brock, 2002, Taborsky and Wong, 2017) and fine scale observational (Rowley and Russell, 1990, Schradin and Pillay, 2005) and manipulative studies (Komdeur, 1992, Riechert and Jones, 2008, Heg et al., 2011), although each method has its limitations and taxonomic biases. Comparative analyses have proven useful for studying evolutionary questions especially when combined with molecular phylogenetic tools as they are able to reveal patterns across multiple species and lineages (e.g. Edwards and Naeem, 1993, Arnold and Owens, 1998, Cockburn, 2006). Intraspecific comparisons across ecologically diverging populations have also proven extremely valuable for testing ecological hypotheses (e.g. Groenewoud et al., 2016). However these broad patterns may overlook contrasting patterns in smaller sets of species or within any given population, and are currently taxonomically restricted to terrestrial species and a handful of freshwater fish species. Smaller-scale observational studies have been effectively used to investigate the relationships between life-history, ecology and sociality, especially over the long-term. However, observational studies are not able to show causality between these factors and sociality and are limited in impact as only a few species can be investigated. Manipulative experiments may save the day by demonstrating causality in many cases, but they too by necessity focus on smaller sets of species and short-term manipulations which limits the generality of their conclusions. There is also a need for more comparative and observational studies on the effects of dispersal risk on delayed dispersal and additional manipulative work on the life-history hypothesis in order to give a well balanced perspective of social evolution and maintenance. We suggest that combining these approaches under a single framework would provide a comprehensive method of studying the evolution of sociality across a broad range of taxa, though few studies have attempted to do so.

Additionally, different animal groups have proven to be more amenable to particular methodologies. For example, birds, insects and mammals have been well studied through comparative analyses due to their well defined phylogenies and long history of observation. On the other hand, habitat specialist fish, because of their small body size and site attachment, are extending the boundaries of our understanding of sociality through amenability to experimental manipulation. Overall, hypotheses for social evolution have been less extensively studied in marine taxa. While cooperative rearing of young has not been observed in marine

38 fish, there are group living species which are typically comprised of unrelated individuals and often a monogamous breeding pair with a number of non-breeding subordinates (Taborsky and Wong, 2017). These groups bear many resemblances to cooperative breeding birds and mammals and cooperative breeding theories have proven successful in explaining the evolution and maintenance of these social systems (Buston and Balshine, 2007, Wong, 2010, Wong and Buston, 2013). Unconventional life-history strategies, such as bi-directional sex-change, and amenability to experimental manipulation and observation present further opportunities to challenge hypotheses of social evolution under novel conditions. For example, the ability to change sex may alter the costs and benefits associated with dispersal from the group. Additionally, indeterminate growth as observed in social marine fishes presents opportunities for exploring the life-history hypothesis which is currently lacking experimental testing. Combining multiple methodological approaches with investigations of novel taxa are now clearly required to gain a truly general understanding of the evolution of sociality

39 3 Beyond group size: A general quantitative assessment of sociality in coral-dwelling fishes (genus Gobiodon)

Prepared for publication in Journal of Evolutionary Biology

3.1 Abstract A fundamental step in understanding the evolution of sociality in any taxa is to quantify the extant social state. The most common method of quantifying sociality is to examine group size. While this metric may be a decent indicator of sociality, it is only one attribute among a myriad of factors which may ultimately influence the evolution of sociality. The purpose of this study is to encourage researchers to move beyond group size as a singular measure of a very complex concept. Group size as a measure of sociality does not offer any insight into group structure, social behaviours or social complexity. Here, we present a general description of sociality for each species of Gobiodon present at Lizard Island, Australia. We quantify sociality using group size and a more complex sociality index. We then discuss the usefulness of group size as a proxy for sociality in Gobiodon by comparing the two metrics. Next, we examine group structure by analysing size data and looking for patterns suggesting size hierarchies. Next we inspect constraints on group size, known to affect other habitat specialist fishes. Finally, we reconstruct the ancestral state of sociality in the genus and investigate the current distribution of sociality in the genus. We found group size was a reasonable proxy for sociality in Gobiodon, but stress that this singular measure is only one aspect of a complex subject. In the species which regularly formed groups, there was good evidence of size based hierarchies. We determined coral size was the main constraint on group size, but the size of the largest individual had little effect. Lastly, sociality appears to be randomly distributed throughout the genus indicating sociality is highly constrained and shared ancestry is unlikely to explain its evolution. The ancestral states of sociality are highly uncertain which likely means that factors other than shared ancestry determine the extant social state of a species. This multifaceted description of sociality for each species of Gobiodon present at Lizard Island lays the foundation for future studies on the evolution of sociality in coral gobies and other social marine fishes. While we recognise the limitations to our methodology, we anticipate this comprehensive approach to describing sociality could be applied to any taxa.

3.2 Introduction Animal sociality has been of interest to biologists since Darwin first published his theory of natural selection (Darwin, 1859). Some level of sociality has been demonstrated in most of the broad animal taxonomic groupings (see reviews: Arnold and Owens, 1998, Briga et al., 2012, Brown, 1987, Buston and Wong, 2014, Chapple, 2003, Clutton-Brock, 2002, Cockburn, 1998, Cornwallis et al., 2010, Ebensperger, 2001, Elgar, 2015, Jennions and Macdonald, 1994, Lukas and Clutton-Brock, 2012b, Taborsky, 2001, Wong and Buston, 2013, Chak et al., 2017, Dey et al., 2017, Shen et al., 2017). The decision to join or remain within a group is inherently interesting because it is not immediately obvious how this benefits the

40 individual group members in an evolutionary context. For example, reproduction is often controlled and only available to dominant group members (Buston and Cant, 2006, Blumstein and Armitage, 1999, Strassmann et al., 1994, Wong et al., 2008a, Young et al., 2006, Creel and Waser, 1994). What then, is the evolutionary benefit to subordinate group members? Why do they choose to remain within a group rather than pursuing independent breeding opportunities? Conversely, the presence of subordinates represents a burden to dominant group members (e.g. increased competition for reproduction Young et al., 2006). Why tolerate these competitors? There are many hypotheses about the evolution of sociality and these tend to be taxon specific (Hing et al., 2017, Chak et al., 2017, Dey et al., 2017, Shen et al., 2017, Arnold and Owens, 1998, Blumstein and Moller, 2008, Boomsma, 2009, Bourke, 2011, Briga et al., 2012, Clutton-Brock, 2002, Cockburn, 1998, Ebensperger, 2001, Emlen, 1982a, Hamilton, 1964b, Hatchwell and Komdeur, 2000, Jennions and Macdonald, 1994, Jetz and Rubenstein, 2011, Kingma et al., 2014, Lukas and Clutton- Brock, 2012a, Riehl, 2013, Rubenstein and Lovette, 2007). A critical component for investigating the evolution of sociality among taxa is to describe and quantify sociality such that variation between taxonomic units can be identified and correlated with factors of interest. However, a description of sociality is not straightforward as ‘sociality’ can only be coarsely defined. Alexander (1974) described sociality simply as “group-living”. This definition is still widely accepted, although it has been expanded to include affiliative social behaviours such as monogamous pairing, parental care and alloparental care, among others (Goodson, 2013). Sociality is clearly a complex concept with many aspects. Here, we focus on several of these aspects in order to gain an appreciation of the level of sociality displayed by each species of Gobiodon.

The complexity of social behaviours varies markedly between (and sometimes within) species. Group size is commonly used to quantify sociality as it is easily observed, can be applied at multiple spatial, temporal and taxonomic scales and interpretation is relatively simple (Reiczigel et al., 2008). However, this metric does have some shortcomings which are rarely acknowledged in the studies utilising this methodology. Group size does not give information about group structure or reproductive skew for example. It also does not address complexity of social behaviours within the group – cooperation for example. For example, a small colony of eusocial ants would be considered more socially complex than a large herd of wildebeest. Using group size as a metric to compare these two species would generate the result of wildebeest being more social than the ants. For this reason, some authors have developed social indices to measure additional aspects of sociality (Armitage, 1981, Ruddell et al., 2007, Avilés and Harwood, 2012). However, such indices are still only proxies of sociality, albeit more complex and nuanced in their interpretation than group size alone.

The study of animal sociality has historically been confined to terrestrial taxa due to the relative ease of observation and experimentation (Hing et al., 2017). Notwithstanding the great advances achieved in terrestrial systems, aquatic taxa have recently provided novel insight into the evolution of animal social systems (Buston and Wong, 2014, Armitage, 1981, Dey et al., 2017, Chak et al., 2017, Heg et al., 2011,

41 Stiver et al., 2005, Taborsky, 2016, Wong and Buston, 2013). In the marine realm, habitat specialist fishes are increasingly being recognised as excellent model species for testing hypotheses of social evolution (Wong and Buston, 2013, Buston and Wong, 2014, Hing et al., 2017). Although not cooperative breeders, many species of habitat specialist fish are group-living and have evolved interesting life-history and mating strategies which provide unique opportunities to test hypotheses of social evolution which have been well established in terrestrial species, but remain less well tested in marine environments. For example, indirect (kin selected) benefits due to delayed dispersal and natal philopatry are widely recognised as a common route to sociality in birds and mammals (Bourke, 2014, Lukas and Clutton-Brock, 2012a). However, many habitat-specialist fishes have a pelagic larval phase and do not settle in family groups, thereby contradicting kinship based theories of social evolution (e.g. Avise and Shapiro, 1986, Buston et al., 2007).

Coral gobies (genus Gobiodon) are small obligate coral-dwelling fishes that display a wide variety of social organisations, making them excellent candidates for use in studies of social evolution (Herler et al., 2011, Hing et al., 2019, Munday et al., 1997). Typically, each goby species has particular coral-species preferences and only a single species is present on any give coral head (Munday, 2004a). Despite their potential as model species in this field, they have so far received little attention (Hing et al., 2019, but see: Hing et al., 2018, Pereira and Munday, 2016, Thompson et al., 2007). Much of the research conducted to date on Gobiodon focuses on ecology (Munday, 2004a, Wall and Herler, 2009, Munday, 2001, Munday et al., 1997, Munday et al., 2004), physiology (Cole, 2011, Cole and Hoese, 2001, Nilsson et al., 2007, Schubert et al., 2003) and phylogenetic relationships (Duchene et al., 2013, Herler et al., 2009, Hing et al., 2019). However, there have been relatively few explicit studies on sociality in Gobiodon species (but see: Hing et al., 2018, Hing et al., 2019).

Thompson et al. (2007) investigated correlates of social group size in Gobiodon, and showed there was a positive relationship between habitat patch size and group size in two species of Gobiodon, (G. quinquestrigatus and G. okinawae, among other genera), but the relationship broke down in G. okinawae possibly due to their increased mobility. This relationship between group size and habitat patch size has also been demonstrated in other species of habitat specialist fishes (Buston, 2003a, Kuwamura et al., 1994, Mitchell and Dill, 2005, Wong, 2011), suggesting that size of the habitat constrains social group size. However, these species also form size based hierarchies in groups which results in growth and size regulation of subordinates (Buston, 2003a, Hamilton and Heg, 2008, Kuwamura et al., 1994, Mitchell and

Dill, 2005, Wong, 2011). Therefore, the size of the largest (most dominant) group member (SLα) has also been shown to constrain group size as there is a theoretical maximum number of fish that can be accommodated within a habitat patch that is based upon SLα and the size ratio of adjacently ranked individuals (Wong, 2010). The relative effects of these ecological (coral size) and social constraints (SLα and growth regulation) are yet to be disentangled.

The purpose of this study is to encourage researchers to move beyond group size as a singular metric for a very complex, multifaceted aspect of animal behaviour. Group size may well provide a good proxy for

42 sociality in many taxa, but its effectiveness as a proxy should be empirically demonstrated, rather than assumed. Here, we quantify sociality in each of the Gobiodon species present at Lizard Island, Australia, using group size and a more refined sociality index and discuss whether group size is an appropriate proxy for sociality in this genus. We then examine group structure and determine whether there is evidence of a size based hierarchy (a sign of more complex sociality) in each species. Next, we examine constraints on group size by testing whether group size is dependent on coral size, SLα or both, in each species. Finally, we take a broad look at the genus and use the social index quantification to assess ancestral states of sociality and describe the extant distribution of sociality in the genus. Thus we provide a comprehensive description of sociality, taking into account group size, group structure, potential influences on group size and overall distribution of sociality within the genus. This description and quantification will lay the foundation for future studies on the evolution of sociality in Gobiodon species and other habitat specialist fishes with similar characteristics.

3.3 Methods 3.3.1 Statement of ethics and permits This research was undertaken in accordance with the University of Wollongong Animal Ethics Committee approvals AE14-04 and AE14-29. Fieldwork was conducted at Lizard Island Research Station in the Great Barrier Reef Marine Park under permits G13/36197.1 and G15/37533.1.

3.3.2 Study site The study took place from February to March 2014 at Lizard Island, Queensland, Australia (Fig 3.1). The reefs at Lizard Island consist of fringing reefs surrounding the main island and several smaller islands encompassing a sheltered lagoon. There are also a number of small isolated reefs at various locations around the island. Depths range from less than 1 m in the sheltered lagoon to 20 m around the fringing reefs. Goby hosting colonies were searched along haphazardly placed 30 m transects at depths ranging from <1 m to 5 m as this was where the greatest variety of goby hosting corals occurred. Transects were only used to aid in the re-location of corals, not for any spatial analysis.

Fig 3.1: Map of the survey sites. Dotted light grey line is the outline of reef areas around Lizard Island. All study sites are indicated on map (regular font), specific reefs in the Lizard Island lagoon are numbered: Big Vickey’s Reef (1); Vickey’s Reef (2); Horse Shoe Reef (3); Palfrey Reef (4 – 4a); Loomis Reef (5); Trawler (6); Picnic Beach (7); Ghost Beach (8); Bird Island Reef (9); Entrance Bommie (10); Bird Bommie (11); Lizard Head Reef (12).

44 3.3.3 Coral measurement Corals were haphazardly searched for by divers for the presence of coral gobies. Corals that hosted gobies were identified to species and measured along three axes (length, width and height). The average coral diameter was calculated as the simple average of these three measurements. Simple average diameter was used as it gives a better representation of the major axis of the coral than geometric mean diameter (Kuwamura et al., 1994).

3.3.4 Fish capture and processing Fifteen species of Gobiodon were identified and counted in each coral head examined to determine group size. On the occasions where more than a single species was detected in a single coral head, those fishes were excluded from subsequent analyses. Fish were removed from corals by anesthetising them with a clove oil solution (Munday and Wilson, 1997), placed into zip-lock bags and taken to a boat for processing where they were stored in a large container of seawater. Seawater was regularly replaced and the zip-lock bags flushed to maintain temperature and aeration. The standard length (SL; measured from the tip of the snout to the posterior end of the caudal peduncle) of each fish was measured to the nearest 0.1 cm with plastic vernier callipers. Standard length was used as damage to the caudal fin was common (likely from conspecific contests) and accurate measurements of total length were not possible for these individuals. A small (less than 0.5 cm) fin clip was cut from the caudal fin for genetic analyses.

3.3.5 Sociality metrics Mean group size was calculated for each species except G. species D (sensu Munday et al., 1999), which was only observed twice. We also adapted a sociality index developed by Avilés and Harwood (2012) which takes into account the proportion of groups in a population (representing the tendency of the species to form groups or not), the proportion of subordinates in the population (signifying the potential for subordinate helpers) and the proportion of the life-cycle spent in a group (representing the tendency for natal philopatry). The index developed by Avilés and Harwood (2012) is:

3.1

Where Ad = age of dispersal, Aa = age of adulthood, Ng = number of groups, Np = number of pairs, Ni = number of solitary individuals, Ir = number of reproducing adults and In = number of non-reproducing adults. We adapted this index by setting the fraction of the life-cycle spent in a group ( ) to 1 for all species. We maximised this value as we considered the majority of social variation between species was likely to be attributed to the other two components of equation 3.1 and the vast majority of the lifecycle was spent in a single coral colony. We based this on the short larval phase (22 to 41 days; Brothers et al., 1983) and the life-span (in the order of years) observed for several Gobiodon species (Taborsky and Wong, 2017, Munday, 2001). Once the larvae of Gobiodon settle onto a coral they do not tend to move unless they

45 are forcefully evicted (Wong et al., 2007, Wong et al., 2008a). The remaining components of equation 3.1 were not modified for our purposes.

To compare the sociality metrics (group size and social index), we ranked each species from most social (Rank 1) to least social (Rank 10) using each metric. Average rank was used where ties occurred between species (i.e. if two species ranked 4 and 5 had equivalent social indices or mean group size, they would both be given a rank of 4.5). Pearson’s rho (ρ) was used to assess the correlation between the two metrics.

3.3.6 Size hierarchies Size hierarchies are an interesting aspect of sociality in many species of group forming habitat specialist fishes (Buston, 2003a, Hamilton and Heg, 2008, Kuwamura et al., 1994, Mitchell and Dill, 2005, Wong, 2011). They may indicate the presence of interesting social behaviours such as subordinate growth regulation (Buston, 2003b) and social queuing (Wong et al., 2007). While factors other than size are certainly able to influence dominance relationships within groups, body size has been shown to be an important component in a closely related genus (Paragobiodon; Wong, 2011). Personal observations of groups of Gobiodon species indicated that there was a range of body sizes within groups. I therefore wanted to look for evidence of size-based hierarchies in Gobiodon in the form of within-group size structuring.

To determine whether there was evidence of size hierarchies in each species (and hence the possibility of

SLα acting as a constraint on group size), we compared patterns of body size in each group for all fifteen species collected. As not all individuals were able to be captured and measured in all groups, groups with missing data were excluded from these comparisons. We did not collect body size data from enough full groups to conduct a formal analysis of size ratio frequencies (sensu Buston and Cant, 2006, Wong et al., 2007, Hamilton and Heg, 2008). However, we conducted an alternative analysis of body size data to indicate whether a size based hierarchy was possible in each species. Ranks were assigned to each individual in the group based on their body size, with rank 1 being the largest fish. If size based hierarchies were present, we would expect to see similarly sized breeding pairs (ranks 1 and 2; Munday et al., 2006) and steadily decreasing body sizes in subsequent ranks owing to strategic growth regulation (Buston and Cant, 2006, Wong et al., 2007, Hamilton and Heg, 2008, Wong et al., 2008b). Conversely, in the case of no size-hierarchies, we would expect body size differences to be smaller or absent. To detect the presence (or absence) of size structuring, and hence the possibility of a size-based hierarchy, we conducted a linear regression of standard length (response) and rank (predictor) for each species. Rank 1 individuals were excluded from the analysis, but rank 2 was retained as we wished to capture any size difference between dominants and subordinates (i.e. the size difference between rank 2 and 3). A linear line of best fit with a significant negative slope was considered to be indicative of within-group size structuring in the species. Linear models were performed in R using the stats package (R Core Team, 2019).

3.3.7 Constraints on group size We assessed the relationship between group size, coral size and the standard length of the largest individual

46 in the group (SLα) for each species to examine possible constraints on group size in Gobiodon species. To investigate the relationship between these variables, we conducted a full model with group size as the response variable and coral size, SLα and the interaction as the predictors. Distinct models were conducted for each species as we were interested in describing the effects of these factors for each species. The models incorporated a Poisson distribution and log link function as the response variable (group size) was count data. High degrees of multicolinearity were detected for the predictors and their interaction. We therefore analysed the individual effects of each predictor on group size alongside the full model. While this approach enabled us to assess the individual effects of each predictor, it did not allow an accurate assessment of the combined effects. We therefore recommend the results of this analysis be interpreted with caution. Reduced models with group size as the response and a single predictor (either coral size or

SLα) were also conducted with Poisson distributions and log link functions. We compared AIC values from the full model and the two reduced models with group size as the response variable to assess the best fitting model. This enabled us to determine which factors best predicted group size. Finally, a relationship between group size, coral size and SLα has been demonstrated in other species of habitat specialist fishes. We wished to test whether coral size indirectly affected group size in coral gobies via a direct effect on

SLα. To do this we conducted a linear model with SLα as the response and coral size as the predictor was performed in order to assess whether coral size was a significant predictor of SLα in any of the species. Five species (G. aoyagii, G. axillaris, G. citrinus, G. species D and an unknown hybrid) were excluded from these analyses as fewer than fifteen observations were made for these species (Table 3.1). All modelling was performed in R using the lme4 package (Bates et al., 2015). We checked for overdispersion and model fit using the overdisp() and cod() functions respectively, available in the sjstats package (Lüdecke, 2018). Where overdispersion was detected, the model was re-run using the MASS package with a negative- binomial family (Venables and Ripley, 2002). We used the Anova() function in the car package to conduct an analysis of deviance on the predictor variables (Fox and Weisberg, 2011).

Table 3.1: Summary table of species metrics used in analyses. Abbreviations are: number of groups (n), sociality index (SI), group size (GS), standard length of the largest fish (SLα), coral size (CS). All length measurements are in cm.

Species n SI mean GS mean SLα mean CS

G. acicularis 17 0.56 2.82 2.28 55.20

G. aoyagii 10 0.48 1.80 NA NA

G. axillaris 9 0.33 1.67 NA NA

G. brochus 35 0.36 2.00 2.65 20.28

G. ceramensis 20 0.36 1.80 2.84 26.93

G. citrinus 9 0.63 4.11 NA NA

47 G. erythrospilus 66 0.41 1.86 3.27 25.41

G. fuscoruber 51 0.57 2.78 2.86 28.65

G. histrio 41 0.43 1.71 3.13 21.60

G. oculolineatus 30 0.39 1.97 2.42 25.56

G. okinawae 19 0.46 1.74 2.09 43.79

G. quinquestrigatus 59 0.37 1.93 2.74 22.44

G. rivulatus 37 0.65 2.59 2.01 23.44

G. sp D 3 NA NA NA NA

Unknown hybrid 8 0.63 3.50 NA NA

3.3.8 Ancestral Reconstruction A full description of the development of the phylogenetic tree is provided in (Hing et al., 2019). Briefly, 7 genes (4 mtDNA and 3 nuclear DNA; see Hing et al. 2019) were concatenated and used to infer a Bayesian summary tree. The ‘unknown hybrid’ was excluded from genetic analysis as we were unsure whether it was a true hybrid or if it was a colour variant of a known species.

BEAST2 was used for the ancestral state reconstruction of sociality. The discrete extant state of sociality was determined using the sociality index proposed by Avilés and Harwood (2012) and adapted by Hing et al. (2018). The Bayesian analysis was set up using the same settings as the Bayesian phylogenetic analyses (Hing et al., 2019). Stationarity was also assessed in the same manner as the Bayesian phylogeny. Hing et al. (2018) used a sociality index value of 0.5 to distinguish pair- and group-forming species, noting that some species classified as pair-forming were occasionally found in groups. We therefore performed ancestral reconstructions using the same cut-off value of 0.5 and a lower value of 0.4 to conservatively re- classify ‘borderline’ pair-forming species as group-forming. This methodological control was included to ensure the posterior probabilities at each node were not heavily influenced by the designation of the extant social state of each species. As an additional methodological control, we also re-classified the outgroup, P. xanthosoma as pair-forming in order to test whether the choice of a group- or pair-forming outgroup affected the analysis.

3.4 Results 3.4.1 Mean group size Using mean group size as a measure, G. citrinus was the ‘most social’ species (mean group size 4.11 ± 0.96 SE) while G. axillaris was the ‘least social’ (mean group size 1.67 ± 0.17 SE; Table 3.1). Five species, (G. acicularis, G. citrinus, G. fuscoruber, G. rivulatus and the unknown hybrid) had mean group sizes greater than 2 individuals (Fig 3.2). These species likely have a tendency for group formation. Gobiodon brochus,

48 G. oculolineatus and G. quinquestrigatus had mean group sizes very close to 2 individuals and the upper range of their standard error was over two individuals (Fig 3.2). These species may prefer to reside in pairs, but may allow one or more subordinates if conditions allow. The remainder of the species (G. aoyagii, G. axillaris, G. ceramensis, G. erythrospilus, G. histrio and G. okinawae) all had mean group sizes and standard error ranges below 2 individuals indicating solitary living or pair-forming sociality.

Fig 3.2: Mean group size of each species observed at Lizard Island. Error bars are standard error. Raw data are displayed as jittered points in blue. Dashed line indicates a mean group size of 2 individuals. Species above this line likely have a greater tendency to form larger groups (more social) than those below this line.

3.4.2 Sociality index The most social species according to the sociality index was G. rivulatus (0.65) while the least social species was G. axillaris (0.33). An index value of 0.5 is theoretically the value exactly half-way between a perfectly social species (social index = 1.00) and perfectly solitary species (social index = 0.00). Species with a sociality index greater than 0.5 likely have a greater tendency to form groups than those below this value. In our study species, G. acicularis, G. citrinus, G. fuscoruber, G. rivulatus and the unknown hybrid, all had sociality indices greater than 0.5 (Fig 3.3). These five species were also deemed to be the most

49 likely to form groups by the mean group size analysis (Fig 3.2).

Fig 3.3: Sociality index calculated for each species. Dashed line at index value 0.5 indicates half-way between theoretically perfect social and solitary living species.

3.4.3 Comparison of mean group size and sociality index There was reasonable agreement in the ranked sociality determined by mean group size and the sociality index (Pearson’s ρ = 0.648; Fig. 3.4). Both methods of ranking sociality perfectly agreed on the ranks of G. fuscoruber, G. erythrospilus and G. axillaris. There was also relatively good or perfect agreement on the five most social species (G. acicularis, G. citrinus, G. fuscoruber, G. rivulatus and the unknown hybrid; Fig. 4), though the exact order of those five species differed between the two methods. There was greater disparity between the two methods from ranks 6 to 14 with the exception of G. erythrospilus and G. axillaris (ranks 9 and 14 respectively) on which the two methods agreed (Fig. 3.4).

Fig 3.4: Correlation of ranked sociality of each species calculated using group size (GS) and the sociality index. Low rank represents most social, high rank represents least social (SI). Dashed line represents a 1:1 correlation. Blue line is the linear line of best fit: y = 2.64 + 0.65x.

3.4.4 Size Hierarchies In all species, the two presumed dominant group members (ranks 1 and 2) were closely matched in length (size ratio ranks 2:1 > 0.8; Fig 3.5). For several species in this dataset (G. aoyagii, G. axillaris, G. ceramensis, G. okinawae, G. sp D), the breeding pair were the only fish observed in the coral and subordinates (rank 3 or higher) were rarely observed in other analyses (pers obs.).

A significant negative relationship between body size and rank was detected for G. acicularis, G. brochus,

G. citrinus, G. histrio, G. oculolineatus, G. quinquestrigatus, G. rivulatus and the unknown hybrid (F(1, 17) = 2 2 2 12.31, R = 0.385, P = 0.003; F(1, 18) = 21.95, R = 0.524, P < 0.001; F(1, 11) = 12.81, R = 0.496, P = 0.004; 2 2 2 F(1, 18) = 33.66, R = 0.632, P < 0.001; F(1, 47) = 40.38, R = 0.451, P < 0.001; F(1, 22) = 64.01, R = 0.733, P 2 2 <0.001; F(1, 47) = 35.72, R = 0.420, P < 0.001; F(1, 10) = 12.46, R = 0.510, P = 0.005 respectively; Fig 3.5). Though not a conclusive indicator of size hierarchies, these relationships do indicate that rank is a significant predictor of body size in these species, which is a hallmark of size hierarchies (Buston, 2003b). 2 No relationship was detected for G. erythrospilus and G. fuscoruber (F(1,16) = 3.743, R = 0.139, P = 0.071; 2 F(1, 25) = 2.65, R = 0.060, P = 0.116 respectively). Both species were observed in larger groups, but rarely.

51 There was a negative trend between body size and rank for G. erythrospilus and it is possible this relationship would be significant with if more data on large groups could be obtained (Fig 3.5). Likewise, the two larger groups of G. fuscoruber were highly variable in standard length within ranks and additional data on larger groups would clarify whether a relationship between body size and rank existed for this species (Fig 3.5).

1 2 Fig 3.5: Relationship between body size (standard length, SL) and rank for each species. Black lines join the individuals of each group. Red line indicates the 3 linear line of best fit (± SE) between body size and ranks ≥ 2

53 3.4.5 Constraints on group size For three species, G. fuscoruber, G. oculolineatus and G. rivulatus, coral size was significantly positively related to group size (χ2 = 20.976, df = 1, P < 0.001; χ2 = 8.130, df = 1, P = 0.004; χ2 = 19.274, df = 1, P < 0.001 respectively; Fig 3.6). However this relationship was leveraged by a single large group detected in a large coral for G. oculolineatus. The interaction between coral size and SLα, was not significant nor was the main effect of SLα (Table 3.2; supplementary tables 3.1, 3.3). The interaction model for these three species had the most predictive power when compared to the model for each of the main effects individually (Table 3.2; supplementary tables 3.1 – 3.4). For these three species, this result suggests that when space allows (larger corals), these species will form larger groups and that group size is not constrained by the size of the largest individual.

Fig 3.6: Significant effect of coral size on group size for (a) G. fuscoruber, (b) G. oculolineatus and (c) G. rivulatus. Line and standard error ribbon are the modelled group size – coral size relationship with SLα held constant at its estimated marginal mean (2.864 ± 0.311, 2.420 ± 0.336, 2.008 ± 0.288 respectively). Raw data are shown as points.

The interaction between coral size and SLα and each of the main effects were all non-significant for the remaining seven species in the full models (Table 3.2). Groups of three or more individuals were present in these seven species for which there was no statistically significant relationship between group size and coral size (Hing, 2019b). However, with the exception of G. erythrospilus and G. histrio, these groups tended to form in smaller and intermediate sized corals respective to the size range occupied by the species. Gobiodon erythrospilus and G. histrio did also show a positive relationship between group size and coral size, but this relationship was not significant when the standard length of alpha was accounted for in the model (full model). The relationship did become significant for G. erythrospilus when SLα was excluded from the model (χ2 = 9.133, df = 1, P = 0.003) but this model was a poorer fit for the data (Table 3.2). There were many instances of single or paired individuals occupying corals of all sizes in G. erythrospilus and G. histrio. Several groups of three individuals were observed and these did occur in larger corals, however the large number of singles and pairs likely obscured any relationship. This may indicate a pair-forming preference in these two species, but they may also tolerate subordinates if there is sufficient space in the coral. Gobiodon acicularis, on the other hand, was observed in groups quite frequently, but the size of the groups was not

54 dependent on the size of the coral or the SLα (Table 3.2). That is, G. acicularis appears to form groups regardless of coral size and size of the largest group member, indicating a strong preference for group forming in this species.

Table 3.2: Overall results of effects from all models. Significant effects are shown with significance levels: P < 0.05 (*), P < 0.01 (**). NS indicates no significant effects in the model. AIC values are given in brackets below. No AIC is given for the SLα ~ coral size model as it would not be comparable to the other models. Response Group size Group size Group size SLα

Predictors Coral size x SLα Coral size SLα Coral size

G. acicularis NS NS NS NS

(41.9) (58.8) (39.8)

G. brochus NS NS NS Coral size*

(88.5) (107.0) (85.8)

G. ceramensis NS NS NS NS

(51.0) (56.6) (47.2)

G. erythrospilus NS Coral Size* NS Coral size*

(71.5) (182.4) (69.7)

G. fuscoruber Coral Size** Coral Size** SLα Coral size**

(113.8) (186.7) (130.8)

G. histrio NS NS NS Coral size*

(68.7) (109.1) (65.4)

G. oculolineatus Coral Size* Coral Size** NS NS

(68.7) (86.9) (73.5)

G. okinawae NS NS NS NS

(26.6) (57.1) (23.1)

G. quinquestrigatus NS NS NS Coral size*

(110.1) (169.7) (106.5)

G. rivulatus Coral Size** Coral Size** NS NS

(104.9) (120.6) (122.0)

55 When coral size was removed from the model, G. fuscoruber was the only species to show a significant relationship between group size and SLα. As Coral size also significantly predicted SLα in G. fuscoruber, it is possible that coral size indirectly influences group size through its effect on SLα. However, given the full interaction model was by far the more parsimonious fit, and coral size was the only significant predictor in this model, it seems likely that coral size is the main driving force in determining group size in G. fuscoruber. Neither G. oculolineatus nor G. rivulatus (the other two species with significant relationships between group size and coral size in the full model) displayed significant relationships between SLα and coral size indicating coral size alone was the main predictor of group size in these species.

Four species, G. brochus, G. erythrospilus, G. histrio and G. quinquestrigatus, had a significant relationship between SLα and coral size indicating coral size was a strong predictor of SLα in these species. However neither SLα nor coral size were significant predictors of group size in the full model for these species. This means SLα may be predicted by coral size in these species, but neither has any detectable impact on the group size of the species.

3.4.6 Ancestral state reconstruction We first produced an ancestral reconstruction of sociality using the Bayesian phylogeny where species with a social index greater than 0.5 were considered to be group-forming and those lower were considered to be pair-forming. At this value, four species were considered to be group-forming while the remaining 10 species were pair-forming (Table 3.3). The lower sociality index cut-off value of 0.4 produced a more even number of pair-and group-forming species; seven pair-forming and seven group-forming (Table 3.3). All reconstructions showed reasonably equivalent probability for either group- or pair-forming ancestors at all nodes, regardless of the sociality cut-off value (Fig 3.7). The ancestral reconstruction of sociality using a cut- off value of 0.5, slightly favoured pair-forming ancestors at all nodes except the outgroup (range 0.516 to 0.663; Fig 4). Setting a lower cut-off value (0.4) between pair- and group-forming species resulted in several nodes changing to slightly favour group-forming ancestors, but only weakly (range 0.353 to 0.549; Fig 3.7). Changing the outgroup to a pair-forming species also had little effect on the posterior probabilities of pair- or group-forming ancestors at each node (with sociality cut-off value 0.5). As expected there was a slight increase in the posterior probability of pair-forming ancestors at all nodes, but this ranged from 0.531 to 0.664. These consistently even posterior probabilities in all configurations likely indicate that phylogeny does not have a strong influence on the social organisation of these species.

56 Table 3.3: Social categorization of each species for different cut-off values of the sociality index. Bold type indicates species which changed from pair-forming to group-forming when the sociality index cut-off value was changed.

Sociality cut-off

Goby Species 0.5 0.4

G. acicularis Group Group

G. aoyagii Pair Pair

G. axillaris Pair Pair

G. brochus Pair Pair

G. ceramensis Pair Pair

G. citrinus Group Group

G. erythrospilus Pair Group

G. fuscoruber Group Group

G. histrio Pair Group

G. oculolineatus Pair Pair

G. okinawae Pair Group

G. quinquestrigatus Pair Pair

G. rivulatus Group Group

G. sp. D Pair Pair

The tendency to favour pair-forming ancestors was weak (posterior probability 0.516 to 0.587) throughout the phylogeny except between G. quinquestrigatus and G. sp. D which had a posterior probability of a pair- forming ancestor of 0.662 (Fig 3.7). The ancestral nodes of each clade appeared to slightly favour pair- forming ancestors as well, but the posterior probabilities of pair- or group-forming ancestors were still quite even (posterior probability 0.516 to 0.550). This indicates that group-forming species probably evolved multiple times throughout the lineage but the relatively even posterior probability of pair- or group-forming ancestors at each node suggests factors other than genetic evolution have a strong influence on the extant social state.

Fig 3.7. Phylogenies of Gobiodon at Lizard Island showing the ancestral state of sociality with a sociality index cut-off value of 0.5 (i) and 0.4 (ii). Pie-charts at nodes show the posterior probability of either pair- (red) or group-forming (blue) ancestors. Colour of species names indicates the extant state of sociality as either pair- (red) or group-forming (blue).

3.5 Discussion Our results demonstrate that group size is correlated with the more complex sociality index proposed by Avilés and Harwood (2012). Group size is therefore a reasonable proxy for sociality in the genus Gobiodon. However, neither group size nor the sociality index explicitly incorporate aspects of sociality such as constraints on sociality or social organization within groups. We took the next logical step and assessed patterns of social structuring (size based hierarchies). We found most social species (those species observed with subordinates in the corals) had evidence of size based hierarchies. Next we tested two constraints known to limit group sizes in other closely related fishes displaying size hierarchies (Buston, 2003a, Kuwamura et al., 1994, Mitchell and Dill, 2005, Wong, 2011). We found compelling evidence that coral size was the main factor constraining group sizes in Gobiodon. On the other hand, SLα had little effect on group size in the vast majority of species tested. Finally, we examined the extant distribution of sociality in the genus and assessed the ancestral states of sociality. This analysis showed that sociality is randomly distributed and likely arose multiple times throughout the evolutionary history of the genus. This study represents the most comprehensive assessment of sociality in the genus Gobiodon to date and may serve as a template for future research of sociality in other taxa.

58 3.5.1 Comparison of quantification methods There was reasonable agreement in ranked sociality of each species between the two methods used to quantify sociality (mean group size and sociality index). There was perfect agreement on the ranking of G. axillaris (least social species), G. erythrospilus and G. fuscoruber. Both metrics also agreed on the 5 most social species, G. acicularis, G. citrinus, G. fuscoruber, G. rivulatus and the unknown hybrid (though the exact order varied). This level of correlation indicates that each method produced a different order of species when ranked from most to least social, but there was some agreement.

The reasonable level of correlation between the two measures indicates that mean group size alone may be a reasonable proxy for sociality in this genus. Group size however, is only one aspect of sociality. Group size on its own does not take into account group structure or social behaviour. For example, using mean group size as a measure of sociality, a loose aggregation of animals with multiple breeders (i.e. a communal breeding system) could be considered equally as social as a group of cooperatively breeding animals with the same group size, but with a monogamous pair of breeders and a number of subordinates who cooperate to raise young. The cooperatively breeding group could be argued as more socially complex owing to reproductive suppression of subordinates and cooperative rearing of young (e.g. Blumstein and Moller, 2008, Creel and Waser, 1994, Heg et al., 2011), but viewed through the lens of mean group size, is socially equivalent to a loose aggregation of similar size. The sociality index proposed by Avilés and Harwood (2012), on the other hand, provides a more nuanced measure of sociality than mean group size alone. It indirectly takes group size into account, but also accounts for the proportion of time spent in a group and the number of non-breeding subordinates in the population. These last two components account for delayed dispersal, reproductive suppression of subordinates and the tendency of subordinates to remain philopatric, important factors in group formation and maintenance (Koenig et al., 1992, Kokko and Ekman, 2002, Komdeur, 1992, Stacey and Ligon, 1991). Using the previous example of a loose aggregation and a group of cooperatively breeding animals of similar group size, the loose aggregation would have a smaller number of non-breeders in the group and the index value would therefore be lower than that of the cooperatively breeding group.

We made several assumptions about Gobiodon groups and it should be noted that a more accurate calculation of the social index might be possible if the actual non-breeding status of subordinates could be confirmed and the proportion of the life-cycle spent in a group was accurately measured. In the case of coral gobies, we made an a priori assumption that all groups consisted of a single pair of monogamous breeders and one or more non-breeding subordinates. This is consistent with size-based hierarchies observed in two species of Paragobiodon (Kuwamura et al., 1994, Wong, 2011), the sister taxon to Gobiodon (Herler et al., 2009). Histological analyses of whole groups of all species are clearly required to clarify mating and social systems in this genus and hence a more accurate assessment of the sociality index. Non-breeding status could also be determined by long-term observation of groups. Proportion of life-cycle spent in the group would have to be obtained through observation. Data collection would take substantially more time if these variables were to

59 be measured. We feel however that the assumptions we made for Gobiodon were biologically realistic and the indices we calculated were therefore a good reflection of sociality (Hing et al., 2018).

3.5.2 Social organization Our results demonstrate that size based hierarchies are possible in most species of social Gobiodon (i.e. those species observed in groups of three or more fish). However, further observation of dominance behaviours would be required to verify whether dominance rank is equivalent to size rank. Gobiodon erythrospilus and G. fuscoruber displayed little evidence of size based hierarchies, despite several observations of larger groups. However, there was a downward trend of body size with increasing rank in the individual groups of these species. Additional observations of larger groups of these species would clarify whether size based hierarchies are present or not. If size hierarchies are truly absent in these species, size differences between dominant and subordinate group members would be small. This could result in subordinates with similar competitive abilities to dominants and possibly plural breeding. Thompson et al. (2007) suggested that this may occur in G. okinawae and G. quinquestrigatus. However, our study indicated G. okinawae rarely formed groups while G. quinquestrigatus showed strong evidence of size based hierarchies (indicative of high reproductive skew within the group).

3.5.3 Constraints on group size and social organization Previous research on two closely related species of coral goby, (Paragobiodon xanthosoma, Wong, 2011, Paragobiodon echinocephalus, Kuwamura et al., 1994) and other species of habitat specialist fishes, that display size based hierarchies (Amphiprion ocellaris, Mitchell and Dill, 2005, Amphiprion percula, Buston, 2003a), indicate that habitat patch size, length of the largest individual in the group and the size ratio between adjacently ranked subordinates were important determinants of group size in these species. Coral size was the only significant predictor of group size in the full model for three species (G. fuscoruber, G. oculolineatus and G. rivulatus). No other significant predictors of group size were evident in the remaining species. Coral size significantly predicted SLα in four species (G. brochus, G. erythrospilus, G. histrio and G. quinquestrigatus), but SLα was not a predictor for group size in these species. It is possible that the majority of corals for these species were under-saturated at the time of observation and the full group size – habitat patch size - SLα relationship had not fully developed as reported for other species of habitat specialist fishes (Buston, 2003a, Kuwamura et al., 1994, Mitchell and Dill, 2005, Wong, 2011). It is also feasible that other factors, not measured in this study, contributed to sociality in these species. Identifying any other factors which influence sociality will be of great importance to understanding the evolution of sociality in this genus.

We found that coral size was the most significant predictor of group size in three species of Gobiodon (G. fuscoruber, G. oculolineatus and G. rivulatus). Gobiodon fuscoruber and G. rivulatus were also two of the top five most social species determined by both mean group size and sociality index. Standard length of α was not a significant predictor for group size when included in the same model. This contrasts with other species of habitat specialist fish (A. percula, A. ocellaris, P. echinocephalus and P. xanthosoma), which form

60 size based hierarchies (Buston, 2003a, Kuwamura et al., 1994, Mitchell and Dill, 2005, Wong, 2011). In a size based hierarchy, there are a discrete number of subordinates that can reside within a group and this is determined by the size of the largest individual and the size ratio between adjacent ranks. The length of α may be dependent upon the habitat patch size in habitat specialist fishes (Buston and Cant, 2006, Kuwamura et al., 1994). Habitat patch size therefore appears to have an indirect effect on group size in these species. However we found that habitat patch size was the main effect on group size in three of our species. Interestingly, one of these species (G. fuscoruber) showed little evidence of a size based hierarchy (discussed below) which could explain why there is little dependence on SLα in this species.

Five species (G. brochus, G. erythrospilus, G. fuscoruber, G. histrio and G. quinquestrigatus) showed a significant relationship between SLα and coral size indicating the length of the largest individual in the group was dependent on coral size. However, only G. fuscoruber displayed any relationship with these variables and group size when they were all included in the model and only coral size was a significant predictor of group size. The other four species showed no relationship between group size, coral size and SLα. This suggests that coral size may determine the size of the largest individual in these species, but neither coral size nor SLα has an impact on group size. With the exception of G. erythrospilus and G. fuscoruber, the other three species displayed quite convincing evidence of size based hierarchies in their groups. It is possible that corals for these species had not reached their carrying capacities and thus the relationship between group size, coral size and SLα had not fully developed in the majority of observed groups. It is also distinctly possible that factors other than coral size and SLα, not measured in this study, have a strong influence on group size in these species. For example, life-history factors such as longevity or benefits of philopatry, among other effects, have been shown to have strong influences on the evolution of sociality in a broad range of taxa (e.g. Chapple, 2003, Hatchwell and Komdeur, 2000, Stacey and Ligon, 1991, Wong, 2010) and would be important avenues for future research on sociality in these species.

Of the remaining three species for which there was no relationship between any of the measured variables, G. acicularis inhabited relatively large corals compared to its congeners and was observed very frequently in groups of three or more individuals. The relationship between group size, coral size and SLα likely broke down in this species because of the much larger coral sizes. However, this species obviously has a preference for group formation. G. ceramensis was rarely observed in groups of three or more individuals and when they were, they were in intermediate sized corals while solitary individuals and pairs were frequently observed in larger corals. This likely indicates a preference for pair-formation in G. ceramensis. Gobiodon okinawae also tended to inhabit larger corals and was one of only two species regularly observed to co-habit host corals with other species (G. fuscoruber was the other species displaying co-habitation behaviour). Thompson et al. (2007) determined that the group size – coral size relationship broke down for G. okinawae due to increased mobility. Based on our own observations, this seems a likely explanation as G. okinawae was regularly observed swimming outside its coral host, only returning to the safety of the branches when approached. It is possible that this species does not display the strict coral preferences observed in other

61 Gobiodon species (Munday et al., 1997) and may instead visit multiple host-corals within an area. This would certainly obscure a relationship between group size and coral size.

3.5.4 Ancestral state reconstruction Our ancestral reconstruction of sociality in the coral gobies, Gobiodon indicates that sociality appears to have arisen multiple times in the Gobiodon genus. In contrast to several other vertebrate groups in which there is evidence for a phylogenetic signal of sociality our findings suggest that other factors, such as ecology or life- history, likely have a strong impact on which species display sociality at any given time (Hing et al., 2019, Kruckenhauser et al., 1999, Nowicki et al., 2018, Shultz et al., 2011). In support of this, Hing et al. (2018) showed the mean group size of social species of Gobiodon displayed plastic responses following multiple major ecological disturbances suggesting sociality may be quite flexible in Gobiodon species rather than phylogenetically constrained.

While Hing et al. (2018) did not delve into any species-specific trends, it is possible that the observed social plasticity was driven by a few key species. Our ancestral reconstruction of sociality using two different social cut-off values showed that three species, G. erythrospilus, G. histrio and G okinawae changed categorization from pair- to group-forming. While we cannot infer plasticity in the trait from this artificial manipulation of the sociality cut-off, these three species have a social index close to 0.5, the value which Hing et al. (2018) chose as a biologically meaningful cut-off value. These particular species have social indices close to 0.5 because there was a relatively even proportion of groups and pairs in the population. This indicates a certain level of social plasticity in these species – when conditions allow, they will form groups, but they are also able to survive as a breeding pair. These species are therefore prime candidates for further study of social plasticity.

Our results demonstrate that sociality is randomly distributed throughout the genus Gobiodon and likely arose multiple times over its evolutionary history. Such a pattern is unlikely to occur in taxa with a strong phylogenetic signal of sociality (but see: Nowicki et al., 2018, Agnarsson, 2002, Schneider and Kappeler, 2014, Smorkatcheva and Lukhtanov, 2014 for examples of taxa with a strong phylogenetic signal of sociality). Our results are consistent with those of Hing et al. (2019) which demonstrated there was conflicting evidence of a phylogenetic signal of sociality in the Gobiodon genus. In species with low phylogenetic signal we would expect factors other than shared ancestry to have a strong influence on sociality.

Ancestral reconstruction of sociality showed that the probability of pair- or group-forming ancestors was equally likely at each node throughout the phylogeny. This strongly suggests that factors other than shared ancestry influence the extant social state of each species. In support of this, sociality (group-forming) appears to be randomly distributed throughout the genus. Hing et al. (2019) showed that there was little evidence for shared ancestry of sociality in the genus and a combination of coral size and fish length best predicted sociality in the genus.

62 3.6 Conclusions Sociality is a complex, multifaceted concept (Goodson, 2013). While this is widely accepted, it is common practice to study ‘sociality’ by single measures. The most common of these is group size. Here, we have shown that there is reasonable correlation between mean group size and a more complex sociality index which measures multiple aspects of sociality (Avilés and Harwood, 2012). Group size is a critical component of sociality and appears to be a reasonable measure of ‘sociality’ in coral gobies. However, we must recognise that group size alone does not tell the whole story as it does not allow inference about breeding systems, social behaviours or social organization (among a myriad of other features) – all important aspects of sociality. While group size may well offer a decent indication of sociality in many taxa, we nevertheless recommend researchers acknowledge it is a proxy and only one aspect of a complex concept. We have attempted a comprehensive assessment of sociality in the genus Gobiodon taking into account group size, a sociality index (which accounts for social behaviours such as delayed dispersal, philopatry and tolerance of subordinates), size structuring within groups (which provides insight into social organization and the breeding system), possible constraints on sociality and the overall distribution of sociality in the genus. While we recognize improvements could be made to our methodology, we anticipate future researchers could apply this comprehensive approach to the study of sociality on a broad range of taxa and thus provide a detailed understanding of sociality and stimulate new insights into its evolution and maintenance.

63 4 Drivers of sociality in Gobiodon fishes: An assessment of phylogeny, ecology and life-history

Published as: Hing, M. L., Klanten, O. S., Wong, M. Y. L., & Dowton, M. (2019). Drivers of sociality in Gobiodon fishes: An assessment of phylogeny, ecology and life-history. Molecular Phylogenetics and Evolution, 137, 263-273.

4.1 Abstract What drives the evolution of sociality in animals? Many robust studies in terrestrial organisms have pointed toward various kinship-based, ecological and life-history traits or phylogenetic constraint which have played a role in the evolution of sociality. These traits are not mutually exclusive and the exact combination of traits is likely taxon-specific. Phylogenetic comparative analyses have been instrumental in identifying social lineages and comparing various traits with non-social lineages to give broad evolutionary perspectives on the development of sociality. Few studies have attempted this approach in marine vertebrate systems. Social marine fishes are particularly interesting because many have a pelagic larval phase and non-conventional life-history strategies (e.g. bi-directional sex-change) not often observed in terrestrial animals. Such strategies provide novel insights into terrestrially-derived theories of social evolution. Here, we assess the strength of the phylogenetic signal of sociality in the Gobiodon genus with Pagel’s lambda and Blomberg’s K parameters. We found some evidence of a phylogenetic signal of sociality, but factors other than phylogenetic constraint also have a strong influence on the extant social state of each species. We then use phylogenetic generalized least squares analyses to examine several ecological and life-history traits that may have influenced the evolution of sociality in the genus. We found an interaction of habitat size and fish length was the strongest predictor of sociality. Sociality in larger species was more dependent on coral size than in smaller species, but smaller species were more social overall, regardless of coral size. Finally, we comment on findings regarding the validity of the species G. spilophthalmus which arose during the course of our research. These findings in a group of marine fishes add a unique perspective on the evolution of sociality to the excellent terrestrial work conducted in this field.

4.2 Introduction The question of how sociality first arose in animals has attracted much attention in the fields of evolutionary ecology and animal behaviour. Many mechanisms are thought to contribute to the evolution of sociality including ecological factors, life-history traits and phylogeny (Arnold and Owens, 1998, Emlen, 1982a, Hamilton, 1964b, Hatchwell and Komdeur, 2000, Hing et al., 2017, Kokko and Ekman, 2002). These features are not mutually exclusive and may be highly dependent on each other (Arnold and Owens, 1998, Chapple, 2003). Hamilton’s rule predicts that sociality should evolve under certain combinations of relatedness and costs and benefits of social actions and is widely regarded as a universal framework to study social evolution (Bourke, 2014, Hamilton, 1964b). Ecology, life-history and relatedness change the costs and

64 benefits conferred to individuals within the group. Under this framework, individuals should receive greater inclusive fitness benefits if they form social groups with close relatives (Briga et al., 2012, Hughes et al., 2008). Groups consisting of unrelated individuals are also possible if ecological or life-history factors alter the direct costs and benefits of group living such that the benefits outweigh the costs (e.g. Buston et al., 2007, Riehl, 2011).

Phylogenetic relationships among taxa can constrain the evolution of sociality which may predispose species to sociality (e.g. Agnarsson, 2002, Nowicki et al., 2018, Schneider and Kappeler, 2014, Smorkatcheva and Lukhtanov, 2014). However, the extant state of sociality may depend on various ecological and life-history conditions (Chapple, 2003, Rubenstein and Lovette, 2007, Schürch et al., 2016). For example, altered environmental conditions and extreme weather events could reduce habitat sizes for a normally social species, increasing animal density and increasing conflict within the group ultimately leading to a reduction in sociality (Hing et al., 2018). On the other hand, some species in which sociality has a strong phylogenetic signal (that is, sociality is highly constrained), may maintain their sociality regardless of other factors (Kruckenhauser et al., 1999, Nowicki et al., 2018, Shultz et al., 2011). In either case, understanding the strength of the relationship between phylogeny and sociality can help us to understand what role phylogeny played in the evolution of sociality.

The majority of studies of sociality have been conducted on birds, mammals and invertebrates wherein subordinates are usually related to dominants and display natal philopatry (Bourke, 2011, Hing et al., 2017, Jennions and Macdonald, 1994, Jetz and Rubenstein, 2011, Rubenstein and Abbot, 2017). Habitat specialist fishes on the other hand provide a unique opportunity to study social evolution as they often reside in groups with low relatedness due to a pelagic larval phase (contrary to most terrestrial species; Avise and Shapiro, 1986, Buston et al., 2007, but see Buston et al., 2009). In particular, coral gobies of the genus Gobiodon are ideal for testing hypotheses about sociality as they display a wide variety of social phenotypes (Thompson et al., 2007, Wong et al., 2007), are easily observed because they occupy discrete habitat patches (Wong and Buston, 2013) and their phylogenetic relationships are reasonably well established (Duchene et al., 2013, Hing et al., 2017).

Several previous studies have examined phylogenetic relationships among species of Gobiodon (Agorreta et al., 2013, Duchene et al., 2013, Harold et al., 2008, Herler et al., 2009, Thacker and Roje, 2011). However, these studies have focused on relationships within the genus or more broadly at the family level (Gobiidae). To date, no studies have investigated the phylogenetic patterns of sociality in this genus. Duchene et al. (2013) examined the coevolution of Gobiodon species with their host corals and provides the most recent and comprehensive phylogeny of the Gobiodon genus. Likewise, there have been a number of studies investigating the causes and consequences of sociality in coral gobies (Gobiodon and Paragobiodon), but these studies have often focussed on a single species or a subset of species within the genus (Hing et al., 2018, Hobbs and Munday, 2004, Hobbs et al., 2004, Munday et al., 2006, Thompson et al., 2007, Wong, 2011, Wong, 2010, Wong et al., 2007). Furthermore, no studies so far have examined the relationship

65 between sociality and ecological and life history traits across the genus Gobiodon while controlling for phylogeny, and hence tested key hypotheses of social evolution.

In this study we resolved the phylogenetic relationships within the genus Gobiodon at Lizard Island (Great Barrier Reef, Queensland, Australia) using seven molecular markers. Our reconstruction builds on the inferred phylogeny of Duchene et al. (2013) by increasing the number of molecular markers used, thereby inferring a phylogenetic tree with greater confidence. We then assessed the phylogenetic signal of sociality in the genus. Given previous work on Gobiodon demonstrated plasticity in social organization in response to extreme weather events (Hing et al., 2018), we expected to find a relatively weak phylogenetic signal of sociality. However, we did not know a priori what the strength of the signal would be and hence the extent to which shared evolutionary history of species would contribute to present day patterns of sociality. We therefore tested a range of ecological and life-history characteristics with phylogenetic structure in the models to assess the role these factors might have played in the evolution of sociality in Gobiodon.

Previous studies have shown significant relationships between group size and the factors of habitat size and body size in closely related species of coral gobies and more broadly in other species of habitat specialist fish (Amphiprion percula, Buston, 2003b, Paragobiodon, Gobiodon and Eviota, Thompson et al., 2007, Paragobiodon xanthosoma, Wong, 2010). Most of the species in these previous studies form size based social hierarchies and habitat size and body size have been shown to predict group size in these species. A similar relationship has also been demonstrated between sociality and ecological generalism in snapping shrimp (Brooks et al., 2017). Coral gobies are generally considered to be highly specialized in their choice of corals (Munday et al., 1997). However, we observed considerable variation in coral choice for some species, especially after extreme weather events (Hing et al., 2018). We also observed some variation in social structure and therefore aimed to investigate whether a relationship existed between sociality and host generalization. Hence, we specifically focused on two ecological variables: i) host-coral size and ii) host coral generalization (the ability to inhabit a broad range of host coral species), and one life-history variable iii) body size, and assessed their relationship with sociality.

Finally, we present findings on Gobiodon spilophthalmus concerning its phylogenetic placement, which arose during our analyses. This is the first study to assess the phylogenetic basis and ecological and life history correlates of sociality in Gobiodon and therefore provides an important starting point for understanding the evolution of sociality in marine fishes.

4.3 Methods 4.3.1 Ethics approvals and research permits All research activities for this study were conducted with the approval of the University of Wollongong Animal Ethics Committee (AE14-04, AE14-29). We conducted our research in the Great Barrier Reef Marine Park under permits G13/36197.1 and G15/37533.1.

66 4.3.2 Field Sampling Tissue samples of fifteen species of Gobiodon were collected from 23 sites around Lizard Island between February - March 2014 and January – February 2016 (Table 4.1, Fig 4.1). However, G. spilophthalmus was removed from the analyses as barcoding analysis of the CO1 gene demonstrated the individuals collected were likely juvenile specimens of G. acicularis and G. ceramensis (Section 4.4.4). We searched all species of Acropora, Stylophora, Seriatopora and Echinopora known to host Gobiodon fishes along 30 m transects in the study area (Munday et al., 1999). Transects were placed haphazardly at each site and only used as a reference to aid in the relocation of tagged corals (i.e. transects were not used for any kind of spatial analysis). In total, 21 species of coral were recorded.

Fig 4.1: Map of study sites at Lizard Island, Australia. Dotted lines indicate reef structure. Site names are in regular font. Numbered sites are: Big Vickey’s Reef (1); Vickey’s Reef (2); Horse Shoe Reef (3); Palfrey Reef (4 – 4a); Loomis Reef (5); Trawler (6); Picnic Beach (7); Ghost Beach (8); Bird Island Reef (9); Entrance Bommie (10); Bird Bommie (11); Lizard Head Reef (12).

68 Corals were searched by divers with the aid of an underwater light for the presence of gobies. Corals hosting gobies were identified to species and measured along three axes (length, width and height: Hing et al., 2018). Gobies were removed from the corals by anesthetising them with a clove oil solution and creating a current by hand (Munday and Wilson, 1997). The species and number (group size) of captured fish was recorded and brought to a boat for processing. On the boat, fish were placed into a large container of regularly refreshed seawater to maintain constant temperature and aeration. Each fish was anesthetised and measured to the nearest 0.01 cm with vernier callipers and a small caudal fin clip (~1-2 mm) of each individual was preserved in ethanol. After processing, fish were released back to their original coral of capture.

4.3.3 Ecological and life-history factors Coral size was calculated as the simple average diameter, (L + W + H)/3 as it provides a good representation of the major axis of the coral (Kuwamura et al., 1994). Ecological generalisation was assessed as the number of host-coral species each goby species was observed to occupy. We added observations from three subsequent field trips between August 2014 and February 2016 for the ecological generalisation analyses as two cyclones impacted the study site over this period (Hing et al., 2018). We reasoned that these impacts had the potential to alter normal patterns of residency and species adhering to a ‘specialist’ strategy would possibly broaden their host-species range under extreme circumstances. We therefore wished to capture any variation these disturbances caused for this analysis.

Body size was chosen as a life-history trait of interest for this study. We measured the standard length (tip of the snout to caudal peduncle) of each individual. Standard length was used rather than total length as many individuals had sustained damage to the caudal fin and an accurate measure of total length could not be obtained.

4.3.4 Sociality index We used a sociality index proposed by Avilés and Harwood (2012). The index is an average for each species, of the proportion of groups in the study population, proportion of subordinates in the study population and proportion of the life-cycle spent in a group. The proportion of the life-cycle spent in a group may be an important indicator of delayed dispersal in some species. However, coral gobies undergo a pelagic larval phase prior to joining a group where they typically remain in a social queue to obtain breeding status (i.e. they do not delay dispersal, but do tend to remain in a group once settled). Therefore, we assumed the proportion of the life-cycle spent in the group was 1 for all species and the main variation in sociality in coral gobies was caused by the remaining two components of the sociality index. The proportion of groups in the study population is indicative of a species’ tendency to form groups, while the proportion of subordinates in the study population (associated with the proportion of groups) is an indication of behaviour in terms of the subordinate’s willingness to join a group and the dominant member’s willingness to tolerate them. The social index ranges from 0 to 1. Raw index values were used in the Generalized Least Squares analyses (Section 4.3.9).

69 Table 4.1: Goby species observed at Lizard Island with number of tissue samples obtained. Number of host- coral species was used as a measure of host-generalization. Mean standard length (SL) and host-coral size (CS) were calculated for each species. Tissue Samples Coral species Mean SL Mean CS Goby spp (n) inhabited (n) (cm) (cm)

G. acicularis 3 1 1.91 55.20

G. aoyagii† 3 2 2.49 26.41

G. axillaris 3 4 3.09 23.76

G. brochus 4 9 2.54 16.50

G. ceramensis 6 2 2.69 27.23

G. citrinus 3 3 2.79 91.49

G. erythrospilus 3 11 2.60 23.31

G. fuscoruber†† 4 10 2.75 29.95

G. histrio 3 10 2.80 23.22

G. oculolineatus 3 9 2.44 23.86

G. okinawae 3 11 2.12 43.95

G. quinquestrigatus 6 11 2.49 21.33

G. rivulatus 3 8 1.65 21.70

G. spilophthalmus c.f.‡ 6 - - -

G. species D 3 1 2.84 27.33

P. xanthosoma 1 1 1.72 26.53

† G. aoyagii was previously referred to as G. species A as a placeholder but has now been formally described by Shibukawa et al. (2013). †† G. unicolor (sensu Munday et al., 1999) was reassigned as G. fuscoruber by Herler et al. (2013). ‡ Measurements of ecological and life-history factors were not obtained for G. spilophthalmus c.f. as they were determined to be juveniles of other species and excluded from analyses.

4.3.5 DNA extraction, amplification and sequencing DNA was extracted from fin clips for two to three individuals of each species of Gobiodon and one individual Paragobiodon xanthosoma which was used as an outgroup to the Gobiodon genus (Table 4.1). We used a standard Proteinase-K salting out procedure to extract DNA (Aljanabi and Martinez, 1997). DNA was resuspended in 20-50 µl of TE solution (1 mM Tris-HCl, 0.1 mM ethylenediaminetetraacetic acid [pH 8])

70 and stored at 4 oC. We amplified nuclear recombination activating gene 1 (RAG1), nuclear zinc finger protein of the cerebellum 1 (ZIC1) and the mitochondrial cytochrome c oxidase subunit 1 (CO1) gene using generic fish primers for each gene (primer sequences available in Supplementary Table 4.1; Holcroft, 2005, Li et al., 2007, Ward et al., 2005 respectively). Where weak amplification occurred, goby specific primers were designed using an alignment of the appropriate gene region made up of sequences obtained from species which showed strong amplification (Supplementary Table 4.1). Polymerase Chain Reactions (PCRs) were performed using MyTAQ Polymerase (Bioline, Australia) in accordance with the manufacturer’s instructions. The PCR conditions consisted of 2 minutes at 95 oC, 35 cycles of 1 minute at 94 oC, 1 minute at 45 - 65 oC (optimised for each gene and species), 1 minute at 72 oC and a final elongation of 5 minutes at 72 oC. PCR products were checked for length and strength of amplification using 1% agarose gel electrophoresis. ExoSAP-IT (GE Healthcare, Bucks, UK) was used to treat each PCR product prior to sequencing using the ABIPRISM BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Australia). Each PCR product was sequenced in both the forward and reverse direction.

4.3.6 Sequence Alignment Alignment of RAG1, ZIC1 and CO1 genes was trivial, because there were no internal indels in the alignment – both ClustalW and MUSCLE (within MEGA7; Kumar et al., 2016) produced alignments with only leading and trailing gaps, where the length of reliable sequence was slightly different. The default settings for both ClustalW and MUSCLE were used.

Once COI, RAG1 and ZIC1 sequences had been obtained for 2 to 3 individuals of each species, consensus sequences were established using Bioedit (Hall, 1999). We then constructed additional consensus sequences for 12S and 16S rRNA genes (obtained from GenBank, accession numbers available in Supplementary Table 4.2) for the species in our study and obtained further consensus sequences for the nuclear ribosomal protein S7 Intron 1 chromosome 2 (S7I1) gene and mitochondrial cytochrome b (cytb) from GenBank (Supplementary Table 4.2; Duchene et al., 2013, Harold et al., 2008, Herler et al., 2009). All seven genes (RAG1, ZIC1, S7I1, COI, cytochrome b, 12S and 16S) were concatenated for each species.

4.3.7 Phylogenetic analysis Partitioning schemes and nucleotide substitution models were established with PartitionFinder version 1.1.1 (Lanfear et al., 2012) using the corrected Akaike Information Criterion (AICc) and a heuristic search algorithm with branch lengths unlinked. We performed the analysis on 7 datablocks, one for each gene. Priors for the branching process and times were set as follows: the tree prior was a Yule model, the birth rate had a uniform prior, as did the clock rates for each of the gene partitions. A strict clock was set for each partition, but the clock rate was unlinked between partitions. Phylogenetic trees were then inferred from Bayesian analysis conducted on BEAST2 v2.4.2 (Bouckaert et al., 2014, Drummond et al., 2012) in which unlinked partitions and a Markov Chain Monte Carlo (MCMC) process with a chain length of 100 million was specified. No calibration information was used as we only wished to examine relative estimates of branching times. Separate BEAST analyses were also conducted on the concatenated mitochondrial data

71 (since the mitochondrial genes represent a single, linked locus), and each nuclear gene fragment. These trees are reported in the supplementary phylogenetic trees. The trees recovered from the individual nuclear gene analyses were generally poorly resolved, with many nodes having low posterior probability support. This is not surprising given the relatively small size of these datasets. The mitochondrial tree was well resolved (with high posterior probability support), but differed in the placement of one clade (i.e. Fig 4.3, clade B) when compared with the ‘full data’ set. We focus here on the ‘full data’ set, because it is larger and contains information from multiple (mitochondrial and nuclear) sources.

Stationarity was assessed with Tracer v1.6 (Rambaut et al., 2018). In initial BEAST analyses, stationarity was not reached after 100 million generations (expected sample sizes (ESS) values generally less than 200), primarily because some parameter values were very close to zero. However, when the nucleotide substitution model for 6 of the 7 gene partitions was simplified (from GTR to HKY; in one of the gene partitions, PartitionFinder suggested JC69, and this was kept as JC69), stationarity was reached after 100 million generations, with all EES values greater than 200. A maximum likelihood analysis was also conducted using “Randomized Axelerated Maximum Likelihood” (RAxML) version 8 (Stamatakis, 2014). The Gamma model of rate heterogeneity was used with branch lengths optimized per gene and the proportion of invariable sites estimated. A maximum likelihood search was then applied to find the best scoring tree.

4.3.8 Phylogenetic signal Phylogenetic signal of sociality was calculated in R using the phylosig() function of the phytools package (Revell, 2012). We used the social index for each species and the Bayesian summary tree for the analyses. We calculated both Pagel’s lambda (Pagel, 1999) and Blomberg’s K (Blomberg et al., 2003) statistics and produced tests against a null hypothesis of no phylogenetic signal using a likelihood ratio test and randomization test respectively.

4.3.9 Phylogenetic Generalized Least Squares models Phylogenetic Generalized Least Squares was used to assess relationships between sociality and ecological and life-history traits while taking into account phylogenetic non-independence between species. Sociality index was the dependent variable and the ecological and life-history traits were included as main and interacting effects. We used a summary of the Bayesian inferred phylogenetic tree for this analysis. All pGLS analyses were conducted using the nlme package in R (Pinheiro et al., 2018). Four models of trait evolution (Brownian motion, Pagel’s Lambda, Blomberg ACDC and Ornstein-Uhlenbeck) available in the ape package (Paradis et al., 2004) were applied to each of the relationships. As we had no a priori expectations of the type of selection sociality might be under, we chose the best model to present by comparing Akaike’s Information Criterion (AIC). An analysis of deviance was conducted using the Car package (Fox and Weisberg, 2011) on the best model to identify factors that significantly deviated from the null model.

72 4.3.10 Gobiodon spilophthalmus Gobiodon spilophthalmus was first described by Fowler (1944). However this description was based upon a single preserved specimen. We therefore based our identification on Munday et al. (1999) who provide a live specimen photo and describe G. spilophthalmus as uniform black in colour and only distinguishable from G. ceramensis (also uniform black as adults) in the juvenile phase. The juveniles of G. spilophthalmus are white with black stripes along the body and black spots on the head (Fig 4.2 (i)). We collected specimens morphologically similar to those depicted in Munday et al. (1999) as G. spilophthalmus. During collection, we noted a small G. ceramensis changed colour upon capture from uniform black to the black and white stripes and spots similar to that described for juvenile G. spilophthalmus. This was observed again in 2019 by colleagues at One Tree Island, Australia (Froehlich pers. comm.; Fig 4.2 (v)). These observations prompted a closer examination of our G. spilophthalmus c.f. specimens. G. spilophthalmus c.f. specimens were found on the coral species Seriatopora hystrix and Echionopora horrida which are also inhabited (almost exclusively) by G. ceramensis and G. acicularis respectively (Fig 4.2 (iii, iv) photos). Other G. spilophthalmus c.f. specimens were sometimes observed associating with groups of G. ceramensis or G. acicularis. To investigate this further, we sequenced the barcoding region (COI) of individuals resembling G. spilophthalmus from independent colonies of S. hystrix and E. horrida, and compared them with individuals of G. ceramensis and G. acicularis. First, we conducted an Automatic Barcode Gap Discovery (ABGD) analysis which groups COI sequences into hypothetical species based on automatic detection of the ‘barcode gap’, the natural break in sequence divergence that occurs when within-species divergence is compared to between-species sequence divergence (Puillandre et al., 2012). We used the default settings and Kimura 2-P (K80) distances. We then conducted a Bayesian phylogenetic analysis of the COI gene of G. acicularis, G. ceramensis and G. spilophthalmus c.f. using BEAST2. In this analysis we coded each individual with the species of coral it was collected from. We used the same methods described above (sections 4.3.6 and 4.3.7) for sequence alignment and Bayesian analysis to infer a gene tree for this species group using G. okinawae as an outgroup. Furthermore, Gobiodon heterospilos is described as similar in appearance to G. spilophthalmus but lacking the black body stripes (presumably in the juvenile phase; Munday et al., 1999). Steinke et al. (2017) deposited three COI sequences on the BOLD database for G. heterospilos from Lizard Island, however the photo attached to the only juvenile in their collection (BOLD record LIFS847-08) clearly possesses black body stipes. We therefore conducted a second Bayesian phylogenetic analysis using the same methods described above (sections 4.3.6 and 4.3.7) of our specimens of G. acicularis, G. ceramensis, G. spilophthalmus c.f. and the G. heterospilos sequences deposited by Steinke et al. (2017) in order to determine if G. heterospilos c.f. could be differentiated from species identified in our collection.

Fig 4.2: Gobiodon spilophthalmus as depicted by Munday et al. (1999) (i) and G. heterospilos sample deposited by Steinke et al. (2017) on the BOLD database, record LIFS847-08 (ii). Specimens from our collection matching descriptions of juvenile G. spilophthalmus collected in 2014 from Seriatopora hystrix (iii) and Echinopora horrida (iv). A small G. ceramensis transitioning from the suspected juvenile spots and stripes pattern to the uniform black adult phase (v).

74 4.4 Results Our results suggest a combination of ecological and life-history factors contributed to the evolution of sociality in the Gobiodon genus, but sociality by itself also has some evidence of a phylogenetic signal. Phylogenetic analyses by two methods inferred identical species composition of four clades giving high confidence in the phylogenetic tree used for pGLS analyses. Phylogenetic generalized least squares analyses then demonstrated coral size and mean body size of the species likely have a strong influence on the extant social state of a species (Section 4.4.3).

4.4.1 Phylogenetic inference Both analyses; Bayesian and maximum likelihood, produced four clades (A-D; Fig 4.3) containing exactly the same Gobiodon species within each clade. The main difference between both analyses was the Bayesian tree inferred 2 main sister groups (A/B and C/D sister clades) with strong support (posterior probability 1.00) while the maximum likelihood tree was unresolved at the base of each sister clade (bootstrap support <50). However it still produced the same 4 clades with the same configuration. The two main sister groups inferred with the Bayesian tree each in turn formed two sister clades: clade A and B with moderate support (posterior probability 0.79) and the sister clades of C and D with strong support (posterior probability 0.99). Clade A resolved G. acicularis and G. ceramensis as sister species (posterior probability 1.00), and contained two other species, G. okinawae (posterior probability 1.00) and G. citrinus (posterior probability 1.00) (Fig 4.3). The species G. oculolineatus, G. quinquestrigatus, G. species D and G. rivulatus made up clade B with G. quinquestrigatus and G. species D as sister taxa (posterior probability 1.00) (Fig 4.3). Clade C contained a single sister species group made up of G. aoyagii and G. brochus (posterior probability 0.99) (Fig 4.3). Clade D contained two sister species groups, the first consisting of G. histrio and G. erythrospilus (posterior probability 1.00) and the second consisting of G. fuscoruber and G. axillaris (posterior probability 1.00) (Fig 4.3).

Fig 4.3: Phylogeny of Gobiodon present at Lizard Island based on 7 molecular markers (4 mtDNA; COI, cytb, 12S, 16S and 3 nuclear DNA; RAG1, ZIC1, S7I1) produced with Bayesian (i) and maximum likelihood (ii) methods. Node values in (i) are posterior probability where * indicates a value of 1. Node values in (ii) are bootstrap percentages where * indicates a value of 100.

In the maximum likelihood analysis, the node giving rise to the A/B/C group could not be resolved with any certainty (bootstrap support <50). However the configuration of the species within each clade was identical to the Bayesian analysis and resolved with moderate to strong bootstrap support (75 – 100). The strong support for the nodes within each clade in both analyses signifies reasonable confidence in the species composition of each clade. The Bayesian analysis produced a tree with very high posterior probabilities (with the exception of the node relating clades A and B). We therefore based all further analyses on the Bayesian analysis.

4.4.2 Phylogenetic signal There was some evidence of a phylogenetic signal of sociality in the Gobiodon genus. We found little evidence of a phylogenetic signal of sociality in the genus using Pagel’s lambda (λ = 0.614, P = 0.349). However, Blomberg’s K displayed some evidence of a phylogenetic signal of sociality (K = 0.802, P = 0.035). Although the value of K represents a relatively low signal, the significant test result indicates it was stronger than expected under a random distribution of the trait (sociality).

4.4.3 Phylogenetic generalized least squares There was a significant interaction between coral size and mean fish length in the pGLS model predicting sociality (analysis of deviance, df = 1, χ2 = 4.845, λ = 1.043, P = 0.028). The model predicted coral size would have little impact on sociality for smaller species, but smaller species would generally be more social

76 (social index approximately 0.75, Fig. 4.4). On the other hand, sociality in larger species was much more dependent on host-coral size (Fig 4.4). In other words, smaller species overall are predicted to be more social than larger species regardless of the size of coral they inhabit, whereas larger species are predicted to exhibit sociality only when corals are large.

Fig 4.4: Model predictions for the interacting effects of host-coral size and fish length on sociality index. Raw data are pair-forming species (circles) and group-forming species (triangles). Modelled species sizes, indicated by different line types (figure legend), range from 1.5 cm (solid) to 3.5 cm (dotted).

There were no significant interactions between coral size and host generalization or mean fish-length and host generalization on sociality in the respective models (df = 1, χ2 = 0.781, λ = 1.073, P = 0.377; df = 1, χ2 = 0.024, λ = 1.073, P = 0.878 respectively, Fig 4.5). This means there was no significant difference in the relationship between sociality and host-coral size between species that adhere to either specialist or generalist host strategies. Likewise, there was no significant difference in the relationship between sociality and fish- length between host-specialist and -generalist species. The main effect of host generalization alone was also non-significant (df = 1, χ2 = 0.063, P = 0.803) indicating that the ability to occupy a greater host-range is not likely to facilitate sociality in these species.

Fig 4.5: Interacting effects of mean coral size and host-generalization (a) and mean fish length and host- generalization (b) on sociality. Lines in a) are different average coral sizes from 10 cm (solid line) to 75 cm (dotted line). Lines in b) are different mean fish length from 1.5 cm (solid line) to 3.5 cm (dotted line). Both (a) and (b) raw data are individual species conforming to group-forming (triangles) or pair-forming (circles) strategies.

78 While the detection of a phylogenetic signal of sociality was somewhat unconvincing in the test of Pagel’s Lambda and Blomberg’s K (Section 4.4.2), the pGLS analyses showed a strong indication of phylogenetic signal (λ > 1). Taken together these results indicate there is some phylogenetic signal of sociality, but other effects (such as ecology and life-history) are probably equally, if not more important in determining the extant social state of a species.

4.4.4 Gobiodon spilophthalmus Our analyses revealed the G. spilophthalmus c.f. specimens were likely juveniles of G. acicularis or G. ceramensis depending on which coral species they were collected from. The ABGD analysis revealed two distinct species groups, with the G. spliophthalmus c.f. specimens collected from S. hystrix grouping with G. ceramensis and those collected from E. horrida grouping with G. acicularis. This pattern was also supported in the Bayesian analysis of these COI sequences (Fig 4.6). This phylogeny showed G. spilophthalmus c.f. grouping with both G. ceramensis and G. acicularis, depending on their respective host corals. Gobiodon ceramensis did split into two groups in this analysis, but HKY distances ranged from 0.2% to 0.7% indicating extremely low divergence in the COI sequences, a strong indication they should be considered a single species. When we included the G. heterospilos sequences deposited by Steinke et al. (2017) into a Bayesian phylogenetic analysis with our G. spilophthalmus c.f., G. ceramensis and G. acicularis specimens, the G. heterospilos samples were placed in the same groups as G. spilophthalmus c.f. (collected from S. hystrix) and G. ceramensis (posterior probability 0.999). We therefore suspect Steinke et al. (2017) understandably misidentified these specimens in their study and we did not include them in further analyses. These analyses indicate the specimens we collected, which were morphologically similar to G. spilophthalmus, were most likely juveniles of either G. ceramensis or G. acicularis and could be reliably differentiated by the species of coral they were collected from. We therefore did not include G. spilophthalmus in our broader phylogenetic analyses.

Fig 4.6: Phylogenetic tree produced with Bayesian analysis showing G. acicularis grouping with specimens resembling G. spilophthalmus, and the two groups of G. ceramensis also recovered with specimens resembling G. spilophthalmus. Node values are posterior probabilities. Values for internal nodes of each species group are not displayed as the placement of individuals within each group is irrelevant. Species names are abbreviated to acic (G. acicularis), spil (G. spilophthalmus c.f.), cera (G. ceramensis) and the outgroup, oki (G. okinawae). Letters immediately following each species abbreviation indicates the coral species the specimen was collected from; Echinopora horrida (E), Seriatopora hystrix (h) and Stylophora pistillata (p). The last three characters are an individual identifier. The outgroup was a consensus sequence (cons) of the COI gene.

4.5 Discussion Our analyses provide evidence of some phylogenetic signal of sociality in the coral-gobies, Gobiodon. In contrast to several other vertebrate groups which display strong phylogenetic signals of sociality, our findings suggest factors such as ecology, life-history or both, likely have a stronger impact on which species display sociality at any given time (Kruckenhauser et al., 1999; Nowicki et al., 2018; Shultz et al., 2011). In support of this, Hing et al. (2018) showed the mean group size of social species of Gobiodon displayed plastic responses following multiple major ecological disturbances, suggesting sociality may be quite flexible in Gobiodon species rather than phylogenetically constrained.

80 While Hing et al. (2018) did not delve into any species-specific trends, it is possible the observed social plasticity was driven by a few key species (e.g. G. acicularis, G. erythrospilus, G. fuscoruber, G. histrio and G. okinawae). These particular species have social indices close to 0.5 (the value exactly half-way between theoretically perfect sociality and completely solitary) because there was a relatively even proportion of groups and pairs in the study population (Hing et al., 2018). This indicates a certain level of social plasticity in these species – when conditions allow, they will form groups, but they are also able to survive as a breeding pair. These species are therefore prime candidates for further study of social plasticity.

Like many cryptobenthic fishes, Gobiodon species have a pelagic larval phase where the larvae are mixed with other nektonic organisms (Brandl et al., 2018). It therefore seems likely that relatedness within the group would be low, as for other marine fishes (Avise and Shapiro, 1986; Buston et al., 2007; but see Buston et al., 2009), although this is yet to be empirically tested. Low relatedness reduces the value of ‘r’ in Hamilton’s rule and hence the likelihood of sociality evolving, all else being equal (Bourke, 2014; Hamilton, 1964b). For sociality to evolve in such groups, there must therefore be other factors which alter the direct costs and benefits of group living. This was recently demonstrated in freshwater cichlids by Dey at al. (2017) who found direct benefits provided from group living, biparental care and diet type, were more influential than relatedness (associated with social monogamy) in the evolution of cooperative breeding, a complex form of sociality. This contrasts with many other vertebrate lineages which often form groups of closely related individuals and in which indirect (kin) benefits are likely to have heavily influenced the evolution of social groups (Bourke, 2014, Halliwell et al., 2017, Lukas and Clutton-Brock, 2012a, While et al., 2009, but see Riehl, 2013). This emphasis on direct costs and benefits represents an alternate pathway to complex sociality to the kinship-based pathway often proposed in the vertebrate literature. Alternatives such as this are worthy of further exploration as they offer novel insights into the evolution of sociality (Dey et al. 2017; Riehl, 2013).

We tested factors known to provide direct fitness benefits in other closely related species, namely the effects of host coral size, host coral generalization (ecological factors) and body size (life-history factor) on sociality (Buston, 2003b; Thompson et al., 2007; Wong, 2011). We found there was a significant interaction between host coral size and body size on the degree of sociality when phylogenetic correlation was accounted for. The relationship between host coral size and sociality was stronger for lager species. This makes intuitive sense as individuals of larger species would presumably take up more physical space in a coral. Hence, for larger bodied species to form groups, they would need to inhabit larger corals on average. On the other hand, smaller species could potentially form larger groups in a much larger size-range of corals before the habitat becomes saturated and group members are forced to disperse from the group. Group sizes of various social fish species are not only influenced by habitat size, however, and are instead related to size differences maintained between adjacent ranked individuals (Mitchell & Dill, 2005; Buston & Cant. 2006; Ang & Manica 2010b; Wong 2011). Thus, it is also possible that smaller bodied species of Gobiodon maintain larger size ratios (smaller size differences) between adjacent ranked group members than larger bodied

81 species, which would be an important avenue of future research.

Although smaller species showed less of a relationship between sociality and host-coral size, they were more social overall than larger species. This may indicate that smaller species obtain greater direct fitness benefits from social living or face greater constraints of dispersal or greater costs of solitary living. For example, smaller species might be more prone to predation or less competitive for vacant habitat compared to larger species, thus limiting dispersal opportunities and enhancing the benefits of remaining within a group (Helfman and Winkelman, 1997, Munday and Jones, 1998). This finding is again at odds with other terrestrial vertebrate systems which generally exhibit a positive relationship between sociality and body size (Armitage, 1981, Bekoff et al., 1981). This discrepancy between terrestrial and marine vertebrates highlights the importance of studying animal groups with varying life-history strategies.

While host generalization has been proposed as a driver of sociality in some habitat specialist marine species (Brooks et al., 2017), we found no evidence that it played a role in Gobiodon sociality. There was considerable variation in the number of host-coral species inhabited by each species of Gobiodon but this variation showed no discernable pattern in association with sociality. Munday et al. (1997) demonstrated Gobiodon species have distinct coral preferences. However, our research suggests some species appear to be more capable of relaxing this preference than others (especially during intense ecological disturbance; e.g. Hing et al., 2018). This ability does not however, appear to be related to sociality. The coral preferences displayed by many Gobiodon species may be due to properties of particular coral species such as complexity, branch length or inter-branch distances (Untersteggaber et al., 2014). Sociality might therefore be influenced by coral properties, not measured in this study rather than variation in host-preference. For example more complex corals might increase the benefits of remaining in the group (for example by offering greater protection from predators) and thereby promote sociality. A similar pattern of increasingly complex habitat and a higher density of lizard aggregations has been documented by Michael et al. (2010). Untersteggaber et al. (2014) demonstrated that coral occupancy by G. histrio and G. rivulatus was related to coral size and branch length. Given our findings on sociality and coral size, coral architecture would be an interesting factor to consider in future studies of Gobiodon sociality.

To date, there have been few comparative studies of marine fishes looking at phylogenetic, ecological and life-history correlates of sociality across multiple species (Hing et al., 2017; but see Nowicki et al., 2018). In contrast, numerous studies in other vertebrate systems have been instrumental in developing our current understanding of how ecology (Brown, 1974; Emlen, 1982a; Kokko et al., 2002; Kokko and Ekman, 2002; Stacey and Ligon, 1991) and life-history (Arnold and Owens, 1998; Hatchwell and Komdeur, 2000; Rowley and Russell, 1990) have influenced the evolution of sociality in these systems (reviewed in Hing et al., 2017). For example, phylogenetic reconstructions of sociality in other vertebrate systems have revealed non- random clustering in birds and mammals (Arnold and Owens, 1998; Briga et al., 2012; Edwards and Naeem, 1993). Closer examination at the genus level has revealed likely ecological and life-history correlates of sociality (e.g. Armitage, 1981; Faulkes et al., 1997). We have now added a comparatively understudied

82 group of vertebrates with non-conventional life-histories (marine fishes) to this knowledge base. Unconventional life-history strategies (such as bi-directional sex change observed in several species of Gobiodon; Cole, 2011; Cole and Hoese, 2001; Munday et al., 1998; Nakashima et al., 1996) likely alter the costs and benefits of group living in these social systems and therefore represent a unique perspective on social evolution (Buston and Wong, 2014; Hing et al., 2017; Wong and Buston, 2013).

4.5.1 Comparison of taxonomic structure We built upon the phylogeny of Duchene et al. (2013) by adding additional molecular markers. Our Bayesian analysis inferred similar species composition (albeit with fewer species as we did not sample from the Red Sea) of each clade to that of Duchene et al. (2013), but the placement of the clades relative to each other varied between the two studies. Both studies inferred two sister species groups with high posterior probability. However, the sister clades C/D in our study, inferred with strong support, were not sister to each other in Duchene et al. (2013). Instead clade C was sister to cade A and the other group consisted of clades B/D in Duchene et al. (2013). Our tree provides very strong support for the sister group C/D while the node relating clades C and A in Duchene et al. (2013) is inferred with moderate support. However the A/B group in our study was not strongly supported. It seems there is broad agreement in the species composition of each clade. However, further research into the relationships between the clades is clearly required to discern the true genetic structure of the genus.

4.5.2 Gobiodon spilophthalmus We determined our G. spilophthalmus c.f. specimens were in fact juveniles of either G. ceramensis or G. acicularis depending on the host-coral they were collected from. To our knowledge this is the first record of these species having juveniles of similar appearance to each other and to those described as G. spilophthalmus (Fowler, 1944; Munday et al., 1999). Our findings raise several possibilities. First, G. spilophthalmus may not be a valid species. The phylogeny produced by Duchene et al. (2013) shows very low support for the node relating G. spilophthalmus to G. ceramensis indicating there was difficulty delineating these samples as separate species. Harold et al. (2008) recognise G. spilophthalmus as a valid species, but do not include it in their phylogeny of Indo-Pacific Gobiodon species. Second, G. spilophthalmus could be a valid species but is not present at Lizard Island. We cannot rule this possibility out with our data, but we find it unlikely that a species described from the New Hebrides (Vanuatu) would not be present at Lizard Island especially given the broad distribution of its congeners (Fowler, 1944; Munday et al., 1999). Additionally, Munday et al. (1999) describe G. spilophthalmus as occurring throughout the range of their collections which includes the Great Barrier Reef and Papua New Guinea. Third, G. spilophthalmus is a valid species and is present at Lizard Island, but we did not sample any. Although we sampled as many reefs as possible at Lizard Island, fourteen goby colonies may not be representative of the whole Lizard Island population, especially if G. spilophthalmus is rare. Additionally, there is clearly confusion around the identification of G. heterospilos and G. spilophthalmus in the literature (Fowler, 1944; Munday et al., 1999; Steinke et al., 2017), assuming both are indeed valid species as recognized by Harold et al. (2008).

83 Assuming G. spilophthalmus is a valid species, it appears to have diverged very recently and is therefore very closely related to its sister species, G. ceramensis (Duchene et al., 2013). It is likely the genetic markers used in our analysis (COI) and other studies featuring G. spilophthalmus, are evolving more slowly than this clade is speciating and thus not capable of fully capturing the true genetic structure of these species. The conflicting possibilities presented above and this issue of recent speciation outpacing divergence in the COI marker, highlight the need for a full genomic study of this clade to determine the validity of these species. Detailed ecological observations would also be highly desirable to establish field identification guidelines for each species, if indeed they can be reliably differentiated in the field.

4.6 Conclusion The phylogenetic signal of sociality in Gobiodon could not be conclusively resolved. However, we found a combination of life-history and ecological effects best predicted sociality in these species. Previous research suggests that sociality is probably quite plastic in Gobiodon and supports the idea of phylogenetic independence of sociality (Hing et al., 2018). Our study revealed a relationship between sociality and the interaction between ecological and life-history factors. This provides good evidence for a link between these correlates and sociality in this genus, which should now be tested experimentally in order to demonstrate causality. We also highlight the need for full genomic studies of G. spilophthalmus, G. acicularis and G. ceramensis which have caused substantial confusion in the literature at the time of writing. With continued advances in genomic sequencing we anticipate this study will encourage future research to resolve the validity of these species. Issues of species identification aside, this study complements the admirable body of research conducted on terrestrial organisms by presenting a novel perspective of ecological and life-history traits which have likely influenced the evolution of sociality. Work on terrestrial organisms has been instrumental in developing theories of social evolution. However, these terrestrially derived theories have only recently been tested against organisms displaying non-conventional life-history strategies.

84 5 Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

Published as: Hing, M. L., Klanten, O. S., Dowton, M., Brown, K. R., & Wong, M. Y. L. (2018). Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes. PLOS ONE, 13(9), e0202407.

5.1 Abstract Social organization is a key factor influencing a species’ foraging and reproduction, which may ultimately affect their survival and ability to recover from catastrophic disturbance. Severe weather events such as cyclones can have devastating impacts to the physical structure of coral reefs and on the abundance and distribution of its faunal communities. Despite the importance of social organization to a species’ survival, relatively little is known about how major disturbances such as tropical cyclones may affect social structures or how different social strategies affect a species’ ability to cope with disturbance. We sampled group sizes and coral sizes of group-forming and pair-forming species of the Gobiid genus Gobiodon at Lizard Island, Great Barrier Reef, Australia, before and after two successive category 4 tropical cyclones. Group sizes of group-forming species decreased after each cyclone, but showed signs of recovery four months after the first cyclone. A similar increase in group sizes was not evident in group-forming species after the second cyclone. There was no change in mean pair-forming group size after either cyclone. Coral sizes inhabited by both group- and pair-forming species decreased throughout the study, meaning that group-forming species were forced to occupy smaller corals on average than before cyclone activity. This may reduce their capacity to maintain larger group sizes through multiple processes. We discuss these patterns in light of two non- exclusive hypotheses regarding the drivers of sociality in Gobiodon, suggesting that benefits of philopatry with regards to habitat quality may underpin the formation of social groups in this genus.

5.2 Introduction Social organization is an important determinant of a species’ survival (Ebensperger, 2001), foraging efficiency (Ridley and van den Heuvel, 2012) and ability to reproduce successfully (Kokko et al., 2001), factors which ultimately affect their potential to recover from disturbances. Social structures may be as simple as monogamous pairing or as complex as a eusocial colony with division of labour and non- reproductive castes. Social organization may be influenced by broad ecological (Emlen, 1982a) or life- history factors (Rowley and Russell, 1990), within-group social interactions (Wong et al., 2007) or genetic relatedness (Hughes et al., 2008) and even individual variation in physiology (Killen et al., 2017), neurophysiology and genetics (Greenwood et al., 2013). Each social structure provides benefits to its constituents, but often at a cost to their reproduction or access to some other resource (Hamilton, 1964a, Hamilton, 1964b, Bourke, 2014). That is to say, there are trade-offs associated with different social structures that individuals must consider.

85 Group living is thought to have evolved in many lineages as a response to genetic (kinship) and environmental factors (Hamilton, 1964a, Hamilton, 1964b, Bourke, 2014). With respect to environmental factors, many hypotheses point toward variability in ecological factors as influencing the evolution of sociality (Emlen, 1982a, Komdeur, 1992). Hypotheses such as the benefits of philopatry (Woolfenden, 1975, Stacey and Ligon, 1991, Kokko et al., 2002) and ecological constraints models (Selander, 1964, Brown, 1974, Gaston, 1978, Emlen, 1982a, Kokko et al., 2002) examine the idea that ecological factors, such as habitat quality (e.g. habitat size, resource availability, defence) or the availability of suitable breeding territory (respectively), influence the decision of subordinates to either disperse from their habitat or remain within a group. These two hypotheses are often viewed as two sides of the same coin as they both look at aspects of ecology to explain social evolution and maintenance (Hing et al., 2017). The benefits of philopatry hypothesis focuses on the benefits conferred from residing in a high-quality habitat (e.g. inheritance of breeding status (Buston, 2004b), increased fitness (Heg et al., 2011)). High-quality habitat is typically colonized rapidly (Komdeur, 1992). An individual living on low-quality habitat may therefore increase its fitness by moving to a high-quality habitat as a subordinate (Komdeur, 1992). However, this benefit must be traded off against the associated costs (e.g. delayed reproduction, risk of movement). In contrast, the ecological constraints hypothesis concentrates on factors of ecology that may restrict subordinate individuals already residing in a group from dispersing (e.g. habitat saturation (Wong, 2010), predation risk (Heg et al., 2004a)). These two hypotheses are not mutually exclusive and often operate alongside other effects (e.g. kinship, life-history). However, the question of which combination of effects best describes social group formation and maintenance is still of interest as each one emphasizes different costs and benefits (Hatchwell and Komdeur, 2000). While these hypotheses have been well studied in terrestrial organisms, they have only recently been tested in marine environments (Duffy and Macdonald, 2010, Wong and Buston, 2013, Buston and Wong, 2014, Hing et al., 2017). Of the marine taxa tested so far, habitat-specialist coral-reef fishes are emerging as a useful model species to study theories of social evolution and maintenance (Wong and Buston, 2013, Buston and Wong, 2014, Hing et al., 2017) and have shown similar responses to habitat manipulation as terrestrial species (e.g. Wong, 2010). Many social fishes have a pelagic larval phase which suggests low levels of kinship within groups, reducing the potential confounding factor of relatedness (Hing et al., 2017, Taborsky and Wong, 2017, Buston et al., 2007, but see Buston et al., 2009). Given the apparent influence of ecological factors on the formation and maintenance of social groups, we would expect that disturbances capable of altering a species’ habitat, such as severe weather events, would have a strong impact on social organization (Wong, 2010, Brandl and Bellwood, 2014). Many species of coral-reef fishes, especially habitat-specialists, can be found in social groups (e.g. Buston and Cant, 2006, Ang and Manica, 2010b, Herler et al., 2011, Brandl et al., 2018). The size of these social groups is often related directly or indirectly to the size of the habitat in which they reside (Buston, 2003a, Brandl et al., 2018, Buston, 2003b, Wong, 2011). Complex social structures such as size-based dominance

86 hierarchies, in which the largest dominants breed and smaller subordinates are reproductively suppressed, have been documented in these groups (e.g. Buston, 2003b, Wong, 2010). Further, they are known to exhibit sequential hermaphroditism or bi-directional sex-change (Nakashima et al., 1996, Munday et al., 1998, Buston, 2003b). In such systems, the loss of a breeding individual results in the next subordinate in the queue taking its place (Wong et al., 2007). This social organization may provide a level of redundancy which could help a social species recover quickly following a major disturbance. For example, Rubenstein (2011) argued that cooperative breeding could be a bet hedging strategy in variable environments as it may buffer variance in fecundity between years. Duffy and Macdonald (2010) also found that eusociality conferred advantages to sponge-dwelling shrimps allowing them to occupy a greater number of host sponge species and more sponges overall than less social sister species. This finding, combined with research on host specialization and extinction by Munday (2004b), could imply that more social species face lower extinction risk following a disturbance because their sociality allows them to monopolize a greater host range. However, Courchamp et al. (1999) found that obligate cooperative breeders were more at risk of group extinction because of their reliance on subordinates to reproduce and survive. These studies show that while complex social structures may provide advantages allowing species to survive a severe disturbance and to re-colonize afterwards, they may also result in localized extinctions. Further research into the effects of ecological disturbance on social organization and how varying social systems, such as pair- or group-forming, are able to cope with disturbance are clearly required. Extreme climatic events such as tropical cyclones are known to have devastating impacts on the physical structure of coral reefs (Harmelin-Vivien, 1994, Lirman and Fong, 1995, Fabricius et al., 2008, Gouezo et al., 2015). The effects on fish and invertebrate communities which depend on the coral structure for food and shelter are likewise devastating (Harmelin-Vivien, 1994, Wilson et al., 2006, Komyakova et al., 2013, Cheal et al., 2017). The destructive forces of cyclones can have a strong influence on the re-distribution of species and their relative abundances following the event (Emslie et al., 2008). However, relatively little is known about the impacts that cyclones may have on the social organization of coral-reef inhabitants and whether social organization may mediate disturbance-induced population trends in species with different social structures. Given the importance of social organization for factors such as reproduction (Kokko et al., 2001), foraging efficiency (Ridley and van den Heuvel, 2012) and ultimately the ability to recover from a major disturbance, it is plausible that destructive events such as tropical cyclones may have a detectable effect on a species’ social organization. We evaluated the effects of cyclones on the social organization of coral gobies of the genus Gobiodon. These species are small (3-4 cm) microbenthic (Brandl et al., 2018) habitat-specialist fishes that live within the structures of branching and plate-forming acroporid and pocilloporid corals (Munday et al., 1997, Munday, 2000). These fishes are highly site attached once settled, but have been shown to move between corals (Munday et al., 1998). Gobiodon spp. display a wide variety of social phenotypes from pair-forming (PF) species to group-forming (GF) species that typically live in groups ranging from 3 to 12 individuals (Thompson et al., 2007). Social groups usually consist of two breeding individuals and one or more non-

87 breeding subordinates which form a size-based hierarchy and queue for a breeding position. However there is some evidence to support multiple breeding individuals in larger group sizes for some species (Thompson et al., 2007). In this study, we investigated how extreme climatic events influence the social organization of colonies of Gobiodon fishes and discuss how these effects may impact their survival. Opportunistic investigations of such disturbances (extreme climatic events) are important for theory development as they can test well developed theory under extreme conditions (Altwegg et al., 2017). Specifically, we examined the effects of two successive category 4 cyclones that impacted the Great Barrier Reef, on the group size (social structure) and coral size (ecological factor) of GF and PF species of Gobiodon. As habitat patch size is known to be related to mean group size in some species, smaller corals should be less capable of supporting larger groups (Thompson et al., 2007). Therefore, we expected that physical damage caused by the cyclones would result in smaller corals, and that as coral size decreased, so too would mean group size of both GF and PF coral gobies. We also expected that advantages conferred from sociality would help GF species to recover from these disturbances (Duffy and Macdonald, 2010, Munday, 2004b). Additionally, we used the occurrence of these cyclones as a ‘natural experiment’ to examine the related effects of ecological constraints and benefits of philopatry on the formation of social groups in the GF species. Munday (2004a) demonstrated that coexistence between two species of Gobiodon occurred through a competitive lottery, meaning that whichever species colonized a particular coral was able to hold that territory. Our own observations show that while coral gobies do show distinct preferences for certain species of coral, they can and will colonize a wide range of species. It is therefore likely that Gobiodon species will colonize any available habitat following a severe disturbance. If ecological constraints (lack of available habitat) were responsible for the formation of social groups, we would expect coral vacancy to be very low as gobies would preferentially colonize vacant habitat over residing as a subordinate in a group. That is, subordinates should disperse to seek independent breeding opportunities if there is suitable vacant habitat. In contrast, if benefits of philopatry were driving group living, we would expect greater coral vacancy as the GF species would vacate lower-quality corals in favor of taking up residence as a subordinate in higher-quality corals. While we do not fully understand what constitutes high- or low quality habitat in these species, we consider coral size to be a reasonable proxy of habitat quality as Kuwamura et al. (1994) and Hobbs and Munday (2004) demonstrated that growth, survival and reproductive success increased in larger habitats for other species of coral associated fishes.

5.3 Materials and methods 5.3.1 Ethics Statement This research was conducted under research permits issued by the Great Barrier Reef Marine Park Authority (G13/36197.1 and G15/37533.1) and with the approval of the University of Wollongong Animal Ethics Committee (AE14-04).

88 5.3.2 Study area and survey sites The study took place at Lizard Island, Great Barrier Reef, Queensland, Australia (14o 40.729’ S, 145o 26.907’ E) (Fig 5.1) between 2014 and 2016. Twenty three sites were surveyed in total over four survey times, eleven of which were located within the sheltered lagoon. The remaining twelve sites were located on the fringing reefs around Lizard Island. As this study was designed to examine how sociality of Gobiodon spp. varied over successive impacts at Lizard Island as a whole, we did not assess variation in sociality at smaller spatial scales (e.g. sites). As such, survey sites were chosen to give reasonable coverage of the reefs at Lizard Island. Not all sites were assessed during each survey time as several sites were scoured down to bare rock after each cyclone. These sites were not surveyed as our interest was in the surviving goby colonies (see Hing, 2019a for the range of sites covered at each survey time). The number of sites visited during each survey time was 15, 14, 11, and 17 respectively. All measurements were made on scuba at depths ranging from less than one meter to five meters.

Fig 5.1: Map of the survey sites. Dotted light grey line is the outline of reef areas around Lizard Island. All study sites are indicated on map (regular font), specific reefs in the Lizard Island lagoon are numbered: Big Vickey’s Reef (1); Vickey’s Reef (2); Horse Shoe Reef (3); Palfrey Reef (4 – 4a); Loomis Reef (5); Trawler (6); Picnic Beach (7); Ghost Beach (8); Bird Island Reef (9); Entrance Bommie (10); Bird Bommie (11); Lizard Head Reef (12).

5.3.3 Cyclone activity and sampling periods Two cyclones impacted the study site in consecutive years. Cyclone Ita impacted Lizard Island in April 2014 as a category 4 system and cyclone Nathan in March 2015, also as a category 4 system. Both cyclones caused substantial damage to the fringing and lagoonal reefs including greatly reduced coral cover and associated changes in reef fish diversity and abundance (Brandl et al., 2016, Ceccarelli et al., 2016, Khan et al., 2017, Ferrari et al., 2017). We conducted surveys on coral sizes and group sizes of 13 Gobiodon spp. during February and March 2014 (1 month prior to cyclone Ita), August and September 2014 (4 months after cyclone Ita), January and February 2015 (1 month prior to cyclone Nathan and 9 months after cyclone Ita) and January and February 2016 (10 months after cyclone Nathan) (Fig 5.2). These repeated surveys provided us with a broad overview of the effects that multiple disturbances had on the social organization of coral gobies.

Fig 5.2: Timeline of data collection. Timeline shows year and month of data collection (fish, dashed black arrow) and cyclone activity (cyclone, blue arrow). In total, data on group size, coral size and proportion of corals occupied were collected at 4 time points for 13 species of Gobiodon.

5.3.4 Survey methods Two types of transects were deployed over the four surveys. For this study however, we did not attempt to assess any spatial patterns between sites. Transects were only used as a guide to locate corals. Haphazardly placed 30 m line transects were used to locate corals one meter either side during the first and fourth survey times. Cross transects (two 4 m x 1 m belt transects laid in a cross, designed to measure the community around a focal colony) were used during the first (Palfrey reef only; Fig 5.1 sites 4 and 4a), second, third and fourth survey times. Line transects were placed roughly parallel to each other and separated by at least 10 m and cross transects were placed at least 8 m (twice the length of the transect on either axis) from each other to ensure that any given coral was not measured twice during the survey period. As coral gobies show strong preferences for certain species of branching and plate forming (mostly) Acroporid corals (Munday et al., 1997, Munday et al., 1999, Herler et al., 2011), only these species of corals were counted on the transects. In total, 23 species of coral were surveyed for goby occupancy (Hing, 2019a). Each coral’s living part was measured along three axes (length (L) width (W) and height (H)) and the simple average diameter calculated

90 as (L + W + H)/3. Simple average diameter was used in this study (as opposed to geometric mean diameter (L x W x H)1/3) as it provides a better representation of the major axis of the coral (Kuwamura et al., 1994). All goby supporting corals occurring on the transects were measured and searched for gobies. The number of adult gobies living within each coral head was counted by visual inspection using a torch. Adults could be easily distinguished from juveniles by their distinct coloration and markings. While the number of juveniles (if present) was recorded for each coral, they were not included in the group size observations as juveniles had been observed moving between multiple corals during each survey (Hing pers. obs.). Additionally, juvenile abundance was extremely low during all surveys and there was no difference in abundance for either PF or GF species during any survey time (Supplementary Table 5.3). In contrast, adults displayed remarkable coral-host fidelity, even tolerating extreme hypoxia and severe coral bleaching (Munday et al., 2004, Nilsson et al., 2004, Hing pers. obs., respectively). The number of transects at each site varied depending on the size of the reef. The number of transects conducted at each site also varied from year to year depending on the perceived abundance of suitable corals for habitation, and ranged from 1 to 44 transects. In total, the number of transects placed around Lizard Island during each survey time was 56, 141, 109 and 140 for the February 2014, August 2014, January 2015 and January 2016 surveys respectively. The methods of measuring goby group sizes and coral sizes (described in detail below) remained exactly the same regardless of the different number and size of transects that were used throughout the study. There was a significant difference in coral size measured between the two transect types, however this was most likely a site effect as line transects were used extensively on the fringing reefs in January 2016, after both cyclones. Corals at these sites sustained heavy damage and were therefore smaller on average. We therefore pooled the data from both types of transect and included site as a random effect in the statistical models. 5.3.5 Sociality in Gobiodon We documented 15 species of Gobiodon at Lizard Island during the present study (Table 5.1). However, two species (sp. A and sp. D) were excluded from later analyses as they were uncommon at the study site. The remaining species displayed a range of sociality ranging from solitary individuals to pairs and groups reaching up to 21 individuals. From here on we will use the term “group” to refer to any colony with a group size of three or more. We used a sociality index formulated by Avilés and Harwood (2012) to categorize each species as either GF or PF:

(1)

91 biologically relevant assumptions. Once coral gobies settle onto a coral as juveniles, they are not known to move frequently unless forcefully evicted from the coral (Wong et al., 2007, Wong et al., 2008a). Although we do not have a precise estimate of the age at settlement for each species, Brothers et al. (1983) estimated the larval life of three species of Gobiodon ranging from 22 to 41 days. Given that Gobiodon spp. live in the order of years (Munday, 2001, Taborsky and Wong, 2017), we assume that each species spends the majority of its life-cycle in a single coral. We therefore set the maximum proportion of the life-cycle spent in the group ( ) as 1 for each species. While there may be natural variation in this parameter, this assumption is biologically realistic and enables us to make relative comparisons between species primarily based on the remaining two factors in equation 1. The last two components of the index were calculated as per equation 1. Having calculated the sociality indices, species were categorized as GF if their sociality index was greater than 0.5 and remaining species with sociality indices less than 0.5 were categorized as PF (Table 5.1). The index value of 0.5 was defined as the cut-off value between PF and GF species because it lies directly in the middle of the observed index range where there was a natural split in the data (Supplementary Fig 5.2). It should be noted however that “PF” species were sometimes observed in groups (i.e. 3 or more individuals) and “GF” species were sometimes observed in pairs or as singles. The terminology used here therefore indicates the tendency of particular species to form either groups or pairs. Importantly, calculations of sociality indices and subsequent categorization was based on data from surveys obtained before any recent cyclone activity (February 2014). We acknowledge that these reefs have been subjected to Crown of Thorns Starfish (COTS) outbreaks in the past. Our measure of sociality may therefore vary from sociality recorded at other locations. Unfortunately, COTS outbreaks are a relatively frequent occurrence on the Great Barrier Reef and we therefore consider our measure of sociality to be representative of the ‘normal’ social organization of the species in question. 5.3.6 Group size To assess the effect of cyclone activity on social organization, we used a generalized linear mixed model with a zero-truncated negative binomial distribution to analyze the effects of sociality and survey time and their interaction on the group size of coral gobies. The zero truncated distribution was used as it does not allow predictions of group size less than one. A negative binomial distribution was used to account for overdispersion which rendered an initially employed zero-truncated Poisson model unsuitable. The model contained survey time (Feb-14, Aug-14, Jan-15 and Jan-16), social organization (PF or GF) and the interaction between these factors as fixed effects. Site, coral species and goby species were included as crossed random effects. Root mean square error (RMSE) was used to assess model performance. RMSE is a measure of the overall agreement between model predictions and the observed data and is measured in the same unit as the response variable. Generalized linear mixed models were conducted in R using the glmmADMB package (Fournier et al., 2012, Skaug et al., 2014) and pairwise comparisons conducted with the emmeans package (Lenth, 2018). Figures were produced using the ggplot2 package (Wickham, 2016). 5.3.7 Coral size and abundance of empty corals To investigate changes in coral sizes for PF and GF species over the four survey times, we tested the

92 relationship between social organization, survey time and coral size. We used a generalized linear mixed model with survey time, social organization and their interaction as fixed effects and site, goby species and coral species as crossed random effects. A gamma distribution was used to account for positive skew and heteroscedasticy in the data and because it gave a better fit than models conducted with log-normal distributions. RMSE was used to assess model performance. To test the hypothesis that subordinates (i.e. non-reproducing individuals) in colonies of GF species might be constrained by a lack of available habitat, we also assessed whether the mean number of empty corals on a transect was different for transects with or without groups of GF species. We used a generalized linear model for this analysis with the number of empty corals as the dependent variable and survey time and transect type (with or without groups of GF species) as independent variables. The model was run with a zero-inflated negative binomial distribution to handle the large number of zero counts and this produced a better model than a zero-inflated Poisson model when compared with Akaike Information Criterion (AIC). The model was conducted using the R package glmmADMB (Fournier et al., 2012, Skaug et al., 2014). 5.3.8 Proportion of inhabited corals and probability of coral occupancy We qualitatively reviewed the mean proportion of corals occupied on each transect to determine whether cyclone activity would change the relative proportion of either social organization’s occupancy. Since we expected coral size to change with cyclone activity, we assessed whether coral size (a potential aspect of habitat quality) was related to the type of goby species (PF or GF) that occupied it during each survey. This was examined by assessing the multinomial probability that corals would be inhabited by either GF species, PF species or neither. These data were modeled as a multinomial response with coral size and survey time as predictors. Prior to cyclone Ita (survey 1), these data were only collected at one site (Palfrey; Fig 5.1). For each of the remaining time points (surveys 2-4), data were collected from various sites around Lizard Island (Fig 5.1; Hing, 2019a). Misclassification error is the proportion of false classifications predicted by the model and was used to assess model performance. The multinomial model was conducted in R using the nnet package (Venables and Ripley, 2002).

5.4 Results 5.4.1 Categorization of social organization Of the 13 Gobiodon spp. surveyed at Lizard Island, five species were categorized as “GF” species and eight species were classified as “PF” (see above for definitions) (Table 5.1).

93 Table 5.1: Gobiodon species observed at Lizard Island with their social index. The number of individuals and groups of each species recorded during the February 2014 survey are provided. Species were categorized as group-forming (below dotted line) if their social index was greater than 0.5. Otherwise they were categorized as pair-forming (above dotted line).

Species Individuals Groups Sociality index Categorization G. axillaris 15 9 0.33 Pair G. brochus 70 35 0.36 Pair G. ceramensis 36 20 0.36 Pair G. erythrospilus 138 69 0.41 Pair G. histrio 79 43 0.43 Pair G. oculolineatus 59 30 0.39 Pair G. okinawae 33 19 0.46 Pair G. quinquestrigatus 114 59 0.38 Pair G. acicularis 48 17 0.56 Group G. citrinus 37 9 0.63 Group G. fuscorubera 142 51 0.57 Group G. rivulatus 145 45 0.65 Group Unknown species 28 8 0.63 Group a G. fuscoruber is synonymous with G. unicolor (Herler et al., 2013) 5.4.2 Group size Prior to cyclone Ita (Feb 2014), GF species were observed with mean group sizes of 2.71 (± 0.17 SE) individuals per coral. The mean group size of GF species decreased to 2.13 (± 0.11 SE) following cyclone Ita (Aug 2014). Five months later (Jan 2015, 9 months after cyclone Ita) the mean group size of GF species appeared to show some sign of recovery, increasing to 2.58 ± 0.11 (SE). This trend of recovering group sizes was not evident 10 months after cyclone Nathan (Jan 2016), when mean group sizes for GF species was 2.27 ± 0.15 (SE), similar to those just four months after cyclone Ita. Meanwhile PF species had a mean group size of 1.88 (± 0.05 SE) individuals per coral at the beginning of the study (Feb 2014) and maintained their group sizes at a similar level through both cyclones. The mean group sizes of PF species was 1.81 (± 0.03 SE), 1.74 (± 0.04 SE) and 1.74 (± 0.04 SE) for the Aug 2014, Jan 2015 and Jan 2016 surveys respectively. Group-forming species had larger mean group sizes than PF species at every survey time (Fig 5.3), although the difference in group size between GF and PF species reduced substantially following cyclone Ita (Aug 2014; Fig 5.3). This was due to the reduction in the mean group size of the GF species after cyclone Ita. These patterns were supported by the statistical model which had a RMSE of 1.36 (Supplementary Table 5.1). The model predicted an initial decrease in the mean group size of GF species following cyclone Ita (pairwise comparison ratio 1.58 (Feb-14/group:Aug-14/group, 95% CI (0.76, 1.83)). However, the predicted mean group sizes remained at these lower sizes for the subsequent surveys (Supplementary Table 5.2.1; Fig

94 5.3). The model did show a slight increase in mean group size of GF species in the Jan-15 survey (confidence interval was relatively large; estimated marginal mean 1.78, 95% CI (1.10, 2.81); Fig 5.3). Mean group sizes of PF species did not change significantly throughout the study. The statistical model showed very little variation in group size during any survey time (Fig 5.3; Supplementary Table 5.2.1), but predicted lower mean group sizes than observed, ranging from 1.28 ± 0.16 (SE) before the cyclones to 1.09 ± 0.19 (SE) after both cyclones.

Fig 5.3: Variation in group size of PF and GF species in response to cyclone activity. Modeled mean group size of pair-forming (circles, pink dotted line) and group-forming (triangles, blue dashed line) species at the four survey times. Error bars are 95% CI. Cyclone symbols show when each cyclone impacted the research sites. Raw data for pair- (pink) and group-forming (blue) species are shown as jittered point clouds. Six observations of group sizes greater than 10 are not shown here, but were included in the model.

5.4.3 Coral Size Over each successive survey, the mean size of corals inhabited by GF species, PF species and the mean size of uninhabited corals all decreased (pairwise comparison ratio 1.23 (Feb-14:Jan16, 95% CI (1.16, 1.32); Fig 5.4). The number of very large corals (greater than 50 cm mean diameter) also decreased substantially

95 following the first cyclone (cyclone Ita; Fig 5.4) and were detected in low numbers in all subsequent surveys. The interaction between sociality and survey time was not significant (analysis of deviance χ2 = 3.36, df = 3, P = 0.34), indicating that the coral size decreased at a similar rate across the four survey times for each category of social organization. As this interaction was non-significant, pairwise comparisons were conducted on the main effects only. On average, GF species inhabited larger corals (26.93 ± 0.56 (SE)) than the PF species (19.76 ± 0.19 (SE)) during each survey and the mean size of uninhabited corals (12.86 ± 0.25 (SE)) was always less than that of inhabited corals (Fig 5.4). The pattern of decreasing coral size was supported by the statistical model (RMSE = 7.42; Fig 5.4). The model also supported the pattern of GF species inhabiting larger corals than PF species on average (pairwise comparison ratio 0.80 (PF:GF), 95% CI (0.61, 1.06); Fig 5.5). Vacant corals were smaller than corals inhabited by either PF or GF species (pairwise comparison ratio 0.63 (vacant:PF), 95% CI (0.37, 0.85); pairwise comparison ratio 0.51 (vacant:GF), 95% CI (0.37, 0.69) respectively).

Fig 5.4: Mean coral size over the four survey times. Modeled mean coral diameter inhabited by pair-forming (circles, pink dotted line), group-forming (triangles, blue dashed line) species and vacant corals (squares, green solid line). Error bars are 95% CI. Cyclone symbols show when each cyclone impacted the research sites. Raw data of empty corals (green), pair- and group-forming species (pink and blue, respectively) are shown as jittered point clouds. Eight observations of corals larger than 100 cm mean diameter were omitted from this figure but were included in the model.

To assess whether habitat saturation (an ecological constraint) was acting as a constraint on subordinate dispersal, we looked at whether the number of vacant corals differed between transects with or without groups (colonies with 3 or more individuals) of GF species. Corals that were uninhabited were present on transects where at least one group of GF species was present (Hing, 2019a). This means that there was vacant habitat available for subordinates to disperse to. However, there was no difference in the mean number of empty corals on transects with or without a group of GF species during any survey time detected by the model (pairwise comparison ratio 1.19 (no groups:groups present), 95% CI (0.89, 1.44). This could indicate that some coral vacancy was due to reduced abundance of coral gobies overall, but the fact that groups of GF

97 species were present on transects where there were corals available to disperse to demonstrates that either; some constraint was restricting dispersal from the group or subordinate gobies were receiving a benefit from remaining within the group. 5.4.4 Proportion of inhabited corals and probability of occupation PF species occupied proportionally more corals on average during each survey than GF species (Fig 5.5). There was a similar proportion of corals occupied by GF species as there were vacant corals during each survey. The proportion of corals inhabited by PF species decreased from 0.61 ± 0.04 (SE) at the beginning of the study (Feb 2014) to 0.54 ± 0.02 (SE) after cyclone Ita (Aug 2014). This downward trend continued into the next survey (Jan 2015) where the proportion of corals inhabited by PF species was 0.46 ± 0.02 (SE). However, the proportion of corals inhabited by PF species increased after cyclone Nathan (Jan 2016) to 0.56 ± 0.03 (SE). The GF species on the other hand showed relative stability in the proportion of corals they occupied during the study. There was an initial increase in the proportion of corals inhabited by GF species from 0.14 ± 0.03 (SE) at the beginning of the study to 0.22 ± 0.02 (SE) after cyclone Ita (Aug 2014). The mean proportion of corals occupied by GF species then remained at similar levels for the remaining two surveys (Fig 5.5). The proportion of vacant corals was also relatively unchanged throughout the study except for a small increase nine months after cyclone Ita (Jan 2015; 0.31 ± 0.02 (SE); Fig 5.5).

Fig 5.5: Mean proportion of corals inhabited by pair-forming species (triangles, pink dotted line), group- forming species (circles, blue dashed line) and remaining vacant (squares, green solid line) over the four surveys. Error bars indicate standard error. Raw data are shown as jittered point clouds for vacant (green), pair- (pink) and group-forming (blue) species.

98 The multinomial model of coral occupancy had a misclassification rate of 0.404 indicating that the predictions may not be reliable. Nevertheless, the trends agree reasonably well with our observations and we give a qualitative account of these, recognizing that probability estimates may have large error. Odds ratios and associated confidence intervals for the model coefficients are available in Supplementary Table 5.3, however, we urge the same caution in their interpretation. Prior to cyclone activity (February 2014), there was a low probability that the smallest corals would remain vacant and this probability decreased rapidly for corals of increasing mean diameter (Fig 5.6a). This was consistent with our observations as larger corals were rarely vacant (Fig 5.4, pink and blue points). After cyclone Ita, there was a similar pattern of decreasing probability of corals remaining vacant with increasing coral size (Fig 5.6a), but there was a higher probability of the smallest corals remaining vacant. Again, this pattern was consistent with our observations of coral size (Fig 5.4). The probability that a PF species would occupy a coral increased initially with increasing coral size, but then decreased after reaching an apparent optimal coral size around 15 cm (Fig 5.6b, solid orange line). This pattern of increasing to an optimum size is certainly plausible if we consider that GF species typically inhabited the larger corals (Fig 5.4) posing an upper restraint on occupancy by PF species. Corals in the smaller range may have been less desirable as they may not support successful feeding, reproduction or protection from predators. Furthermore, the coral size model had predicted the mean coral size for PF species within this coral size range (Fig 5.4). The ‘optimal’ coral size for PF species appeared to increase to 20 cm – 30 cm in the survey times after cyclone Ita (Fig 5.6b). Consistent with the concept of the PF species having lower probability of occupancy at higher coral sizes, the probability that a GF species would occupy a coral increased as coral size increased (Fig 5.6c). This relationship between coral size and probability of inhabitance by a GF species did not change with respect to survey time (Fig 5.6c).

Fig 5.6: Probability that a coral of given size would remain vacant or be inhabited by either a pair- or group- forming species of Gobiodon. Probabilities are shown for each survey time: Feb 2014 (orange, unbroken), Aug 2014 (green, dotted), Jan 2015 (blue, dashed), Jan 2016 (purple, dot-dash).

5.5 Discussion The effects of cyclones on the social organization of coral-reef fish are poorly understood despite clear links between social organization and factors that could affect species persistence and recovery following environmental disturbances [1-3]. Here, we investigated the impacts of two successive cyclones (Ita 2014 and Nathan 2015) on the social organization of coral-gobies over three years, and at the same time shed light on the possible factors influencing the formation of social groups. 5.5.1 Effects of cyclones on social organization and coral size Both cyclones had a small, but detectable effect on the social organization of GF species. Similar impacts on social organization were not evident in the PF species. The group size of GF species declined, while the group sizes of PF species showed little variation over time. Despite the general decline in their group sizes, GF species exhibited some recovery eight months after cyclone Ita. However, there was no such recovery

100 exhibited after cyclone Nathan. The lack of apparent recovery after cyclone Nathan indicates that multiple impacts of this nature can have longer lasting negative impacts on the social structure of GF species. The relative stability of group sizes in the PF species on the other hand, suggests a level of resilience in social structure in the face of natural disturbance. Overall, mean coral size and the presence of very large corals (greater than 50 cm mean diameter) decreased with each cyclone. This was consistent with damage reported in studies on these cyclones (Brandl et al., 2016, Ceccarelli et al., 2016, Khan et al., 2017, Ferrari et al., 2017) and others (Harmelin-Vivien, 1994). 5.5.2 Implications for pair- and group-forming species The overall reduction in coral sizes meant that both GF and PF species were more frequently observed in corals of smaller sizes including some of a size that were unoccupied before the cyclones (Feb 2014). Therefore, the recovery in group size of GF species following cyclone Ita (Jan 2015) occurred despite the fact that the corals they inhabited were smaller on average compared to pre-cyclone (Feb 2014). This result was unexpected, given the positive relationship between coral size and group size regularly reported for social habitat-specialist reef fishes (Mitchell and Dill, 2005, Thompson et al., 2007, Wong et al., 2005). This may indicate that GF species of gobies will tolerate greater coral saturation (i.e. more subordinates in smaller corals) following a disturbance, especially if they benefit in future reproduction or survival from doing so (Ang and Manica, 2011). Despite this small recovery following cyclone Ita, group sizes of GF species remained relatively lower following cyclone Nathan. This may be due to social conflict (Wong et al., 2007) and recruitment prevention (Buston, 2003a), demonstrated in other social fishes at high rates of habitat saturation. Smaller group sizes suggest lower numbers of subordinates which may have a negative impact on future reproductive efforts (Ang and Manica, 2011). Smaller group sizes could also be problematic under a regime of repeated disturbance as larger group size may provide a level of redundancy and buffer effects of future disturbance (Munday, 2004b, Duffy and Macdonald, 2010, Rubenstein, 2011). However, when group sizes are reduced, so too is this redundancy. The proportion of corals inhabited by PF species did decrease following cyclone Ita, but had returned to pre- cyclone levels in the period following cyclone Nathan. At all survey times, PF species inhabited a substantially higher proportion of corals than GF species. This suggests that PF species might be better able to colonize vacant corals than GF species, for example by out-competing GF species for habitat (Munday, 2004a, Munday et al., 2001). However, most of the GF species in our study tended to prefer different species of coral to the PF species and we therefore consider competitive effects unlikely. Instead, the greater proportion of corals inhabited by PF species could be due to their tendency to live in intermediate sized (20 – 30 cm) corals as shown by our analysis of the probability of occupation by a PF species. Corals in this size range were relatively common in the surveys following cyclone Ita (compared to the larger corals that GF species tend to inhabit). Group-forming species on the other hand showed a relatively lower probability of occupying corals in this intermediate size range. This ability or preference of PF species to occupy corals in the range of sizes most commonly found after the cyclones could be advantageous at the population scale, as

101 long as these habitats were of sufficient quality to enable foraging, protection from predators and successful breeding (Kuwamura et al., 1994, Hobbs and Munday, 2004). 5.5.3 Ecological Constraints and Benefits of Philopatry In theory, subordinates living in a group could maximize their lifetime reproductive success if they dispersed to pursue independent breeding rather than remaining in a group as a subordinate. In practice however, various ecological constraints and benefits of remaining philopatric amongst other factors (e.g. life-history and phylogeny), alter the advantages of dispersing from or remaining in their current group (Hamilton, 1964b, Bourke, 2014, Hing et al., 2017). For example, a lack of vacant habitat to disperse to in order to pursue independent breeding (an ecological constraint) would increase the benefit of remaining in the group, even as a non-breeding subordinate, especially if the subordinate stands to inherit the breeding position in the future (a benefit of philopatry). Habitat saturation (i.e. lack of available suitable habitat) is often invoked as a key ecological constraint leading to group formation and maintenance in a variety of taxa (e.g. birds (Komdeur, 1992); mammals (Lucia et al., 2008); fish (Hing et al., 2017)). Other studies on a closely related coral goby (Wong, 2010) and on social freshwater fishes (Heg et al., 2011) have found the combination of habitat saturation and benefits of philopatry promote group-living. However, we found little evidence to support habitat saturation acting as a constraint on dispersal in coral gobies following these disturbances. Our analysis of vacant corals on transects with and without groups of GF species indicate that GF groups were present even when alternative corals were available for subordinate dispersal. As we only included corals of a size that pairs of gobies had been observed in, these alternative corals are assumed to be of a size capable of supporting at least a breeding pair. Our study therefore indicates that habitat saturation alone was unlikely to explain group formation. Instead, and consistent with the benefits of philopatry hypothesis, subordinates of GF species stayed within the group, presumably obtaining benefits that group living provides (e.g. inheritance of a breeding position in a good quality habitat). Additionally, our analysis of the probability of occupation showed that GF species were increasingly more likely to inhabit a coral as coral size increased. Coral size has been shown to be related to individual growth, survival and reproductive success in some coral-associated fishes and may therefore be considered a reasonable proxy for habitat quality (Hobbs and Munday, 2004, Kuwamura et al., 1994). This strong association between coral size (quality) and probability of occupancy by a GF species is consistent with the benefits of philopatry model as we would expect larger group sizes (characteristic of more social species) in higher-quality habitat. Conversely, under a habitat saturation model we would expect a much weaker association between coral size and the probability of occupancy by a GF species as subordinates would be expected to disperse to vacant habitat of any size that could support independent breeding. Furthermore, if habitat saturation (availability of corals) was acting as a constraint on dispersal following the cyclone, we would expect the proportion of inhabited corals to approach 100% as subordinates would quickly fill any vacant habitat to pursue independent breeding (Komdeur, 1992). Alternatively, if there were sufficient benefits of residing in a high-quality habitat, we would expect the proportion of inhabited corals to be substantially lower than 100% after the cyclones as individuals living in low-quality habitat would vacate

102 and take up residence in a higher-quality habitat as a subordinate. We found the proportion of corals inhabited by social species was very low and relatively constant (< 25%) throughout the study, even though there were vacant corals present (approximately 20% per transect), suggesting that benefits of philopatry and not habitat saturation was responsible for group formation.

5.6 Conclusion Few studies thus far have examined the effects that extreme climatic events such as tropical cyclones could have on social organization of social species. While two cyclones in consecutive years may be rare, the frequency of the most intense cyclones is projected to increase as sea surface temperatures continue to rise in the future and repeated disturbances may become more prevalent (Knutson et al., 2010). The destructive nature of these events on coral-reef communities has been well documented (Lirman and Fong, 1995, Cheal et al., 2002, Gouezo et al., 2015). However, changes to social organization from such events have been less studied. Here we demonstrated that repeated cyclones are likely to negatively impact social organization in a genus of coral-reef fishes through flow-on effects of the destruction of habitat, but only in GF species. Pair- forming species appear to be able to monopolize smaller corals and maintain their social organization in response to extreme climatic events. Additionally, we suggest that the most likely mechanism for the maintenance of group sizes in GF species are benefits of philopatry, but these benefits only promote group living when the habitat is of sufficient size. Cyclones are capable of reducing whole areas of coral to well below what appears to be the minimum size threshold for GF coral gobies to form their usual group structures, which may be linked to their ability to recover from such disasters. In fact, we observed several sites that were completely devoid of corals (and hence coral gobies) following each cyclone. With the frequency of more intense cyclones and other stressors on coral reefs (e.g. coral bleaching) set to increase in the near future, population declines and localized extinctions of GF species of coral gobies through habitat loss and lowered recovery ability due to impacts on their social organization are a real possibility. While PF species appear to buffer these effects somewhat, they are still vulnerable to habitat destruction caused by these catastrophic events.

103 6 General Discussion

6.1 Introduction Social behaviour is observable in every major taxonomic lineage, from plants and bacteria to arthropods, birds, mammals, reptiles and fish (Baluška and Mancuso, 2009, Buston and Wong, 2014, Chapple, 2003, Cockburn, 1998, Jennions and Macdonald, 1994, Toth and Rehan, 2017, Whiteley et al., 2017). This common behaviour represents possibly one of the greatest examples of convergent evolution, but the proximate mechanisms driving this behaviour vary markedly between species (Elgar, 2015). A central theme in the field of behavioural ecology is therefore to understand the evolutionary origins of sociality in a broad range of taxa. Most research effort in this area has concentrated on terrestrial animals (Hing et al., 2017). This is likely (at least partially) due to the difficulties of observing aquatic taxa over long periods of time and because aquatic taxa haven’t traditionally been thought of as social animals. This general bias toward terrestrial studies means that social evolution in animals with life-history strategies differing from terrestrial species are rarely assessed (Wong and Buston, 2013). This limits our understanding of social evolution as these unconventional life-histories may alter the costs and benefits associated with group living. Overlooking these factors means we are assessing social evolution with reduced information. While great advances have been made in progressing our understanding of the factors influencing social evolution in terrestrial taxa, a truly comprehensive appreciation of this behaviour must incorporate diverse taxa from many environments (Elgar, 2015, Wong and Buston, 2013, Zuk et al., 2014).

Examining sociality in marine fishes has already lead to some major new ideas about the formation and maintenance of groups (reviewed in Wong and Buston, 2013), constraints on group sizes (Ang and Manica, 2010b, Mitchell and Dill, 2005, Kuwamura et al., 1996), the evolution of cooperation in the absence of relatedness (Buston and Wong, 2014, Buston, 2003b, Wong et al., 2007) and how social hierarchies can be maintained despite conflicts over rank and reproduction (Buston and Cant, 2006, Wong et al., 2007). These studies have so far only obtained these insights for single species. While these single species findings are important, they lack the generality of comparative analyses. Nonetheless, this is clearly an important group of organisms with great potential to provide novel insight on social evolution. In this thesis, I have expanded on these studies by providing a comparative analysis of an entire genus, yielding important insights into their social evolution and maintenance and in turn providing a solid foundation for future research on sociality in Gobiodon.

Looking to the future, at the time of writing, we are facing a period of global environmental change. It is widely recognised that severe weather events are likely to increase under this changing environment (Knutson et al., 2010, Walsh et al., 2012). The physical and ecological effects of these extreme weather events is relatively well studied in the marine environment (Coker et al., 2009, Wilson et al., 2006, Hughes and Connell, 1999, Gouezo et al., 2015, Johns et al., 2014). There are also well known links between ecology and social organization (Chapman and Valenta, 2015, Duffy and Macdonald, 2010, Schradin et al., 2018,

104 Schürch et al., 2016). It is therefore reasonable to assume that changes in a species’ ecology would have measurable effects on their social organization. Despite this logical relationship, the effects of severe weather events on social organization have received little attention thus far.

Extreme weather events can be difficult to study because of their unpredictability. This unpredictability usually (but not always) means that it is impossible to gather data before the event. The physical destruction caused by these events can also make site access difficult or unsafe following a severe weather event. Given the paucity of studies examining the effects of severe weather events on sociality, it is important to opportunistically sample these events when possible. Even data gathered after the event without knowledge of the system prior to impact can be informative (Altwegg et al., 2017). It is quite clear that abundances and distributions of animals are altered by severe weather events in both terrestrial (e.g. Schowalter et al., 2017, Luja and Rodríguez-Estrella, 2010, Freeman et al., 2008) and marine environments (e.g. Cheal et al., 2002, Wismer et al., 2018, Emslie et al., 2008, Gouezo et al., 2015). However the mechanisms behind these alterations are less well understood. Social organization is important for a species’ survival following these disturbances because it may contribute to their feeding efficiency, reproductive output and predator defence (Clark and Dukas, 1994, Ridley and van den Heuvel, 2012). Altered social organization would therefore seem to be a mechanism worthy of investigation for abundance and distributional shifts following severe weather events. Two cyclones impacted my study sites during this PhD research. This provided a unique opportunity to explore the effects these events had on social organization. This is the first study to look at these effects in coral reef fishes, and to my knowledge is the first study of its kind in the broader sociality literature.

105 6.2 Summary of key results Chapter 2 – Literature review Presented overview of methodology used in social evolution

Summarised the main hypotheses

Presented a general framework to study social evolution

Chapter 3 – Quantifying sociality in Gobiodon Developed the basis for future work on social evolution in the genus Gobiodon

Demonstrated that group size was a good measure of sociality

Chapter 4 – Evolution of sociality in Gobiodon Revealed that sociality evolved due to a combination of ecology and life-history

Improved the understanding of phylogenetic relationships within the Lizard Island population of Gobiodon

Chapter 5 – Environmental impacts on sociality in Gobiodon Sociality can change in response to severe weather events

Benefits of philopatry likely drives group formation following disturbance

6.3 Key results 6.3.1 Chapter 2 – A general framework for research programs on social evolution In Chapter 2 (published as Hing et al., 2017), I recommended that researchers conduct studies with comparative analyses in mind. The framework I suggested was designed to enhance interspecific comparative analyses, as these studies offer great insight into the evolution of sociality (e.g. Jetz and Rubenstein, 2011, Blumstein and Armitage, 1999). The framework consisted of 1) sourcing or building a phylogeny for the taxonomic scale of interest; 2) collecting behavioural, ecological, life-history and social data of interest to be correlated with the underlying phylogeny; 3) targeting experimental work to assign causation based on the findings of the phylogenetic correlations. In this thesis I demonstrated how such a framework could be undertaken to provide meaningful insights into social evolution. I began by building a specific phylogeny to examine sociality in Gobiodon at Lizard Island. Whilst collecting the genetic samples I also collected behavioural, ecological and life-history data for the second part of the framework. I then performed phylogenetically controlled correlations of this data and demonstrated that a combination of ecological and life-history traits likely drove sociality in these species. I had then planned to conduct experimental work on altering an ecological variable (coral size) while controlling for the life-history variable (fish length) in order to explore whether sociality changed as a response. However my work was interrupted by cyclone activity. I instead conducted a “natural experiment” to determine whether the severe impact of the cyclones changed the ecology of the system and in turn, whether these changes impacted upon the sociality of coral gobies. In the context of the broader field of social evolution, I have demonstrated that

106 this cohesive framework is capable of providing substantial insight into the evolution of sociality.

In addition, I highlighted the comparative paucity of social evolution studies conducted on marine species. There is unquestionably a bias toward terrestrial taxa in the social evolution literature (Elgar, 2015, Hing et al., 2017). While great advances have been made in our understanding of the factors which may contribute to social behaviour in terrestrial species, this bias restricts our ability to make taxonomic generalizations (Elgar, 2015). This taxonomic bias has been acknowledged in social evolution and other fields of evolutionary biology (Elgar, 2015, Zuk et al., 2014). It is encouraging to see a number of researchers who are making attempts to even out this bias with understudied taxa (Ang and Manica, 2010a, Avilés and Harwood, 2012, Buston and Wong, 2014, Chak et al., 2017, Chapple, 2003). My intent in highlighting this taxonomic unevenness was to ensure the issue remains current and to encourage future research in social evolution using novel study systems.

6.3.2 Chapter 3 – Quantifying sociality in Gobiodon At the time of writing, Gobiodon species have not been used to study social evolution. The first step in any study of sociality should be to quantify sociality such that variation can be measured between species. The vast majority of studies which quantify sociality do so using group size (but see Armitage, 1981, Avilés and Harwood, 2012 for examples of studies employing more complex indicies). However, group size is only one measure of a very complex concept. I therefore conducted a comprehensive study of sociality in each species of Gobiodon, taking into account two measures of sociality, size structure of groups, possible constraints on group size and the distribution and ancestral states of sociality in the genus. This quantitative description of sociality will be important for future research on sociality in this genus and may be used as a general framework for describing sociality in other species.

As a metric for sociality, group size may well be acceptable. However, no study that I am aware of has attempted to verify whether group size is an acceptable proxy for complex sociality. For example, group size alone does not give any information about affiliative behaviours or group structure. In Chapter 3, I assessed group size against a more complex sociality index (Avilés and Harwood, 2012). Group size was strongly correlated with the sociality index. Therefore, group size is a reasonably good measure of sociality in Gobiodon. This finding will allow future studies of sociality in Gobiodon to use group size as a verified measure of sociality. However, I would still recommend researchers recognise that group size is only a single aspect of a complex topic.

I then examined groups for each species of Gobiodon for evidence of size structuring – a hallmark of size based dominance hierarchies and social queues (Buston, 2003b, Wong et al., 2007). I found good evidence of size structuring in all of the more social species, but my sample sizes were not sufficient to conduct frequency analyses to determine specific size ratios between ranks (sensu Buston and Cant, 2006, Wong et al., 2007, Hamilton and Heg, 2008). Building on this study with greater replication would be highly desirable for future research in order to definitively confirm (or refute) the presence of size based dominance hierarchies in each species. Nonetheless, the observed size structuring in the more social species indicates

107 that there is a linear progression of body sizes in group members. Larger individuals often have a competitive advantage over smaller individuals (e.g. Forrester, 1991). Thus it seems likely that the body size progression correlates with rank and a size based dominance hierarchy exists in these groups. The presence of a size based dominance hierarchy has important implications for social evolution. For example such hierarchies often involve a social queue. Buston (2003b) and Wong et al. (2007) have shown that other habitat specialist fishes stabilise such queues by reducing competition through body size adjustment. That is, subordinate fishes in the queue reduce their growth rates such that their body size does not encroach on that of their immediate dominant. Thus the dominant is not competitively threatened and will tolerate the presence of the subordinate, rather than evicting it from the group. Other fish species with size based hierarchies appear to reach equilibrium through segregation or increasing affiliative behaviours (Ang and Manica, 2010a, Hamilton et al., 2005). Peaceful cooperation is a novel method of conflict mitigation and has not been observed in terrestrial taxa. However, how prevalent this form of cooperation is within marine fishes is not yet known. Thus research in this area of Gobiodon sociality would be highly desirable. Size based hierarchies and social queues usually involve the inheritance of breeding status and a high quality habitat. These are both examples of benefits obtained through philopatry and provide good opportunity for testing the benefits of philopatry hypothesis

Factors constraining group size are also an integral component of sociality. In other habitat specialist fishes, with similar ecological characteristics (strong host specificity, high mortality outside host, small body size, size based dominance hierarchies), there exists a three way relationship between group size, habitat patch size and the. I therefore tested these three components in each species of Gobiodon present at Lizard Island (Buston, 2003b, Kuwamura et al., 1994, Mitchell and Dill, 2005, Wong, 2011). I was not able to completely disentangle the effects of coral size and size of the largest individual (measured as standard length in my study (SLα)) on group size, but when tested individually, SLα appeared to have little effect on group size in any species of Gobiodon except G. fuscoruber. In contrast to my findings, Buston (2003b), Mitchell and Dill (2005) and Wong (2011) have found that the size of the largest individual strongly predicts group size in a range of habitat specialist fishes. This is because a body size ratio exists within the size based hierarchy and a finite number of subordinates can exist within the group, dependant on SLα. It is possible that the relationship breaks down in the majority of Gobiodon species because the two dominant breeders are closely matched in size (Munday et al., 2006). It is also possible that the corals I surveyed were under-saturated and the full group size – habitat size – SLα relationship had not fully developed. This could happen if some other factor, not considered in my research, influenced the optimal group size. For example, if foraging efficiency was also an important factor in determining group size, it might peak at a lower group size than that allowed under a specific SLα. The actual group size might then tend toward the foraging efficiency optimum and there would be no relationship between group size and SLα. Another possibility is that a distinct size ratio between adjacent ranks is absent in Gobiodon species. I did not have enough replicates to conduct a study of size ratios. I found evidence of some size structuring in Gobiodon groups, but the presence of size based

108 dominance hierarchies is yet to be confirmed. If such a hierarchy is absent in Gobiodon groups, it could also upset the relationship between group size and SLα. The mechanisms behind this breakdown in relationship between group size and SLα would be interesting avenues of future research in these species.

Despite the lack of relationship between group size and SLα, there was a strong relationship between group size and coral size for three species of Gobiodon. This indicates that coral size was a substantial constraint on group size in these species. Habitat patch size is a well documented constraint on group size in fishes (Buston, 2003b, Thompson et al., 2007, Kuwamura et al., 1994, Mitchell and Dill, 2005, Wong, 2011). However there was strong evidence of group forming in G. Citrinus and G. acicularis with no relationship between group size and coral size. These species appear to form groups regardless of coral size. This may indicate that group living is beneficial to this species regardless of habitat size and would be an interesting aspect to investigate further. Buston (2004a) has shown that subordinates of Amphiprion do not provide any net benefits to the dominant group members and their presence is tolerated due to a neutral state of cost and benefit to the group. The costs and benefits of maintaining a group of subordinates in Gobiodon species has not yet been examined.

There did not appear to be any consistent factor that influenced group size in Gobiodon species. It therefore seems likely that the factors constraining group size are species-specific. To my knowledge, this kind of analysis has not been conducted over an entire genus before. This finding emphasizes the importance of comparative analyses across multiple species demonstrates that even closely related taxa with similar ecological requirements can vary markedly in the factors selecting for social behaviour.

The last section of Chapter 3 looked at the distribution of sociality in the genus and the ancestral states of sociality. I found that sociality was randomly distributed throughout the genus. This strongly indicates that factors other than phylogenetic constraint influenced whether a species became social or not. This has rarely been tested in marine fishes, but Nowicki et al. (2018) found a strong phylogenetic signal for pair formation in butterflyfishes (genus Chaetodon). The ancestral reconstruction of sociality in the Gobiodon genus revealed relatively even probabilities of either pair-or group forming ancestors at most nodes. This reinforces the idea that other factors influenced the social states of these ancestors as well as the extant species.

In this chapter I provided a comprehensive overview of sociality in the genus Gobiodon. At the time of writing, no other study has attempted to verify group size as a reliable measure of sociality, and few acknowledge the shortcomings of using a single metric to imply sociality. Here, I have measured sociality by two methods, demonstrated size structure within groups, examined constraining factors on group size and revealed the extant distribution of sociality in the genus. This study lays the foundation for future work on sociality in Gobiodon and may serve as general framework for examining sociality in other taxa.

109 6.3.3 Chapter 4 - How did sociality evolve in coral gobies? In Chapter 3, I determined that sociality in coral gobies was not randomly distributed throughout the phylogeny. This is a strong indicator that the trait (sociality) is not under phylogenetic constraint and other factors such as ecology and life-history were likely responsible for the extant social state of each species. To formally test this hypothesis I conducted two tests for phylogenetic signal in this chapter. I found only a low phylogenetic signal of sociality in Gobiodon. This indicates that other factors like had a stronger influence over the extant state of sociality in Gobiodon than phylogenetic constraint. I therefore tested a range of factors including average coral size, host generalization and average fish length. Of these variables, the interaction between coral size and fish length best predicted sociality in coral gobies. It should be noted however, that there could be other factors which influence sociality that I did not assess in this chapter. For example, coral architecture or coral health could be important determinants of coral quality for their inhabitants. Inheritance of high quality habitat is a key feature of the benefits of philopatry hypothesis (which was considered most likely to be driving group formation following disturbance in chapter 5).

While evolutionary processes of sociality have not been assessed in any other closely related species of fish, Wong (2010) found that habitat saturation, risk of movement and habitat size strongly influenced subordinate dispersal in Paragobiodon xanthosoma (sister genus to Gobiodon). Habitat saturation and risks of movement would therefore be interesting factors to examine in the future for Gobiodon. In more distantly related habitat specialist fishes (genus Amphiprion), Buston (2004b) considered territory inheritance to be an important benefit for subordinates to remain within the group. I did not specifically examine territory inheritance in Gobiodon, but I suspect it is an important benefit of group living. I base this on my observations of size structuring in Chapter 3. It seems likely that Gobiodon species also queue for breeding positions, suggesting that the benefit of inheriting the territory outweighs the cost of leaving the group. This would certainly be an interesting relationship to explore further.

In a recent study on butterfly fish (genus Chaetodon), Nowicki et al. (2018) demonstrated that pair-forming was ancestral and gregarious group behaviour in several species that had independent origins. I found little support for any phylogenetic clustering of sociality (akin to gregariousness in Chaetodon) in Gobiodon. Instead, I ascertained that a combination of ecological and life-history traits best predicted sociality in Gobiodon species. This discrepancy highlights how variable the factors influencing the evolution of sociality can be, even between coral reef fishes. It also emphasizes the necessity for more phylogenetic studies of sociality across diverse taxa. There are a number of phylogenetic studies of sociality in terrestrial species (e.g. Kamilar and Cooper, 2013, Kruckenhauser et al., 1999, Legendre et al., 2014, Lukas and Clutton-Brock, 2012b, Ossi and Kamilar, 2006, Prum, 1994, Rehan and Toth, 2015, Rivera et al., 2014, Rubenstein and Lovette, 2007) and these tend to show a high degree of variation in phylogenetic signal across diverse taxa. However, few marine studies exist (but see Chak et al., 2017, Hing et al., 2019, Nowicki et al., 2018) which limits our ability to determine variability in factors involved in the evolution of sociality more broadly.

I also improved our understanding of the phylogenetic relationships in the genus Gobiodon by adding

110 additional molecular markers to previous phylogenies (Duchene et al., 2013, Harold et al., 2008, Herler et al., 2009). In addition, I empirically tested and subsequently removed a described species (Gobiodon spilophthalmus; Fowler, 1944) from previous studies (Duchene et al., 2013, Harold et al., 2008, Munday et al., 1999), which I demonstrated was likely the juvenile version of two valid adult species, G. acicularis and G. ceramensis (Hing et al., 2019). This finding will help to clarify the current confusion around the identification of the species within this clade (Harold et al., 2008, Munday et al., 1999, Steinke et al., 2017).

6.3.4 Chapter 5 - Does sociality change with disturbance? In Chapter 5 I described how sociality may change in Gobiodon following severe weather events. The observed changes were likely due to physical disturbance of habitat. A slight increase in group size following the first cyclone was probably due to some benefit of group-living. Although, I did not attempt to identify what these benefits might be, habitat quality seems a likely candidate for future exploration. Specifically, the benefit of inheriting a good quality habitat as reported by Buston (2004b) for Amphiprion. Mean coral diameter (measured in my study) may be one aspect of coral quality as it would be correlated with inter- branch space, a possible aspect of quality as it would determine space available for nesting and protection (Schiemer et al., 2009). However, coral health (Schiemer et al., 2009), coral architecture (Untersteggaber et al., 2014) and distance to other corals (Wall and Herler, 2009) are also conceivable aspects of habitat quality for coral gobies. Coral health and coral architecture likely relate to the available space for feeding, egg laying and protection, while distance to other corals may be a proxy of predation risk.

The observed changes in group size following each cyclone show that there is some plasticity in group size in Gobiodon. Social flexibility may be an important life-history tactic for dealing with environmental variation as described by Schradin et al. (2019) and Cronin (2001). In Chapter 5, I found that group-forming species’ group sizes changed after each cyclone while the pair-forming species did not (Hing et al. 2018)(Hing et al., 2018). An interesting avenue for future research would be to investigate the intraspecific social plasticity in Gobiodon. It is still unclear whether the observed changes in group size were a result of, or a reaction to the environmental disturbance. Determining the reasons behind these shifts in social organization would help to understand the longer term impacts of these destructive events.

My finding that benefits of philopatry likely drive sociality following disturbance has implications for conservation as it indicates that maintaining high quality corals is important for maintaining normal group sizes in social species. Although the more social species appear to be able to survive at lower average group sizes in the short term (Hing et al., 2018), the long-term effects have not been examined. My results indicate that sequential disturbances have longer lasting effects on social structures. Future research in this area should therefore prioritise the investigation of long-term effects of these social changes. A species’ social organization may be linked to a number of factors which could affect survival following an extreme weather event. For example, social organization is a well known predictor of foraging efficiency and predator detection (e.g. Clark and Dukas, 1994). In other species, group size is correlated with reproductive success and juvenile survival (McNutt, 1996, Courchamp and Macdonald, 2001, Nunez et al., 2015, Ridley and van

111 den Heuvel, 2012). Knowledge of the potential implications of reduced group size in Gobiodon (observed after each impact in Chapter 5) would help to resolve the question of the long term effects of severe weather events on coral gobies. Behavioural observations could help to describe foraging and predator detection behaviour at different group sizes and egg counts could be used to determine variation in reproductive output of different sized groups in Gobiodon.

I also demonstrated that highly social species were able to make some recovery in group size following a single extreme weather event, even in corals of reduced size. A similar recovery was not observed following the second impact. This indicates that each successive impact has longer lasting effects on Gobiodon sociality. At the time of writing, the frequency of the most intense storms and cyclones are projected to increase as global sea temperature rises (Knutson et al., 2010). The Great Barrier Reef has also endured two severe bleaching events in successive years for the first time in recorded history (Eakin et al., 2019) and globally, the time between recurrent bleaching events has decreased by a factor of five since the 1980’s (Hughes et al., 2018). There is clearly an urgent need to assess the effects these recurrent impacts are likely to have on reef inhabitants.

The effects of severe weather events on social organization have rarely been assessed in any taxa (but see Thompson et al., 2019 for a recent example). However, Thompson et al. (2019) has since examined the effects of the same two cyclones on butterfly fish sociality. These two studies show that severe weather events are capable of causing changes in sociality in at least two genera of coral reef fishes (Hing et al., 2018, Thompson et al., 2019). Further studies are clearly needed to assess the generality of these findings and the flow-on effects that these changes may have. More broadly, natural disturbances have been shown to impact within-group social dynamics in cetaceans (e.g. Elliser and Herzing, 2014, Herzing et al., 2017). Human induced impacts such as habitat fragmentation have also been shown to influence group size in primates (e.g. Sterck, 1999, Umapathy et al., 2011, Irwin, 2007). But aside from these examples, there are very few studies of how sociality is impacted by environmental disturbance. Given the paucity of studies showing the effects of disturbance on social organization across the board, and the demonstrated links between sociality and ecology, there is a clear need for future research in this area.

6.4 Conclusion Habitat-specialist marine fishes remain a relatively understudied group of organisms in the field of social evolution. This is despite many desirable qualities for a model study system such as wide distribution, relative abundance, ease of observation and the availability of a wealth of ecological, physiological and phylogenetic research for many species (reviewed in Buston and Wong, 2014, Hing et al., 2017, Taborsky and Wong, 2017, Wong and Buston, 2013). A taxonomic bias toward terrestrial organisms exists in the social evolution literature (Hing et al., 2017). This bias means that social evolution theory lacks assessment under unusual conditions (Elgar, 2015). In conducting this study, I have added a comprehensive body of research on a new model taxon (genus Gobiodon) to the field of social evolution. This is an important step toward

112 evening out the taxonomic bias toward terrestrial taxa in this field.

This thesis represents the first study on social evolution and maintenance in the Gobiodon genus. As such, it lays the groundwork for future research of a unique taxon as a model species and clearly demonstrates the potential of the genus Gobiodon to rigorously assess social evolution theory in a novel context. I achieved this by firstly, proposing and demonstrating the effectiveness of using a robust methodological framework to investigate questions of social evolution in novel model taxa (Chapter 2, published as Hing et al., 2017). I then provided a solid basis for future research of Gobiodon sociality by presenting a multifaceted quantification of sociality in each species of Gobiodon present at Lizard Island, Australia (Chapter 3). Part of this quantification was a novel comparison of group size with a more complex social index, not attempted in any other taxa. Next, I assessed the effects of phylogenetic constraint, ecology and life-history factors on the evolution of sociality in Gobiodon (Chapter 4, published as Hing et al., 2019). Finally, in Chapter 5 (published as Hing et al., 2018), I conducted a natural experiment to investigate the effects of severe weather events on social organization in Gobiodon, the first study to address this relationship. Together, this body of research contributes to the understanding of the various factors that may influence sociality in an underrepresented taxon.

My research is the first to assess the impact that severe weather events may have on social organization in coral-reef fishes. In fact, the impact of severe weather events on social organization has rarely been tested in any species. This is despite clear links between severe weather and ecological disturbance and between ecology and sociality. I have demonstrated that Gobiodon sociality does change in response to severe weather events (Hing et al., 2018). This is an important finding because the precise mechanisms behind community shifts following disturbance are not well known. Changes in sociality likely cause changes in feeding behaviour and frequency, predation risk and reproductive output (Clark and Dukas, 1994, Courchamp and Macdonald, 2001, McNutt, 1996, Nunez et al., 2015, Ridley and van den Heuvel, 2012). Thus, changes in sociality should be considered as a potential mechanism driving abundance and distributional shifts of species following disturbance. Studies such as this will become increasingly important as severe weather events and other environmental disturbances increase in frequency in the future (Knutson et al., 2010, Hughes et al., 2018).

This thesis lays the groundwork for future work on the evolution of sociality in coral gobies. I have shown that coral gobies are a good model species for such research by quantitatively demonstrating that there is variation in sociality both within and between species, by identifying ecological and life-history factors which likely contributed to the evolution of sociality and lastly, by showing that sociality can change in response to environmental disturbance. Throughout this research, I have clearly demonstrated that Gobiodon hold great potential for the study of social evolution. It is my sincere hope that this thesis will serve as the foundation for future research on Gobiodon sociality and that these often overlooked species continue to contribute to the field of social evolution.

113

References

AGNARSSON, I. 2002. Sharing a web - On the relation of sociality and kleptoparasitism in theridiid spiders (Theridiidae, Araneae). Journal of Arachnology, 30, 181-188. AGORRETA, A., SAN MAURO, D., SCHLIEWEN, U., VAN TASSELL, J. L., KOVACIC, M., ZARDOYA, R. & RUBER, L. 2013. Molecular phylogenetics of Gobioidei and phylogenetic placement of European gobies. Molecular Phylogenetics and Evolution, 69, 619-633. ALEXANDER, R. D. 1974. The evolution of social behavior. Annual review of ecology and systematics, 5, 325-383. ALJANABI, S. M. & MARTINEZ, I. 1997. Universal and rapid salt-extraction of high quality genomic DNA for PCR- based techniques. Nucleic Acids Research, 25, 4692-4693. ALTWEGG, R., VISSER, V., BAILEY, L. D. & ERNI, B. 2017. Learning from single extreme events. Philosophical Transactions of the Royal Society B: Biological Sciences, 372. ANG, T. Z. & MANICA, A. 2010a. Aggression, segregation and stability in a dominance hierarchy. Proceedings of the Royal Society B-Biological Sciences, 277, 1337-1343. ANG, T. Z. & MANICA, A. 2010b. Unavoidable limits on group size in a body size-based linear hierarchy. Behavioral Ecology, 21, 819-825. ANG, T. Z. & MANICA, A. 2011. Effect of the Presence of Subordinates on Dominant Female Behaviour and Fitness in Hierarchies of the Dwarf Angelfish Centropyge bicolor. Ethology, 117, 1111-1119. ANTHONY, L. L. & BLUMSTEIN, D. T. 2000. Integrating behaviour into wildlife conservation: the multiple ways that behaviour can reduce Ne. Biological Conservation, 95, 303-315. ARMITAGE, K. B. 1981. Sociality as a life-history tactic of ground squirrels. Oecologia, 48, 36-49. ARNOLD, K. E. & OWENS, I. P. F. 1998. Cooperative breeding in birds: a comparative test of the life history hypothesis. Proceedings of the Royal Society B-Biological Sciences, 265, 739-745. AVILÉS, L. & HARWOOD, G. 2012. A Quantitative Index of Sociality and Its Application to Group-Living Spiders and Other Social Organisms. Ethology, 118, 1219-1229. AVISE, J. C. & SHAPIRO, D. Y. 1986. Evaluating kinship of newly settled juveniles within social groups of the coral reef fish Anthias squamipinnis. Evolution, 40, 1051-1059. AWATA, S., MUNEHARA, H. & KOHDA, M. 2005. Social system and reproduction of helpers in a cooperatively breeding cichlid fish (Julidochromis ornatus) in Lake Tanganyika: Field observations and parentage analyses. Behavioral Ecology and Sociobiology, 58, 506-516. BAGLIONE, V., CANESTRARI, D., MARCOS, J. M., GRIESSER, M. & EKMAN, J. 2002. History, environment and social behaviour: experimentally induced cooperative breeding in the carrion crow. Proceedings of the Royal Society B-Biological Sciences, 269, 1247-1251. BALSHINE, S., LEACH, B., NEAT, F., REID, H., TABORSKY, M. & WERNER, N. 2001. Correlates of group size in a cooperatively breeding cichlid fish (Neolamprologus pulcher). Behavioral Ecology and Sociobiology, 50, 134-140. BALUŠKA, F. & MANCUSO, S. 2009. Plant neurobiology: From sensory biology, via plant communication, to social plant behavior. Cognitive Processing, 10, 3-7. BATES, D., MÄCHLER, M., BOLKER, B. & WALKER, S. 2015. Fitting Linear Mixed-Effects Models Using lme4. Journal of Statistical Software, 67, 48. BEKOFF, M., DIAMOND, J. & MITTON, J. B. 1981. Life-history patterns and sociality in canids: Body size, reproduction, and behavior. Oecologia, 50, 386-390. BELLWOOD, D. R., HOEY, A. S., ACKERMAN, J. L. & DEPCZYNSKI, M. 2006. Coral bleaching, reef fish community phase shifts and the resilience of coral reefs. Global Change Biology, 12, 1587-1594.

114 BERGMÜLLER, R., HEG, D. & TABORSKY, M. 2005. Helpers in a cooperatively breeding cichlid stay and pay or disperse and breed, depending on ecological constraints. Proceedings of the Royal Society B: Biological Sciences, 272, 325-331. BLOMBERG, S. P., GARLAND JR, T. & IVES, A. R. 2003. Testing for phylogenetic signal in comparative data: Behavioral traits are more labile. Evolution, 57, 717-745. BLUMSTEIN, D. T. & ARMITAGE, K. B. 1999. Cooperative breeding in marmots. Oikos, 84, 369-382. BLUMSTEIN, D. T. & MOLLER, A. P. 2008. Is sociality associated with high longevity in North American birds? Biology Letters, 4, 146-148. BOLAND, C. R. J., HEINSOHN, R. & COCKBURN, A. 1997. Experimental manipulation of brood reduction and parental care in cooperatively breeding white-winged choughs. Journal of Animal Ecology, 66, 683-691. BOOMSMA, J. J. 2009. Lifetime monogamy and the evolution of eusociality. Philosophical Transactions of the Royal Society B-Biological Sciences, 364, 3191-3207. BOUCKAERT, R., HELED, J., KÜHNERT, D., VAUGHAN, T., WU, C.-H., XIE, D., SUCHARD, M. A., RAMBAUT, A. & DRUMMOND, A. J. 2014. BEAST 2: A Software Platform for Bayesian Evolutionary Analysis. PLOS Computational Biology, 10, e1003537. BOURKE, A. F. G. 2011. Principles of social evolution, Oxford University Press Oxford. BOURKE, A. F. G. 2014. Hamilton's rule and the causes of social evolution. Philosophical Transactions of the Royal Society B-Biological Sciences, 369, 10. BRANDL, S. J. & BELLWOOD, D. R. 2014. Pair-formation in coral reef fishes: an ecological perspective. In: HUGHES, R. N., HUGHES, D. J. & SMITH, I. P. (eds.) Oceanography and Marine Biology: An Annual Review. CRC Press. BRANDL, S. J., EMSLIE, M. J., CECCARELLI, D. M. & RICHARDS, Z. T. 2016. Habitat degradation increases functional originality in highly diverse coral reef fish assemblages. Ecosphere, 7. BRANDL, S. J., GOATLEY, C. H. R., BELLWOOD, D. R. & TORNABENE, L. 2018. The hidden half: Ecology and evolution of cryptobenthic fishes on coral reefs. Biological Reviews. BRIGA, M., PEN, I. & WRIGHT, J. 2012. Care for kin: within-group relatedness and allomaternal care are positively correlated and conserved throughout the mammalian phylogeny. Biology Letters, 8, 533-536. BROCKMANN, H. J. 1997. Cooperative breeding in wasps and vertebrates: the role of ecological constraints. In: CHOE, J. C. & CRESPI, B. J. (eds.) The evolution of social behavior in insects and arachnids. BROOKER, R. M., MUNDAY, P. L. & AINSWORTH, T. D. 2010. Diets of coral-dwelling fishes of the genus Gobiodon with evidence of corallivory. Journal of Fish Biology, 76, 2578-2583. BROOKS, K. C., MAIA, R., DUFFY, J. E., HULTGREN, K. M. & RUBENSTEIN, D. R. 2017. Ecological generalism facilitates the evolution of sociality in snapping shrimps. Ecology Letters, 20, 1516-1525. BROTHERS, E. B., WILLIAMS, D. M. & SALE, P. F. 1983. Length of larval life in twelve families of fishes at "One Tree Lagoon", Great Barrier Reef, Australia. Marine Biology, 76, 319-324. BROWN, J. L. 1974. Alternate Routes to Sociality in Jays—With a Theory for the Evolution of Altruism and Communal Breeding. American Zoologist, 14, 63-80. BROWN, J. L. 1987. Helping and communal breeding in birds, Princeton, New Jersey, Princeton University Press. BRUINTJES, R., BONFILS, D., HEG, D. & TABORSKY, M. 2011. Paternity of subordinates raises cooperative effort in cichlids. PLoS ONE, 6. BRUINTJES, R., HEKMAN, R. & TABORSKY, M. 2010. Experimental global food reduction raises resource acquisition costs of brood care helpers and reduces their helping effort. Functional Ecology, 24, 1054-1063. BURDA, H. 1990. Constraints of pregnancy and evolution of sociality in mole-rats - with special reference to reproductive and social patterns in Cryptomys hottentotus (Bathyergidae, Rodentia). Zeitschrift Fur Zoologische Systematik Und Evolutionsforschung, 28, 26-39. BURT, D. B. 1996. Habitat-Use Patterns in Cooperative and Non-Cooperative Breeding Birds: Testing Predictions with Western Scrub-Jays. The Wilson Bulletin, 108, 712-727.

115 BUSTON, P. 2003a. Forcible eviction and prevention of recruitment in the clown anemonefish. Behavioral Ecology, 14, 576-582. BUSTON, P. 2003b. Social hierarchies: Size and growth modification in clownfish. Nature, 424, 145-146. BUSTON, P. 2004a. Does the presence of non-breeders enhance the fitness of breeders? An experimental analysis in the clown anemonefish Amphiprion percula. Behavioral Ecology and Sociobiology, 57, 23-31. BUSTON, P. M. 2004b. Territory inheritance in clownfish. Proceedings of the Royal Society B-Biological Sciences, 271, S252-S254. BUSTON, P. M. & BALSHINE, S. 2007. Cooperating in the face of uncertainty: A consistent framework for understanding the evolution of cooperation. Behavioural Processes, 76, 152-159. BUSTON, P. M., BOGDANOWICZ, S. M., WONG, A. & HARRISON, R. G. 2007. Are clownfish groups composed of close relatives? An analysis of microsatellite DNA variation in Amphiprion percula. Molecular Ecology, 16, 3671-3678. BUSTON, P. M. & CANT, M. A. 2006. A new perspective on size hierarchies in nature: patterns, causes, and consequences. Oecologia, 149, 362-372. BUSTON, P. M., FAUVELOT, C., WONG, M. Y. L. & PLANES, S. 2009. Genetic relatedness in groups of the humbug damselfish Dascyllus aruanus: small, similar-sized individuals may be close kin. Molecular Ecology, 18, 4707-4715. BUSTON, P. M. & WONG, M. Y. L. 2014. Why Some Animals Forgo Reproduction in Complex Societies Behaviors of coral reef fishes provide strong support for some major new ideas about the evolution of cooperation. American Scientist, 102, 290-297. CANESTRARI, D., MARCOS, J. M. & BAGLIONE, V. 2005. Effect of parentage and relatedness on the individual contribution to cooperative chick care in carrion crows Corvus corone corone. Behavioral Ecology and Sociobiology, 57, 422-428. CARTER, G. G. & WILKINSON, G. S. 2013. Food sharing in vampire bats: Reciprocal help predicts donations more than relatedness or harassment. Proceedings of the Royal Society B: Biological Sciences, 280. CECCARELLI, D. M., EMSLIE, M. J. & RICHARDS, Z. T. 2016. Post-disturbance stability of fish assemblages measured at coarse taxonomic resolution masks change at finer scales. PLoS ONE, 11. CHAK, S. T. C., DUFFY, J. E., HULTGREN, K. M. & RUBENSTEIN, D. R. 2017. Evolutionary transitions towards eusociality in snapping shrimps. Nature Ecology & Evolution, 1, 0096. CHAPAIS, B. 2013. Monogamy, strongly bonded groups, and the evolution of human social structure. Evolutionary Anthropology, 22, 52-65. CHAPMAN, C. A. & VALENTA, K. 2015. Costs and benefits of group living are neither simple nor linear. Proceedings of the National Academy of Sciences, 112, 14751-14752. CHAPMAN, R. E. & BOURKE, A. F. G. 2001. The influence of sociality on the conservation biology of social insects. Ecology Letters, 4, 650-662. CHAPPLE, D. G. 2003. Ecology, life-history, and behavior in the Australian Scincid genus Egernia, with comments on the evolution of complex sociality in lizards. Herpetological Monographs, 17, 145-180. CHEAL, A. J., COLEMAN, G., DELEAN, S., MILLER, I., OSBORNE, K. & SWEATMAN, H. 2002. Responses of coral and fish assemblages to a severe but short-lived tropical cyclone on the Great Barrier Reef, Australia. Coral Reefs, 21, 131-142. CHEAL, A. J., MACNEIL, M. A., EMSLIE, M. J. & SWEATMAN, H. 2017. The threat to coral reefs from more intense cyclones under climate change. Global Change Biology, 23, 1511-1524. CIPRESSO PEREIRA, P. H., MUNDAY, P. L. & JONES, G. P. 2015. Competitive mechanisms change with ontogeny in coral-dwelling gobies. Ecology, 96, 3090-3101. CLARK, C. W. & DUKAS, R. 1994. Balancing foraging and antipredator demands - an advantage of sociality. American Naturalist, 144, 542-548. CLUTTON-BROCK, T. 2002. Behavioral ecology - Breeding together: Kin selection and mutualism in cooperative vertebrates. Science, 296, 69-72.

116 CLUTTON-BROCK, T. H., BROTHERTON, P. N. M., O'RIAIN, M. J., GRIFFIN, A. S., GAYNOR, D., KANSKY, R., SHARPE, L. & MCILRATH, G. M. 2001. Contributions to cooperative rearing in meerkats. Animal Behaviour, 61, 705-710. CLUTTON-BROCK, T. H., GAYNOR, D., MCILRATH, G. M., MACCOLL, A. D. C., KANSKY, R., CHADWICK, P., MANSER, M., SKINNER, J. D. & BROTHERTON, P. N. M. 1999. Predation, group size and mortality in a cooperative mongoose, Suricata suricatta. Journal of Animal Ecology, 68, 672-683. COCKBURN, A. 1996. Why do so many Australian birds cooperate: Social evolution in the Corvida? In: FLOYD, R. B., SHEPPARD, A. W. & DEBARRO, P. J. (eds.) Frontiers of Population Ecology. Canberra, Australia: CSIRO Publishing, Melbourne. COCKBURN, A. 1998. Evolution of helping behavior in cooperatively breeding birds. Annual Review of Ecology and Systematics, 29, 141-177. COCKBURN, A. 2006. Prevalence of different modes of parental care in birds. Proceedings of the Royal Society B- Biological Sciences, 273, 1375-1383. COKER, D. J., PRATCHETT, M. S. & MUNDAY, P. L. 2009. Coral bleaching and habitat degradation increase susceptibility to predation for coral-dwelling fishes. Behavioral Ecology, 20, 1204-1210. COLE, F. R. & BATZLI, G. O. 1978. Influence of Supplemental Feeding on a Vole Population. Journal of Mammalogy, 59, 809-819. COLE, K. S. 2011. Patterns of reproductive morphology in the genus Gobiodon (Teleostei: Gobiidae). Environmental Biology of Fishes, 92, 323-335. COLE, K. S. & HOESE, D. F. 2001. Gonad morphology, colony demography and evidence for hermaphroditism in Gobiodon okinawae (Teleostei, Gobiidae). Environmental Biology of Fishes, 61, 161-173. CORNWALLIS, C. K., WEST, S. A., DAVIS, K. E. & GRIFFIN, A. S. 2010. Promiscuity and the evolutionary transition to complex societies. Nature, 466, 969-U91. COURCHAMP, F., GRENFELL, B. & CLUTTON-BROCK, T. 1999. Population dynamics of obligate cooperators. Proceedings of the Royal Society B: Biological Sciences, 266, 557-563. COURCHAMP, F. & MACDONALD, D. W. 2001. Crucial importance of pack size in the African wild dog Lycaon pictus. Animal Conservation, 4, 169-174. CREEL, S. R. & WASER, P. M. 1994. Inclusive fitness and reproductive strategies in dwarf mongooses. Behavioral Ecology, 5, 339-348. CRONIN, A. L. 2001. Social flexibility in a primitively social allodapine bee (Hymenoptera: Apidae): results of a translocation experiment. Oikos, 94, 337-343. CURRY, R. L. 1989. Geographic-Variation in Social-Organization of Galapagos Mockingbirds - Ecological Correlates of Group Territoriality and Cooperative Breeding. Behavioral Ecology and Sociobiology, 25, 147-160. DARWIN, C. 1859. On the origin of species by means of natural selection. Murray, London, 220. DEPCZYNSKI, M. & BELLWOOD, D. R. 2006. Extremes, plasticity, and invariance in vertebrate life history traits: Insights from coral reef fishes. Ecology, 87, 3119-3127. DEY, C. J., O’CONNOR, C. M., WILKINSON, H., SHULTZ, S., BALSHINE, S. & FITZPATRICK, J. L. 2017. Direct benefits and evolutionary transitions to complex societies. Nature ecology & evolution, 1, 0137. DIERKES, P., HEG, D., TABORSKY, M., SKUBIC, E. & ACHMANN, R. 2005. Genetic relatedness in groups is sex- specific and declines with age of helpers in a cooperatively breeding cichlid. Ecology Letters, 8, 968-975. DIRNWÖBER, M. & HERLER, J. 2007. Microhabitat specialisation and ecological consequences for coral gobies of the genus Gobiodon in the Gulf of Aqaba, northern Red Sea. Marine Ecology Progress Series, 342, 265-275. DIXSON, D. L. & HAY, M. E. 2012. Corals Chemically Cue Mutualistic Fishes to Remove Competing Seaweeds. Science, 338, 804-807. DOERR, E. D. & DOERR, V. A. J. 2006. Comparative demography of treecreepers: evaluating hypotheses for the evolution and maintenance of cooperative breeding. Animal Behaviour, 72, 147-159. DOUBLE, M. C. & COCKBURN, A. 2003. Subordinate superb fairy-wrens (Malurus cyaneus) parasitize the reproductive success of attractive dominant males. Proceedings of the Royal Society of London. Series B: Biological Sciences, 270, 379-384.

117 DROBNIAK, S. M., WAGNER, G., MOUROCQ, E. & GRIESSER, M. 2015. Family living: An overlooked but pivotal social system to understand the evolution of cooperative breeding. Behavioral Ecology, 26, 805-811. DRUMMOND, A. J., SUCHARD, M. A., XIE, D. & RAMBAUT, A. 2012. Bayesian Phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution, 29, 1969-1973. DU PLESSIS, M. A., SIEGFRIED, W. R. & ARMSTRONG, A. J. 1995. Ecological and Life-History Correlates af Cooperative Breeding in South-African Birds. Oecologia, 102, 180-188. DUCHENE, D., KLANTEN, S. O., MUNDAY, P. L., HERLER, J. & VAN HERWERDEN, L. 2013. Phylogenetic evidence for recent diversification of obligate coral-dwelling gobies compared with their host corals. Molecular Phylogenetics and Evolution, 69, 123-132. DUFFIELD, G. A. & BULL, C. M. 2002. Stable social aggregations in an Australian lizard, Egernia stokesii. Naturwissenschaften, 89, 424-427. DUFFY, J. E. & MACDONALD, K. S. 2010. Kin structure, ecology and the evolution of social organization in shrimp: a comparative analysis. Proceedings of the Royal Society B-Biological Sciences, 277, 575-584. DUFTNER, N., SEFC, K. M., KOBLMÜLLER, S., SALZBURGER, W., TABORSKY, M. & STURMBAUER, C. 2007. Parallel evolution of facial stripe patterns in the Neolamprologus brichardi/pulcher species complex endemic to Lake Tanganyika. Molecular Phylogenetics and Evolution, 45, 706-715. EAKIN, C. M., SWEATMAN, H. P. A. & BRAINARD, R. E. 2019. The 2014–2017 global-scale coral bleaching event: insights and impacts. Coral Reefs, 38, 539-545. EBENSPERGER, L. A. 2001. A review of the evolutionary causes of rodent group-living. Acta Theriologica, 46, 115- 144. EBERLE, M. & KAPPELER, P. M. 2006. Family insurance: kin selection and cooperative breeding in a solitary primate (Microcebus murinus). Behavioral Ecology and Sociobiology, 60, 582-588. EDEN, S. F. 1987. When do helpers help? Food availability and helping in the moorhen, Gallinula chloropus. Behavioral Ecology and Sociobiology, 21, 191-195. EDWARDS, S. V. & NAEEM, S. 1993. The Phylogenetic Component of Cooperative Breeding in Perching Birds. American Naturalist, 141, 754-789. ELGAR, M. A. 2015. Challenges for social evolution: integrating insights across diverse taxa. Frontiers in Ecology and Evolution, 3. ELLISER, C. R. & HERZING, D. L. 2014. Social structure of Atlantic spotted dolphins, Stenella frontalis, following environmental disturbance and demographic changes. Marine Mammal Science, 30, 329-347. EMLEN, S. T. 1982a. The evolution of helping 1. An ecological constraints model. American Naturalist, 119, 29-39. EMLEN, S. T. 1982b. The Evolution of Helping. II. The Role of Behavioral Conflict. The American Naturalist, 119, 40-53. EMLEN, S. T. 1994. Benefits, constraints and the evolution of the family. Trends in Ecology & Evolution, 9, 282-285. EMLEN, S. T., REEVE, H. K., SHERMAN, P. W., WREGE, P. H., RATNIEKS, F. L. W. & SHELLMANREEVE, J. 1991. Adaptive Versus Nonadaptive Explanations of Behavior - The Case of Alloparental Helping. American Naturalist, 138, 259-270. EMSLIE, M. J., CHEAL, A. J., SWEATMAN, H. & DELEAN, S. 2008. Recovery from disturbance of coral and reef fish communities on the Great Barrier Reef, Australia. Marine Ecology Progress Series, 371, 177-190. FABRICIUS, K. E., DE'ATH, G., PUOTINEN, M. L., DONE, T., COOPER, T. F. & BURGESS, S. C. 2008. Disturbance gradients on inshore and offshore coral reefs caused by a severe tropical cyclone. Limnology and Oceanography, 53, 690-704. FAULKES, C. G. & BENNETT, N. C. 2013. Plasticity and constraints on social evolution in African mole-rats: ultimate and proximate factors. Philosophical Transactions of the Royal Society B-Biological Sciences, 368. FAULKES, C. G., BENNETT, N. C., BRUFORD, M. W., OBRIEN, H. P., AGUILAR, G. H. & JARVIS, J. U. M. 1997. Ecological constraints drive social evolution in the African mole-rats. Proceedings of the Royal Society B-Biological Sciences, 264, 1619-1627. FEARY, D. A. 2007. The influence of resource specialization on the response of reef fish to coral disturbance. Marine Biology, 153, 153-161.

118 FELSENSTEIN, J. 1985. Phylogenies and the Comparative Method. American Naturalist, 125, 1-15. FERRARI, R., FIGUEIRA, W. F., PRATCHETT, M. S., BOUBE, T., ADAM, A., KOBELKOWSKY-VIDRIO, T., DOO, S. S., ATWOOD, T. B. & BYRNE, M. 2017. 3D photogrammetry quantifies growth and external erosion of individual coral colonies and skeletons. Scientific Reports, 7. FIELD, J., CRONIN, A. & BRIDGE, C. 2006. Future fitness and helping in social queues. Nature, 441, 214-217. FORD, H. A., BELL, H., NIAS, R. & NOSKE, R. 1988. The Relationship Between Ecology and the Incidence of Cooperative Breeding in Australian Birds. Behavioral Ecology and Sociobiology, 22, 239-249. FORRESTER, G. E. 1991. Social rank, individual size and group composition as determinants of food consumption by humbug damselfish, Dascyllus aruanus. Animal Behaviour, 42, 701-711. FOURNIER, D. A., SKAUG, H. J., ANCHETA, J., IANELLI, J., MAGNUSSON, A., MAUNDER, M. N., NIELSEN, A. & SIBERT, J. 2012. AD Model Builder: using automatic differentiation for statistical inference of highly parameterized complex nonlinear models. Optimization Methods and Software, 27, 233-249. FOWLER, H. W. 1944. Fishes obtained in the New Hebrides by Dr. Edward L. Jackson. Proceedings of the Academy of Natural Sciences of Philadelphia, 96, 155-371. FOX, J. & WEISBERG, S. 2011. An {R} Companion to Applied Regression, Thousand Oaks CA, Sage Publications. FRECKLETON, R. P., HARVEY, P. H. & PAGEL, M. 2002. Phylogenetic analysis and comparative data: A test and review of evidence. American Naturalist, 160, 712-726. FREEMAN, A. N. D., PIAS, K. & VINSON, M. F. 2008. The impact of Tropical Cyclone Larry on bird communities in fragments of the endangered rainforest Type 5b. Austral Ecology, 33, 532-540. GARDNER, J. L., MAGRATH, R. D. & KOKKO, H. 2003. Stepping stones of life: natal dispersal in the group-living but noncooperative speckled warbler. Animal Behaviour, 66, 521-530. GARLAND, T., HARVEY, P. H. & IVES, A. R. 1992. Procedures for the Analysis of Comparative Data Using Phylogenetically Independent Contrasts. Systematic Biology, 41, 18-32. GASTON, A. J. 1978. The Evolution of Group Territorial Behavior and Cooperative Breeding. The American Naturalist, 112, 1091-1100. GOODSON, J. L. 2013. Deconstructing sociality, social evolution and relevant nonapeptide functions. Psychoneuroendocrinology, 38, 465-478. GOUEZO, M., GOLBUU, Y., VAN WOESIK, R., REHM, L., KOSHIBA, S. & DOROPOULOS, C. 2015. Impact of two sequential super typhoons on coral reef communities in Palau. Marine Ecology Progress Series, 540, 73- 85. GOWANS, S., WHITEHEAD, H. & HOOKER, S. K. 2001. Social organization in northern bottlenose whales, Hyperoodon ampullatus: not driven by deep-water foraging? Animal Behaviour, 62, 369-377. GRAFEN, A. 1982. How not to measure inclusive fitness. Nature, 298, 425-426. GREENWOOD, A. K., WARK, A. R., YOSHIDA, K. & PEICHEL, C. L. 2013. Genetic and neural modularity underlie the evolution of schooling behavior in threespine sticklebacks. Current Biology, 23, 1884-1888. GRIMES, L. 1976. The occurrence of cooperative breeding behaviour in African birds. Ostrich, 47, 1-15. GROENEWOUD, F., FROMMEN, J. G., JOSI, D., TANAKA, H., JUNGWIRTH, A. & TABORSKY, M. 2016. Predation risk drives social complexity in cooperative breeders. Proceedings of the National Academy of Sciences of the United States of America, 113, 4104-4109. GROMOV, V. S. 2017. The spatial-and-ethological population structure, cooperation, and the evolution of sociality in rodents. Behaviour, 154, 609-649. GRUETER, C. C., CHAPAIS, B. & ZINNER, D. 2012. Evolution of Multilevel Social Systems in Nonhuman Primates and Humans. International Journal of Primatology, 33, 1002-1037. HALL, T. A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic acids symposium series, 1999. [London]: Information Retrieval Ltd., c1979-c2000., 95-98. HALLIWELL, B., ULLER, T., HOLLAND, B. R. & WHILE, G. M. 2017. Live bearing promotes the evolution of sociality in reptiles. Nature communications, 8, 2030.

119 HAMILTON, I. M. & HEG, D. 2008. Sex differences in the effect of social status on the growth of subordinates in a co-operatively breeding cichlid. Journal of Fish Biology, 72, 1079-1088. HAMILTON, I. M., HEG, D. & BENDER, N. 2005. Size differences within a dominance hierarchy influence conflict and help in a cooperatively breeding cichlid. Behaviour, 142, 1591-1613. HAMILTON, W. D. 1964a. The genetical evolution of social behaviour. I. Journal of Theoretical Biology, 7, 1-16. HAMILTON, W. D. 1964b. The genetical evolution of social behaviour. II. Journal of Theoretical Biology, 7, 17-52. HARMELIN-VIVIEN, M. L. 1994. The Effects of Storms and Cyclones on Coral Reefs: A Review. Journal of Coastal Research, 211-231. HAROLD, A. S., WINTERBOTTOM, R., MUNDAY, P. L. & CHAPMAN, R. W. 2008. Phylogenetic relationships of Indo-Pacific coral gobies of the genus Gobiodon (Teleostei : Gobiidae), based on morphological and molecular data. Bulletin of Marine Science, 82, 119-136. HATCHWELL, B. J. & KOMDEUR, J. 2000. Ecological constraints, life history traits and the evolution of cooperative breeding. Animal Behaviour, 59, 1079-1086. HAYES, L. D. 2000. To nest communally or not to nest communally: a review of rodent communal nesting and nursing. Animal Behaviour, 59, 677-688. HEG, D., BACHAR, Z., BROUWER, L. & TABORSKY, M. 2004a. Predation risk is an ecological constraint for helper dispersal in a cooperatively breeding cichlid. Proceedings of the Royal Society B-Biological Sciences, 271, 2367-2374. HEG, D., BENDER, N. & HAMILTON, I. 2004b. Strategic growth decisions in helper cichlids. Proceedings of the Royal Society B: Biological Sciences, 271, S505-S508. HEG, D., BROUWER, L., BACHAR, Z. & TABORSKY, M. 2005. Large group size yields group stability in the cooperatively breeding cichlid Neolamprologus pulcher. Behaviour, 142, 1615-1641. HEG, D., HEG-BACHAR, Z., BROUWER, L. & TABORSKY, M. 2008. Experimentally induced helper dispersal in colonially breeding cooperative cichlids. Environmental Biology of Fishes, 83, 191-206. HEG, D., ROTHENBERGER, S. & SCHURCH, R. 2011. Habitat saturation, benefits of philopatry, relatedness, and the extent of co-operative breeding in a cichlid. Behavioral Ecology, 22, 82-92. HEG, D. & TABORSKY, M. 2010. Helper response to experimentally manipulated predation risk in the cooperatively breeding cichlid Neolamprologus pulcher. PLoS ONE, 5. HELFMAN, G. S. & WINKELMAN, D. L. 1997. Threat sensitivity in bicolor damselfish: Effects of sociality and body size. Ethology, 103, 369-383. HERLER, J., BOGORODSKY, S. V. & SUZUKI, T. 2013. Four new species of coral gobies (Teleostei: Gobiidae: Gobiodon), with comments on their relationships within the genus. Zootaxa, 3709, 301-329. HERLER, J., KOBLMULLER, S. & STURMBAUER, C. 2009. Phylogenetic relationships of coral-associated gobies (Teleostei, Gobiidae) from the Red Sea based on mitochondrial DNA data. Marine Biology, 156, 725-739. HERLER, J., MUNDAY, P. L. & HERNAMAN, V. 2011. Gobies on Coral Reefs. In: PATZNER, J. L. V. T., M.; KOVAČIĆ, M.; KAPOOR, B. G. (ed.) The Biology of Gobies. Jersey, British Isles, New Hampshire: Science Publishers. HERZING, D. L., AUGLIERE, B. N., ELLISER, C. R., GREEN, M. L. & PACK, A. A. 2017. Exodus! Large-scale displacement and social adjustments of resident Atlantic spotted dolphins (Stenella frontalis) in the Bahamas. PLOS ONE, 12, e0180304. HING, M. 2019a. Cyclone dataset. v1 ed. Mendelay Data. HING, M. 2019b. Drivers of sociality in Gobiodon fishes. v1 ed. Mendeley Data. HING, M. L., KLANTEN, O. S., DOWTON, M., BROWN, K. R. & WONG, M. Y. L. 2018. Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes. PLOS ONE, 13, e0202407. HING, M. L., KLANTEN, O. S., DOWTON, M. & WONG, M. Y. L. 2017. The Right Tools for the Job: Cooperative Breeding Theory and an Evaluation of the Methodological Approaches to Understanding the Evolution and Maintenance of Sociality. Frontiers in Ecology and Evolution, 5.

120 HING, M. L., KLANTEN, O. S., WONG, M. Y. L. & DOWTON, M. 2019. Drivers of sociality in Gobiodon fishes: An assessment of phylogeny, ecology and life-history. Molecular Phylogenetics and Evolution, 137, 263-273. HOBBS, J. P. A. & MUNDAY, P. L. 2004. Intraspecific competition controls spatial distribution and social organisation of the coral-dwelling goby Gobiodon histrio. Marine Ecology Progress Series, 278, 253-259. HOBBS, J. P. A., MUNDAY, P. L. & JONES, G. P. 2004. Social induction of maturation and sex determination in a coral reef fish. Proceedings of the Royal Society B-Biological Sciences, 271, 2109-2114. HODGE, S. J. 2005. Helpers benefit offspring in both the short and long-term in the cooperatively breeding banded mongoose. Proceedings of the Royal Society B: Biological Sciences, 272, 2479-2484. HOLCROFT, N. I. 2005. A molecular analysis of the interrelationships of tetraodontiform fishes (Acanthomorpha: Tetraodontiformes). Molecular Phylogenetics and Evolution, 34, 525-544. HUGHES, T. P., ANDERSON, K. D., CONNOLLY, S. R., HERON, S. F., KERRY, J. T., LOUGH, J. M., BAIRD, A. H., BAUM, J. K., BERUMEN, M. L., BRIDGE, T. C., CLAAR, D. C., EAKIN, C. M., GILMOUR, J. P., GRAHAM, N. A. J., HARRISON, H., HOBBS, J.-P. A., HOEY, A. S., HOOGENBOOM, M., LOWE, R. J., MCCULLOCH, M. T., PANDOLFI, J. M., PRATCHETT, M., SCHOEPF, V., TORDA, G. & WILSON, S. K. 2018. Spatial and temporal patterns of mass bleaching of corals in the Anthropocene. Science, 359, 80-83. HUGHES, T. P. & CONNELL, J. H. 1999. Multiple stressors on coral reefs: A long -term perspective. Limnology and Oceanography, 44, 932-940. HUGHES, W. O. H., OLDROYD, B. P., BEEKMAN, M. & RATNIEKS, F. L. W. 2008. Ancestral monogamy shows kin selection is key to the evolution of eusociality. Science, 320, 1213-1216. IRWIN, M. T. 2007. Living in forest fragments reduces group cohesion in diademed sifakas (Propithecus diadema) in eastern Madagascar by reducing food patch size. American Journal of Primatology, 69, 434-447. JENNIONS, M. D. & MACDONALD, D. W. 1994. Cooperative Breeding in Mammals. Trends in Ecology & Evolution, 9, 89-93. JETZ, W. & RUBENSTEIN, D. R. 2011. Environmental Uncertainty and the Global Biogeography of Cooperative Breeding in Birds (vol 21, pg 72, 2011). Current Biology, 21, 438-438. JOHNS, K. A., OSBORNE, K. O. & LOGAN, M. 2014. Contrasting rates of coral recovery and reassembly in coral communities on the Great Barrier Reef. Coral Reefs, 33, 553-563. JOHNSON, D. D. P., JETZ, W. & MACDONALD, D. W. 2002. Environmental correlates of badger social spacing across Europe. Journal of Biogeography, 29, 411-425. JOHNSON, J. S., KROPCZYNSKI, J. N. & LACKI, M. J. 2013. Social network analysis and the study of sociality in bats. Acta Chiropterologica, 15, 1-17. JOHNSTONE, R. A. 2000. Models of reproductive skew: A review and synthesis. Ethology, 106, 5-26. JUNGWIRTH, A., WALKER, J. & TABORSKY, M. 2015. Prospecting precedes dispersal and increases survival chances in cooperatively breeding cichlids. Animal Behaviour, 106, 107-114. KAMILAR, J. M. & COOPER, N. 2013. Phylogenetic signal in primate behaviour, ecology and life history. Philosophical Transactions of the Royal Society B: Biological Sciences, 368. KAPPELER, P. M. 2019. A framework for studying social complexity. Behavioral Ecology and Sociobiology, 73. KENT, D. S. & SIMPSON, J. A. 1992. Eusociality in the beetle Austroplatypus incompertus (Coleoptera: Curculionidae). Naturwissenschaften, 79, 86-87. KHAN, J. A., GOATLEY, C. H. R., BRANDL, S. J., TEBBETT, S. B. & BELLWOOD, D. R. 2017. Shelter use by large reef fishes: long-term occupancy and the impacts of disturbance. Coral Reefs, 36, 1123-1132. KILLEN, S. S., MARRAS, S., NADLER, L. & DOMENICI, P. 2017. The role of physiological traits in assortment among and within fish shoals. Philosophical Transactions of the Royal Society B: Biological Sciences, 372. KINGMA, S. A., SANTEMA, P., TABORSKY, M. & KOMDEUR, J. 2014. Group augmentation and the evolution of cooperation. Trends in Ecology and Evolution, 29, 476-484. KLEIMAN, D. G. 2011. Canid Mating Systems, Social Behavior, Parental Care and Ontogeny: Are they Flexible? Behavior Genetics, 41, 803-809.

121 KNUTSON, T. R., MCBRIDE, J. L., CHAN, J., EMANUEL, K., HOLLAND, G., LANDSEA, C., HELD, I., KOSSIN, J. P., SRIVASTAVA, A. K. & SUGI, M. 2010. Tropical cyclones and climate change. Nature Geoscience, 3, 157-163. KOENIG, W. D., PITELKA, F. A., CARMEN, W. J., MUMME, R. L. & STANBACK, M. T. 1992. The Evolution of Delayed Dispersal in Cooperative Breeders. Quarterly Review of Biology, 67, 111-150. KOKKO, H. & EKMAN, J. 2002. Delayed dispersal as a route to breeding: Territorial inheritance, safe havens, and ecological constraints. American Naturalist, 160, 468-484. KOKKO, H., JOHNSTONE, R. A. & CLUTTON-BROCK, T. H. 2001. The evolution of cooperative breeding through group augmentation. Proceedings of the Royal Society B-Biological Sciences, 268, 187-196. KOKKO, H., JOHNSTONE, R. A. & WRIGHT, J. 2002. The evolution of parental and alloparental effort in cooperatively breeding groups: When should helpers pay to stay? Behavioral Ecology, 13, 291-300. KOMDEUR, J. 1992. Importance of habitat saturation and territory quality for evolution of cooperative breeding in the seychelles warbler. Nature, 358, 493-495. KOMYAKOVA, V., MUNDAY, P. L. & JONES, G. P. 2013. Relative importance of coral cover, habitat complexity and diversity in determining the structure of reef fish communities. PLoS ONE, 8. KRUCKENHAUSER, L., PINSKER, W., HARING, E. & ARNOLD, W. 1999. Marmot phylogeny revisited: Molecular evidence for a diphyletic origin of sociality. Journal of Zoological Systematics and Evolutionary Research, 37, 49-56. KUMAR, S., STECHER, G. & TAMURA, K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular biology and evolution, 33, 1870-1874. KUTSUKAKE, N. 2009. Complexity, dynamics and diversity of sociality in group-living mammals. Ecological Research, 24, 521-531. KUWAMURA, T., NAKASHIMA, Y. & YOGO, Y. 1996. Plasticity in size and age at maturity in a monogamous fish: Effect of host coral size and frequency dependence. Behavioral Ecology and Sociobiology, 38, 365-370. KUWAMURA, T., YOGO, Y. & NAKASHIMA, Y. 1994. Population dynamics of goby Paragobiodon echinocephalus and host coral Stylophora pistillata. Marine Ecology Progress Series, 103, 17-23. LANFEAR, R., CALCOTT, B., HO, S. Y. W. & GUINDON, S. 2012. PartitionFinder: Combined Selection of Partitioning Schemes and Substitution Models for Phylogenetic Analyses. Molecular Biology and Evolution, 29, 1695-1701. LE VIN, A. L., MABLE, B. K., TABORSKY, M., HEG, D. & ARNOLD, K. E. 2011. Individual variation in helping in a cooperative breeder: relatedness versus behavioural type. Animal Behaviour, 82, 467-477. LEGENDRE, F., D'HAESE, C. A., DELEPORTE, P., PELLENS, R., WHITING, M. F., SCHLIEP, K. & GRANDCOLAS, P. 2014. The evolution of social behaviour in Blaberid cockroaches with diverse habitats and social systems: phylogenetic analysis of behavioural sequences. Biological Journal of the Linnean Society, 111, 58-77. LEGGE, S. 2000. Helper contributions in the cooperatively breeding laughing kookaburra: feeding young is no laughing matter. Animal Behaviour, 59, 1009-1018. LENTH, R. 2018. Emmeans: Estimated marginal means, aka least-squares means. R package. 1.1.2 ed. LI, C., ORTÍ, G., ZHANG, G. & LU, G. 2007. A practical approach to phylogenomics: the phylogeny of ray-finned fish (Actinopterygii) as a case study. BMC Evolutionary Biology, 7, 44. LIGON, J. D. & LIGON, S. H. 1978. The communal social system of the green woodhoopoe in Kenya. Living Bird, 17, 159-197. LIGON, J. D. & LIGON, S. H. 1990. Green woodhoopoes: life history traits and sociality. In: STACEY, P. B. & KOENIG, W. D. (eds.) Cooperative breeding in birds. LIGON, J. D., LIGON, S. H. & FORD, H. A. 1991. An experimental-study of the bases of male philopatry in the cooperatively breeding superb fairy-wren Malurus cyaneus. Ethology, 87, 134-148. LIRMAN, D. & FONG, P. 1995. The effects of Hurricane-Andrew and Tropical-Storm-Gordon on florida reefs. Coral Reefs, 14, 172-172. LUBIN, Y. & BILDE, T. 2007. The Evolution of Sociality in Spiders. Advances in the Study of Behavior.

122 LUCIA, K. E., KEANE, B., HAYES, L. D., LIN, Y. K., SCHAEFER, R. L. & SOLOMON, N. G. 2008. Philopatry in prairie voles: an evaluation of the habitat saturation hypothesis. Behavioral Ecology, 19, 774-783. LÜDECKE, D. 2018. Sjstats: statistical functions for regression models. R package version 0.14. 0. LUJA, V. H. & RODRÍGUEZ-ESTRELLA, R. 2010. Are tropical cyclones sources of natural selection? Observations on the abundance and behavior of frogs affected by extreme climatic events in the Baja California Peninsula, Mexico. Journal of Arid Environments, 74, 1345-1347. LUKAS, D. & CLUTTON-BROCK, T. 2012a. Cooperative breeding and monogamy in mammalian societies. Proceedings of the Royal Society B: Biological Sciences, 279, 2151-2156. LUKAS, D. & CLUTTON-BROCK, T. 2012b. Life histories and the evolution of cooperative breeding in mammals. Proceedings of the Royal Society B-Biological Sciences, 279, 4065-4070. LYNCH, M. & RITLAND, K. 1999. Estimation of pairwise relatedness with molecular markers. Genetics, 152, 1753- 1766. MANNING, C. J., DEWSBURY, D. A., WAKELAND, E. K. & POTTS, W. K. 1995. Communal Nesting and Communal Nursing in House Mice, Mus-Musculus Domesticus. Animal Behaviour, 50, 741-751. MARGRAF, N. & COCKBURN, A. 2013. Helping behaviour and parental care in fairy-wrens (Malurus). Emu, 113, 294-301. MARINO, J., SILLERO-ZUBIRI, C., JOHNSON, P. J. & MACDONALD, D. W. 2012. Ecological bases of philopatry and cooperation in Ethiopian wolves. Behavioral Ecology and Sociobiology, 66, 1005-1015. MCCALLUM, D. A. 1988. Alternative emigration strategies and the adaptive significance of natal dispersal in a population of mountain chickadees (Parus gambeli). PhD Dissertation, University of New Mexico. MCLAREN, I. A. 1967. Seals and Group Selection. Ecology, 48, 104-110. MCNUTT, J. W. 1996. Adoption in African wild dogs, Lycaon pictus. Journal of Zoology, 240, 163-173. MICHAEL, D. R., CUNNINGHAM, R. B. & LINDENMAYER, D. B. 2010. The social elite: Habitat heterogeneity, complexity and quality in granite inselbergs influence patterns of aggregation in Egernia striolata (Lygosominae: Scincidae). Austral Ecology, 35, 862-870. MITCHELL, J. 2005. Queue selection and switching by false clown anernonefish, Amphiprion ocellaris. Animal Behaviour, 69, 643-652. MITCHELL, J. S. & DILL, L. M. 2005. Why is group size correlated with the size of the host sea anemone in the false clown anemonefish? Canadian Journal of Zoology-Revue Canadienne De Zoologie, 83, 372-376. MUNDAY, P., HAROLD, A. & WINTERBOTTOM, R. 1999. Guide to coral-dwelling gobies, genus Gobiodon (Gobiidae), from Papua New Guinea and the Great Barrier Reef. Revue française d'aquariologie, 26, 53-58. MUNDAY, P. L. 2000. Interactions between habitat use and patterns of abundance in coral-dwelling fishes of the genus Gobiodon. Environmental Biology of Fishes, 58, 355-369. MUNDAY, P. L. 2001. Fitness consequences of habitat use and competition among coral-dwelling fishes. Oecologia, 128, 585-593. MUNDAY, P. L. 2002. Does habitat availability determine geographical-scale abundances of coral-dwelling fishes? Coral Reefs, 21, 105-116. MUNDAY, P. L. 2004a. Competitive coexistence of coral-dwelling fishes: The lottery hypothesis revisited. Ecology, 85, 623-628. MUNDAY, P. L. 2004b. Habitat loss, resource specialization, and extinction on coral reefs. Global Change Biology, 10, 1642-1647. MUNDAY, P. L., CALEY, M. J. & JONES, G. P. 1998. Bi-directional sex change in a coral-dwelling goby. Behavioral Ecology and Sociobiology, 43, 371-377. MUNDAY, P. L., CARDONI, A. M. & SYMS, C. 2006. Cooperative growth regulation in coral-dwelling fishes. Biology Letters, 2, 355-358. MUNDAY, P. L. & JONES, G. P. 1998. The ecological implications of small body size among coral-reef fishes. Oceanography and Marine Biology, 36, 373-411.

123 MUNDAY, P. L., JONES, G. P. & CALEY, M. J. 1997. Habitat specialisation and the distribution and abundance of coral-dwelling gobies. Marine Ecology Progress Series, 152, 227-239. MUNDAY, P. L., JONES, G. P. & CALEY, M. J. 2001. Interspecific competition and coexistence in a guild of coral- dwelling fishes. Ecology, 82, 2177-2189. MUNDAY, P. L., VAN HERWERDEN, L. & DUDGEON, C. L. 2004. Evidence for sympatric speciation by host shift in the sea. Current Biology, 14, 1498-1504. MUNDAY, P. L. & WILSON, S. K. 1997. Comparative efficacy of clove oil and other chemicals in anaesthetization of Pomacentrus amboinensis, a coral reef fish. Journal of Fish Biology, 51, 931-938. NAKASHIMA, Y., KUWAMURA, T. & YOGO, Y. 1995. Why Be a Both‐ways Sex Changer? Ethology, 101, 301- 307. NAKASHIMA, Y., KUWAMURA, T. & YOGO, Y. 1996. Both-ways sex change in monogamous coral gobies, Gobiodon spp. Environmental Biology of Fishes, 46, 281-288. NAM, K. B., SIMEONI, M., SHARP, S. P. & HATCHWELL, B. J. 2010. Kinship affects investment by helpers in a cooperatively breeding bird. Proceedings of the Royal Society B-Biological Sciences, 277, 3299-3306. NANDI, A. K., BHADRA, A., SUMANA, A., DESHPANDE, S. A. & GADAGKAR, R. 2013. The evolution of complexity in social organization-A model using dominance-subordinate behavior in two social wasp species. Journal of Theoretical Biology, 327, 34-44. NILSSON, G. E., HOBBS, J. P., MUNDAY, P. L. & OSTLUND-NILSSON, S. 2004. Coward or braveheart: extreme habitat fidelity through hypoxia tolerance in a coral-dwelling goby. Journal of Experimental Biology, 207, 33- 39. NILSSON, G. E., HOBBS, J. P. A., ÖSTLUND-NILSSON, S. & MUNDAY, P. L. 2007. Hypoxia tolerance and air- breathing ability correlate with habitat preference in coral-dwelling fishes. Coral Reefs, 26, 241-248. NONACS, P. 2000. Measuring and using skew in the study of social behavior and evolution. American Naturalist, 156, 577-589. NOWICKI, J. P., O’CONNELL, L. A., COWMAN, P. F., WALKER, S. P. W., COKER, D. J. & PRATCHETT, M. S. 2018. Variation in social systems within Chaetodon butterflyfishes, with special reference to pair bonding. PLOS ONE, 13, e0194465. NUNEZ, C. M. V., ADELMAN, J. S. & RUBENSTEIN, D. I. 2015. Sociality increases juvenile survival after a catastrophic event in the feral horse (Equus caballus). Behavioral Ecology, 26, 138-147. OLI, M. K. & ARMITAGE, K. B. 2003. Sociality and individual fitness in yellow-bellied marmots: Insights from a long-term study (1962-2001). Oecologia, 136, 543-550. OSSI, K. & KAMILAR, J. M. 2006. Environmental and phylogenetic correlates of Eulemur behavior and ecology (Primates : Lemuridae). Behavioral Ecology and Sociobiology, 61, 53-64. PAGEL, M. 1999. Inferring the historical patterns of biological evolution. Nature, 401, 877-884. PAGEL, M. D. & HARVEY, P. H. 1988. Recent developments in the analysis of comparative data. Quarterly Review of Biology, 63, 413-440. PARADIS, E., CLAUDE, J. & STRIMMER, K. 2004. APE: analyses of phylogenetics and evolution in R language. Bioinformatics, 20, 289-290. PEN, I. & WEISSING, F. J. 2000. Towards a unified theory of cooperative breeding: the role of ecology and life history re-examined. Proceedings of the Royal Society B-Biological Sciences, 267, 2411-2418. PEREIRA, P. H. C. & MUNDAY, P. L. 2016. Coral colony size and structure as determinants of habitat use and fitness of coral-dwelling fishes. Marine Ecology Progress Series, 553, 163-172. PINHEIRO, J., BATES, D., DEBROY, S., SARKAR, D. & TEAM, R. C. 2018. nlme: Linear and nonlinear mixed effects models. R package version 3.1-137. Available at h ttp://CRAN. R-project. org/package= nlme. PRUM, R. O. 1994. Phylogenetic analysis of the evolution of alternative social-behavior in the manakins (aves, pipridae). Evolution, 48, 1657-1675. PUILLANDRE, N., LAMBERT, A., BROUILLET, S. & ACHAZ, G. 2012. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Molecular Ecology, 21, 1864-1877.

124 PURCELL, J. 2011. Geographic patterns in the distribution of social systems in terrestrial arthropods. Biological Reviews, 86, 475-491. QUIÑONES, A. E., VAN DOORN, G. S., PEN, I., WEISSING, F. J. & TABORSKY, M. 2016. Negotiation and appeasement can be more effective drivers of sociality than kin selection. Philosophical Transactions of the Royal Society B: Biological Sciences, 371. R CORE TEAM 2019. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing. RAMBAUT, A., DRUMMOND, A., XIE, D., BAELE, G. & SUCHARD, M. A. 2018. Tracer v1.7. http://tree.bio.ed.ac.uk/software/tracer/. REEVE, H. K. & RATNIEKS, F. L. W. 1993. Queen-queen conflicts in polygynous societies: mutual tolerance and reproductive skew. Queen number and sociality in insects. Oxford University Press, Oxford, 45-85. REHAN, S. M. & TOTH, A. L. 2015. Climbing the social ladder: The molecular evolution of sociality. Trends in Ecology and Evolution, 30, 426-433. REICZIGEL, J., LANG, Z., RÓZSA, L. & TÓTHMÉRÉSZ, B. 2008. Measures of sociality: two different views of group size. Animal Behaviour, 75, 715-721. REVELL, L. J. 2012. phytools: an R package for phylogenetic comparative biology (and other things). Methods in Ecology and Evolution, 3, 217-223. RICKLEFS, R. E. 1975. Evolution of cooperative breeding in birds. Ibis, 117, 531-534. RIDLEY, A. R. & VAN DEN HEUVEL, I. M. 2012. Is there a difference in reproductive performance between cooperative and non-cooperative species? A southern African comparison. Behaviour, 149, 821-848. RIECHERT, S. E. & JONES, T. C. 2008. Phenotypic variation in the social behaviour of the spider Anelosimus studiosus along a latitudinal gradient. Animal Behaviour, 75, 1893-1902. RIEHL, C. 2011. Living with strangers: direct benefits favour non-kin cooperation in a communally nesting bird. Proceedings of the Royal Society B-Biological Sciences, 278, 1728-1735. RIEHL, C. 2013. Evolutionary routes to non-kin cooperative breeding in birds. Proceedings of the Royal Society B- Biological Sciences, 280, 7. RIEHL, C. & STRONG, M. J. 2015. Social living without kin discrimination: experimental evidence from a communally breeding bird. Behavioral Ecology and Sociobiology, 69, 1293-1299. RIVERA, D. S., ABADES, S., ALFARO, F. D. & EBENSPERGER, L. A. 2014. Sociality of Octodontomys gliroides and other octodontid rodents reflects the influence of phylogeny. Journal of Mammalogy, 95, 968-980. ROOD, J. P. 1983. The social system of the dwarf mongoose. In: EISENBERG, J. F. & KLEIMAN, D. G. (eds.) Advances in the study of mammalian behavior. Shippensburg, Pennsylvania: American Society of Mammalogists. ROOD, J. P. 1987. Dispersal and intergroup transfer in the dwarf mongoose. In: CHEPKO-SADE, B. D. & HALPIN, Z. T. (eds.) Mammalian dispersal patterns: the effects of social structure on population genetics. Chicago: University of Chicago Press. ROOD, J. P. 1990. Group-size, survival, reproduction, and routes to breeding in dwarf mongooses. Animal Behaviour, 39, 566-572. ROWLEY, I. 1968. Communal species of Australian birds. Bonn. Zool. Betr, 19, 362-368. ROWLEY, I. & RUSSELL, E. 1990. Splendid fairy-wrens: demonstrating the importance of longevity. In: STACEY, P. K., WD (ed.) Cooperative breeding in birds: long-term studies of ecology and behavior. Cambridge: Cambridge University Press. RUBENSTEIN, D. R. 2011. Spatiotemporal environmental variation, risk aversion, and the evolution of cooperative breeding as a bet-hedging strategy. Proceedings of the National Academy of Sciences of the United States of America, 108, 10816-10822. RUBENSTEIN, D. R. & ABBOT, P. 2017. Comparative social evolution, Cambridge University Press. RUBENSTEIN, D. R. & LOVETTE, I. J. 2007. Temporal environmental variability drives the evolution of cooperative breeding in birds. Current Biology, 17, 1414-1419.

125 RUDDELL, S. J. S., TWISS, S. D. & POMEROY, P. P. 2007. Measuring opportunity for sociality: quantifying social stability in a colonially breeding phocid. Animal Behaviour, 74, 1357-1368. RYMER, T. L., PILLAY, N. & SCHRADIN, C. 2013. Extinction or Survival? Behavioral Flexibility in Response to Environmental Change in the African Striped Mouse Rhabdomys. Sustainability, 5, 163-186. SCHIEMER, L., NIEDERMULLER, S. & HERLER, J. 2009. The influence of colony size and coral health on the occupation of coral-associated gobies (Pisces: Gobiidae). Coral Reefs, 28, 137-142. SCHNEIDER, T. C. & KAPPELER, P. M. 2014. Social systems and life-history characteristics of mongooses. Biological Reviews, 89, 173-198. SCHOWALTER, T. D., WILLIG, M. R. & PRESLEY, S. J. 2017. Post-Hurricane Successional Dynamics in Abundance and Diversity of Canopy Arthropods in a Tropical Rainforest. Environmental Entomology, 46, 11- 20. SCHRADIN, C., HAYES, L. D., PILLAY, N. & BERTELSMEIER, C. 2018. The evolution of intraspecific variation in social organization. Ethology, 124, 527-536. SCHRADIN, C. & PILLAY, N. 2005. Intraspecific variation in the spatial and social organization of the African striped mouse. Journal of Mammalogy, 86, 99-107. SCHRADIN, C., PILLAY, N. & BERTELSMEIER, C. 2019. Social flexibility and environmental unpredictability in African striped mice. Behavioral Ecology and Sociobiology, 73. SCHUBERT, M., MUNDAY, P. L., CALEY, M. J., JONES, G. P. & LLEWELLYN, L. E. 2003. The toxicity of skin secretions from coral-dwelling gobies and their potential role as a predator deterrent. Environmental biology of fishes, 67, 359-367. SCHÜRCH, R., ACCLETON, C. & FIELD, J. 2016. Consequences of a warming climate for social organisation in sweat bees. Behavioral Ecology and Sociobiology, 70, 1131-1139. SELANDER, R. K. 1964. Speciation in wrens of the genus Campylorhynchus, University of California Publications in Zoology. SERVEDIO, M. R., PRICE, T. D. & LANDE, R. 2013. Evolution of displays within the pair bond. Proceedings of the Royal Society B-Biological Sciences, 280. SHEN, S. F., EMLEN, S. T., KOENIG, W. D. & RUBENSTEIN, D. R. 2017. The ecology of cooperative breeding behaviour. Ecology Letters, 20, 708-720. SHERMAN, P. W., LACEY, E. A., REEVE, H. K. & KELLER, L. 1995. Forum: The eusociality continuum. Behavioral Ecology, 6, 102-108. SHIBUKAWA, K., SUZUKI, T. & AIZAWA, M. 2013. Gobiodon aoyagii, a new coral goby (Actinopterygii, Gobiidae, Gobiinae) from the west Pacific, with redescription of a similarly-colored congener Gobiodon erythrospilus Bleeker, 1875. Bulletin of the National Museum of Nature and Science, Series A, 39, 143-165. SHULTZ, S., OPIE, C. & ATKINSON, Q. D. 2011. Stepwise evolution of stable sociality in primates. Nature, 479, 219-U96. SILK, J. B. 2007. The adaptive value of sociality in mammalian groups. Philosophical Transactions of the Royal Society B: Biological Sciences, 362, 539-559. SKAUG, H., FOURNIER, D., NIELSEN, A., MAGNUSSON, A. & BOLKER, B. 2014. Generalized linear mixed models using AD model builder. R package version 0.8.0. 0.8.0 ed. SMITH, H., FRÈRE, C., KOBRYN, H. & BEJDER, L. 2016. Dolphin sociality, distribution and calving as important behavioural patterns informing management. Animal Conservation, 19, 462-471. SMORKATCHEVA, A. V. & LUKHTANOV, V. A. 2014. Evolutionary association between subterranean lifestyle and female sociality in rodents. Mammalian Biology, 79, 101-109. SOLOMON, N. G. 2003. A reexamination of factors influencing philopatry in rodents. Journal of Mammalogy, 84, 1182-1197. SORATO, E., GULLETT, P. R., GRIFFITH, S. C. & RUSSELL, A. F. 2012. Effects of predation risk on foraging behaviour and group size: adaptations in a social cooperative species. Animal Behaviour, 84, 823-834.

126 SPINKS, A. C., JARVIS, J. U. M. & BENNETT, N. C. 2000. Comparative patterns of philopatry and dispersal in two common mole-rat populations: implications for the evolution of mole-rat sociality. Journal of Animal Ecology, 69, 224-234. STACEY, P. 1979a. Kinship, promiscuity, and communal breeding in the acorn woodpecker. Behavioral Ecology and Sociobiology, 6, 53-66. STACEY, P. B. 1979b. Habitat saturation and communal breeding in the acorn woodpecker. Animal Behaviour, 27, 1153-1166. STACEY, P. B. & LIGON, J. D. 1987. Territory quality and dispersal options in the acorn woodpecker, and a challenge to the habitat-saturation model of cooperative breeding. American Naturalist, 130, 654-676. STACEY, P. B. & LIGON, J. D. 1991. The benefits-of-philopatry hypothesis for the evolution of cooperative breeding - variation in territory quality and group-size effects. American Naturalist, 137, 831-846. STAMATAKIS, A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics, 30, 1312-1313. STEINKE, D., DE WAARD, J. R., GOMON, M. F., JOHNSON, J. W., LARSON, H. K., LUCANUS, O., MOORE, G. I., READER, S. & WARD, R. D. 2017. DNA barcoding the fishes of Lizard island (Great Barrier Reef). Biodiversity Data Journal, 5. STERCK, E. H. M. 1999. Variation in langur social organization in relation to the socioecological model, human habitat alteration, and phylogenetic constraints. Primates, 40, 199-213. STIVER, K. A., DIERKES, P., TABORSKY, M., GIBBS, H. L. & BALSHINE, S. 2005. Relatedness and helping in fish: examining the theoretical predictions. Proceedings of the Royal Society B-Biological Sciences, 272, 1593- 1599. STRASSMANN, J. E., HUGHES, C. R., TURILLAZZI, S., SOLIS, C. R. & QUELLER, D. C. 1994. GENETIC RELATEDNESS AND INCIPIENT EUSOCIALITY IN STENOGASTRINE WASPS. Animal Behaviour, 48, 813-821. SZATHMÁRY, E. & MAYNARD SMITH, J. 1995. The major evolutionary transitions. Nature, 374, 227-232. TABORSKY, M. 1984. Broodcare helpers in the cichlid fish Lamprologus brichardi: Their costs and benefits. Animal Behaviour, 32, 1236-1252. TABORSKY, M. 2001. The evolution of bourgeois, parasitic, and cooperative reproductive behaviors in fishes. Journal of Heredity, 92, 100-110. TABORSKY, M. 2016. Cichlid fishes: a model for the integrative study of social behavior. In: KOENIG, W. D. & DICKINSON, J. L. (eds.) Cooperative breeding in vertebrates: studies of ecology, evolution and behavior. Cambridge, UK: Cambridge University Press. TABORSKY, M. & WONG, M. 2017. Sociality in Fishes. In: RUBENSTEIN, D. I. & ABBOT, P. (eds.) Comparative Social Evolution. Cambridge, UK: Cambridge University Press. TAMMONE, M. N., LACEY, E. A. & RELVA, M. A. 2012. Habitat use by colonial tuco-tucos (Ctenomys sociabilis): specialization, variation, and sociality. Journal of Mammalogy, 93, 1409-1419. TEWKSBURY, J. J., HUEY, R. B. & DEUTSCH, C. A. 2008. Ecology - Putting the heat on tropical animals. Science, 320, 1296-1297. THACKER, C. E. & ROJE, D. M. 2011. Phylogeny of Gobiidae and identification of gobiid lineages. Systematics and Biodiversity, 9, 329-347. THOMPSON, C. A., MATTHEWS, S., HOEY, A. S. & PRATCHETT, M. S. 2019. Changes in sociality of butterflyfishes linked to population declines and coral loss. Coral Reefs, 38, 527-537. THOMPSON, V. J., MUNDAY, P. L. & JONES, G. P. 2007. Habitat patch size and mating system as determinants of social group size in coral-dwelling fishes. Coral Reefs, 26, 165-174. TOTH, A. L. & REHAN, S. M. 2017. Molecular Evolution of Insect Sociality: An Eco-Evo-Devo Perspective. Annual Review of Entomology, 62, 419-442. UMAPATHY, G., HUSSAIN, S. & SHIVAJI, S. 2011. Impact of Habitat Fragmentation on the Demography of Lion- tailed Macaque (Macaca silenus) Populations in the Rainforests of Anamalai Hills, Western Ghats, India. International Journal of Primatology, 32, 889-900.

127 UNTERSTEGGABER, L., MITTEROECKER, P. & HERLER, J. 2014. Coral architecture affects the habitat choice and form of associated gobiid fishes. Marine Biology, 161, 521-530. VAN DE CASTEELE, T., GALBUSERA, P. & MATTHYSEN, E. 2001. A comparison of microsatellite-based pairwise relatedness estimators. Molecular Ecology, 10, 1539-1549. VAN VEELEN, M., GARCÍA, J. & AVILÉS, L. 2010. It takes grouping and cooperation to get sociality. Journal of Theoretical Biology, 264, 1240-1253. VENABLES, W. & RIPLEY, B. 2002. Modern applied statistics with S, New York: Springer. WALL, M. & HERLER, J. 2009. Postsettlement movement patterns and homing in a coral-associated fish. Behavioral Ecology, 20, 87-95. WALSH, K. J. E., MCINNES, K. L. & MCBRIDE, J. L. 2012. Climate change impacts on tropical cyclones and extreme sea levels in the South Pacific - A regional assessment. Global and Planetary Change, 80-81, 149- 164. WARD, R. D., ZEMLAK, T. S., INNES, B. H., LAST, P. R. & HEBERT, P. D. N. 2005. DNA barcoding Australia's fish species. Philosophical Transactions of the Royal Society B: Biological Sciences, 360, 1847-1857. WASER, P. M., CREEL, S. R. & LUCAS, J. R. 1994. Death and disappearance - estimating mortality risks associated with philopatry and dispersal. Behavioral Ecology, 5, 135-141. WEINMAN, L. R., SOLOMON, J. W. & RUBENSTEIN, D. R. 2015. A comparison of single nucleotide polymorphism and microsatellite markers for analysis of parentage and kinship in a cooperatively breeding bird. Molecular Ecology Resources, 15, 502-511. WHILE, G. M., ULLER, T. & WAPSTRA, E. 2009. Family conflict and the evolution of sociality in reptiles. Behavioral Ecology, 20, 245-250. WHITELEY, M., DIGGLE, S. P. & GREENBERG, E. P. 2017. Progress in and promise of bacterial quorum sensing research. Nature, 551, 313-320. WICKHAM, H. 2016. ggplot2: elegant graphics for data analysis, Springer. WILSON, S. K., GRAHAM, N. A. J., PRATCHETT, M. S., JONES, G. P. & POLUNIN, N. V. C. 2006. Multiple disturbances and the global degradation of coral reefs: are reef fishes at risk or resilient? Global Change Biology, 12, 2220-2234. WISMER, S., TEBBETT, S. B., STREIT, R. P. & BELLWOOD, D. R. 2018. Spatial mismatch in fish and coral loss following 2016 mass coral bleaching. Science of The Total Environment, 650, 1487-1498. WOLFF, J. O. 1997. Population regulation in mammals: An evolutionary perspective. Journal of Animal Ecology, 66, 1-13. WONG, M. & BALSHINE, S. 2011. The evolution of cooperative breeding in the African cichlid fish, Neolamprologus pulcher. Biological Reviews, 86, 511-530. WONG, M. Y. L. 2010. Ecological constraints and benefits of philopatry promote group-living in a social but non- cooperatively breeding fish. Proceedings of the Royal Society B-Biological Sciences, 277, 353-358. WONG, M. Y. L. 2011. Group Size in Animal Societies: The Potential Role of Social and Ecological Limitations in the Group-Living Fish, Paragobiodon xanthosomus. Ethology, 117, 638-644. WONG, M. Y. L. 2012. Abiotic stressors and the conservation of social species. Biological Conservation, 155, 77-84. WONG, M. Y. L. & BUSTON, P. M. 2013. Social Systems in Habitat-Specialist Reef Fishes: Key Concepts in Evolutionary Ecology. Bioscience, 63, 453-463. WONG, M. Y. L., BUSTON, P. M., MUNDAY, P. L. & JONES, G. P. 2007. The threat of punishment enforces peaceful cooperation and stabilizes queues in a coral-reef fish. Proceedings of the Royal Society B-Biological Sciences, 274, 1093-1099. WONG, M. Y. L., JORDAN, L. A., MARSH-ROLLO, S., ST-CYR, S., REYNOLDS, J. O., STIVER, K. A., DESJARDINS, J. K., FITZPATRICK, J. L. & BALSHINE, S. 2012. Mating systems in cooperative breeders: the roles of resource dispersion and conflict mitigation. Behavioral Ecology, 23, 521-530. WONG, M. Y. L., MUNDAY, P. L., BUSTON, P. M. & JONES, G. P. 2008a. Monogamy when there is potential for polygyny: tests of multiple hypotheses in a group-living fish. Behavioral Ecology, 19, 353-361.

128 WONG, M. Y. L., MUNDAY, P. L., BUSTON, P. M. & JONES, G. R. 2008b. Fasting or feasting in a fish social hierarchy. Current Biology, 18, R372-R373. WONG, M. Y. L., MUNDAY, P. L. & JONES, G. P. 2005. Habitat patch size, facultative monogamy and sex change in a coral-dwelling fish, Caracanthus unipinna. Environmental Biology of Fishes, 74, 141-150. WOOLFENDEN, G. E. 1975. Florida scrub jay helpers at the nest. Auk, 92, 1-15. WRIGHT, J., PARKER, P. G. & LUNDY, K. J. 1999. Relatedness and chick-feeding effort in the cooperatively breeding Arabian babbler. Animal Behaviour, 58, 779-785. YOUNG, A. J., CARLSON, A. A., MONFORT, S. L., RUSSELL, A. F., BENNETT, N. C. & CLUTTON-BROCK, T. 2006. Stress and the suppression of subordinate reproduction in cooperatively breeding meerkats. Proceedings of the National Academy of Sciences of the United States of America, 103, 12005-12010. ZÖTTL, M., HEG, D., CHERVET, N. & TABORSKY, M. 2013. Kinship reduces alloparental care in cooperative cichlids where helpers pay-to-stay. Nature Communications, 4. ZUK, M., GARCIA-GONZALEZ, F., HERBERSTEIN, M. E. & SIMMONS, L. W. 2014. Model systems, taxonomic bias, and sexual selection: Beyond drosophila. Annual Review of Entomology.

129 Appendices

Appendix 1: Manuscripts published as a result of this thesis

Hing, M. L., Klanten, O. S., Dowton, M., & Wong, M. Y. L. (2017). The Right Tools for the Job: Cooperative Breeding Theory and an Evaluation of the Methodological Approaches to Understanding the Evolution and Maintenance of Sociality. [Review]. Frontiers in Ecology and Evolution, 5(100). doi: 10.3389/fevo.2017.00100

Hing, M. L., Klanten, O. S., Dowton, M., Brown, K. R., & Wong, M. Y. L. (2018). Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes. PLOS ONE, 13(9), e0202407. doi: 10.1371/journal.pone.0202407

Hing, M. L., Klanten, O. S., Wong, M. Y. L., & Dowton, M. (2019). Drivers of sociality in Gobiodon fishes: An assessment of phylogeny, ecology and life-history. Molecular Phylogenetics and Evolution, 137, 263- 273. doi: 10.1016/j.ympev.2019.05.020

Note: Article from ‘Molecular Phylogenetics and Evolution’ is not included due to copyright restrictions

130

REVIEW published: 31 August 2017 doi: 10.3389/fevo.2017.00100

The Right Tools for the Job:

Cooperative Breeding Theory and an

Evaluation of the Methodological

Approaches to Understandingthe

Evolution and Maintenance of

Sociality

Martin L. Hing 1*, O. Selma Klanten 2, Mark Dowton3 and Marian Y. L. Wong 1*

1Centrefor Sustainable Ecosystems Solutions, School of Biological Sciences, University of Wollongong, Wollongong, NSW, Australia, 2 Fish Ecology Laboratory, School of the Life Sciences, University of Technology Sydney, Sydney, NSW, Australia, 3 Edited by: Centrefor Medical and Molecular Bioscience, School of Biological Sciences, University of Wollongong, Wollongong, NSW, Trine Bilde, Aarhus University, Denmark Australia Reviewed by: Michael Taborsky, University of Bern, Why do we observe so many examples in nature in which individuals routinely delay or Switzerland completely forgo their own reproductive opportunities in order to join and remain within Kelly Anne Stiver, Southern Connecticut a group? Cooperative breeding theory provides a rich framework with which to study State University, United States the factors that may influence the costs and benefits of remaining philopatric as a non- *Correspondence: Martin L. Hing breeder. This is often viewed as an initial step in the development of costly helping [email protected] Y. L. behavior provided by non-breeding subordinates. Despite many excellent empirical Wong [email protected] studies testing key concepts of the theory, there is still debate regarding the relative importance of various evolutionary forces, suggesting that there may not be a general Specialty section: explanation but rather a dynamic and taxonomically varied combination of factors This article was submitted to Social Evolution, a section of the journal influencing the evolution and maintenance of sociality. Here, we explore two potential Frontiers in Ecology and Evolution improvements in the study of sociality that could aid in the progress of this field. The first addressesthefactthat empiricalstudiesofsocial evolutionaretypicallyconductedusing Received: 23 October 2016 Accepted: 10 August 2017 either comparative, observational or manipulative methodologies. Instead, we suggest a Published: 31 August 2017 holistic approach, whereby observational and experimental studies are designed with the explicit view of advancing comparative analyses of sociality for the taxon, and in Citation: Hing ML, Klanten OS, Dowton M and Wong MYL (2017) The Right tandem, where comparative work informs targeted research effort on specific (usually Tools for the Job: Cooperative Breeding understudied) species within the lineage. A second improvement relates to the Theory broadening of tests of cooperative breeding theory to include taxa where subordinates and an Evaluation of the Methodological do not necessarily provide active cooperation within the group. The original bias Approaches to Understanding the W R Z D U G ³ K H O S I X O V X E R U G L Q D W H V ´ D U RHoVwHeveIr,UreRcePnt D I R F X Evolution and Maintenance of Sociality. consideration of other taxa, especially marine taxa, is slowly revealing that the theory Front. Ecol. Evol. 5:100. doi: 10.3389/fevo.2017.00100 can and should encompass a continuumof cooperative social systems, including those

Frontiers in Ecology and Evolution | www.frontiersin.org 1 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

where subordinates do not actively help. This review summarizes the major hypotheses of cooperative breeding theory, one of the dominant frameworks to examine social evolution, and highlights the potential benefits that a combined methodologicalapproach and a broader application could provide to the study of sociality. Keywords: cooperative breeding theory, evolution of sociality, methodology, kinship, ecological constraints, benefits of philopatry, life-history hypothesis, fish

INTRODUCTION subordinates in groups, whether or not they actively cooperate must weigh the costs and benefits of group membership. It is The animal kingdom contains many examples of species, these costs and benefits that the hypotheses that make up including our own, which form surprisingly complex social cooperative breeding theory focus on. Thus, studies investigating structures (Munday et al., 1998; Purcell, 2011; Grueter et al., 2012; the determinants of group living need not be restricted to Chapais, 2013; Johnson et al., 2013; Taborsky and Wong, 2017). applying cooperative breeding theory only to species where The size, structure and composition of these groups can vary both helping actively occurs. within and between species, from pair-bonding monogamous Notwithstanding the excellent empirical and theoretical work partners (Kleiman, 2011; Servedio et al., 2013) to large and highly conducted in this field (e.g., Emlen, 1994; Cockburn, 1996; complex societies exhibiting social hierarchies and division of Arnold and Owens, 1998; Hatchwell and Komdeur, 2000; Pen labor (Duffy and Macdonald, 2010; Nandi et al., 2013). Such and Weissing, 2000; Buston and Balshine, 2007), the relative variation in social structure is intriguing as it suggests that there importance of the evolutionary forces at play which influence may be a great diversity of underlying social, ecological or life the decision of non-breeders to forego their own reproductive history factors that influence the evolution of stable groups and opportunities and remain within a group are still the subject their maintenance over many generations. of much discussion. Advances in understanding have so far been One of the most fascinating cases within the broad spectrum of made through either comparative studies, focusing on a broad sociality is the formation of groups where individuals delay or group of taxa, or through more narrowly focused observational or forgo their own reproductive opportunities (Clutton-Brock et manipulative work on a more restricted subset of species in a al., 2001; Buston, 2003b; Faulkes and Bennett, 2013; Margraf and generally piecemeal fashion. Each methodology provides Cockburn, 2013). Subordinate members of such groups often but important insights into the study system, but they also have not always, provide help in raising the offspring of dominant their own unique limitations. A combination of methodologies breeders. When this alloparental care is present in the group will address many of these limitations and give a more general the social system is often referred to as “cooperative breeding.” understanding of the system (Brown, 1974). Indeed, comparative Delayed dispersal is widely believed to be the first step in the studies often use data from focused observational and evolution of cooperative breeding (Emlen, 1982a; Brown, 1987). experimental studies and many researchers have combined Importantly, the factors influencing an individual’s decision to observational and manipulative methodologies to provide delay its dispersal and breeding are often the same as the factors powerful results. However, we contend that combining all three that select for the evolution of subsequent cooperative actions, methodologies under a single framework provides the most such as alloparental care, territory defense or nest maintenance. comprehensive approach to studying the evolution of sociality. For example, high predation pressure can act as a constraint The fresh water cichlid Neolamprologus pulcher provides an on dispersal, driving group formation (as shown experimentally excellent example of how many comparative, observational and by Heg et al., 2004a). This same pressure may then select for experimental studies have provided an extremely robust view individuals who contribute to the collective defense of the group of social evolution and maintenance and challenged terrestrially by increasing their individual chances of survival and future derived theories, such as kinship based mechanisms, in being reproduction (e.g., Heg and Taborsky, 2010; Groenewoud et al., involved in social evolution (e.g., Wong and Balshine, 2011). 2016). But what does the evolution of sociality in N. pulcher, tell us Besides explaining the evolution of group-living and helpful about sociality in the (roughly) 50 other species in the cooperation in groups, we propose that cooperative breeding Neolamprologus genus? Can these results be generalized to all theory can also be applied to explain the evolution and social freshwater fishes or indeed all vertebrates? Interspecies maintenance of group living even for species where there is no comparative analyses are the only way that we can answer such helpful cooperation. In such groups subordinate group members broad evolutionary questions. Obviously, gathering the may exhibit behaviors that offset or avoid inflicting costs on observational and experimental data for comparative analysis of dominants (Kokko et al., 2002; Buston and Balshine, 2007; Wong 50 species would represent an extremely time consuming and et al., 2007) such that their overall effect on dominant fitness costly process. Carefully coordinated collaborations between is neutral (termed “peaceful cooperation”; Wong et al., 2007). research groups could help to spread the research effort. In order While such actions may not increase dominant fitness, it still to maximize the impact of any individual piece of research, represents a cost to a subordinate who must assess this against the focused observational and experimental work should be targeted benefits gained from remaining within the group. That is, toward species within the given lineage which are lacking in

Frontiers in Ecology and Evolution | www.frontiersin.org 2 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

data and designed with the express view of contributing to future evolution of sociality. In this review, we assess the major comparative work. Mapping sociality and traits of interest onto a theoretical framework in this field, highlight the advantages and phylogeny for the lineage would help to identify suitable species disadvantages of the different methodologies used to test existing and can be used to study questions about the evolutionary origins theory, and discuss developments made in less-well studied social of sociality and how those traits might have contributed. systems with the aim of galvanizing a more holistic integration of Manipulative studies should then be undertaken for the purpose multiple techniques and taxa into future studies of social of assigning causality to the findings of the comparative work. evolution. This approach will allow the comparison of multiple traits across a lineage and will allow researchers to provide robust answers to broad evolutionary questions aboutsociality. THEORETICAL FRAMEWORK The great variation in factors contributing to social evolution is Group Living as a Major Transition likely to differ among species. For this reason it is imperative The evolution of sociality in animals may be considered as one that research effort is spread across a large number of species in of the most recent evolutionary transitions according to order to gain a truly comprehensive understanding of the role Szathmáry and Smith’s (1995) major evolutionary transitions that these factors play in the evolution of sociality. Comparisons theory. This theory examines the idea that major evolutionary across multiple species would be best performed when focused transitions occur when groups of “individuals” come together to observational or experimental data has been gathered under the form more complex forms of life. This theory explains the same theoretical framework. The majority of studies of social evolution of all life from individual biological molecules through group living have so far focused on species of birds, mammals to colonies of eusocial multicellular animals (Bourke, 2011). The and insects with comparatively little attention given to evolution of cooperation was a necessary step along the path ectothermic vertebrates with the exception of one notable family toward eusociality. There is a continuum of cooperation among of freshwater fishes (Elgar, 2015; Figure 1). Inclusion of group members in animal societies and the degree of cooperation understudied animal groups is important for our ability to displayed is likely to depend on a range of life-history, social and assess the universality of frameworks of social evolution and ecologicalfactors(Kokkoet al., 2002; Bustonand Balshine, 2007). to gain novel insights as a result, especially when these species display uncommon traits or unconventional life-histories. For Reproductive Skew Theory instance, the ability of many social marine fishes to change sex Reproductive skew theory offers a potential general theory for may have interesting implications for hypotheses regarding an social evolution through competitive effects and conflict individual’s ability to acquire a mate and hence on its decision resolution. Reproductive skew theory views reproduction as a disperse or remain within a group. Likewise, comparisons of limited resource and focuses on the distribution of reproductive long-lived social reptiles and avian lineages could lend support shares within the group (Emlen, 1982b; Reeve and Ratnieks, 1993; to hypotheses examining the role that longevity plays in the Johnstone, 2000). Groups with one or a few dominant breeders

FIGURE 1 | Approximate number of articles published on major animal groups focusing on four key hypotheses of cooperative breeding. Abbreviations are: Kin, Kinship; Monog, Monogamy; LH, Life-history; EC, Ecological Constraints; BoP, Benefits of Philopatry; FW, Freshwater; M, Marine. Search parameters are available in Supplementary Table S1. Numbers presented here are intended as approximations only as search parameters were not completely mutually exclusive or exhaustive.

Frontiers in Ecology and Evolution | www.frontiersin.org 3 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

fall at the “highly skewed” end of the spectrum while aggregations (e.g., Groenewoud et al., 2016). The hypotheses comprised within where any individual can breed with any other individual would cooperative breeding theory may therefore be useful to study be considered to have “low skew.” In this review we will restrict social systems in which non-breeding subordinate members our discussion to groups with dominant breeders and one or cooperate in some form regardless of relatedness or whether more non-breeding subordinates, i.e., high reproductive skew active help is provided in the care of offspring. societies. METHODOLOGICAL APPROACHES Cooperative Breeding Theory Cooperative breeding theory (Brown, 1974) is derived from Many studies have focused on testing four key hypotheses of Hamilton’s rule (Hamilton, 1964; Grafen, 1982; Bourke, 2014) cooperative breeding theory (Table 1) using broad comparisons and describes the evolution of social systems in which of relevant ecological, social and life history variables across reproductively mature individuals delay their own independent multiple species of birds, mammals and insects (Cockburn, 1996; breeding in order to remain within a group as non-breeding Arnold and Owens, 1998; Johnson et al., 2002; Purcell, 2011). subordinates and help to raise the offspring of dominant breeders. Essentially, these studies have investigated the evolution of Cooperative breeding groups are generally characterized by high sociality by phylogenetic comparative analysis, comparing reproductive skew. Offspring of such groups often, but not differences in key variables between multiple social and asocial always remain on the natal territory and many groups are species within a given lineage. While such contrasts enable broad therefore comprised of subordinates related to the dominant generalizations to be made, they fall short of identifying causality breeders, in which case relatedness is high (in Hamilton’s of effects. In contrast to this methodology, studies that have rule) and the likelihood of cooperative actions being tested these hypotheses through refined experimental selectively favored is raised (Bourke, 2014). However, a growing manipulation of characteristics associated with the evolution of number of studies have revealed social systems where non- sociality (Komdeur, 1992; Baglione et al., 2002; Wong, 2010) do breeding subordinates disperse to other groups and areunrelated demonstrate causality, but their necessary focus on just one or a to the dominant breeders (Double and Cockburn,2003; Gardner few species greatly reduces the ability to draw general et al., 2003; Awata et al., 2005; Dierkes et al., 2005; Wong, conclusions. Therefore, it is through using a combination of these 2010; Riehl, 2013). In these cases, cooperative rearing of young approaches for a given lineage that holds the potential to provide may still take place as well as other forms of cooperative an insight into the generality and causality of sociality across a behavior in order to avoid conflict and maintain a stable group broad range of species (Figures 1, 2). While many studies do structure (Gardner et al., 2003; Wong et al., 2007). While these combine observational and experimental methodologies (e.g., latter groups may not strictly fit the definition of a cooperatively Komdeur, 1992; Stiver et al., 2005) we suggest that great advances breeding group if they do not provide alloparental care, could be made by following such work with comparative studies. cooperative breeding theory forms a rich framework with This would work most efficiently if the observational and which to assess the circumstances that could lead to an experimental studies were specifically designed with comparative individuals’ decision to forgo its own reproductive opportunities analysis in mind. and remain in a group as a non-breeding subordinate (Emlenet al., 1991; Koenig et al., 1992). Comparative Analyses and Syntheses Cooperative breeding theory encompasses several non- mutually Comparative analyses are used to compare traits across multiple exclusive hypotheses for the evolution of sociality (Table 1). taxa or populations across multiple geographic locations and may Cooperative breeding theory can be applied to two broad areas range in taxonomic scale from studies within a genus to of social behavior—the evolution of group living and the studies across phyla (e.g., Blumstein and Armitage, 1999; evolution of cooperation (Koenig et al., 1992). This review will Boomsma, 2009; Jetz and Rubenstein, 2011). They may draw focus primarily on those studies addressing the evolution of upon the findings of other observational and/or manipulative group living so as to incorporate studies where subordinate studies (Cockburn, 2006) or they may make use of novel data (Du individuals remain in groups but do not provide any active forms Plessis et al., 1995). Combining this comparative approach with of help to dominant breeders (e.g., Eden, 1987; Gardner et al., phylogenetic information is arguably one of the most powerful 2003; Wong and Buston, 2013; Buston and Wong, 2014; methods with which to examine broad evolutionary trends and Drobniak et al., 2015). In groups where subordinates do not patterns (Arnold and Owens, 1998; Briga et al., 2012). Comparing provide active help, dominant group members may still tolerate ecological, life-history, morphological and/or behavioral traits their presence. Actions such as regulation of growth may facilitate across multiple taxa in a molecular phylogenetic context may group stability in groups where active subordinate help is absent allow researchers to examine the evolutionary history of many (e.g., Wong et al., 2007). Whether or not help is later provided, different attributes and identify ecological, social, morphological the first step of this evolutionary strategy is an individuals’ and behavioral differences between social and non-social species decision of whether to disperse and pursue its own breeding (Ford et al., 1988; Pagel and Harvey, 1988; Arnold and Owens, opportunities or to delay such opportunities in order to obtain 1998; Cornwallis et al., 2010). In turn, the differences that are the benefits of group living (Emlen, 1982a). Furthermore, the detected may provide an insight to the conditions under which factors involved in the evolution and maintenance of sociality sociality (or other traits) may have evolved. In this way, future and in the development of helping behavior are often the same observational and experimental studies could be targeted at

Frontiers in Ecology and Evolution | www.frontiersin.org 4 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

TABLE 1 | Four of the major hypotheses of Cooperative Breeding Theory and the respective key factors proposed to influence the evolution of sociality.

Hypothesis Description Key factors Key predictions Key references

Observational Experimental

Monogamy: Monogamy and natal Within-group Subordinatehelpers shouldbe Removal of subordinates Hamilton, 1964; Hughes Kinship philopatryshouldresult in relatedness (rY) closely related to breeders should reducefitness of et al., 2008; Boomsma, groups of closelyrelated Subordinates should breeders 2009; Cornwallis et al., individuals providing a context preferentially provide help to Subordinates should 2010; Lukas and which may promote closekin preferentially choose to Clutton-Brock, 2012; cooperative breeding settle with or provision kin Bourke, 2014 over unrelated group members

Life History Certainsuites of lifehistory Reproductive output (X) Species characterizedbylow Subordinate removal or Rowley and Russell, 1990; traits of aspecies or lineage, life span(Z) mortality rates and low fecundity addition should have an Arnold and Owens, 1998; such as low fecundity and low growth rate (Z) should be more social than those impact on life-history traits Hatchwell and Komdeur, mortality rates, lead tohabitat age atfirst characterized byhigher mortality Supplemental feeding 2000 saturation and a shortage of reproduction (Z) rates and high fecundity may alter growth rates, suitable breeding sites, which birth rate : mortality survival or longevity may predispose aspecies or ratio (X, Z) lineage to sociality

Ecological Factors: Costs of dispersing due to Predation risk (X) Sociality willbemoreprevalentin Increasing ecological Selander, 1964; Brown, Costs of Dispersal ecological pressures, such as Habitat saturation (X) species or populations constraints should 1974; Gaston, 1978; Emlen, high predation rates or low Mate availability (X) experiencing high constraints on promote philopatry and 1982a; Kokko et al., 2002 resource availability promote Resource availability (X) dispersal increasing sociality delayed dispersal and thereby Sociality will be less prevalent in Decreasing ecological restraint from independent species or populations constraints should breeding and helping experiencing relaxed constraints promote dispersal and on dispersal decreasing sociality

Ecological Direct benefits of remaining on Habitat size (X) Socialspecies willlivein Subordinates should delay Woolfenden, 1975; Stacey Factors: Benefits the natal site, such as Habitat variability (X, Z) environments with high variance dispersal when other and Ligon, 1991; Kokko of Philopatry: increased protection and Life span(Z) in habitat quality and high levels available habitats are of and Ekman, 2002; direct and indirect access to high quality habitat Fecundity (X) of predation risk lowerqualityrelevantto Taborsky, 2016 following the death of inheritance of breeding Less socialspecies will livein thecurrent habitat dominant, promote sociality status (Z) environments with low variance Subordinates should Indirect benefits of remaining Offspring fitness(Z) in habitatquality disperseto pursue on the natal site, such as Offspring survival (Z) Social species will be found in independent breeding increased fitness and survival areas with highpredationrisk opportunities when higher of offspring Subordinates should inherit quality habitat is available breeding status and/or gain survival benefits

+ D P L O rWuleRdQes¶crVibes the conditions under which a cooperative action will be favored: Xi + rYi + fZi > Xj + rYj + fZj, where X, Y and Z are present direct benefits, indirect benefits and future direct benefits respectively. r is the relatedness between the actor and recipient of an action and f is the probability of inheritance. i and j denote the effects of a cooperative act (e.g., staying and helping) and non-cooperative act(e.g., dispersing) respectively. Parentheses inthe Key Factorscolumnindicatetherelevantparameters of + D P rLu leO. W R Q ¶ V specific sets of species within the lineage showing variation in of the lineage and a model of evolutionary change. Other authors sociality and traits of interest. Understanding the causes of these have since improved upon this method to enable the use of variations (only achievable through experimental manipulations) partially resolved phylogenies (Garland et al., 1992; Pagel, 1999; could provide specific mechanisms that have caused the observed Freckleton et al., 2002). For this reason, comparative analyses are social systems in these socially contrasting species. particularly well suited to taxa with well-studied phylogenies or One issue arising from the comparison of a trait across multiple for which genetic material can be easily obtained. Thus far, the taxa within a given lineage is that the individual species are part majority of comparative studies have focused on terrestrial taxa of a hierarchical structure. That is, they are related by a which has resulted in many great advancements in the field common ancestor and therefore not independent. Felsenstein (Brown, 1974; Arnold and Owens, 1998; Boomsma, 2009; Riehl, (1985) discussed this issue and proposed a method to overcome 2013). However, marine organisms are relatively understudied in the non-independence of species which he terms terms of comparative work, which is unfortunate as they offer a “phylogenetically independent contrasts.” Essentially, while the rich diversity of social organization and varied ecological niches species themselves may not be independent, the contrast (or and life-history strategies with which to explore the various difference) between pairs of species in the trait being measured is hypotheses of social evolution and maintenance (McLaren, 1967; independent. This method requires a fully resolved phylogeny Gowans et al., 2001; Duffy and Macdonald, 2010; Wong and

Frontiers in Ecology and Evolution | www.frontiersin.org 5 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

trends across multiple species. With molecular genetic techniques becoming increasingly available, it is more feasible for researchers to conduct phylogenetic comparative studies and to incorporate them into a research program alongside observational and experimental studies. The piecemeal approach widely used at the time of writing, while highly effective at advancing our knowledge of the evolution of sociality, could be made more efficient if finer scale observations and experiments were specifically designed around planned comparative work. This comparative work can then be used to more effectively target research effort on sets of species which contrast in their degree of sociality and in other traits of interest. Monogamy and Kinship Studies of the relationship between monogamy, kinship and sociality have championed the use of phylogenetic comparative analysis to test entrenched theory. In particular, the idea that

FIGURE 2 | Approximate number of articles published on each of the major monogamous breeding systems lead to high levels of relatedness hypotheses using comparative, observational and experimental amongst subordinates which in turn promotes sociality has been methodologies. Abbreviations are: Kin, Kinship; Monog, Monogamy; LH, suggested comparatively for insect, bird and mammalian Life-history; EC, Ecological Constraints; BoP, Benefits of Philopatry. Search societies (Hughes et al., 2008; Boomsma, 2009; Cornwallis et al., parameters are available in Supplementary Table S1. Numbers presented here are intended as approximations only as search parameters were not completely 2010; Lukas and Clutton-Brock, 2012). For example, Cornwallis mutually exclusive or exhaustive. et al. (2010) conducted a comparative analysis of 267 birds and showed that species displaying high levels of promiscuity (i.e., polygamous species) were less likely to transition to cooperatively breeding systems. Furthermore, this study showed that lineages Buston, 2013). Given the great variety of social organization that evolved cooperative breeding systems and subsequently displayed in these organisms, there is clearly enormous potential reverted to independent breeding systems had more promiscuous to test and challenge terrestrially derived cooperative breeding ancestors (Cornwallis et al., 2010). Similarly, Hughes et al. hypotheses under novel conditions. (2008) concluded that monogamy was critical in the evolution of A variety of studies have so far demonstrated the increasing eusociality in a comparative analysis of 267 species of eusocial availability and ease of phylogenetic analyses as a powerful tool bees, ants and wasps. Boomsma (2009) later reviewed monogamy to conduct comparisons across multiple taxa. Arnold and and eusociality in insects and found that all of the evidence at the Owens (1998) employed this technique in a comparative time of writing indicated that eusocial insect societies with sterile analysis of 9,672 bird species representing 139 families to worker castes only arose in lineages with monogamous parents. demonstrate that cooperative breeding was not randomly High levels of kinship due to monogamous associations may distributed amongst avian taxa, and in fact showed an uneven certainly predispose a species to cooperative breeding, but the geographic distribution of “hotspots” of cooperatively breeding emerging number of cases of cooperative breeding amongst species which the authors considered could infer some common unrelated group members suggests that direct benefits from biological predisposition to this system. Similarly, Edwards and group living and cooperation must be considered (Riehl, 2013; Naeem (1993) found that cooperative breeding in birds was not Bourke, 2014). In a review of 213 cooperatively breeding birds, randomly distributed among taxa in a meta-analysis of avian Riehl (2013) suggested that as much as 15% of these species cooperative breeding including phylogenetic simulations of nest with unrelated individuals. These individuals are clearly not ancestral states. Most recently, this non-random phylogenetic gaining inclusive fitness benefits and must therefore be accruing distribution of cooperative breeding amongst avian taxa has been sufficient direct benefits, either presently or in the future, to offset confirmed in a comprehensive review of modes of parental care the costs associated with group living. However, the majority of amongst the avian phylogeny (Cockburn, 2006). Another species in this study did nest with related individuals. Therefore, phylogenetic comparison of 44 species of mammals found that monogamy and kinship likely played a significant role in the there was a strong phylogenetic signal for allomaternal care evolution of cooperative breeding in these species. It should also (multiple females assisting a dominant female in maternal care be noted that living in groups of close kin may involve costs due duties), in other words, that cooperative breeding in the form to deleterious inbreeding effects and many group living species of allomaternal care was strongly clustered (Briga et al., 2012). have developed behaviors to avoid this (costs of inbreeding are This finding is similar to the non-random phylogenetic discussed in Lubin and Bilde, 2007). Thus far little comparative distribution of cooperative breeding observed in birds (Edwards work has taken place to examine the evolution of sociality and Naeem, 1993; Arnold and Owens, 1998; Cockburn, 2006) amongst groups of unrelated individuals (but see Groenewoud et suggesting that cooperative breeding is strongly clustered in al., 2016 for an intraspecific comparative analysis). Social birds and mammals. These studies demonstrate the effectiveness marine species with a pelagic larval stage present an excellent of phylogenetic comparative analyses for uncovering broad

Frontiers in Ecology and Evolution | www.frontiersin.org 6 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

avenue for future comparative work in this area as the mixing monogamy and polytocy (multiple offspring per birth). However, of larvae in the water column makes settlement in family groups using Australian Scincid lizards (genus Egernia) as model species, highlyunlikely. Chapple (2003) demonstrated that several species of this genus Comparative studies have substantially contributed to our were shown to exhibit life-history traits (increased longevity and understanding of the role that kinship and monogamy has played age at maturity) associated with similar levels of sociality to those in promoting the evolution of sociality. However, there is a bias found in avian taxa, suggesting that life history traits could still toward terrestrial taxa in the comparative literature which play a role in some vertebrate groups. From these varied results it confines our understanding of the factors involved in the seems clear that the role that life-history plays in the evolution of evolution of group living to relatively conventional breeding group living is likely to be taxonomically specific which highlights strategies (Figure 1). Social marine fishes are particularly the need to assess life-history factors and sociality across a broad interesting as many species undergo a pelagic stage in their life- range of taxa and to incorporate species which display unusual cycles, whereby larvae are mixed in the water column and life-history strategies. eventually settle onto a habitat. This mixing of larvae means that Besides the latter example, there appears to be relatively little social groups formed by these species are unlikely to consist of support for the life history hypothesis, at least from comparative related individuals (Avise and Shapiro, 1986; Buston et al., 2007, studies. However, the majority of comparative analyses have 2009). Cooperative rearing of young does not appear to occur focused on the relationship between longevity and sociality, a in the species studied to date which supports the idea that kinship single case among a myriad of potential life-history traits that is a major factor in the evolution of helping but may be less could have influenced the evolution of sociality (Blumstein and influential in the development of group living. Direct fitness Moller, 2008). Given the potential role that life-history traits may benefits however, likely play a greater role in social group have played in setting the stage for the evolution of sociality, formation and maintenance in these species (Wong and Buston, phylogenetically independent contrasts across multiple species 2013; Buston and Wong, 2014) and there is a need for more combined with more focused observational and experimental comparative studies focusing on these benefits and their role in (where possible) studies would be a useful method for future the evolution of sociality. In any case, such examples of non-kin research in this area. Also, species with less conventional life- social groups are the minority in terrestrial systems which have history strategies, such as small body size, high mortality rates, typically shown strong support for monogamy and kin selection sex change and indeterminate growth, all traits exhibited by a as key factors in the evolution of group living and cooperative range of marine fishes (Munday and Jones, 1998; Munday et breeding. al., 1998; Wong et al., 2005; Depczynski and Bellwood, 2006), have thus far received little attention (Figure 1). To this end, Life-History Hypothesis social habitat specialist fishes would make particularly good study Akin to the reasoning that monogamy creates the necessary species for comparative analysis, especially given that several conditions for cooperative breeding to evolve through kinship groups have already well resolved phylogenies (e.g., Herler et al., based mechanisms, life-history traits such as longevity are 2009; Thacker and Roje, 2011; Duchene et al., 2013). thought to promote favorable ecological conditions for the evolution of sociality. Comparative work in this field has Ecological Factors informed much of the debate surrounding the life-history While monogamy and life-history traits may create ideal hypothesis. Based on their comparative analysis, Arnold and conditions for social evolution, ecological factors may ultimately Owens (1998) proposed that low annual mortality was the main determine which species display social behavior. Comparative factor predisposing avian species to cooperative breeding— a key analyses are ideal for the study of large scale environmental prediction of the life-history hypothesis (Table 1). This influences on the evolution of sociality since their very aim is to proposition was questioned by Blumstein and Moller (2008) compare patterns across multiple taxa or within a single species based on their comparative study of 257 North American birds. over large geographic areas. Such analyses have demonstrated Their study controlled for body mass, sampling effort, latitude, that there is a non-random geographic distribution of socialityin mortality rate, migration distance and age at first reproduction a variety of taxa (Jetz and Rubenstein, 2011; Purcell, 2011). For (factors which Arnold and Owens, 1998; had not accounted example, Purcell (2011) conducted an extensive review of the for), and found no association between sociality and increased literature pertaining to arthropod sociality along latitudinal and longevity per se. Blumstein and Moller (2008) note however, that altitudinal gradients, and reanalyzed five previous case studies of longevity and sociality are often confounded with other life- social spiders and four ant subfamilies. It was found that climatic history factors, such as reproductive suppression, delayed factors were correlated with variation in colony size, with social breeding, increased parental care and survival, suggesting the arthropod species occurring more frequently at lower latitudes. need for further comparative research into these factors. Such geographic hot-spotting of cooperative breeding was also Similarly, a more recent comparative meta- analysis of recognized by Jetz and Rubenstein (2011), who conducted a mammalian phylogenies found no support for longevity playing a global comparative analysis of sociality for 95% of the world’s part in the transition from independent breeding to cooperative bird species. They found that temporal (among-year) variability breeding in mammals (Lukas and Clutton-Brock, 2012). Instead, in precipitation was a major predictor of the occurrence of they found that cooperative breeding only occurred in cooperative breeding. Together, these studies demonstrate the mammalian lineages displaying effectiveness of comparative analyses in identifying likely

Frontiers in Ecology and Evolution | www.frontiersin.org 7 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

environmental factors involved in the evolution of sociality, observation is an intraspecific comparative analysis of the African suggesting that broad scale environmental characteristics, such as cichlid Neolamprologus pulcher by Groenewoud et al. (2016) rainfall, temperature, predator abundance and the size and which examined predation risk and its interaction with other availability of food resources may be important in the evolution ecological factors such as shelter availability and population of sociality in a diverse range of animals. density across eight populations. This study concluded that Some comparative studies have also shown that cooperative predation risk was a significant driver of group formation and breeders are more likely to occur in temporally variable the evolution of complex social behavior. Comparative analyses (unstable) environments (Rowley, 1968; Grimes, 1976; Jetz and appear to be well suited to examine risks of dispersal as a Rubenstein, 2011). In contrast, other studies have shown a mechanism of ecological constraint on dispersal. For example, greater occurrence of cooperatively breeding species in less one might expect that dispersal would be more risky in arid temporally variable (stable) environments (Brown, 1974; environments where foraging success is enhanced by group size, Ricklefs, 1975; Woolfenden, 1975; Ford et al., 1988). Emlen as predicted in the aridity food-distribution hypothesis (Faulkes et (1982a) sought to reconcile this discrepancy in ecological al., 1997; Spinks et al., 2000; Ebensperger, 2001). Aridity is a observations of cooperatively breeding birds with his ecological large-scale environmental factor linked to precipitation which, as constraints model. The ecological constraints hypothesis focuses previously discussed, has been well studied through comparative on the ecological characteristics of a species’ environment that analyses. While the paucity of comparative studies specifically may prevent group members from dispersing (Emlen, 1982a). addressing dispersal risk appears to be a significant gap in the Emlen (1982a) proposed that the common thread in these literature, it should be noted that some comparative analyses may opposing observations was that individuals were faced with the touch on risks of dispersal through other mechanisms such as decision of either dispersing to pursue independent breeding increased benefits of philopatry gained through predator defense opportunities or to remain at the nest as a non- breeding (e.g., Ebensperger, 2001). Such constraints on dispersal may also subordinate. Either environmental condition (stableor unstable) increase the benefits of remaining philopatric through increased could sufficiently restrict an individual’s success in dispersing survival. and pursuing independent breeding opportunities and thus Benefits of philopatry can be gained through either direct “force” them to remain at the nest. For example, in stable fitness benefits (e.g., survival, growth, predator detection, environments, populations of animals may expand and dilution or competitive advantage) or indirect benefits (e.g., preferable breeding habitat could quickly become saturated (e.g., increased fitness and survival of offspring). While many Schradin and Pillay, 2005). In this situation, dispersal due to comparative analyses have examined the ecological factors that limited opportunities for successful independent breeding options constrain dispersal and hence promote natal philopatry (Emlen, is constrained. Alternatively, in unstable environments, the 1994; Hatchwell and Komdeur, 2000; Lucia et al., 2008), none benefits of remaining at the nest may be greater than dispersing have explicitly focused on the benefits ofphilopatry hypothesis on and rearing young independently, which is what Stacey and its own. Instead, discussion of benefit based mechanisms of Ligon (1991) subsequently coined as the benefits of philopatry social evolution and maintenance are from studies examining the hypothesis. effects of multiple ecological factors. Much support for benefit Environmental variability is likely linked to the availability of based models has come from the mammalian literature, food resources which has also been shown to be a constraint on especially rodents, particularly in relation to the dispersal and hence a factor of interest in the evolution of thermoregulatory benefits of huddling (Hayes, 2000; cooperative breeding (Rubenstein and Lovette, 2007). A Ebensperger, 2001; Solomon, 2003). Ebensperger (2001) comparative analysis conducted by Du Plessis et al. (1995) suggested that comparative methods should be used for future investigated 217 South African birds comprising 175 non- studies of the evolution of rodent sociality and that they should cooperative breeding species and 25 obligate and 17 facultative simultaneously weigh the constraints and benefits associated with cooperative breeding species. Based on the findings of their study, group living. The concept that these hypotheses are not mutually Du Plessis et al. (1995) proposed that obligate and facultative exclusive led Hayes (2000) to propose a “pup defense—animal cooperative breeding systems had evolved independently under density hypothesis” in a review of communal nesting in rodents. different ecological circumstances. Obligate cooperative breeders This hypothesis explores the idea that the benefit of pup defense tended to live in predictable habitats where year-round food generally increases with group size (Manning et al., 1995), but availability was sufficient to sustain permanent groups and this benefit must be weighed against the potential constraint of benefited by increasing survival from predation. Facultative the increased probability of infanticide by conspecifics locating cooperative breeders, on the other hand, lived in less predictable the nest, which is more likely at higher animal densities (Wolff, environments where food limitations negated the formation of 1997). stable groups, with cooperative breeding occurring in years of It is clear that ecological factors are influential in determining the higher food availability, suggesting that benefits gained were costs and benefits of remaining philopatric and hence group- predominantly related to reproduction rather than survival. living, though much debate remains over which particular Many of the comparative analyses discussed thus far have ecological factors provide sufficient benefits or constraints for focused on broad scale environmental patterns, and the sociality and subsequent cooperative breeding to evolve and be availability of resources. One area that appears to be distinctly maintained. Comparative analyses have proven a useful tool with lacking is risks of dispersal. One notable exception to this which to identify these benefits and constraints as cooperative

Frontiers in Ecology and Evolution | www.frontiersin.org 8 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

breeding species likely share similar benefits or occupy similar exhibiting similar life histories and inhabiting similar ecological ecological niches. niches. Blumstein and Armitage (1999) argued that ecological factors such as harsh environmental conditions, and food Other Hypotheses availability drove life-history characteristics such as growth rates Much of the work discussed thus far has focused on the roles and age of maturation. They found that marmots living in harsh of kinship, life-history and ecological factors. While these factors environments delayed dispersal past a reproductive maturity tend to dominate the literature (Figure 2), there are alternative index which resulted in the formation of extended family groups, hypotheses such as group augmentation (Kokko et al., 2001), further highlighting the link between ecological factors and life- which examines the benefits conferred to breeders in the group history in the formation of familygroups. from maintaining a number of subordinate helpers at the nest Although these examples demonstrate the effectiveness of (i.e., breeders actively recruit or even kidnap subordinate comparative analyses in studying multiple factors of social group members) rather than focusing on constraints placed evolution, to date they have only focused on the interplay of upon subordinate dispersal from a group, or the ecologically- ecological and life-history traits. There is clearly a need for more associated benefits conferred to subordinates of remaining at the comparative studies focusing on integrating additional factors as nest. Such alternative hypotheses should also be considered well, such as kinship and group augmentation (Figure 2). when examining mechanisms of social evolution. Thus far, no Furthermore, comparative studies are not capable of showing comparative analyses have explicitly addressed group causation. To gain this level of understanding researchers should augmentation as a mechanism of social evolution and aim to follow comparative work with manipulative experiments. maintenance, but the hypothesis was the subject of a review by The comparative analysis can be used to target these experiments Kingma et al. (2014) who formalized a clear conceptual at sets of species contrasting in sociality. framework to guide future empirical work in the area. Several comparative studies have also alluded to group augmentation Observational Studies effects such as increased survival (and hence greater lifetime Observational studies covered in this section refer to those that reproductive output) through group defense orpredator detection are correlative and focus on a small subset of species, often a (the “many eyes hypothesis”) (Ebensperger, 2001; Ridley and van single species, as opposed to the comparative analyses which den Heuvel, 2012). examine broad scale patterns across multiple taxa or manipulative experiments which are capable of demonstrating Multiple Factors causality. For these reasons, observational studies should be Although the ecological constraints, benefits of philopatry and augmented by comparative and experimental work to gain a life-history hypotheses have so far been dealt with separately holistic view of social evolution. Observational studies are in this review, it is important to note, as many of these studies particularly well suited to investigating animals which live in have done, that ecological and life-history factors are not groups on discrete habitat patches or well defined territories (e.g., mutually exclusive and often act in concert and alongside other Nam et al., 2010; Marino et al., 2012). Similar to comparative evolutionary selective forces. Multiple factors likely have varying analyses, there is a pervading taxonomic bias in observational influences on different species. It is therefore paramount that studies leaning toward terrestrial taxa (Figure 1). Species with these factors are studied in concert across a range of lineages if less conventional life-histories, often seen in marine taxa, are we are to gain a truly representative view of how sociality evolved relatively understudied yet could shed new light on the evolution and is maintained. Comparative analyses and syntheses are well and maintenance of sociality. Habitat specialist fish are placed to advance the study of social evolution in this way. particularly well suited to observational work as they are For example, the comparative analysis conducted by Arnold and widely distributed on coral reefs, display a wide variety of social Owens (1998) suggested that while life-history traits such as organization and live on discrete habitat patches (Buston, 2003b; longevity predisposed avian lineages to cooperative breeding, Wong et al., 2005). Additionally, many are demersal spawners ecological constraints might then determine which species would and as such provide a convenient measure of fecundity through benefit from cooperative breeding behavior (and hence determine egg counts (Herler et al., 2011). whether cooperative breeding was actually expressed in a given Finer scale observational studies are useful for examining lineage). While this explanation accounted for the patchy intraspecific variation in cooperative breeding behavior, which phylogenetic distribution of cooperative breeding, it did not fully may be overlooked in comparative analyses (Schradin and Pillay, explain why species within the same lineages varied so 2005; Sorato et al., 2012). Additionally, the comparative analyses markedly in their social behavior. Hatchwell and Komdeur discussed above often rely on the data provided by finer scale (2000) coined a “broad constraints hypothesis,” whereby life- observational studies. For example, Cockburn’s (1996) breeding history traits and ecological constraints acted together causing a data was compiled from 20 different studies in order to compare broad constraint on the turn-over of breeding opportunities ofa ecological correlates of cooperative breeding in a group of species, a concept originally proposed by Ricklefs (1975). This Australian birds (Table 1 in Cockburn, 1996). Alternatively, other broad constraints approach was also echoed by Solomon (2003) studies such as Ridley and van den Heuvel (2012) have used in a review of factors influencing philopatry in rodents. These comparative methods to identify a trend to focus on and studies show that broad constraints on breeding opportunities subsequently conduct finer scale observational analyses. In both explain the variation in cooperative behavior observed in species methodologies, detailed observational data from a subset of

Frontiers in Ecology and Evolution | www.frontiersin.org 9 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

species has played a key role in informing discussion on the breeding long-tailed tit, Aegithalos caudatus, using group history evolution of sociality. Furthermore, many observational studies pedigrees and microsatellite genotypes from a 14 year field study can be performed over large temporal scales (e.g., Rubenstein, to show that investment by helpers increased with relatedness. 2011; Marino et al., 2012), which is often logistically impractical Likewise, Bruintjes et al. (2011) found that subordinate cichlids, for experimental manipulations and typically outside of the aims Neolamprologus pulcher, raised their levels of helping behavior of such research (though multi-generational experimental when they had bred successfully and their offspring were present manipulations may be an option for researchers wishing to in the clutch. In another observational study, Canestrari et al. demonstrate evolutionary mechanisms). Such long-term data is (2005) found that among a cooperative breeding population of extremely important in the study of sociality, especially when carrion crows, Corvus corone corone, genetic parents fed chicks at species are subjected to seasonal or other temporal fluctuations in greater rates than helpers with no parentage. However, the nests their ecology orbehavior. often contained the offspring of several breeding individuals, and the amount of feeding was not proportional to the number of Monogamy and Kinship offspring in the nest. This may indicate that carrion crows do Kinship based models of cooperative breeding propose that not have a mechanism to recognize close kin and/or that costs helpers should maximize their indirect genetic benefits by associated with provisioning unrelated chicks may be low. preferentially helping descendent or close kin. Testing this Conversely, in mammalian lineages, cooperative breeding in the hypothesis requires knowledge of the relatedness of individuals form of allosuckling represents a high energetic investment to in a population. This can be achieved through observation of mothers. Eberle and Kappeler (2006) documented this behavior group history of the study population or by inferring relatedness during a long-term observational study of a population of gray by comparing genetic markers. Microsatellite markers have thus mouse lemurs (Microcebus murinus). Microsatellite analyses far tended to be the preferred tool for genetic inference of showed that groups consisted of related individuals and their relatedness. However, more recently, single nucleotide observations showed a high mortality rate of both adults and polymorphisms (SNP’s) have emerged as a potential alternative juveniles in this species. Eberle and Kappeler’s (2006) study as the markers tend to be cheaper and easier to develop than indicated that female gray mouse lemurs possess a kin microsatellites (Weinman et al., 2015). Genetic inference of recognition mechanism, regularly discriminating their own pedigree is not always straightforward, especially when offspring over the offspring of other females in communal nests, researchers have difficulty in determining the relative frequency but provisioned allomaternal care and in some instances, adopted of kin/non-kin in the population, which is often the case in wild the young of other related individuals in the case of their mother’s populations in which the dispersal or settlement of offspring death. The provision of care however, was more often directed cannot be directly observed (e.g., fish with a pelagic larval toward direct descendent pups and pups suckled more at their phase). Combining observations of group history with genetic own mothers. Eberle and Kappeler (2006) concluded that kin inference is an effective method of determining relatedness and selection was most likely the main selective force behind this many studies have used this approach (e.g., Wright et al., 1999; cooperative breeding system which provided “family insurance” Legge, 2000; Clutton-Brock et al., 2001; Dierkes et al., 2005). in the face of high mortality risk in this species. However, when such observational data is not available, In contrast, other observational studies have found little evidence researchers must rely on genetic tools alone (e.g., Buston et al., to support a relationship between relatedness and helping 2009). A number of estimators of pair-wise relatedness have behavior (Wright et al., 1999; Legge, 2000; Clutton- Brock et been proposed (Lynch and Ritland, 1999; Van De Casteele et al., al., 2001; Wong et al., 2012). For example, in a six year 2001), but these estimators still rely on sound knowledge of the observational study of meerkats (Suricata suricatta), Clutton- true frequency distribution of relationship in the population in Brock et al. (2001) assessed the individual contributions of order to determine the likelihood that two individuals are indeed helpers toward relatives. They found that individual variation related (Buston et al., 2009, Supplementary Material). If this in the amount of food that helpers gave to pups was related to requirement can be fulfilled, genetic inference of relatedness is a individual foraging success, sex and age rather than relatedness to powerful method for studying the effects of kinship on the the pups. Similarly, in a population of Arabian babblers, evolution of sociality. Turdiodes squamiceps, Wright et al. (1999) found little effect of These methods have been used to demonstrate preferential relatedness on feeding rates or load sizes using three different provisioning of close kin in many species such as long-tailed measures of relatedness. Cooperatively breeding kookaburras tits (Nam et al., 2010), carrion crows (Canestrari et al., 2005), (Dacelo novaeguineae) also did not invest in higher provisioning and gray mouse lemurs (Eberle and Kappeler, 2006). However, or incubation at nests of related individuals (Legge, 2000). there is some ambiguity as to whether related individuals actively Instead, individuals in larger groups provisioned less food to choose to remain philopatric and provision care to related young chicks regardless of relatedness. Since food provision represents a in order to maximize indirect benefits, or whether family groups high energetic cost in this species, Legge (2000) believed that form due to some direct benefit of remaining at the natal habitat larger groups of kookaburras may gain direct fitness benefits and the provision of help to close kin is merely a result of nesting through higher survival and hence greater life-time reproduction in family groups. Observational studies have played a key role by “load lightening” when more helpers were available rather in informing this debate. For example, Nam et al. (2010) than indirect genetic benefits via kin selection. Similarly, Wong examined the investment of helpers of the cooperatively et al. (2012) found that while helpers were indeed more related to

Frontiers in Ecology and Evolution | www.frontiersin.org 10 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

breeders in monogamous than polygynous mating systems, they et al., 2010 respectively) may be capable of altering growth rates did not provide more help in the cooperatively breeding cichlid, or overall body condition and hence longevity in some species Neolamprologus pulcher. However, Stiver et al. (2005) found that and as such may be capable of disentangling cause from other factors acted alongside kinship effects to determine helping consequence especially if it is possible to maintain over multiple behavior in the same species. They showed that relatedness, generations. The relative ease with which observational studies although not the only driver in helping behavior, still plays a role can be conducted over long periods makes them a valuable in the amount of help provided by subordinate N. pulcher. method to use to study the role of life-history traits in the It is evident from these studies and others that the evolution of evolution of group living and complex social behavior. sociality through kinship based processes is likely to be species specific. However, the true specificity of these processes cannot be Ecological Factors determined unless subsequent comparative work is undertaken. Finer scale observational studies are also excellent for examining Furthermore, the question of whether the provisioning of close ecological correlates of sociality such as predation risk and habitat kin is a cause or a consequence of kinship based group saturation. Since such studies usually occur in situ, they are formation can only be disentangled using manipulative valuable for providing a view of the relationship between sociality experiments. Nevertheless, these observational studies highlight and ecology under natural conditions. Sorato et al. (2012) the importance of the relationship between genetic relatedness investigated the effects of predation risk on foraging behavior and helping behavior, uncovered using either group history and group size in the chestnut-crowned babbler, Pomatostomus information, genetic inference or both, to examine whether ruficeps, and found that larger groups were less likely to be kinship might have been a driver of sociality in these species. attacked by a predator. Sorato et al. (2012) proposed that predation was therefore likely to be a key factor promoting the Life-History Hypothesis evolution of group living in Pomatostomus ruficeps. Curry The importance of longevity in the evolution of cooperative (1989) examined patterns of sociality and habitat availability breeding has been demonstrated by Rowley and Russell (1990) amongst four species of allopatric Galapagos mockingbirds in a long term observational study of Splendid Fairy-Wrens (Nesomimus spp.) and found that species constrained by a lack (Malurus splendens). In this study, Rowley and Russell (1990) of available habitat maintained cooperatively breeding social monitored color banded groups of Splendid Fairy-wrens (long- groups. Similarly, Schradin and Pillay (2005) found that group lived cooperative breeders) between 1973 and 1987. Rowley and formation in arid populations of the African striped mouse, Russell (1990) pointed out that the available habitat tends to Rhabdomys pumilio, was likely caused by habitat saturation. They become saturated in longer lived species which restricts also suggest that group living benefits such as increased vigilance independent breeding opportunities. In a study conducted on against predators and thermoregulation could be important Australian skinks, Egernia stokesii, Duffield and Bull (2002) factors in promoting philopatric behavior. highlighted the similarity in life-history characteristics and group As is the case for comparative analyses, there appear to be formation in cooperatively breeding birds and mammals. fewer observational studies examining the effects of dispersal risk Duffield and Bull (2002) considered that the longevity of these on delayed dispersal in terrestrial taxa. Waser et al. (1994) skinks caused the finite number of available rock crevices to pointed out the absence of a parameter estimating the probability become saturated, constraining dispersal and promoting group of dispersing successfully in the cooperative breeding literature. living. Kent and Simpson (1992) also describe eusociality in a However, the authors believe that estimates of the survival rate particularly long lived beetle, Autroplatypus incompertus, though of emigrants and philopatric animals could be calculated from it is not clear whether this longevity is a cause of the social existing census data and behavioral observations to estimate such a structure. parameter. Waser et al. (1994) demonstrated the effectiveness of Theoretically, the rate of development may also influence the this approach using data from a number of observational studies evolution of sociality through delayed dispersal as animals on dwarf mongooses, Helogale parvula (Rood, 1983, 1987, 1990; exhibiting slower development and lower growth rates likely Creel and Waser, 1994). This study showed that in this species, require extended parental care (Solomon, 2003). While there is older and more experienced individuals had greater dispersal some support for this hypothesis (Burda, 1990), several success. Surprisingly, given that dwarf mongooses are observational studies of growth rates in mammals tend to view monomorphic, the study also showed that males had greater this life-history trait as a consequence of sociality rather than a survival after dispersing than females indicating a lower potential cause (Oli and Armitage, 2003; Hodge, 2005). dispersal risk for males than for females. Therefore, census and Nevertheless, these studies show the usefulness of observational behavioral observation data will certainly be vital for continued methodology in informing discussions surrounding the role that advancement in this field, as risks of dispersal are likely to play a life-history traits may or may not have played in the evolution role in group formation in a range of taxa. of sociality. However, as observational studies are not able to Habitat specialist fishes for example, provide an excellent show causality, it is difficult to determine whether changes in life- opportunity to test such hypotheses under novel circumstances history are a cause or a consequence of sociality. This limitation as many of these species are sequential or bi-directional may be mitigated if the observational work is later tested with hermaphrodites (Nakashima et al., 1996; Buston, 2004b) and few experimental manipulations. Supplemental feeding or food congregate in groups of related individuals. Such a varied life- restriction experiments (e.g., Wong et al., 2008b; Bruintjes history, rarely observed in terrestrial taxa, means that indirect

Frontiers in Ecology and Evolution | www.frontiersin.org 11 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

genetic benefits are unlikely to be key factors in the evolution and constrained by ecological factors in this species, but are in fact maintenance of sociality in these species. As such, these species receiving direct benefits (increased foraging success) related to provide a novel system in which to explore the enhanced role remaining philopatric. Marino et al.’s (2012) study highlights the that ecological constraints and direct benefits could contribute to importance of long term observational studies in providing the evolution and maintenance of sociality. For example, a evidence to tease apart different hypotheses of cooperative recent observational study by Groenewoud et al. (2016) showed breeding theory. that predation risk was a significant constraint on dispersal in the cooperatively breeding cichlid Neolamprologus pulcher. A Other Hypotheses lack of available habitat to disperse to may also pose a substantial Other observational studies have questioned the life-history and risk to a subordinate considering dispersal. Buston (2003a) ecological constraints hypotheses as explanations for delayed showed that dominant clown anemonefish (Amphiprion percula) dispersal. Doerr and Doerr (2006) investigated two sympatric strictly regulate the number of subordinates in their group. A species of treecreepers (Climacteris picumnus and Cormobates subordinate considering dispersal from the group would leucophaea) and suggested that the life-history and ecological therefore need to gauge its likelihood of being allowed entry to constraints hypotheses did not explain why some bird species a new group. Buston (2004b) further showed that subordinate A. remain at the nest while others adopt a range of “floater percula form a perfect queue for a breeding position in the group strategies.” Instead, Doerr and Doerr (2006) proposed an “anti- and stand to inherit the breeding territory. In this species and predator tactics” hypothesis based upon their findings to explain likely other habitat specialist fish which form dominance the divergence between group and solitary living in these species. hierarchies, the benefits of remaining philopatric (territory Group augmentation, where advantages are positively related to inheritance) may help to explain the evolution of groupformation, group size, has also been raised as a mechanism promoting the especially when there are substantial risks of dispersal (Buston, formation of social groups (reviewed in Kingma et al., 2014). 2004b; Wong, 2011; but see Mitchell, 2005). The ability of many Few observational studies have specifically focused on this species of habitat specialist fish to change sex could be a key mechanism, although several have mentioned its effects whilst element in the development of social queuing and increase the focusing on alternative cooperative breeding hypotheses (Clutton- benefit of remaining in the group in these species because once Brock et al., 1999; Wright et al., 1999; Balshine et al., 2001; a breeding position is obtained, the previously subordinate Marino et al., 2012) or allee effects (Courchamp and Macdonald, individual can change to the appropriate sex to facilitate 2001; Heg et al., 2005). breeding. This ability may also mitigate the risk of dispersing and not finding a mate of the opposite sex. The effects of sex Manipulative Experiments changing ability on the costs and benefits of dispersal are While the literature discussed so far has been extremely largely untested and these habitat specialist marine fishes important in supporting debate regarding a number of social, life- represent exciting opportunities for future studies (Munday et al., history and ecological correlates of sociality, we must keep in 1998). Furthermore, these species also tend to congregate on mind that these comparative and observational methods are not discrete habitat patches enabling long term observation of social able to provide causal explanations of sociality. Brockmann behavior (Herler et al., 2011; Wong and Buston, 2013). (1997) pointed out an apparent lack of data with which to study The benefits of philopatry hypothesis provides an excellent the ecological constraints model at the time, deeming the example of how the combination of many smaller scale majority of evidence to be correlational. This finding may have observational studies have significantly advanced our changed since Brockmann (1997) wrote her review, with understanding of this particular hypothesis of cooperative manipulative studies leading observational and comparative breeding theory. Notably, Stacey and Ligon (1991) initially studies in publication numbers in the last five years (Figure 3). conceived this hypothesis by drawing upon observational data While experimental manipulation is an extremely powerful tool from several long term studies of acorn woodpeckers (Stacey, for examining factors of social evolution, it must be considered 1979a,b; Stacey and Ligon, 1987), green woodhoopoes (Ligon that the time and expense involved in altering aspects of an and Ligon, 1978, 1990) and mountain chickadee (McCallum, individuals’ social or ecological environment may be prohibitive 1988). Support for this theory has gained momentum through to long term study. It is no surprise then that themajority of observational studies of mammalian species. Marino et al. (2012) manipulative studies are “snap-shots” and care should be taken in conducted a long term observational study in Ethiopian wolves the interpretation of results in an evolutionary timeframe. (Canis simensis) which form large packs in areas of high prey Because of the logistical constraints of manipulative experiments, abundance, but are only found in pairs in areas where prey was many studies have focused on smaller species which are more limited. While this observation may be characteristic of an easily housed or species with habitats that can be easily ecological constraint, groups of wolves gained benefits through manipulated in situ. Social marine or freshwater fish make defense of high quality habitat against neighboring packs. excellent study species for this methodology as they tend to Additionally, Marino et al. (2012) found that even when habitat congregate on discrete habitat patches which can be easily picked saturation was relaxed following an outbreak of rabies in the up and moved or simulated in aquaria, making experimental population, subordinate individuals remained philopatric, taking manipulations of ecological factors highly feasible (Wong, 2010). advantage of the enhanced foraging success of the group. This Many are also demersal spawners which provides a convenient indicates that subordinate individuals are not likely to be measure of reproductive success and fecundity (Buston, 2004a;

Frontiers in Ecology and Evolution | www.frontiersin.org 12 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

more likely to share food with a recipient if the recipient had previously donated food, regardless of relatedness). A similar lack of kinship effect has also been demonstrated in three independent experiments of artificially formed groups of African cichlids, Neolamprologus pulcher (Stiver et al., 2005; Le Vin et al., 2011; Zöttl et al., 2013). All three studies compared groups of cichlids under laboratory conditions where helpers were either related or unrelated to an adult pair and showed that kinship was not related to the amount or type of help that subordinates performed. While these findings may appear to contradict kin selection based models, it is possible that related and unrelated helpers are provisioning help for different reasons. Le Vin et al. (2011) Stiver et al. (2005) and Zöttl et al. (2013) all pointed out that related helpers may help their relatives in order to receive indirect genetic benefits while unrelated helpers may have to “pay to stay” (i.e., provide help to avoid eviction) in order to enjoy the direct fitness benefits of group living (see Quiñones et al., 2016 for a model based on this species showing that negotiations in a pay to stay scenario can result in higher levels of cooperation than relatedness). These studies highlight FIGURE 3 | Approximate number of publications on cooperative breeding for the importance of using experimental studies to demonstrate each methodology. The number articles published in the last 5 years is shown in causality of effects described using observational data. dark gray and is included in the total count. Search parameters are available in Supplementary Table S1. Numbers presented here are intended as Life-History approximations only as search parameters were not completely mutually While much support for the life-history hypothesis has been exclusive or exhaustive. gained from observational and comparative analyses, life-history

traits are generally difficult or in some cases impossible to manipulate experimentally. It is not surprising therefore that the Wong et al., 2008a, 2012). Recent experimental manipulations on majority of manipulative experiments designed to examine the these fish are pushing the boundaries of our understanding of the evolution of sociality, have focused on manipulating ecological evolution and maintenance of sociality (Wong, 2011; reviewed in and social variables. However, Heg et al. (2011) performed a Wong and Buston, 2013; Buston and Wong, 2014). series of manipulative experiments on Neolamprologus pulcher, and concluded that although ecological and social factors were Monogamy and Kinship responsible for the extent of cooperative breeding, a life-history Monogamy is thought to be directly related to the formation approach could best integrate the environmental and social of close family groups and hence sets the stage for cooperative factors that influenced an individual’s decision of whether to breeding to occur (Boomsma, 2009; Cornwallis et al., 2010). In join a group as a subordinate helper or disperse to pursue these close family groups, individuals are expected to increase independent breeding opportunities. Despite this, there is clearlya their indirect genetic benefits by provisioning close kin. While distinct lack of experimental studies focused on the life-history much support for kin selection models has been gained through hypothesis. Manipulating sociality by subordinate removal or observational and comparative studies, several experimental addition for example, could be an effective way of determining studies have questioned kin selection as a mechanism driving whether measurable life-history traits, such as longevity or sociality. Clutton-Brock et al. (2001) conducted a supplemental growth rates, are a consequence rather than cause of sociality. feeding manipulation in a population of meerkats (Suricata While not specifically designed to test this hypothesis, growth suricatta) to test whether relatedness of helpers to a litter rate adjustment has been experimentally induced by breeder or predicted the amount of food they provisioned to the litter. They helper removal or replacement experiments in a species of found that the provision of food to the litter was related to the African cichlid (Neolamprologus pulcher; synonymous with foraging success of the individual helpers, regardless of N. brichardi, Duftner et al., 2007) and in a social marine relatedness to the litter. Similarly, Riehl and Strong (2015) cross- fish (Amphiprion percula) (Taborsky, 1984; Buston, 2003b; Heg fostered broods of nestlings between pairs of nests ensuring that et al., 2004b; Bergmüller et al., 2005 respectively). However, to none of the broods were related to the provisioning adults. specifically test the life-history hypothesis experiments would Feeding rates did not differ at cross-fostered nests compared necessitate considerably long time scales and the arrival or to those of sham-manipulated control nests (where nestlings were premature departure of subordinates would need to be tightly removed and then returned to their original nests), suggesting controlled. Such experiments would therefore be best suited to that provisioning was not influenced by relatedness. Furthermore, fast growing, short lived species or animals which could be easily Carter and Wilkinson (2013) demonstrated thatfood sharing in housed in a captive setting. Several studies have used vampire bats, Desmodus rotundus, was predicted more by supplemental feeding which has resulted in altered growth rates reciprocation than relatedness (that is, food donors were

Frontiers in Ecology and Evolution | www.frontiersin.org 13 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

and increased survival of subordinates (Cole and Batzli, 1978; benefits of philopatry were important factors in the dispersal Boland et al., 1997; Wong et al., 2008b). While not designed of Seychelles warblers by experimentally introducing individuals to test the life-history hypothesis, these short-term experiments to unoccupied islands. Two years after the initial introduction have coincidentally changed life-history factors and this method of warblers, all of the high quality territory was occupied, and may be worthy of investigation for future experimentation in this yearlings born on these territories began to stay and help field. There is also a need for long-term experimentation in order instead of pursuing independent breeding opportunities on still to detect changes in sociality over the temporal scale of the life- vacant lower quality habitat. Komdeur’s (1992) results showed history trait in question. Habitat specialist marine fishes would that while habitat saturation constrained young birds from make good study species as they display a variety of life-history leaving high quality habitat, the benefits of remaining at a high traits such as indeterminate growth rates and sex-change, a life- quality nest resulted in higher life-time reproductive success. history trait rarely observed in terrestrial taxa and many species Similarly, Wong (2010) used field and laboratory experiments to are short lived and have rapid growth rates (Munday and Jones, demonstrate that subordinate dispersal in a coral reef fish, 1998; Munday et al., 1998; Wong et al., 2005; Depczynski and Paragobiodon xanthosomus, was affected by a combination of Bellwood, 2006). ecological constraints (habitat saturation and risk of movement) and benefits of philopatry (coral size—a proxy for habitat quality Ecological Factors in this species), but not by social factors (social rank and forcible Ecological variables such as rainfall, and temperature can vary eviction). Ligon et al. (1991) also tested the effects of several substantially with latitude (Tewksbury et al., 2008). Reciprocal ecological factors on cooperative breeding in groups of superb transplant experiments over large latitudinal gradients are fairy wrens, Malurus cyaneus. They examined the effects of mate therefore useful for assessing the role that ecological factors availability, habitat saturation and group augmentation. Ligon et could play in promoting sociality in broadly distributed taxa. al. (1991) found that their study population of M. cyaneus was not For example, Baglione et al. (2002) demonstrated a clear link constrained by a lack of breeding partners, or by limitations of between sociality and environmental factors in carrion crows, available breeding habitat and that subordinate presence was not Corvus corone corone, via a transplant experiment where eggs related to reproductive success. Ligon et al. (1991) concluded that from asocial nests in Switzerland were moved to social nests in benefits of remaining on a higher quality habitat were Spain. Offspring of non-cooperative crows which were reared in responsible for natal philopatry in male M. cyaneus. These the cooperative population in Spain displayed cooperative examples demonstrate the power of experimental manipulationin behavior and delayed dispersal. Although Baglione et al. (2002) identifying multiple factors which may have affected the suspected that habitat saturation was not a factor contributing to evolution and maintenance ofsociality. cooperative breeding in crows, habitat saturation as a constraint Experimental work, both on larger and smaller scales, has on dispersal has been well supported in many species through been extremely important in identifying species which have experimental manipulation (Curry, 1989; Schradin and Pillay, evolved sociality in response to ecological factors. These studies 2005). In contrast, Riechert and Jones (2008) found that a species have demonstrated that ecological factors relating to sociality of spider, Anelosimus studiosus, which is only social at high have proven relatively amenable to manipulation, either in the latitudes, maintained its social structure regardless of location field or the laboratory, for a range of species. It is clear from when transplanted between social and asocial nests, these examples that the role that ecological factors have played demonstrating that sociality in this species does not change in in the evolution of sociality is species specific, and that other response to ecological factors. factors are likely to play a role in determining whether a species Experimental studies can be used to tease apart the relative exhibits social behavior. The relative effects and causality of effects of individual benefits and constraints, or examine their these factors can only be teased apart using robust manipulative interactions. Indeed, many experimental studies have examined experiments. the combined effects of ecological constraints on dispersal and benefits of philopatry, similar to comparative and observational COMBINING METHODS analyses of this hypothesis. For example, Heg et al. (2011) examined the effects of habitat saturation, benefits of philopatry The discussion so far has highlighted the benefits and pitfalls of and kin-selection on the extent of helping in the cichlid, each individual methodology. We suggest that a combination of Neolamprologus pulcher. They found that habitat saturation and these methodologies will provide an efficient and comprehensive benefits of philopatry were responsible for helping but contrary view of social evolution. This combination should start with to the kin selection model, found that individuals preferred to sourcing or building a phylogeny for the taxa. Building the settle with unrelated fish in an absence of dispersal constraints. phylogeny would involve collection of genetic material from all of Previous experimental studies in freshwater fish have also the species within the lineage. Observational data on sociality and supported the idea that ecological constraints and benefits are associated ecological, life-history and behavioral factors could responsible for delayed dispersal in cooperatively breeding also be collected at the same time. This data can then be mapped cichlids (Heg et al., 2004a, 2008; Bergmüller et al., 2005; onto the phylogeny and correlations between sociality and these Jungwirth et al., 2015). Predation risk in particular has been factors can be determined. This mapping can then be used to shown to be a crucial ecological constraint on dispersal in these target experimental work on sets of species varying in sociality species (Taborsky, 1984; reviewed in Taborsky, 2016). Komdeur and other factors of interest to determine whether causality can (1992) showed that habitat saturation and be assigned to any particular factors.

Frontiers in Ecology and Evolution | www.frontiersin.org 14 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

In many cases, phylogenies will already be fully resolved and and mammals have been well studied through comparative relevant social observational work may have been undertaken for analyses due to their well-defined phylogenies and long history some species. In such cases research effort should be directed to of observation. On the other hand, habitat specialist fish, because “filling in the blanks” for any species lacking in data. of their small body size and site attachment, are extending the Research effort is often directed at a “popular” subset of boundaries of our understanding of sociality through amenability species within a lineage because field techniques have been well to experimental manipulation. Overall, hypotheses for social established. While such research is valuable for examining evolution have been less extensively studied in marine taxa. sociality at the species level, the results are less meaningful at While cooperative rearing of young has not been observed in higher taxonomic levels. For this reason, we encourage marine fish, there are group living species which are typically researchers to design observational and experimental studies comprised of unrelated individuals and often a monogamous with the express view of contributing to future interspecific breeding pair with a number of non-breeding subordinates comparative work. Observations and manipulative experiments (Taborsky and Wong, 2017). These groups bear many should be conducted using similar methods to previous work so resemblances to cooperative breeding birds and mammals and that meaningful comparisons can be made. cooperative breeding theories have proven successful in explaining the evolution and maintenance of these social systems CONCLUSION (Buston and Balshine, 2007; Wong, 2010; Wong and Buston, 2013). Unconventional life-history strategies, such as bi- In this review, we explored the factors influencing the evolution directional sex-change, and amenability to experimental of social systems containing non-breeding subordinates, from the manipulation and observation present further opportunities to perspective of the methodological approaches that have been challenge hypotheses of social evolution under novel conditions. used to test multiple hypotheses. Great advances in the field For example, the ability to change sex may alter the costs and have been made through comparative work (Brockmann, 1997; benefits associated with dispersal from the group. Arnold and Owens, 1998; Clutton-Brock, 2002; Taborsky and Additionally, indeterminate growth as observed in social Wong, 2017) and fine scale observational (Rowley and Russell, marine fishes presents opportunities for exploring the life-history 1990; Schradin and Pillay, 2005) and manipulative studies hypothesis which is currently lacking experimental testing. (Komdeur, 1992; Riechert and Jones, 2008; Heg et al., 2011), Combining multiple methodological approaches with although each method has its limitations and taxonomic biases. investigations of novel taxa are now clearly required to gain Comparative analyses have proven useful for studying a truly general understanding of the evolution of sociality. evolutionary questions especially when combined with molecular phylogenetic tools as they are able to reveal patterns across multiple species and lineages (e.g., Edwards and Naeem, 1993; AUTHOR CONTRIBUTIONS Arnold and Owens, 1998; Cockburn, 2006). Intraspecific MH and MW formulated the idea for the manuscript. MHdrafted comparisons across ecologically diverging populations have also and revised the manuscript. MW provided substantialfeedback proven extremely valuable for testing ecological hypotheses (e.g., on drafts of the manuscript. OK and MD critically reviewed Groenewoud et al., 2016). However, these broad patterns may and provided comment on the manuscript. overlook contrasting patterns in smaller sets of species or within any given population, and are currently taxonomically restricted to terrestrial species and a handful of freshwater fish species. FUNDING Smaller-scale observational studies have been effectively used to investigate the relationships between life-history, ecology and This research has been conducted with the support of the Hermon sociality, especially over the long-term. However, observational Slade Foundation (HSF13/8) and the Australian Government studies are not able to show causality between these factors and Research Training Program Scholarship. sociality and are limited in impact as only a few species can be investigated. Manipulative experiments may save the day by ACKNOWLEDGMENTS demonstrating causality in many cases, but they too by necessity focus on smaller sets of species and short-term manipulations We thank P. Buston, for comments on the manuscript and in which limits the generality of their conclusions. There is also a depth discussion on the technicalities of determining relatedness. need for more comparative and observational studies on the We would also like to thank Dr. Taborsky, Dr. Stiver, one effects of dispersal risk on delayed dispersal and additional anonymous reviewer and the editor, Dr. Bilde for their helpful manipulative work on the life-history hypothesis in order togive a comments on the manuscript. well-balanced perspective of social evolution and maintenance. We suggest that combining these approaches under a single SUPPLEMENTARY MATERIAL framework would provide a comprehensive method of studying the evolution of sociality across a broad range of taxa, though few The Supplementary Material for this article can be found online studies have attempted to do so. at: http://journal.frontiersin.org/article/10.3389/fevo. Additionally, different animal groups have proven to be more 2017.00100/full#supplementary-material amenable to particular methodologies. For example, birds, insects

Frontiers in Ecology and Evolution | www.frontiersin.org 15 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

REFERENCES Buston, P. M. (2004b). Territory inheritance in clownfish. Proc. R. Soc. B Biol. Sci. 271, S252–S254. doi: 10.1098/rsbl.2003.0156 Arnold, K. E., and Owens, I. P. F. (1998). Cooperative breeding in birds: a Buston, P. M., and Balshine, S. (2007). Cooperating in the face of uncertainty: a comparative test of the life history hypothesis. Proc. R. Soc. B Biol. Sci. 265, 739– consistent framework for understanding the evolution of cooperation. Behav. 745. doi: 10.1098/rspb.1998.0355 Processes 76, 152–159. doi: 10.1016/j.beproc.2007.01.020 Avise, J. C., and Shapiro, D. Y. (1986). Evaluating kinship of newly settled juveniles Buston, P. M., Bogdanowicz, S. M., Wong, A., and Harrison, R. G. (2007). within social groups of the coral reef fish Anthias squamipinnis. Evolution 40, Are clownfish groups composed of close relatives? An analysis of microsatellite 1051–1059. doi: 10.1111/j.1558-5646.1986.tb00572.x DNA variation in Amphiprion percula. Mol. Ecol. 16, 3671–3678. doi: Awata, S., Munehara, H., and Kohda, M. (2005). Social system and reproduction of 10.1111/j.1365-294X.2007.03421.x helpers in a cooperatively breeding cichlid fish (Julidochromis ornatus) in Lake Buston, P. M., Fauvelot, C., Wong, M. Y. L., and Planes, S. (2009). Genetic Tanganyika: field observations and parentage analyses. Behav. Ecol. Sociobiol. 58, relatedness in groups of the humbug damselfish Dascyllus aruanus: small, similar- 506–516. doi: 10.1007/s00265-005-0934-6 sized individuals may be close kin. Mol. Ecol. 18, 4707–4715. doi: 10.1111/j.1365- Baglione, V., Canestrari, D., Marcos, J. M., Griesser, M., and Ekman, J. (2002). 294X.2009.04383.x History, environment and social behaviour: experimentally induced cooperative Buston, P. M., and Wong, M. Y. L. (2014). Why Some Animals Forgo Reproduction breeding in the carrion crow. Proc. R. Soc. B Biol. Sci. 269, 1247–1251. doi: in Complex Societies Behaviors of coral reef fishes provide strong support for 10.1098/rspb.2002.2016 some major new ideas about the evolution of cooperation. Am. Sci. 102, 290–297. Balshine, S., Leach, B., Neat, F., Reid, H., Taborsky, M., and Werner, N. (2001). doi: 10.1511/2014.109.290 Correlates of group size in a cooperatively breeding cichlid fish Canestrari, D., Marcos, J. M., and Baglione, V. (2005). Effect of parentage and (Neolamprologus pulcher). Behav. Ecol. Sociobiol. 50, 134–140. doi: relatedness on the individual contribution to cooperative chick care in carrion 10.1007/s002650100343 crows Corvus corone corone. Behav. Ecol. Sociobiol. 57, 422–428. doi: Bergmüller, R., Heg, D., and Taborsky, M. (2005). Helpers in a cooperatively 10.1007/s00265-004-0879-1 breeding cichlid stay and pay or disperse and breed, depending on ecological Carter, G. G., and Wilkinson, G. S. (2013). Food sharing in vampire bats: reciprocal constraints. Proc. R. Soc. BBiol. Sci. 272, 325–331. doi:10.1098/rspb.2004.2960 help predicts donations more than relatedness or harassment. Proc. R. Soc. B Biol. Blumstein, D. T., and Armitage, K. B. (1999). Cooperative breeding in marmots. Sci. 280:1753. doi: 10.1098/rspb.2012.2573 Oikos 84, 369–382. doi: 10.2307/3546418 Chapais, B. (2013). Monogamy, strongly bonded groups, and the evolution of Blumstein, D. T., and Moller, A. P. (2008). Is sociality associated with high human social structure. Evol. Anthropol. 22, 52–65. doi: 10.1002/evan.21345 longevity in North American birds? Biol. Lett. 4, 146–148. doi: 10.1098/rsbl. Chapple, D. G. (2003). Ecology, life-history, and behavior in the Australian 2007.0606 Scincid genus Egernia, with comments on the evolution of complex sociality in Boland, C. R. J., Heinsohn, R., and Cockburn, A. (1997). Experimental lizards. Herpetol. Monogr. 17, 145–180. doi: 10.1655/0733- manipulation of brood reduction and parental care in cooperatively breeding white- 1347(2003)017[0145:ELABIT]2.0.CO;2 winged choughs. J. Anim. Ecol. 66, 683–691. doi: 10.2307/5921 Clutton-Brock, T. (2002). Behavioral ecology - breeding together: kin selection Boomsma, J. J. (2009). Lifetime monogamyand theevolution of eusociality. Philos. and mutualism in cooperative vertebrates. Science 296, 69–72. doi: Trans. R. Soci. B Biol. Sci. 364, 3191–3207. doi: 10.1098/rstb.2009.0101 Bourke, A. 10.1126/science.296.5565.69 F. G. (2011). Principles of Social Evolution. Oxford: Oxford University Clutton-Brock, T. H., Brotherton, P. N. M., O’Riain, M. J., Griffin, A. S., Gaynor, Press. D., Kansky, R., et al. (2001). Contributions to cooperative rearing in meerkats. Bourke, A. F. G. (2014). Hamilton’s rule and the causes of social evolution. Philos. Anim. Behav. 61, 705–710. doi: 10.1006/anbe.2000.1631 Trans. R. Soc. BBiol. Sci. 369, 10. doi:10.1098/rstb.2013.0362 Clutton-Brock, T. H., Gaynor, D., McIlrath, G. M., Maccoll, A. D. C., Kansky, Briga, M., Pen, I., and Wright, J. (2012). Care for kin: within-group relatedness R., Chadwick, P., et al. (1999). Predation, group size and mortality in a and allomaternal care are positively correlated and conserved throughout the cooperative mongoose, Suricata suricatta. J. Anim. Ecol. 68, 672–683. doi: mammalianphylogeny. Biol. Lett. 8, 533–536. doi:10.1098/rsbl.2012.0159 10.1046/j.1365-2656.1999.00317.x Brockmann, H. J. (1997). “Cooperative breeding in wasps and vertebrates: the Cockburn, A. (1996). “Whydo so manyaustralian birds cooperate: social evolution in role of ecological constraints,” in The Evolution of Social Behavior in Insects and the corvida?” in Frontiers of Population Ecology, eds R. B. Floyd, A. Arachnids, eds J. C. Choe and B. J. Crespi (Cambridge, UK: Cambridge W. Sheppard, and P. J. Debarro (Canberra: CSIRO Publishing, Melbourne), 451– UniversityPress), 347–371. 472. Brown, J. L. (1974). Alternate routes to sociality in jays—with a theory for Cockburn, A. (2006). Prevalence of different modes of parental care in birds. Proc. the evolution of altruism and communal breeding. Am. Zool. 14, 63–80. doi: R. Soc. BBiol. Sci.273, 1375–1383.doi:10.1098/rspb.2005.3458 10.1093/icb/14.1.63 Cole, F. R., and Batzli, G. O. (1978). Influence of supplemental feeding on a vole Brown, J. L. (1987). Helping and Communal Breeding in Birds. Princeton, NJ: population. J. Mammal. 59, 809–819. doi: 10.2307/1380145 Princeton University Press. Cornwallis, C. K., West, S. A., Davis, K. E., and Griffin, A. S. (2010). Promiscuity Bruintjes, R., Bonfils, D., Heg, D., and Taborsky, M. (2011). Paternity of and the evolutionary transition to complex societies. Nature 466, 969–U91. doi: subordinates raises cooperative effort in cichlids. PLoS ONE 6:e25673. doi: 10.1038/nature09335 10.1371/journal.pone.0025673 Courchamp, F., and Macdonald, D. W. (2001). Crucial importance of pack size Bruintjes, R., Hekman, R., and Taborsky, M. (2010). Experimental global in the African wild dog Lycaon pictus. Anim. Conserv. 4, 169–174. doi: food reduction raises resource acquisition costs of brood care helpers and 10.1017/S1367943001001196 reduces their helping effort. Funct. Ecol. 24, 1054–1063. doi: 10.1111/j.1365- Creel, S. R., and Waser, P. M. (1994). Inclusive fitness and reproductive strategies in 2435.2010.01715.x dwarfmongooses. Behav. Ecol. 5, 339–348. doi: 10.1093/beheco/5.3.339 Burda, H. (1990). Constraints of pregnancy and evolution of sociality in mole-rats Curry, R. L. (1989). Geographic-variation in social-organization of galapagos - with special reference to reproductive and social patterns in Cryptomys mockingbirds - ecological correlates of group territoriality and cooperative hottentotus (Bathyergidae, Rodentia). Z. Zool. Syst. Evol. 28, 26–39. doi: breeding. Behav. Ecol. Sociobiol. 25, 147–160. doi: 10.1007/ BF00302932 10.1111/j.1439-0469.1990.tb00362.x Depczynski, M., and Bellwood, D. R. (2006). Extremes, plasticity, and invariance Buston, P. (2003a). Forcible eviction and prevention of recruitment in the clown in vertebrate life history traits: insights from coral reef fishes. Ecology 87, 3119– anemonefish. Behav. Ecol. 14, 576–582. doi:10.1093/beheco/arg036 3127. doi: 10.1890/0012-9658(2006)87[3119:EPAIIV]2.0.CO;2 Buston, P. (2003b). Social hierarchies: size and growth modification in clownfish. Dierkes, P., Heg, D., Taborsky, M., Skubic, E., and Achmann, R. (2005). Genetic Nature 424, 145–146. doi: 10.1038/424145a relatedness in groups is sex-specific and declines with age of helpers in a Buston, P. M. (2004a). Does the presence of non-breeders enhance the fitness cooperatively breeding cichlid. Ecol. Lett. 8, 968–975. doi: 10.1111/j.1461- of breeders? An experimental analysis in the clown anemonefish Amphiprion 0248.2005.00801.x percula. Behav. Ecol. Sociobiol. 57, 23–31. doi:10.1007/s00265-004-0833-2

Frontiers in Ecology and Evolution | www.frontiersin.org 16 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

Doerr, E. D., and Doerr, V. A. J. (2006). Comparative demography of treecreepers: Garland, T., Harvey, P. H., and Ives, A. R. (1992). Procedures for the analysis of evaluating hypotheses for the evolution and maintenance of cooperative breeding. comparative data using phylogenetically independent contrasts. Syst. Biol. 41, 18– Anim. Behav. 72, 147–159. doi: 10.1016/j.anbehav.2005.10.017 32. doi: 10.1093/sysbio/41.1.18 Double, M. C., and Cockburn, A. (2003). Subordinate superb fairy-wrens Gaston, A. J. (1978). The evolution of group territorial behavior and cooperative (Malurus cyaneus) parasitize the reproductive success of attractive dominant breeding. Am. Nat.112, 1091–1100. doi:10.1086/283348 males. Proc. R. Soc. Lond. B Biol. Sci. 270, 379–384. doi: 10.1098/rspb. 2002.2261 Gowans, S., Whitehead, H., and Hooker, S. K. (2001). Social organization in Drobniak, S. M., Wagner, G., Mourocq, E., and Griesser, M. (2015). Family northern bottlenose whales, Hyperoodon ampullatus: not driven by deep-water living: an overlooked but pivotal social system to understand the evolution of foraging? Anim. Behav. 62, 369–377. doi: 10.1006/anbe.2001.1756 cooperativebreeding. Behav. Ecol. 26, 805–811. doi: 10.1093/beheco/arv015 Grafen, A. (1982). How not to measure inclusive fitness. Nature 298, 425–426. Duchene, D., Klanten, S. O., Munday, P. L., Herler, J., and van Herwerden, doi: 10.1038/298425a0 L. (2013). Phylogenetic evidence for recent diversification of obligate coral- Grimes, L. (1976). The occurrence of cooperative breeding behaviour in African dwelling gobies compared with their host corals. Mol. Phylogenet. Evol. 69, 123– birds. Ostrich 47, 1–15. doi: 10.1080/00306525.1976.9639530 132. doi: 10.1016/j.ympev.2013.04.033 Groenewoud, F., Frommen, J. G., Josi, D., Tanaka, H., Jungwirth, A., and Duffield, G. A., and Bull, C. M. (2002). Stable social aggregations in an Taborsky, M. (2016). Predation risk drives social complexity in cooperative Australian lizard, Egernia stokesii. Naturwissenschaften 89, 424–427. doi: breeders. Proc. Natl. Acad. Sci. U.S.A. 113, 4104–4109. doi: 10.1073/pnas.15241 10.1007/s00114-002-0346-7 78113 Duffy, J. E., and Macdonald, K. S. (2010). Kin structure, ecology and the evolution Grueter, C. C., Chapais, B., and Zinner, D. (2012). Evolution of multilevel social of social organization in shrimp: a comparative analysis. Proc. R. Soc. B Biol. Sci. 277, systems in nonhuman primates and humans. Int. J. Primatol. 33, 1002–1037. doi: 575–584. doi: 10.1098/rspb.2009.1483 10.1007/s10764-012-9618-z Duftner, N., Sefc, K. M., Koblmüller, S., Salzburger, W., Taborsky, M., and Hamilton, W. D. (1964). The genetical evolution of social behaviour. II. J. Theor. Sturmbauer, C. (2007). Parallel evolution of facial stripe patterns in the Biol. 7, 17–52. doi: 10.1016/0022-5193(64)90039-6 Neolamprologus brichardi/pulcher species complex endemic to Lake Tanganyika. Hatchwell, B. J., and Komdeur, J. (2000). Ecological constraints, life history Mol. Phylogenet. Evol. 45, 706–715. doi: 10.1016/j.ympev. 2007.08.001 traits and the evolution of cooperative breeding. Anim. Behav. 59, 1079–1086. doi: Du Plessis, M. A., Siegfried, W. R., and Armstrong, A. J. (1995). Ecological and 10.1006/anbe.2000.1394 life-history correlates af cooperative breeding in south-african birds. Oecologia 102, Hayes, L. D. (2000). To nest communally or not to nest communally: a review 180–188. doi: 10.1007/BF00333250 of rodent communal nesting and nursing. Anim. Behav. 59, 677–688. doi: Ebensperger, L. A. (2001). A review of the evolutionary causes of rodent group- 10.1006/anbe.1999.1390 living. ActaTheriol.46,115–144. doi:10.4098/AT.arch.01-16 Heg, D., Bachar, Z., Brouwer, L., and Taborsky, M. (2004a). Predation risk is an Eberle, M., and Kappeler, P. M. (2006). Family insurance: kin selection and ecological constraint for helper dispersal in a cooperatively breeding cichlid. Proc. cooperative breeding in a solitary primate (Microcebus murinus). Behav. Ecol. R. Soc. BBiol. Sci.271, 2367–2374.doi:10.1098/rspb.2004.2855 Sociobiol. 60, 582–588. doi: 10.1007/s00265-006-0203-3 Heg, D., Bender, N., and Hamilton, I. (2004b). Strategic growth decisions in Eden, S. F. (1987). When do helpers help? Food availability and helping in helper cichlids. Proc. R. Soc. B Biol. Sci. 27(Suppl. 6), S505–S508. doi: the moorhen, Gallinula chloropus. Behav. Ecol. Sociobiol. 21, 191–195. doi: 10.1098/rsbl.2004.0232 10.1007/BF00303210 Heg, D., Brouwer, L., Bachar, Z., and Taborsky, M. (2005). Large group size yields Edwards, S. V., and Naeem, S. (1993). The phylogenetic component of cooperative group stability in the cooperatively breeding cichlid Neolamprologus pulcher. breeding in perching birds. Am. Nat. 141, 754–789. doi: 10.1086/285504 Behaviour 142, 1615–1641. doi: 10.1163/156853905774831891 Elgar, M. A. (2015). Challenges for social evolution: integrating insights across Heg, D., Heg-Bachar, Z., Brouwer, L., and Taborsky, M. (2008). Experimentally diverse taxa. Front. Ecol. Evol. 3:124. doi: 10.3389/fevo.2015.00124 induced helper dispersal in colonially breeding cooperative cichlids. Environ. Biol. Emlen, S. T. (1982a). The evolution of helping 1. An ecological constraints model. Fishes 83, 191–206. doi: 10.1007/s10641-007-9317-3 Am. Nat.119, 29–39. doi:10.1086/283888 Heg, D., Rothenberger, S., and Schurch, R. (2011). Habitat saturation, benefits of Emlen, S. T. (1982b). The evolution of helping. II. The role of behavioral conflict. philopatry, relatedness, and the extent of co-operative breeding in a cichlid. Am. Nat.119, 40–53. doi:10.1086/283889 Behav. Ecol. 22, 82–92. doi: 10.1093/beheco/arq170 Emlen, S. T. (1994). Benefits, constraints and the evolution of the family. Trends Heg, D., and Taborsky, M. (2010). Helper response to experimentally manipulated Ecol. Evol. 9, 282–285. doi: 10.1016/0169-5347(94)90030-2 predation risk in the cooperatively breeding cichlid Neolamprologus pulcher. PLoS Emlen, S. T., Reeve, H. K., Sherman, P. W., Wrege, P. H., Ratnieks, F. L. W., and ONE 5:e10784. doi: 10.1371/journal.pone.0010784 Shellmanreeve, J. (1991). Adaptiveversusnonadaptiveexplanations of behavior Herler, J., Koblmuller, S., and Sturmbauer, C. (2009). Phylogenetic relationships - the case of alloparental helping. Am. Nat. 138, 259–270. doi: 10.1086/285216 of coral-associated gobies (Teleostei, Gobiidae) from the Red Sea based on Faulkes, C. G., and Bennett, N. C. (2013). Plasticity and constraints on social mitochondrial DNA data. Mar. Biol. 156, 725–739. doi: 10.1007/s00227-008- evolution in African mole-rats: ultimate and proximate factors. Philos. Trans. R. 1124-7 Soc. B Biol. Sci. 368:20120347. doi: 10.1098/rstb.2012.0347 Herler, J., Munday, P. L., and Hernaman, V. (2011). “Gobies on coral reefs,” in Faulkes, C. G., Bennett, N. C., Bruford, M. W., Obrien, H. P., Aguilar, The Biology of Gobies, eds R. A. Patzner, J. L. Van Tassel, M. Kovacˇic´, and B. G. G. H., and Jarvis, J. U. M. (1997). Ecological constraints drive social evolution in Kapoor (Jersey; Enfield, NH: Science Publishers), 493–529. the African mole-rats. Proc. R. Soc. B Biol. Sci. 264, 1619–1627. doi: Hodge, S. J. (2005). Helpers benefit offspring in both the short and long-term in 10.1098/rspb.1997.0226 the cooperatively breeding banded mongoose. Proc. R. Soc. B Biol. Sci. 272, 2479– Felsenstein, J. (1985). Phylogenies and the comparative method. Am. Nat. 125, 1– 2484. doi: 10.1098/rspb.2005.3255 15. doi: 10.1086/284325 Hughes, W. O. H., Oldroyd, B. P., Beekman, M., and Ratnieks, F. L. W. (2008). Ford, H. A., Bell, H., Nias, R., and Noske, R. (1988). The relationship between Ancestral monogamy shows kin selection is key to the evolution of eusociality. ecology and the incidence of cooperative breeding in australian birds. Behav. Ecol. Science 320, 1213–1216. doi: 10.1126/science.1156108 Sociobiol. 22, 239–249. doi: 10.1007/BF00299838 Jetz, W., and Rubenstein, D. R. (2011). Environmental uncertainty and the global Freckleton, R. P., Harvey, P. H., and Pagel, M. (2002). Phylogenetic analysis biogeography of cooperative breeding in birds (vol 21, pg 72, 2011). Curr. Biol. 21, and comparative data: a test and review of evidence. Am. Nat. 160, 712–726. doi: 438–438. doi: 10.1016/j.cub.2011.02.025 10.1086/343873 Johnson, D. D. P., Jetz, W., and Macdonald, D. W. (2002). Environmental Gardner, J. L., Magrath, R. D., and Kokko, H. (2003). Stepping stones of life: correlates of badger social spacing across Europe. J. Biogeogr. 29, 411–425. doi: natal dispersal in the group-living but noncooperative speckled warbler. Anim. 10.1046/j.1365-2699.2002.00680.x Behav. 66, 521–530. doi: 10.1006/anbe.2003.2206 Johnson, J. S., Kropczynski, J. N., and Lacki, M. J. (2013). Social network analysis and the study of sociality in bats. Acta Chiropterol. 15, 1–17. doi: 10.3161/150811013X667821

Frontiers in Ecology and Evolution | www.frontiersin.org 17 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

Johnstone, R. A. (2000). Models of reproductive skew: a review and synthesis. Mitchell, J. (2005). Queue selection and switching by false clown anernonefish, Ethology 106, 5–26. doi: 10.1046/j.1439-0310.2000.00529.x Amphiprion ocellaris. Anim. Behav. 69, 643–652. doi: 10.1016/j.anbehav. Jungwirth, A., Walker, J., and Taborsky, M. (2015). Prospecting precedes dispersal 2004.05.017 and increases survival chances in cooperatively breeding cichlids. Anim. Behav. 106, Munday, P. L., Caley, M. J., and Jones, G. P. (1998). Bi-directional sex change 107–114. doi: 10.1016/j.anbehav.2015.05.005 in a coral-dwelling goby. Behav. Ecol. Sociobiol. 43, 371–377. doi: Kent, D. S., and Simpson, J. A. (1992). Eusociality in the beetle Austroplatypus 10.1007/s002650050504 incompertus (Coleoptera: Curculionidae). Naturwissenschaften 79, 86–87. doi: Munday, P. L., and Jones, G. P. (1998). The ecological implications of small body 10.1007/BF01131810 sizeamongcoral-reeffishes. Oceanogr. Mar. Biol. 36, 373–411. Kingma, S. A., Santema, P., Taborsky, M., and Komdeur, J. (2014). Group Nakashima, Y., Kuwamura, T., and Yogo, Y. (1996). Both-ways sex change in augmentation and the evolution of cooperation. Trends Ecol. Evol. 29, 476–484. doi: monogamous coral gobies, Gobiodon spp. Environ. Biol. Fishes 46, 281–288. doi: 10.1016/j.tree.2014.05.013 10.1007/BF00005004 Kleiman, D. G. (2011). Canid mating systems, social behavior, parental care Nam, K. B., Simeoni, M., Sharp, S. P., and Hatchwell, B. J. (2010). Kinship affects and ontogeny: are they flexible? Behav. Genet. 41, 803–809. doi: 10.1007/s10519- investment by helpers in a cooperatively breeding bird. Proc. R. Soc. B Biol. Sci. 277, 011-9459-0 3299–3306. doi: 10.1098/rspb.2010.0737 Koenig, W. D., Pitelka, F. A., Carmen, W. J., Mumme, R. L., and Stanback, M. T. Nandi, A. K., Bhadra, A., Sumana, A., Deshpande, S. A., and Gadagkar, R. (2013). (1992). The evolution of delayed dispersal in cooperative breeders. Q. Rev. Biol. 67, The evolution of complexity in social organization-A model using dominance- 111–150. doi: 10.1086/417552 subordinate behavior in two social wasp species. J. Theor. Biol. 327, 34–44. doi: Kokko, H., and Ekman, J. (2002). Delayed dispersal as a route to breeding: 10.1016/j.jtbi.2013.01.010 territorial inheritance, safe havens, and ecological constraints. Am. Nat. 160, 468– Oli, M. K., and Armitage, K. B. (2003). Sociality and individual fitness in yellow- 484. doi: 10.1086/342074 bellied marmots: insights from a long-term study (1962-2001). Oecologia 136, 543– Kokko, H., Johnstone, R. A., and Clutton-Brock, T. H. (2001). The evolution of 550. doi: 10.1007/s00442-003-1291-7 cooperative breeding through group augmentation. Proc. R. Soc. B Biol. Sci. 268, 187– Pagel, M. (1999). Inferring the historical patterns of biological evolution. Nature 196. doi: 10.1098/rspb.2000.1349 401, 877–884. doi: 10.1038/44766 Kokko, H., Johnstone, R. A., and Wright, J. (2002). The evolution of parental and Pagel, M. D., and Harvey, P. H. (1988). Recent developments in the analysis of alloparental effort in cooperatively breeding groups: when should helpers pay to comparativedata. Q. Rev. Biol. 63, 413–440. doi: 10.1086/416027 stay? Behav. Ecol. 13, 291–300. doi:10.1093/beheco/13.3.291 Pen, I., and Weissing, F. J. (2000). Towards a unified theory of cooperative Komdeur, J. (1992). Importance of habitat saturation and territory quality for breeding: the role of ecology and life history re-examined. Proc. R. Soc. B Biol. Sci. evolution of cooperative breeding in the seychelles warbler. Nature 358, 493–495. 267, 2411–2418. doi: 10.1098/rspb.2000.1299 doi: 10.1038/358493a0 Purcell, J. (2011). Geographic patterns in the distribution of social systems in Legge, S. (2000). Helper contributions in the cooperatively breeding laughing terrestrial arthropods. Biol. Rev. 86, 475–491. doi: 10.1111/j.1469-185X. kookaburra: feeding young is no laughing matter. Anim. Behav. 59, 1009–1018. doi: 2010.00156.x 10.1006/anbe.2000.1382 Quiñones, A. E., Van Doorn, G. S., Pen, I., Weissing, F. J., and Taborsky, Le Vin, A. L., Mable, B. K., Taborsky, M., Heg, D., and Arnold, K. E. (2011). M. (2016). Negotiation and appeasement can be more effective drivers of Individual variation in helping in a cooperative breeder: relatedness versus sociality than kin selection. Philos. Trans. R. Soc. B Biol. Sci. 371:20150089. doi: behavioural type. Anim. Behav. 82, 467–477. doi: 10.1016/j.anbehav. 2011.05.021 10.1098/rstb.2015.0089 Ligon, J. D., and Ligon, S. H. (1978). The communal social system of the green Reeve, H. K., and Ratnieks, F. L. W. (1993). Queen-Queen Conflicts in Polygynous woodhoopoe in Kenya. Living Bird 17, 159–197. Societies: Mutual Tolerance and Reproductive Skew. Queen Number and Sociality Ligon, J. D., and Ligon, S. H. (1990). “Green woodhoopoes: life history traits and in Insects. Oxford Oxford: University Press, 45–85. sociality,” in Cooperative Breeding in Birds, eds P. B. Stacey and W. D. Koenig Ricklefs, R. E. (1975). Evolution of cooperative breeding in birds. Ibis 117, 531–534. (Cambridge, UK: Cambridge University Press), 31–66. doi: 10.1111/j.1474-919X.1975.tb04252.x Ligon, J. D., Ligon, S. H., and Ford, H. A. (1991). An experimental- study Ridley, A. R., and van den Heuvel, I. M. (2012). Is there a difference in of the bases of male philopatry in the cooperatively breeding superb fairy- reproductive performance between cooperative and non-cooperative species? A wren Malurus cyaneus. Ethology 87, 134–148. doi: 10.1111/j.1439- southern African comparison. Behaviour 149, 821–848. doi: 10.1163/1568539X- 0310.1991.tb01195.x 00003005 Lubin, Y., and Bilde, T. (2007). The evolution of sociality in spiders. Adv. Study Riechert, S. E., and Jones, T. C. (2008). Phenotypic variation in the social behaviour Behav. 37, 83–145. doi: 10.1016/S0065-3454(07)37003-4 of the spider Anelosimus studiosus along a latitudinal gradient. Anim. Behav. 75, Lucia, K. E., Keane, B., Hayes, L. D., Lin, Y. K., Schaefer, R. L., and Solomon, N. 1893–1902. doi: 10.1016/j.anbehav.2007.10.033 G. (2008). Philopatry in prairie voles: an evaluation of the habitat saturation Riehl, C. (2013). Evolutionary routes to non-kin cooperative breeding in birds. hypothesis. Behav. Ecol. 19, 774–783. doi: 10.1093/beheco/arn028 Proc. R. Soc. BBiol. Sci. 280:7. doi:10.1098/rspb.2013.2245 Lukas, D., and Clutton-Brock, T. (2012). Life histories and the evolution of Riehl, C., and Strong, M. J. (2015). Social living without kin discrimination: cooperative breeding in mammals. Proc. R. Soc. B Biol. Sci. 279, 4065–4070. doi: experimental evidence from a communally breeding bird. Behav. Ecol. Sociobiol. 69, 1293–1299. doi: 10.1007/s00265-015-1942-9 10.1098/rspb.2012.1433 Lynch, M., and Ritland, K. (1999). Estimation of pairwise relatedness with Rood, J. P. (1983). “The social system of the dwarf mongoose,” in Advances in molecularmarkers. Genetics, 152, 1753–1766. the Study of Mammalian Behavior, eds J. F. Eisenberg and D. G. Kleiman Manning, C. J., Dewsbury, D. A., Wakeland, E. K., and Potts, W. K. (1995). (Shippensburg, PA: American Societyof Mammalogists), 454–488. Communal nesting and communal nursing in house mice, Mus-Musculus Rood, J. P. (1987). “Dispersal and intergroup transfer in the dwarf mongoose,” in Mammalian Dispersal Patterns: The Effects of Social Structure on Population Domesticus. Anim. Behav. 50, 741–751. doi: 10.1016/0003-3472(95)80134-0 Margraf, N., and Cockburn, A. (2013). Helping behaviour and parental care in Genetics, eds B. D. Chepko-Sade and Z. T. Halpin (Chicago: University of ChicagoPress), 85–103. fairy-wrens(Malurus). Emu113,294–301. doi:10.1071/MU13001 Marino, J., Sillero-Zubiri, C., Johnson, P. J., and Macdonald, D. W. (2012). Rood, J. P. (1990). Group-size, survival, reproduction, and routes to breeding in Ecological bases of philopatry and cooperation in Ethiopian wolves. Behav. Ecol. dwarf mongooses. Anim. Behav. 39, 566–572. doi: 10.1016/S0003- Sociobiol. 66, 1005–1015. doi: 10.1007/s00265-012-1348-x 3472(05)80423-3 McCallum, D. A. (1988). Alternative Emigration Strategies and the Adaptive Rowley, I. (1968). Communal species of Australian birds. Bonn. Zool. Betr, 19, 362–368. Significance of Natal Dispersal in a Population of Mountain Chickadees (Parus gambeli). Ph.D., dissertation, University of New Mexico, Albuquerque. Rowley, I., and Russell, E. (1990). “Splendid fairy-wrens: demonstrating the importance of longevity,” in Cooperative Breeding in Birds: Long-Term Studies of McLaren, I. A. (1967). Seals and group selection. Ecology 48, 104–110. doi: 10.2307/1933422 Ecology And Behavior, ed P. K. Stacey (Cambridge: Cambridge University Press), 3–30.

Frontiers in Ecology and Evolution | www.frontiersin.org 18 August 2017 | Volume 5 | Article 100 Hing et al. Methodological Approaches to Study Sociality

Rubenstein, D. R. (2011). Spatiotemporal environmental variation, risk Waser, P. M., Creel, S. R., and Lucas, J. R. (1994). Death and aversion, and the evolution of cooperative breeding as a bet-hedging disappearance - estimating mortality risks associated with philopatry and strategy. Proc. Natl. Acad. Sci. U.S.A. 108, 10816–10822. doi: dispersal. Behav. Ecol. 5, 135–141. doi: 10.1093/beheco/5.2.135 10.1073/pnas.1100303108 Weinman, L. R., Solomon, J. W., and Rubenstein, D. R. (2015). A Rubenstein, D. R., and Lovette, I. J. (2007). Temporal environmental comparison of single nucleotide polymorphism and microsatellite variability drives the evolution of cooperative breeding in birds. Curr. Biol. markers for analysis of parentage and kinship in a cooperatively 17, 1414–1419. doi: 10.1016/j.cub.2007.07.032 breeding bird. Mol. Ecol. Resour. 15, 502–511. doi: 10.1111/1755- Schradin, C., and Pillay, N. (2005). Intraspecific variation in the spatial 0998.12330 and social organization of the African striped mouse. J. Mammal. 86, 99– Wolff, J. O. (1997). Population regulation in mammals: an evolutionary 107. doi: 10. 1644/1545-1542(2005)086<0099:IVITSA>2.0.CO;2 perspective. J. Anim.l Ecol. 66, 1–13. doi:10.2307/5959 Selander, R. K. (1964). Speciation in Wrens of the genus Campylorhynchus. Wong, M., and Balshine, S. (2011). The evolution of cooperative Berkeley, CA: Universityof California Publications in Zoology. breeding in the African cichlid fish, Neolamprologus pulcher. Biol. Servedio, M. R., Price, T. D., and Lande, R. (2013). Evolution of displays Rev. 86, 511–530. doi: 10.1111/j.1469-185X.2010.00158.x within the pair bond. Proc. R. Soc. B Biol. Sci. 280:1757. doi: Wong, M. Y. L. (2010). Ecological constraints and benefits of philopatry 10.1098/rspb.2012.3020 promote group-living in a social but non-cooperatively breeding fish. Solomon, N. G. (2003). A reexamination of factors influencing Proc. R. Soc. BBiol. Sci. 277, 353–358. doi: 10.1098/rspb.2009.1453 philopatry in rodents. J. Mammal. 84, 1182–1197. doi:10.1644/BLe-013 Wong, M. Y. L. (2011). Group size in animal societies: the potential role Sorato, E., Gullett, P. R., Griffith, S. C., and Russell, A. F. of social and ecological limitations in the group-living fish, (2012). Effects of predation risk on foraging behaviour and group Paragobiodon xanthosomus. Ethology 117, 638–644. doi: 10.1111/j.1439- size: adaptations in a social cooperative species. Anim. Behav. 84, 823– 0310.2011.01913.x 834. doi: 10.1016/j.anbehav.2012.07.003 Wong, M. Y. L., and Buston, P. M. (2013). Social systems in habitat- Spinks, A. C., Jarvis, J. U. M., and Bennett, N. C. (2000). specialist reef fishes: key concepts in evolutionary ecology. Comparative patterns of philopatry and dispersal in two common mole- Bioscience 63, 453–463. doi: 10.1525/bio.2013.63.6.7 rat populations: implications for the evolution of mole-rat sociality. J. Wong, M. Y. L., Buston, P. M., Munday, P. L., and Jones, G. P. (2007). Anim. Ecol. 69, 224–234. doi: 10.1046/j.1365-2656.2000.00388.x The threat of punishment enforces peaceful cooperation and stabilizes Stacey, P. (1979a). Kinship, promiscuity, and communal breeding in queues in a coral-reef fish. Proc. R. Soc. BBiol. Scie. 274, 1093–1099. doi: the acorn woodpecker. Behav. Ecol. Sociobiol. 6, 53–66. doi: 10.1098/rspb.2006.0284 10.1007/BF00293245 Wong, M. Y. L., Jordan, L. A., Marsh-Rollo, S., St-Cyr, S., Stacey, P. B. (1979b). Habitat saturation and communal breeding in Reynolds, J. O., Stiver, K. A., et al. (2012). Mating systems in the acorn woodpecker. Anim. Behav. 27, 1153–1166. doi: 10.1016/0003- cooperative breeders: the roles of resource dispersion and conflict 3472(79)90063-0 Stacey, P. B., and Ligon, J. D. (1987). Territory quality mitigation. Behav. Ecol. 23, 521–530. doi: 10.1093/beheco/arr218 and dispersal options in the acorn woodpecker, and a challenge Wong, M. Y. L., Munday, P. L., Buston, P. M., and Jones, G. P. (2008a). to the habitat-saturation model of Monogamy when there is potential for polygyny: tests of multiple cooperativebreeding. Am. Nat. 130, 654–676. doi: 10.1086/284737 hypotheses in a group- living fish. Behav. Ecol. 19, 353–361. doi: Stacey, P. B., and Ligon, J. D. (1991). The benefits-of-philopatry 10.1093/beheco/arm141 hypothesis for the evolution of cooperative breeding - variation in territory Wong, M. Y. L., Munday, P. L., Buston, P. M., and Jones, G. R. quality and group-size effects.Am.Nat.137, 831–846.doi:10.1086/285196 (2008b). Fasting or feasting in a fish social hierarchy. Curr. Biol. Stiver, K. A., Dierkes, P., Taborsky, M., Gibbs, H. L., and Balshine, S. 18, R372–R373. doi: 10.1016/j.cub.2008.02.063 (2005). Relatedness and helping in fish: examining the theoretical Wong, M. Y. L., Munday, P. L., and Jones, G. P. (2005). Habitat predictions. Proc. R. Soc. B Biol. Sci. 272, 1593–1599. doi: patch size, facultative monogamy and sex change in a coral-dwelling 10.1098/rspb.2005.3123 fish, Caracanthus unipinna. Environ. Biol. Fishes 74, 141–150. doi: Szathmáry, E., and Smith, J. M. (1995). The major evolutionary transitions. 10.1007/s10641-005-6715-2 Nature Woolfenden, G. E. (1975). Florida scrub jay helpers at the nest. Auk 374, 227–232. doi: 10.1038/374227a0 92, 1–15. doi: 10.2307/4084414 Taborsky, M. (1984). Broodcare helpers in the cichlid fish Lamprologus Wright, J., Parker, P. G., and Lundy, K. J. (1999). Relatedness and brichardi: their costs and benefits. Anim. Behav. 32, 1236– chick-feeding effort in the cooperativelybreeding Arabian babbler. Anim. 1252. doi: 10.1016/S0003-3472(84)80241-9 Behav. 58, 779–785. doi: 10.1006/anbe.1999.1204 Taborsky, M. (2016). “Cichlid fishes: a model for the integrative study of Zöttl, M., Heg, D., Chervet, N., and Taborsky, M. (2013). Kinship social behavior,” in Cooperative Breedingin Vertebrates: Studies of Ecology, reduces alloparental care in cooperative cichlids where helpers pay-to- Evolution and Behavior, eds W. D. Koenig and J. L. Dickinson (Cambridge: Cambridge UniversityPress), 354–389. stay. Nat. Commun. 4:1341. doi: 10.1038/ncomms2344 Taborsky, M., and Wong, M. (2017). “Sociality in fishes,” in Comparative Social Evolution, eds D. I. Rubenstein and P. Abbot Conflict of Interest Statement: The authors declare that the research (Cambridge: Cambridge UniversityPress). was conducted in the absence of any commercial or financial Tewksbury, J. J., Huey, R. B., and Deutsch, C. A. (2008). Ecology - putting relationships that could be construed as a potential conflict of interest. the heat on tropical animals. Science 320, 1296–1297. doi: 10.1126/science.1159328 Thacker, C. E., and Roje, D. M. (2011). Copyright © 2017 Hing, Klanten, Dowton and Wong. This is an open- Phylogeny of Gobiidae and identification access article distributed under the terms of the Creative Commons of gobiid lineages. System. Biodivers. 9, 329–347. doi: Attribution License (CC BY). The use, distribution or reproduction in 10.1080/14772000. 2011.629011 other forums is permitted, provided the original author(s) or licensor Van De Casteele, T., Galbusera, P., and Matthysen, E. (2001). A are credited and that the original publication in this journal is cited, in comparison of microsatellite-based pairwise relatedness estimators. Mol. accordance with accepted academic practice. No use, distribution or Ecol. 10, 1539–1549. doi: 10.1046/j.1365-294X.2001.01288.x reproduction is permitted whichdoesnot complywiththeseterms.

Frontiers in Ecology and Evolution | www.frontiersin.org 19 August 2017 | Volume 5 | Article 100

Hing et al. Methodological Approaches to Study Sociality

RESEARCHARTICLE Repeated cyclone events reveal potential causesofsocialityincoral-dwellingGobiodon fishes

Martin L. Hing1*, O. Selma Klanten2, Mark Dowton3, Kylie R. Brown4, Marian Y. L. Wong1

1 Centre for Sustainable Ecosystems Solutions, School of Biological Sciences, University of Wollongong, Wollongong, Australia, 2 Fish Ecology Laboratory, School of Life Sciences, University of Technology Sydney, Sydney, Australia, 3 Centre for Medical and Molecular Bioscience, School of Biological Sciences, University of Wollongong, Wollongong, Australia, 4 Independent Researcher, Sanctuary Point, NSW, Australia

* [email protected]

Abstract

Social organization is a key factor influencing a V S H FfoLrHagVing¶ and reproduction, which may ultimately affect their survival and ability to recover from catastrophic disturbance. Severe weather events such as cyclones can have devastating impacts to the physical OPEN ACCESS structure of coral reefs and on the abundance and distribution of its faunal communities.

Citation:HingML,KlantenOS,DowtonM,Brown Despite the importance of social organization to a V S H FsLurHvivVa¶l, relatively little is known KR, WongMYL(2018)Repeatedcycloneevents about how major disturbances such as tropical cyclones may affect social structures or how revealpotentialcausesofsocialityincoral-dwelling different social strategies affect a V S H FaLbHilityVto¶ cope with disturbance. We sampled Gobiodonfishes. PLoSONE 13(9): e0202407. group sizes and coral sizes of group-forming and pair-forming species of the Gobiid genus https://doi.org/10.1371/journal.pone.0202407 Gobiodon at Lizard Island, Great Barrier Reef, Australia, before and after two successive Editor:HeatherM.Patterson,Departmentof category 4 tropical cyclones. Group sizes of group-forming species decreased after each Agriculture and Water Resources, AUSTRALIA cyclone, but showed signs of recovery four months after the first cyclone. A similar increase in Received: December 15, 2017 group sizes was not evident in group-forming species after the second cyclone. There was no Accepted: July 10, 2018 change in mean pair-forming group size after either cyclone. Coral sizes inhabited by both Published:September 5, 2018 group- and pair-forming species decreased throughout the study, meaning that group-

Copyright:©2018Hingetal.Thisisanopen forming species were forced to occupy smaller corals on average than before cyclone activity. accessarticledistributed under theterms of the This may reduce their capacity to maintain larger group sizes through multiple processes. Creative CommonsAttribution License, which We discuss these patterns in light of two non-exclusive hypotheses regarding the drivers of permitsunrestricteduse, distribution, and sociality in Gobiodon, suggesting that benefits of philopatry with regards to habitat quality reproductioninanymedium,providedtheoriginal author and source are credited. may underpin the formation of social groups in this genus.

Data Availability Statement: All relevant data are withinthe paper anditsSupportingInformation files.

Funding: This research has been conducted with thesupportoftheHermonSladeFoundation (HSF13/8toM.Y.L.W.)andtheAustralian GovernmentResearchTrainingProgram Introduction Scholarship.Thefundershadnoroleinstudy design,datacollectionandanalysis,decisionto Social organization is an important determinant of a species’ survival [1], foraging efficiency publish,orpreparationofthemanuscript. [2] and ability to reproduce successfully [3], factors which ultimately affect their potential to Competinginterests:Theauthorshavedeclared recover from disturbances. Social structures may be as simple as monogamous pairing or as thatnocompetinginterestsexist. complex as a eusocial colony with division of labour and non-reproductive castes. Social

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 1 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes organization may be influenced by broad ecological [4] or life-history factors [5], within- group social interactions [6] or genetic relatedness [7] and even individual variation in physiology [8], neurophysiology and genetics [9]. Each social structure provides benefits to its constituents, but often at a cost to their reproduction or access to some other resource [10–12].That is to say, there are trade-offs associated with different social structures that individuals must consider. Group living is thought to have evolved in many lineages as a response to genetic (kinship) and environmental factors [10–12]. With respect to environmental factors, many hypothesespoint toward variability in ecological factors as influencing the evolution of sociality [4, 13]. Hypotheses such as the benefits of philopatry [14–16] and ecological constraints models [4, 16–19] examine the idea that ecological factors, such as habitat quality (e.g. habitat size, resource availability, defence) or the availability of suitable breeding territory (respectively), influence the decision of subordinates to either disperse from their habitat or remain within agroup. These two hypotheses are often viewed as two sides of the same coin as they both look at aspects of ecology to explain social evolution and maintenance [20]. The benefits of philopatry hypothesis focuses on the benefits conferred from residing in a high-quality habitat (e.g. inheritance of breeding status [21], increased fitness [22]). High-quality habitat is typically colonized rapidly [13]. An individual living on low-quality habitat may therefore increase its fitness by moving to a high-quality habitat as a subordinate [13]. However, this benefit must be traded off against the associated costs (e.g. delayed reproduction, risk of movement). In contrast, the ecological constraints hypothesis concentrates on factors of ecology that may restrict subordinate individuals already residing in a group from dispersing (e.g. habitat satu-ration [23], predation risk [24]). These two hypotheses are not mutually exclusive and often operate alongside other effects (e.g. kinship, life-history). However, the question of which combination of effects best describes social group formation and maintenance is still of interest as each one emphasizes different costs and benefits [25]. While these hypotheses have been well studied in terrestrial organisms, they have only recently been tested in marine environments [20, 26–28]. Of the marine taxa tested so far, habitat-specialist coral-reef fishes are emerging as a useful model species to study theories of social evolution and maintenance [20, 27, 28] and have shown similar responses to habitat manipulation as terrestrial species (e.g. [23]). Many social fishes have a pelagic larval phase which suggests low levels of kinship within groups, reducing the potential confounding factor of relatedness (e.g. [20, 29, 30] but see [31]). Given the apparent influence of ecological factors on the formation and maintenance of social groups, we would expect that disturbances capable of altering a species’ habitat, such as severe weather events, would have a strong impact on social organization [23, 32]. Many species of coral-reef fishes, especially habitat-specialists, can be found in social groups [33, 34–36]. The size of these social groups is often related directly or indirectly to the size of the habitat in which they reside [36–39]. Complex social structures such as size-based dominance hierarchies, in which the largest dominants breed and smaller subordinates are reproductively suppressed, have been documented in these groups [23, 38]. Further, they are known to exhibit sequential hermaphroditism or bi-directional sex-change [38, 40, 41]. In such systems, the loss of a breeding individual results in the next subordinate in the queue taking itsplace [6]. This social organization may provide a level of redundancy which could help a social species recover quickly following a major disturbance. For example, Rubenstein [42] argued that cooperative breeding could be a bet hedging strategy in variable environments as it may buffer variance in fecundity between years. Duffy and Macdonald [26] also found that eusociality conferred advantages to sponge-dwelling shrimps allowing them to occupy a greater

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 2 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes number of host sponge species and more sponges overall than less social sister species. This finding, combined with research on host specialization and extinction by Munday [43], couldimply that more social species face lower extinction risk following a disturbance because their sociality allows them to monopolize a greater host range. However, Courchamp et al. [44] found that obligate cooperative breeders were more at risk of group extinction because of their reliance on subordinates to reproduce and survive. These studies show that while complex social structures may provide advantages allowing species to survive a severe disturbance and to re-colonize afterwards, they may also result in localized extinctions. Further research into the effects of ecological disturbance on social organization and how varying social systems, such as pair- or group-forming, are able to cope with disturbance are clearly required. Extreme climatic events such as tropical cyclones are known to have devastating impacts on the physical structure of coral reefs [45–48]. The effects on fish and invertebrate communities which depend on the coral structure for food and shelter are likewise devastating [45, 49–51]. The destructive forces of cyclones can have a strong influence on the re-distribution of species and their relative abundances following the event [52]. However, relatively little is known about the impacts that cyclones may have on the social organization of coral- reef inhabitants and whether social organization may mediate disturbance-induced population trends in species with different social structures. Given the importance of social organization for factors such as reproduction [3], foraging efficiency [2] and ultimately the ability to recover from a major disturbance, it is plausible that destructive events such as tropical cyclones may have a detectable effect on a species’ social organization. We evaluated the effects of cyclones on the social organization of coral gobies of the genus Gobiodon. These species are small (3–4 cm) microbenthic [36] habitat-specialist fishes that live within the structures of branching and plate-forming acroporid and pocilloporid corals [53, 54]. These fishes are highly site attached once settled, but have been shown to move between corals [41]. Gobiodon spp. display a wide variety of social phenotypes from pair-forming (PF) species to group-forming (GF) species that typically live in groups ranging from 3 to 12 individuals [55]. Social groups usually consist of two breeding individuals and one or more non- breeding subordinates which form a size-based hierarchy and queue for a breeding position.However there is some evidence to support multiple breeding individuals in larger group sizes for some species [55]. In this study, we investigated how extreme climatic events influence the social organization of colonies of Gobiodon fishes and discuss how these effects may impact their survival. Opportu-nistic investigations of such disturbances (extreme climatic events) are important for theory development as they can test well developed theory under extreme conditions [56]. Specifically, weexamined the effects of two successive category 4 cyclones that impacted the Great Barrier Reef, on the group size (social structure) and coral size (ecological factor) of GF and PF species of Gobiodon. As habitat patch size is known to be related to mean group size in some species, smaller corals should be less capable of supporting larger groups [55]. Therefore, we expected that physical damage caused by the cyclones would result in smaller corals, and that as coral size decreased, sotoo would mean group size of both GF and PF coral gobies. We also expected that advantagesconferred from sociality would help GF species to recover from these disturbances [26, 43]. Additionally, we used the occurrence of these cyclones as a ‘natural experiment’ to examine the related effects of ecological constraints and benefits of philopatry on the formation of social groups in the GF species. Munday [57] demonstrated that coexistence between two species of Gobiodon occurred through a competitive lottery, meaning that whichever species colonized a particular coral was able to hold that territory. Our own observations show that while coralgobies do show distinct preferences for certain species of coral, they can and will colonize a wide range of species. It is therefore likely that Gobiodon species will colonize any available

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 3 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes habitat following a severe disturbance. If ecological constraints (lack of available habitat) were responsible for the formation of social groups, we would expect coral vacancy to be very low as gobies would preferentially colonize vacant habitat over residing as a subordinate in a group. That is, subordinates should disperse to seek independent breeding opportunities if there issuitable vacant habitat. In contrast, if benefits of philopatry were driving group living, we would expect greater coral vacancy as the GF species would vacate lower-quality corals in favor of taking up residence as a subordinate in higher-quality corals. While we do not fully understand what constitutes high- or low quality habitat in these species, we consider coral size to be a reasonable proxy of habitat quality as Kuwamura et al. [58] and Hobbs and Mun- day [59] demonstrated that growth, survival and reproductive success increased in larger habitats for other species of coral associated fishes.

Materials andmethods Ethics statement This research was conducted under research permits issued by the Great Barrier Reef Marine Park Authority (G13/36197.1 and G15/37533.1) and with the approval of the University of Wollongong Animal Ethics Committee (AE14-04).

Study area and survey sites The study took place at Lizard Island, Great Barrier Reef, Queensland, Australia (14˚ 40.729’ S, 145˚ 26.907’ E) (Fig 1) between 2014 and 2016. Twenty three sites were surveyed in total over four survey times, eleven of which were located within the sheltered lagoon. The remaining twelve sites were located on the fringing reefs around Lizard Island. As this study was designed to examine how sociality of Gobiodon spp. varied over successive impacts at Lizard Island as a whole, we did not assess variation in sociality at smaller spatial scales (e.g. sites). As such, survey sites were chosen to give reasonable coverage of the reefs at Lizard Island. Not all sites were assessed during each survey time as several sites were scoured down to bare rock after each cyclone. These sites were not surveyed as our interest was in the surviving goby colonies (see S1 Data for the range of sites covered at each survey time). The number of sites visited during each survey time was 15, 14, 11, 17 respectively. All measurements were made on scuba at depths ranging from less than one meter to five meters.

Cyclone activity and sampling periods Two cyclones impacted the study site in consecutive years. Cyclone Ita impacted Lizard Island in April 2014 as a category 4 system and cyclone Nathan in March 2015, also as a category 4 system. Both cyclones caused substantial damage to the fringing and lagoonal reefs including greatly reduced coral cover and associated changes in reef fish diversity and abundance [60– 63]. We conducted surveys on coral sizes and group sizes of 13 Gobiodon spp. during February and March 2014 (1 month prior to cyclone Ita), August and September 2014 (4 months aftercyclone Ita), January and February 2015 (1 month prior to cyclone Nathan and 9 months aftercyclone Ita) and January and February 2016 (10 months after cyclone Nathan) (Fig 2). These repeated surveys provided us with a broad overview of the effects that multiple disturbances had on the social organization of coral gobies.

Survey methods Two types of transects were deployed over the four surveys. For this study however, we did not attempt to assess any spatial patterns between sites. Transects were only used as a guide to

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 4 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

Fig 1. Map of the survey sites. Dotted light grey line is the outline of reef areas around Lizard Island. All study sites are indicated on map (regular font), specific reefs in the Lizard Island lagoon are numbered: Big Vickey’s Reef (1); Vickey’s Reef (2); Horse Shoe Reef (3); Palfrey Reef (4–4a); Loomis Reef(5); Trawler (6); Picnic Beach (7); Ghost Beach (8); Bird Island Reef(9); Entrance Bommie (10); Bird Bommie (11); Lizard Head Reef(12). https://doi.org/10.1371/journal.pone.0202407.g001

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 5 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

Fig 2. Timelineof datacollection. Timelineshows yearand month ofdata collection (fish, dashed black arrow) and cycloneactivity (cyclone, blue arrow). In total, data on group size, coral size and proportion of corals occupied were collected at 4 time points for 13 species of Gobiodon. https://doi.org/10.1371/journal.pone.0202407.g002 locate corals. Haphazardly placed 30 m line transects were used to locate corals one meter either side during the first and fourth survey times. Cross transects (two 4 m x 1 m belt tran-sects laid in a cross, designed to measure the community around a focal colony) were used during the first (Palfrey reef only; Fig 1, sites 4 and 4a), second, third and fourth survey times. Line transects were placed roughly parallel to each other and separated by at least 10 m and cross transects were placed at least 8 m (twice the length of the transect on either axis) from each other to ensure that any given coral was not measured twice during the survey period. As coral gobies show strong preferences for certain species of branching and plate forming (mostly) Acroporid corals [35, 53, 64], only these species of corals were counted on the transects. In total, 23 species of coralwere surveyed for goby occupancy (S1 Data). Each coral’s living part was measured along three axes (length (L) width (W) and height (H)) and the simpleaverage diameter calculated as (L + W + H)/3. Simple average diameter was used in this study (as opposed to geometric mean diameter (L x W x H)1/3) as it provides a better representationof the major axis of the coral [58]. All goby supporting corals occurring on the transects were measured and searched for gobies. The number of adult gobies living within each coral head was counted by visual inspection using a torch. Adults could be easily distinguished from juveniles by their distinct coloration and markings. While the number of juveniles (if present) was recorded for each coral, they were not included in the group size observations as juveniles had been observed moving between multiple corals during each survey (Hing pers. obs.). Addition- ally, juvenile abundance was extremely low during all surveys and there was no difference in abundance for either PF or GF species during any survey time (S2 Fig). In contrast, adults displayed remarkable coral-host fidelity, even tolerating extreme hypoxia and severe coral bleaching [65, 66]. The number of transects at each site varied depending on the size of the reef. The number of transects conducted at each site also varied from year to year depending on the perceived abundance of suitable corals for habitation, and ranged from 1 to 44 transects. In total, the number of transects placed around Lizard Island during each survey time was 56, 141, 109 and 140 for the February 2014, August 2014, January 2015 and January 2016 surveys respectively. The methods of measuring goby group sizes and coral sizes (described in detail below)

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 6 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes remained exactly the same regardless of the different number and size of transects that were used throughout the study. There was a significant difference in coral size measured between the two transect types, however this was most likely a site effect as line transects were used extensively on the fringing reefs in January 2016, after both cyclones. Corals at these sites sustained heavy damage and were therefore smaller on average. We therefore pooled the data from both types of transect and included site as a random effect in the statistical models.

Sociality in Gobiodon We documented 15 species of Gobiodon at Lizard Island during the present study (Table 1). However, two species (sp. A and sp. D) were excluded from later analyses as they were uncommon at the study site. The remaining species displayed a range of sociality ranging from solitary individuals to pairs and groups reaching up to 21 individuals. From here on we will use the term “group” to refer to any colony with a group size of three or more. We used a sociality index formulated by Avile´s and Harwood [67] to categorize each species as either GF or PF: (1) A d

Where Ad = age at dispersal, Aa = age when adulthood is reached, Ng = number of groups, Np = number of pairs, Ni = number of solitary adults, Ir = number of reproducing adults and In = number of non-reproducing (subordinate) adults. The three components in the numera- tor of Eq 1 represent the proportion of a species’ life-cycle spent in a group, the proportion of groupsinthe population and theproportion of subordinatesinthepopulation(respectively). Using this equation, we calculated a sociality index for each Gobiodon spp., making some necessary but biologically relevant assumptions. Once coral gobies settle onto a coral as juveniles, they are not known to move frequently unless forcefully evicted from the coral [6, 68]. Although we do not have a precise estimate of the age at settlement for each species, Brothers et al. [69] estimated the larval life of three species of Gobiodon ranging from 22 to 41 days.

Table 1. List of Gobiodon spp. and sociality categorization.

Gobiodon spp. observed at Lizard Island with their social index. The number of individuals and groups of each species recorded during the February 2014 survey are provided. Species were categorized as group-forming (below dotted line) if their social index was greater than 0.5. Otherwise they were categorized as pair-forming (above dotted line). a G. fuscoruber is synonymous with G. unicolor [76] https://doi.org/10.1371/journal.pone.0202407.t001

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 7 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

Given that Gobiodon spp. live in the order of years [29, 70], we assume that each species spends the majority of its life-cycle in a single coral. We therefore set the maximum proportion of the life-cycle spent in the group (Ad ) as 1 for each species. While there may be natural variation in Aa this parameter, this assumption is biologically realistic and enables us to make relative comparisons between species primarily based on the remaining two factors in Eq 1. The last two components of the index were calculated as per Eq 1. Having calculated the sociality indices, species were categorized as GF if their sociality index was greater than 0.5 and remaining species with sociality indices less than 0.5 were categorized as PF (Table 1). The index value of 0.5 was defined as the cut-off value between PF and GF species because it lies directly in the middle of the observed index range where there was a natural split in the data (S1 Fig). It should be noted however that “PF” species were sometimes observed in groups (i.e. 3 or more individuals) and “GF” species were sometimes observed in pairs or as singles. The terminology used here therefore indicates the tendency of particular species to form either groups or pairs. Importantly, calculations of sociality indices and subsequent categorization was based on data from surveys obtained before any recent cyclone activity (February 2014). We acknowledge that these reefs have been subjected to Crown of Thorns Starfish (COTS) outbreaks in the past. Our measure of sociality may therefore vary from sociality recorded at other locations. Unfortunately, COTS outbreaks are a relatively frequent occurrence on the Great Barrier Reef and we therefore consider our measure of sociality to be representative of the ‘normal’ social organization of the species in question.

Groupsize To assess the effect of cyclone activity on social organization, we used a generalized linear mixed model with a zero-truncated negative binomial distribution to analyze the effects of sociality and survey time and their interaction on the group size of coral gobies. The zero truncated distribution was used as it does not allow predictions of group size less than one. A negative binomial distribution was used to account for over-dispersion which rendered an initiallyemployed zero-truncated Poisson model unsuitable. The model contained survey time (Feb-14, Aug-14, Jan-15 and Jan-16), social organization (PF or GF) and the interaction between these factors as fixed effects. Site, coral species and goby species were included as crossed random effects. Root mean square error (RMSE) was used to assess model performance. RMSE is a measure of the overall agreement between model predictions and the observed data and ismeasured in the same unit as the response variable. Generalized linear mixed models were conducted in R using the glmmADMB package [71, 72] and pairwise comparisons conducted with the emmeans package [73]. Figures were produced using the ggplot2 package [74].

Coralsizeandabundanceofemptycorals To investigate changes in coral sizes for PF and GF species over the four survey times, we tested the relationship between social organization, survey time and coral size. We used a generalized linear mixed model with survey time, social organization and their interaction as fixed effects and site, goby species and coral species as crossed random effects. A gamma distribution was used to account for positive skew and heteroscedasticy in the data and because it gave a better fit than models conducted with log-normal distributions. RMSE was used to assess model performance. To test the hypothesis that subordinates (i.e. non-reproducing individuals) in colonies of GF species might be constrained by a lack of available habitat, we also assessed whether the mean number of empty corals on a transect was different for transects with or without groups of GF species. We used a generalized linear model for this analysis with the number of empty

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 8 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes corals as the dependent variable and survey time and transect type (with or without groups ofGF species) as independent variables. The model was run with a zero-inflated negative binomial distribution to handle the large number of zero counts and this produced a better modelthan a zero-inflated Poisson model when compared with Akaike Information Criterion (AIC).The model was conducted using the R package glmmADMB [71, 72].

Proportion of inhabited corals and probability of coral occupancy We qualitatively reviewed the mean proportion of corals occupied on each transect to deter-mine whether cyclone activity would change the relative proportion of either social organization’s occupancy. Since we expected coral size to change with cyclone activity, we assessed whether coral size (a potential aspect of habitat quality) was related to the type of goby species (PF or GF) that occupied it during each survey. This was examined by assessing the multinomial probability that corals would be inhabited by either GF species, PF species or neither. These data were modeled as a multinomial response with coral size and survey time as predictors. Prior to cyclone Ita (survey 1), these data were only collected at one site (Palfrey; Fig 1). For each of the remaining time points (surveys 2–4), data were collected from various sites around Lizard Island (Fig 1; S1 Data). Misclassification error is the proportion of false classifications predicted by the model and was used to assess model performance. The multinomialmodel was conducted in R using the nnet package [75].

Results Categorization of social organization Of the 13 Gobiodon spp. surveyed at Lizard Island, five species were categorized as “GF” species and eight species were classified as “PF” (see above for definitions) (Table 1).

Groupsize Prior to cyclone Ita (Feb 2014), GF species were observed with mean group sizes of 2.71 (± 0.17 SE) individuals per coral. The mean group size of GF species decreased to 2.13 (± 0.11 SE) following cyclone Ita (Aug 2014). Five months later (Jan 2015, 9 months after cyclone Ita) the mean group size of GF species appeared to show some sign of recovery, increasing to 2.58 ± 0.11 (SE). This trend of recovering group sizes was not evident 10 months after cyclone Nathan (Jan 2016), when mean group sizes for GF species was 2.27 ± 0.15 (SE), similar to those just four months after cyclone Ita. Meanwhile PF species had a mean group size of 1.88 (± 0.05 SE) individuals per coral at the beginning of the study (Feb 2014) and maintained their group sizes at a similar level through both cyclones. The mean group sizes of PF species was 1.81 (± 0.03 SE), 1.74 (± 0.04 SE) and 1.74 (± 0.04 SE) for the Aug 2014, Jan 2015 and Jan 2016 surveys respectively. Group-forming species had larger mean group sizes than PF species at every survey time (Fig 3), although the difference in group size between GF and PF species reduced substantially following cyclone Ita (Aug 2014; Fig 3). This was due to the reduction in the mean group size of the GF species after cyclone Ita. These patterns were supported by the statistical model which had a RMSE of 1.36 (S1 Table). The model predicted an initial decrease in the mean group size of GF species following cyclone Ita (pairwise comparison ratio 1.58 (Feb-14/group: Aug-14/group, 95% CI (0.76, 1.83)). However, the predicted mean group sizes remained at these lower sizes for the subsequent surveys (S2 Table; Fig 3). The model did show a slight increase in mean group size of GF species in the Jan-15 survey (confidence interval was relatively large; estimated marginal mean 1.78, 95% CI (1.10, 2.81); Fig 3).

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 9 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

Fig 3. VariationingroupsizeofPFand GFspeciesinresponsetocycloneactivity.Modeledmeangroupsizeofpair-forming (circles, pinkdottedline) and group- forming (triangles, blue dashed line) species at the four survey times. Error bars are 95% CI. Cyclone symbols show when each cyclone impacted the research sites. Raw data for pair- (pink) and group-forming (blue) species are shown as jittered point clouds. Six observations of group sizes greater than 10 are not shown here, but were included in the model. https://doi.org/10.1371/journal.pone.0202407.g003

Mean group sizes of PF species did not change significantly throughout the study. The statistical model showed very little variation in group size during any survey time (Fig 3), but predicted lower mean group sizes than observed, ranging from 1.28 ± 0.16 (SE) before the cyclones to 1.09 ± 0.19 (SE) after both cyclones.

Coralsize Over each successive survey, the mean size of corals inhabited by GF species, PF species and the mean size of uninhabited corals all decreased (pairwise comparison ratio 1.23 (Feb-14: Jan16, 95% CI (1.16, 1.32); Fig 4). The number of very large corals (greater than 50 cm mean

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 10 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

Fig 4. Mean coral size over the four survey times. Modeled mean coral diameter inhabited by pair-forming (circles, pink dotted line), group-forming (triangles, blue dashed line) species and vacant corals (squares, green solid line). Error bars are 95% CI. Cyclone symbols show when each cyclone impacted the research sites. Raw data of empty corals (green), pair- and group-forming species (pink and blue, respectively) are shown as jittered point clouds. Eight observations of corals larger than 100 cm mean diameter were omitted from this figure but were included in the model. https://doi.org/10.1371/journal.pone.0202407.g004 diameter) also decreased substantially following the first cyclone (cyclone Ita; Fig 4) and were detected in low numbers in all subsequent surveys. The interaction between sociality and survey time was not significant (analysis of deviance 2$ = 3.36, df = 3, P = 0.34), indicating that the coral size decreased at a similar rate across the four survey times for each category of social organization. As this interaction was non-significant, pairwise comparisons were conducted on the main effects only. On average, GF species inhabited larger corals (26.93 ± 0.56 (SE)) than the PF species (19.76 ± 0.19 (SE)) during each survey and the mean size of uninhabited corals (12.86 ± 0.25 (SE)) was always less than that of inhabited corals (Fig 4). The pattern of decreasing coral size was supported by the statistical model (RMSE = 7.42; Fig 4). The model also supported the pattern of GF species inhabiting larger corals than PF species on average

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 11 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

Fig 5. Mean proportion of corals occupied by each social organization and remaining vacant throughout the study. Mean proportion of corals inhabited by pair- forming species (triangles, pink dotted line), group-forming species (circles, blue dashed line) and remaining vacant (squares, green solid line) over the four surveys. Error bars indicate standard error. Raw data are shown as jittered point clouds for vacant (green), pair- (pink) and group-forming (blue) species. https://doi.org/10.1371/journal.pone.0202407.g005

(pairwise comparison ratio 0.80 (PF:GF), 95% CI (0.61, 1.06); Fig 5). Vacant corals were smaller than corals inhabited by either PF or GF species (pairwise comparison ratio 0.63 (vacant:PF), 95% CI (0.37, 0.85); pairwise comparison ratio 0.51 (vacant:GF), 95% CI (0.37, 0.69) respectively). To assess whether habitat saturation (an ecological constraint) was acting as a constraint on subordinate dispersal, we looked at whether the number of vacant corals differed between transects with or without groups (colonies with 3 or more individuals) of GF species. Corals that were uninhabited were present on transects where at least one group of GF species was present (S1 Data). This means that there was vacant habitat available for subordinates to disperse to. However, there was no difference in the mean number of empty corals on transectswith or without a group of GF species during any survey time detected by the model (pairwise comparison ratio 1.19 (no groups:groups present), 95% CI (0.89, 1.44). This could indicate that some coral vacancy was due to reduced abundance of coral gobies overall, but the fact that groups of GF species were present on transects where there were corals available to disperse to demonstrates that either; some constraint was restricting dispersal from the group or subordi-nate gobies were receiving a benefit from remaining within the group.

Proportion of inhabited corals and probability of occupation PF species occupied proportionally more corals on average during each survey than GF species (Fig 5). There was a similar proportion of corals occupied by GF species as there were vacant corals during each survey. The proportion of corals inhabited by PF species decreased from 0.61 ± 0.04 (SE) at the beginning of the study (Feb 2014) to 0.54 ± 0.02 (SE) after cyclone Ita

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 12 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

(Aug 2014). This downward trend continued into the next survey (Jan 2015) where the pro-portion of corals inhabited by PF species was 0.46 ± 0.02 (SE). However, the proportion of corals inhabited by PF species increased after cyclone Nathan (Jan 2016) to 0.56 ± 0.03 (SE). The GF species on the other hand showed relative stability in the proportion of corals they occupied during the study. There was an initial increase in the proportion of corals inhabited by GF species from 0.14 ± 0.03 (SE) at the beginning of the study to 0.22 ± 0.02 (SE) after cyclone Ita (Aug 2014). The mean proportion of corals occupied by GF species then remained at similar levels for the remaining two surveys (Fig 5). The proportion of vacant corals was also relatively unchanged throughout the study except for a small increase nine months after cyclone Ita (Jan 2015; 0.31 ± 0.02 (SE); Fig 5). The multinomial model of coral occupancy had a misclassification rate of 0.404 indicating that the predictions may not be reliable. Nevertheless, the trends agree reasonably well with our observations and we give a qualitative account of these, recognizing that probability estimates may have large error. Odds ratios and associated confidence intervals for the model coefficients are available in S3 Table, however, we urge the same caution in their interpretation. Prior to cyclone activity (February 2014), there was a low probability that the smallest corals would remain vacant and this probability decreased rapidly for corals of increasing mean diameter (Fig 6A). This was consistent with our observations as larger corals were rarely vacant (Fig 4, pink and blue points). After cyclone Ita, there was a similar pattern of decreasing probability of corals remaining vacant with increasing coral size (Fig 6A), but there was a higher probability of the smallest corals remaining vacant. Again, this pattern was consistent with our observations of coral size (Fig 4). The probability that a PF species would occupy a coral increased initially with increasing coral size, but then decreased after reaching an apparent optimal coral size around 15 cm (Fig 6B, solid orange line). This pattern of increasing to an optimum size is certainly plausible if we consider that GF species typically inhabited the larger corals (Fig 4) posing an upper restraint on occupancy by PF species. Corals in the smaller range may have been less desirable as they may not support successful feeding, reproduction or protection from predators. Furthermore, the coral size model had predicted the mean coral size for PF species within this coral size range (Fig 4). The ‘optimal’ coral size for PF species appeared to increase to 20 cm– 30 cm in the survey times after cyclone Ita (Fig 6B). Consistent with the concept of the PF species having lower probability of occupancy at higher coral sizes, the probability that a GF species would occupy a coral increased as coral size increased (Fig 6C). This relationship between coral size and probability of inhabitance by a GF species did not change with respect to survey time (Fig 6C).

Discussion The effects of cyclones on the social organization of coral-reef fish are poorly understood despite clear links between social organization and factors that could affect species persistence and recovery following environmental disturbances [1–3]. Here, we investigated the impacts of two successive cyclones (Ita 2014 and Nathan 2015) on the social organization of coral- gobies over three years, and at the same time shed light on the possible factors influencing the formation of socialgroups.

Effects of cyclones on social organization and coral size Both cyclones had a small, but detectable effect on the social organization of GF species. Simi- lar impacts on social organization were not evident in the PF species. The group size of GF species declined, while the group sizes of PF species showed little variation over time. Despite the general decline in their group sizes, GF species exhibited some recovery eight months after

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 13 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

Fig 6. Probabilityofoccupationforcoralsofvaryingmeandiameter. Probabilitythata coralofgivensizewouldremain vacant(a) or beinhabitedbyeitherapair- (b) or group-forming (c) species of Gobiodon. Probabilities are shown for each survey time: Feb 2014 (orange, unbroken), Aug 2014 (green, dotted), Jan 2015 (blue, dashed), Jan 2016 (purple, dot-dash). https://doi.org/10.1371/journal.pone.0202407.g006 cyclone Ita. However, there was no such recovery exhibited after cyclone Nathan. The lack of apparent recovery after cyclone Nathan indicates that multiple impacts of this nature can have longer lasting negative impacts on the social structure of GF species. The relative stability of group sizes in the PF species on the other hand, suggests a level of resilience in social structure in the face of natural disturbance. Overall, mean coral size and the presence of very large corals (greater than 50 cm mean diameter) decreased with each cyclone. This was consistent with damage reported in studies on these cyclones [60–63] and others [45].

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 14 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

Implications for pair- and group-forming species The overall reduction in coral sizes meant that both GF and PF species were more frequently observed in corals of smaller sizes including some of a size that were unoccupied before the cyclones (Feb 2014). Therefore, the recovery in group size of GF species following cyclone Ita (Jan 2015) occurred despite the fact that the corals they inhabited were smaller on average compared to pre-cyclone (Feb 2014). This result was unexpected, given the positive relationship between coral size and group size regularly reported for social habitat-specialist reef fishes [55, 77, 78]. This may indicate that GF species of gobies will tolerate greater coral saturation (i.e. more subordinates in smaller corals) following a disturbance, especially if they benefit in future reproduction or survival from doing so [79]. Despite this small recovery following cyclone Ita, group sizes of GF species remained relatively lower following cyclone Nathan. This may be due to social conflict [6] and recruitment prevention [37], demonstrated in other social fishes at high rates of habitat saturation. Smaller group sizes suggest lower numbers of subordinates which may have a negative impact on future reproductive efforts [79]. Smaller group sizes could also be problematic under a regime of repeated disturbance as larger group size may provide a level of redundancy and buffer effects of future disturbance [26, 42, 43]. However, when group sizes are reduced, so too is this redundancy. The proportion of corals inhabited by PF species did decrease following cyclone Ita, but had returned to pre-cyclone levels in the period following cyclone Nathan. At all survey times, PF species inhabited a substantially higher proportion of corals than GF species. This suggests that PF species might be better able to colonize vacant corals than GF species, for example by out-competing GF species for habitat [57, 80]. However, most of the GF species in our study tended to prefer different species of coral to the PF species and we therefore consider competitive effects unlikely. Instead, the greater proportion of corals inhabited by PF species could be due to their tendency to live in intermediate sized (20–30 cm) corals as shown by our analysis of the probability of occupation by a PF species. Corals in this size range were relatively common in the surveys following cyclone Ita (compared to the larger corals that GF species tend to inhabit). Group-forming species on the other hand showed a relatively lower probability of occupying corals in this intermediate size range. This ability or preference of PF species to occupy corals in the range of sizes most commonly found after the cyclones could be advantageous at the population scale, as long as these habitats were of sufficient quality to enable foraging, protection from predators and successful breeding [58, 59].

Ecological constraints and benefits of philoparty In theory, subordinates living in a group could maximize their lifetime reproductive success if they dispersed to pursue independent breeding rather than remaining in a group as a subordinate. In practice however, various ecological constraints and benefits of remaining philopatric amongst other factors (e.g. life-history and phylogeny), alter the advantages of dispersing from or remaining in their current group [11, 12, 20]. For example, a lack of vacant habitat to dis-perse to in order to pursue independent breeding (an ecological constraint) would increase thebenefit of remaining in the group, even as a non-breeding subordinate, especially if the subordinate stands to inherit the breeding position in the future (a benefit of philopatry). Habitat saturation (i.e. lack of available suitable habitat) is often invoked as a key ecological constraint leading to group formation and maintenance in a variety of taxa (e.g. birds [13]; mammals [81]; fish [20]). Other studies on a closely related coral goby [23] and on social freshwater fishes [22] have found the combination of habitat saturation and benefits of philopatry

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 15 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes promote group-living. However, we found little evidence to support habitat saturation acting as a constraint on dispersal in coral gobies following these disturbances. Our analysis of vacant corals on transects with and without groups of GF species indicate that GF groups were present even when alternative corals were available for subordinate dispersal. As we only included corals of a size that pairs of gobies had been observed in, these alternative corals are assumed to be of a size capable of supporting at least a breeding pair. Our study therefore indicates that habitat saturation alone was unlikely to explain group formation. Instead, and consistent with the benefits of philopatry hypothesis, subordinates of GF species stayed within the group, presumably obtaining benefits that group living provides (e.g. inheritance of a breeding position in a good quality habitat). Additionally, our analysis of the probability of occupation showed that GF species were increasingly more likely to inhabit a coral as coral size increased. Coral size has been shown to be related to individual growth, survival and reproductive success in some coral-associated fishes and may therefore be considered a reasonable proxy for habitat quality [58, 59]. This strong association between coral size (quality) and probability of occupancy by a GF species is consistent with the benefits of philopatry model as we would expect larger group sizes (characteristic of more social species) in higher-quality habitat. Conversely, under a habitat saturation model we would expect a much weaker association between coral size and the probability of occupancy by a GF species as subordinates would be expected to disperse to vacant habitat of any size that could support independent breeding. Furthermore, if habitat saturation (availability of corals) was acting as a constraint on dispersal following the cyclone, we would expect the proportion of inhabited corals to approach 100% as subordinates would quickly fill any vacant habitat to pursue independent breeding [13]. Alternatively, if there were sufficient benefits of residing in a high-quality habitat, we would expect the proportion of inhabited corals to be substantially lower than 100% after the cyclones as individuals living in low-quality habitat would vacate and take up residence in a higher-quality habitat as a subordinate. We found the proportion of corals inhabited by social species was very low and relatively constant (< 25%) throughout the study, even though there were vacant corals present (approximately 20% per transect), suggesting that benefits of philopatry and not habitat saturation was responsible for group formation.

Conclusion Few studies thus far have examined the effects that extreme climatic events such as tropical cyclones could have on social organization of social species. While two cyclones in consecutive years may be rare, the frequency of the most intense cyclones is projected to increase as sea surface temperatures continue to rise in the future and repeated disturbances may become more prevalent [82]. The destructive nature of these events on coral-reef communities has been well documented [46, 48, 83]. However, changes to social organization from such events have been less studied. Here we demonstrated that repeated cyclones are likely to negatively impact social organization in a genus of coral-reef fishes through flow-on effects of the destruction of habitat, but only in GF species. Pair-forming species appear to be able to monopolize smaller corals and maintain their social organization in response to extreme cli-matic events. Additionally, we suggest that the most likely mechanism for the maintenance of group sizes in GF species are benefits of philopatry, but these benefits only promote group living when the habitat is of sufficient size. Cyclones are capable of reducing whole areas of coral to well below what appears to be the minimum size threshold for GF coral gobies to form their usual group structures, which may be linked to their ability to recover from such disasters. In fact, we observed several sites that were completely devoid of corals (and hence coral gobies)

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 16 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes following each cyclone. With the frequency of more intense cyclones and other stressors on coral reefs (e.g. coral bleaching) set to increase in the near future, population declines and localized extinctions of GF species of coral gobies through habitat loss and lowered recovery ability due to impacts on their social organization are a real possibility. While PF species appear to buffer these effects somewhat, they are still vulnerable to habitat destruction caused by these catastrophic events.

Supporting information S1 Data. Raw Data. Data collected from Lizard Island over four survey times between Febru- ary 2014 and February 2016. Includes some data from collected by MW and SK in 2013. This 2013 data was only used in the categorization of Gobiodon species, not in the statistical models. (CSV) S1Fig. SocialityindexforeachspeciesofGobiodonobservedatLizardIsland. Sociality indices (red dot) calculated for each species. Jittered point clouds indicate the relative number of colonies that were available to calculate the index from. There is a natural split in the species’ indices around 0.5. (DOCX) S2 Fig. Gobiodon juvenile abundance at Lizard Island. Predicted mean juvenile abundance and 95% CI for pair- and group-forming species (pink and blue respectively) across each survey time. Raw data is shown as jittered point clouds. (DOCX) S1 Table. Summary of statistical models. Results from statistical models. Abbreviationsare: Akaike Information Criterion (AIC); standard error (SE); degrees of freedom (df); standarddeviation (SD); root mean squared error (RMSE). (DOCX) S2Table. Pairwisecomparisonsforthefixedeffectsterms ofeach of thegroupsize, coral size, empty corals and predicted probabilities ofinhabitance. Pairwise comparisons were conducted in R using the emmeans package [1]. For a given contrast A/B, ratios greater than 1.1 indicate that A is greater than B and ratios less than 1.00 indicate that B is greater than A. (DOCX) S3 Table. Model coefficients for the multinomial probability of occupancy. Odds and associated confidence interval (CI) for each model coefficient. Vacant corals were the reference group. Odds = 1 indicate an equal chance that the coral would remain vacant or be inhabitedby either a pair- or group-forming species. Odds > 1 indicate a greater chance of the coral being inhabited by either pair- or group-forming species rather than remaining vacant. Odds < 1 indicates a greater chance of the coral remaining vacant. (DOCX)

Acknowledgments The authors express our thanks to Grant Cameron and Karen Hing for their help in the fieldwithout which this research could not have taken place. We also wish to acknowledge the staff and volunteers of the Lizard Island Research Station for the smooth operation of this vital research hub. This manuscript was prepared with the help of the Australian Coral Reef Society Writing Workshop (2016). Thanks also to Simon Brandl, two anonymous reviewers and the

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 17 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes editor, Heather Patterson, for extremely helpful and detailed advice in the preparation of the manuscript.

Author Contributions Conceptualization: Martin L. Hing. Datacuration: MartinL. Hing. Formal analysis: Martin L. Hing. Fundingacquisition: Mark Dowton, MarianY. L. Wong. Investigation: Martin L. Hing, Kylie R. Brown. Methodology: Martin L. Hing. Supervision: O. Selma Klanten, Mark Dowton, Marian Y. L. Wong. Visualization: Kylie R. Brown. Writing o riginaldraft: MartinL. Hing. Writing r eview & editing: Martin L. Hing, O. Selma Klanten, Mark Dowton, Kylie R. Brown, Marian Y. L. Wong.

References 1. Ebensperger LA. A review of the evolutionary causes of rodent group-living. Acta Theriol. 2001; 46 (2):115 ±44. doi: 10.1007/bf03192423. WOS:000169742700001. 2. Ridley AR, van den Heuvel IM. Is there a difference in reproductive performance betweencooperative and non-cooperative species? A southern Africancomparison. Behaviour. 2012; 149(8):821 ±48. doi: 10.1163/1568539x-00003005. WOS:000309380000002. 3. Kokko H, Johnstone RA, Clutton-Brock TH. The evolution of cooperative breeding throughgroup augmentation. Proceedings of the Royal Society B-Biological Sciences. 2001; 268(1463):187 ±96. WOS:000166642600012. 4. Emlen ST. The evolution of helping 1. An ecological constraints model. American Naturalist. 1982; 119 (1):29 ±39. doi: 10.1086/283888. WOS:A1982MY09300003. 5. Rowley I, Russell E. Splendid fairy-wrens: demonstrating the importance of longevity. In: Stacey PK WD, editor. Cooperative breeding in birds: long-term studies of ecology and behavior. Cambridge: Cambridge University Press; 1990. p. 3 ±30. 6. Wong MYL, Buston PM, Munday PL, Jones GP. The threat of punishment enforces peaceful cooperation and stabilizes queues ina coral-reef fish. Proceedings of the Royal Society B-Biological Sciences. 2007; 274(1613):1093 ±9. doi: 10.1098/rspb.2006.0284. WOS:000245472200012. PMID: 17301018 7. Hughes WOH, Oldroyd BP, Beekman M, Ratnieks FLW. Ancestral monogamy shows kin selection is key to the evolution of eusociality. Science. 2008; 320(5880):1213 ±6. doi: 10.1126/science.1156108. WOS:000256233000038. PMID: 18511689 8. Killen SS, Marras S, Nadler L, Domenici P. The role of physiological traits in assortment among and withinfish shoals. Philosophical Transactions of the Royal Society B: Biological Sciences. 2017; 372 (1727). https://doi.org/10.1098/rstb.2016.0233 PMID: 28673911 9. Greenwood AK, Wark AR, Yoshida K, Peichel CL. Genetic and neural modularity underlie the evolution of schoolingbehavior inthreespine sticklebacks. Current Biology. 2013; 23(19):1884 ±8. https://doi.org/ 10.1016/j.cub.2013.07.058 PMID: 24035541 10. Hamilton WD. The genetical evolution of social behaviour. I. Journal of Theoretical Biology. 1964; 7 (1):1 ±16. http://dx.doi.org/10.1016/0022-5193(64)90038-4. PMID: 5875341 11. Hamilton WD. The genetical evolution of social behaviour. II. Journal of Theoretical Biology. 1964; 7 (1):17 ±52. http://dx.doi.org/10.1016/0022-5193(64)90039-6. PMID: 5875340 12. Bourke AFG. + D P L O rWuleRaQnd¶thVe causes of social evolution. Philosophical Transactions of the Royal Society B-Biological Sciences. 2014; 369(1642):10. doi: 10.1098/rstb.2013.0362. WOS:000333813400007. PMID: 24686934

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 18 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

13. Komdeur J. Importance of habitat saturation and territory quality for evolution of cooperative breeding in the seychelles warbler. Nature. 1992; 358(6386):493 ±5. doi: 10.1038/358493a0. WOS: A1992JG73900046. 14. Woolfenden GE. Florida scrub jay helpers at the nest. Auk. 1975; 92(1):1 ±15. 15. Stacey PB, Ligon JD. The benefits-of-philopatry hypothesis for the evolution of cooperative breeding ² variation in territory quality and group-size effects. American Naturalist. 1991; 137(6):831 ±46. doi: 10. 1086/285196. WOS:A1991GB40000007. 16. Kokko H, Johnstone RA, Wright J. The evolution of parental and alloparental effort incooperatively breeding groups: When should helpers pay to stay? Behavioral Ecology. 2002; 13(3):291 ±300. 17. Selander RK. Speciation inwrens of the genus Campylorhynchus: University of California Publications in Zoology; 1964. 18. Brown JL. Alternate Routes to Sociality in Jays ² With a Theory for the Evolution of Altruism and Com- munal Breeding. American Zoologist. 1974; 14(1):63 ±80. https://doi.org/10.1093/icb/14.1.63 19. Gaston AJ. The Evolution of Group Territorial Behavior and Cooperative Breeding. The American Natu- ralist. 1978; 112(988):1091 ±100. https://doi.org/10.1086/283348 20. Hing ML, Klanten OS, Dowton M, Wong MYL. The Right Tools for the Job: Cooperative Breeding The- ory and an Evaluation of the Methodological Approaches to Understanding the Evolution and Mainte- nance of Sociality. Frontiers in Ecology and Evolution. 2017; 5(100). https://doi.org/10.3389/fevo.2017. 00100 21. Buston PM. Territory inheritance inclownfish. Proceedings of the Royal Society B-Biological Sciences. 2004; 271:S252 ±S4. doi: 10.1098/rsbl.2003.0156. WOS:000221321100038. PMID: 15252999 22. Heg D, Rothenberger S, Schurch R. Habitat saturation, benefits of philopatry, relatedness, and the extent of co-operative breeding in a cichlid. Behavioral Ecology. 2011; 22(1):82 ±92. doi: 10.1093/ beheco/arq170. WOS:000288276100017. 23. Wong MYL. Ecological constraints and benefits of philopatry promote group-living in a social but non- cooperatively breeding fish. Proceedings of the Royal Society B-Biological Sciences. 2010; 277 (1680):353 ±8. doi: 10.1098/rspb.2009.1453. WOS:000273001500002. PMID: 19828547 24. Heg D, Bachar Z, Brouwer L, Taborsky M. Predation risk is an ecological constraint for helper dispersal ina cooperatively breeding cichlid. Proceedings of the Royal Society B-Biological Sciences. 2004; 271 (1555):2367 ±74. doi: 10.1098/rspb.2004.2855. WOS:000225645500008. PMID: 15556889 25. Hatchwell BJ, Komdeur J. Ecological constraints, life history traits and the evolution of cooperative breeding. Animal Behaviour. 2000; 59:1079 ±86. doi: 10.1006/anbe.2000.1394. WOS:000088220000001. PMID: 10877885 26. Duffy JE, Macdonald KS. Kin structure, ecology and the evolution of social organization in shrimp: a comparativeanalysis. Proceedings of the Royal Society B-Biological Sciences. 2010; 277(1681):575 ± 84. doi: 10.1098/rspb.2009.1483. WOS:000273459600009. PMID: 19889706 27. Wong MYL, Buston PM. Social Systems in Habitat-Specialist Reef Fishes: Key Concepts in Evolution- aryEcology. Bioscience. 2013; 63(6):453 ±63. doi: 10.1525/bio.2013.63.6.7. WOS:000320743000007. 28. Buston PM, Wong MYL. Why Some Animals Forgo Reproduction in Complex Societies Behaviors of coral reef fishes provide strong support for some major new ideas about the evolution of cooperation. Am Scientist. 2014; 102(4):290 ±7. WOS:000337262900014. 29. Taborsky M, Wong M. Sociality in Fishes. In: Rubenstein DI, Abbot P, editors. Comparative Social Evo- lution. Cambridge, UK: Cambridge University Press; 2017. 30. Buston PM, Bogdanowicz SM, Wong A, Harrison RG. Are clownfish groups composed of close relatives? An analysis of microsatellite DNA variation in Amphiprion percula. Mol Ecol. 2007; 16(17):3671 ± 8. https://doi.org/10.1111/j.1365-294X.2007.03421.x PMID: 17845439 31. Buston PM, Fauvelot C, Wong MYL, Planes S. Genetic relatedness in groups of the humbug damselfish Dascyllus aruanus: small, similar-sized individuals may be close kin. Mol Ecol. 2009; 18(22):4707 ±15. doi: 10.1111/j.1365-294X.2009.04383.x. WOS:000271468800018. PMID: 19845858 32. Brandl SJ, Bellwood DR. Pair-formation incoral reef fishes: an ecological perspective. In: Hughes RN, Hughes DJ, Smith IP, editors. Oceanography and Marine Biology: An Annual Review. 52: CRC Press; 2014. p. 1 ±80. 33. Buston PM, Cant MA. A new perspective on size hierarchies in nature: patterns, causes, and consequences. Oecologia. 2006; 149(2):362 ±72. doi: 10.1007/s00442-006-0442-z. WOS:000239735300017. PMID: 16794835 34. Ang TZ, Manica A. Unavoidable limits on group size in a body size-based linear hierarchy. Behavioral Ecology. 2010; 21(4):819 ±25. doi: 10.1093/beheco/arq062. WOS:000279474900023.

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 19 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

35. Herler J, Munday PL, Hernaman V. Gobies on Coral Reefs. In: Patzner JLvT, M.; . R Y D Mþ .L; Küapoor B. G., editor. The Biology of Gobies. Jersey, British Isles, New Hampshire: Science Publishers; 2011. p. 685. 36. Brandl SJ, Goatley CHR, Bellwood DR, Tornabene L. The hidden half: Ecology and evolution of cryptobenthic fishes on coral reefs. Biological Reviews. 2018. https://doi.org/10.1111/brv.12423 PMID: 29736999 37. Buston P. Forcible evictionand prevention of recruitment in the clown anemonefish. Behavioral Ecol- ogy. 2003; 14(4):576 ±82. doi: 10.1093/beheco/arg036. WOS:000184534600019. 38. Buston P. Social hierarchies: Size and growth modification inclownfish. Nature. 2003; 424(6945):145 ± 6. doi: 10.1038/424145a. WOS:000184032700029. PMID: 12853944 39. Wong MYL. Group Size in Animal Societies: The Potential Role of Social and Ecological Limitations in the Group-Living Fish, Paragobiodon xanthosomus. Ethology. 2011; 117(7):638 ±44. doi: 10.1111/j. 1439-0310.2011.01913.x. WOS:000291857900007. 40. Nakashima Y, Kuwamura T, Yogo Y. Both-ways sex change in monogamous coral gobies, Gobiodon spp. Environmental Biology of Fishes. 1996; 46(3):281 ±8. doi: 10.1007/bf00005004. WOS: A1996UV98000008. 41. Munday PL, Caley MJ, Jones GP. Bi-directional sex change in a coral-dwelling goby. Behavioral Ecol- ogy and Sociobiology. 1998; 43(6):371 ±7. doi: 10.1007/s002650050504. WOS:000076383400004. 42. Rubenstein DR. Spatiotemporalenvironmental variation, risk aversion, and the evolution of cooperative breeding as a bet-hedging strategy. Proc Natl Acad Sci U S A. 2011; 108:10816 ±22. doi: 10.1073/pnas. 1100303108. WOS:000292137100005. PMID: 21690415 43. Munday PL. Habitat loss, resource specialization, and extinction oncoral reefs. Glob Change Biol. 2004; 10(10):1642 ±7. https://doi.org/10.1111/j.1365-2486.2004.00839.x 44. Courchamp F, Grenfell B, Clutton-Brock T. Populationdynamics of obligatecooperators. Proceedings of the Royal Society B: Biological Sciences. 1999; 266(1419):557 ±63. 45. Harmelin-Vivien ML. The Effects of Storms and Cyclones on Coral Reefs: A Review. Journal of Coastal Research. 1994:211 ±31. 46. Lirman D, Fong P. The effects of Hurricane-Andrew and Tropical-Storm-Gordon onflorida reefs. Coral Reefs. 1995; 14(3):172-. WOS:A1995RY33800008. 47. Fabricius KE, ' H ¶ DGW, PKuotinen ML, Done T, Cooper TF, Burgess SC. Disturbance gradients on inshore and offshore coral reefs caused by a severe tropical cyclone. Limnology and Oceanography. 2008; 53(2):690 ±704. https://doi.org/10.4319/lo.2008.53.2.0690 48. Gouezo M, Golbuu Y, van Woesik R, Rehm L, Koshiba S, Doropoulos C. Impact of two sequential super typhoons on coral reef communities in Palau. Marine Ecology Progress Series. 2015; 540:73 ±85. doi: 10.3354/meps11518. WOS:000365698900006. 49. Wilson SK, Graham NAJ, Pratchett MS, Jones GP, Polunin NVC. Multiple disturbances and the global degradation of coral reefs: are reef fishes at risk or resilient? Glob Change Biol. 2006; 12(11):2220 ±34. doi: 10.1111/j.1365-2486.2006.01252.x. WOS:000241242400017. 50. Komyakova V, Munday PL, Jones GP. Relative importance of coral cover, habitat complexity and diversity in determining the structure of reef fish communities. PLoS One. 2013; 8(12). https://doi.org/10. 1371/journal.pone.0083178 PMID: 24349455 51. Cheal AJ, MacNeil MA, Emslie MJ, Sweatman H. The threat to coral reefs from more intense cyclones under climate change. Glob Change Biol. 2017; 23(4):1511 ±24. https://doi.org/10.1111/gcb.13593 PMID: 28139035 52. Emslie MJ, Cheal AJ, Sweatman H, Delean S. Recovery from disturbance of coral and reef fish communities on the Great Barrier Reef, Australia. Marine Ecology Progress Series. 2008; 371:177 ±90. https:// doi.org/10.3354/meps07657 53. Munday PL, Jones GP, Caley MJ. Habitat specialisation and the distribution and abundance of coral- dwellinggobies. Marine Ecology Progress Series. 1997; 152(1 ±3):227 ±39. doi: 10.3354/meps152227. WOS:A1997XK65100020. 54. Munday PL. Interactions between habitat use and patterns of abundance incoral-dwelling fishes of the genus Gobiodon. Environmental Biology of Fishes. 2000; 58(4):355 ±69. doi: 10.1023/ a:1007689314926. WOS:000088028400001. 55. Thompson VJ, Munday PL, Jones GP. Habitat patch size and mating system as determinants of social group size incoral-dwellingfishes. Coral Reefs. 2007; 26(1):165 ±74. doi: 10.1007/s00338-006-0181-y. WOS:000245268300022. 56. Altwegg R, Visser V, Bailey LD, Erni B. Learning from single extreme events. Philosophical Transac- tions of the Royal Society B: Biological Sciences. 2017; 372(1723). https://doi.org/10.1098/rstb.2016. 0141 PMID: 28483871

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 20 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

57. Munday PL. Competitive coexistence of coral-dwelling fishes: The lottery hypothesis revisited. Ecology. 2004; 85(3):623 ±8. doi: 10.1890/03-3100. WOS:000220392900005. 58. Kuwamura T, Yogo Y, Nakashima Y. Populationdynamics of goby Paragobiodon echinocephalus and hostcoral Stylophora pistillata. Marine Ecology Progress Series. 1994; 103(1 ±2):17 ±23. doi: 10.3354/ meps103017. WOS:A1994MN84300002. 59. Hobbs JPA, Munday PL. Intraspecific competitioncontrols spatial distributionand social organisation of the coral-dwelling goby Gobiodon histrio. Marine Ecology Progress Series. 2004; 278:253 ±9. doi: 10. 3354/meps278253. WOS:000224640700020. 60. Brandl SJ, Emslie MJ, Ceccarelli DM, Richards ZT. Habitat degradation increases functional originality in highly diverse coral reef fish assemblages. Ecosphere. 2016; 7(11). https://doi.org/10.1002/ecs2. 1557 61. Ceccarelli DM, Emslie MJ, Richards ZT. Post-disturbance stability of fish assemblages measured at coarse taxonomic resolutionmasks change at finer scales. PLoS One. 2016; 11(6). https://doi.org/10. 1371/journal.pone.0156232 PMID: 27285160 62. Khan JA, Goatley CHR, Brandl SJ, Tebbett SB, Bellwood DR. Shelter use by large reef fishes: long- term occupancy and the impacts of disturbance. Coral Reefs. 2017; 36(4):1123 ±32. https://doi.org/10. 1007/s00338-017-1604-7 63. Ferrari R, Figueira WF, Pratchett MS, Boube T, Adam A, Kobelkowsky-Vidrio T, et al. 3D photogrammetry quantifies growth and external erosion of individual coral colonies and skeletons. Sci Rep. 2017; 7 (1). https://doi.org/10.1038/s41598-017-16408-z PMID: 29196651 64. Munday P, Harold A, Winterbottom R. Guide to coral-dwelling gobies, genus Gobiodon (Gobiidae), from Papua New Guinea and the Great Barrier Reef. Revue franc¸aise G ¶ D T X D U1L99R9O; 2R6(1J ±L H 2):53 ±8. 65. Munday PL, van Herwerden L, Dudgeon CL. Evidence for sympatric speciationby host shift in the sea. Current Biology. 2004; 14(16):1498 ±504. doi: 10.1016/j.cub.2004.08.029. WOS:000223586900029. PMID: 15324668 66. Nilsson GE, Hobbs JP, Munday PL, Ostlund-Nilsson S. Coward or braveheart: extreme habitat fidelity through hypoxia tolerance in a coral-dwelling goby. J Exp Biol. 2004; 207(1):33 ±9. doi: 10.1242/jeb. 00713. WOS:000189011000013. 67. Avile´s L, Harwood G. A Quantitative Index of Sociality and Its Application to Group-Living Spiders and Other Social Organisms. Ethology. 2012; 118(12):1219 ±29. https://doi.org/10.1111/eth.12028 PMID: 23335829 68. Wong MYL, Munday PL, Buston PM, Jones GP. Monogamy when there is potential for polygyny: tests of multiple hypotheses in a group-living fish. Behavioral Ecology. 2008; 19(2):353 ±61. doi: 10.1093/ beheco/arm141. WOS:000254009800017. 69. Brothers EB, Williams DM, Sale PF. Length of larval life in twelve families of fishes at "One Tree Lagoon", Great Barrier Reef, Australia. Marine Biology. 1983; 76(3):319 ±24. https://doi.org/10.1007/ BF00393035 70. Munday PL. Fitness consequences of habitat use and competition among coral-dwelling fishes. Oecolo- gia. 2001; 128(4):585 ±93. doi: 10.1007/s004420100690. WOS:000170758900014. PMID: 28547404 71. Fournier DA, Skaug HJ, Ancheta J, Ianelli J, Magnusson A, Maunder MN, et al. AD Model Builder: using automatic differentiation for statistical inference of highly parameterized complex nonlinear models. Optimization Methods and Software. 2012; 27(2):233 ±49. https://doi.org/10.1080/10556788.2011. 597854 72. Skaug H, Fournier D, Nielsen A, Magnusson A, Bolker B. Generalized linear mixed models using AD model builder. R package version 080. 0.8.0 ed2014. 73. Lenth R. Emmeans: Estimated marginal means, aka least-squares means. R package. 1.1.2 ed2018. 74. Wickham H. ggplot2: elegant graphics for data analysis: Springer; 2016. 75. Venables W, Ripley B. Modern applied statistics with S. 4th ed: New York: Springer; 2002. 76. Herler J, Bogorodsky SV, Suzuki T. Four new species of coral gobies (Teleostei: Gobiidae: Gobiodon), with comments on their relationships within the genus. Zootaxa. 2013; 3709(4):301 ±29. WOS:000324018700001. 77. Mitchell JS, Dill LM. Why is group size correlated with the size of the host sea anemone in the false clownanemonefish? Canadian Journal of Zoology-Revue Canadienne De Zoologie. 2005; 83(2):372 ± 6. doi: 10.1139/z05-014. WOS:000229412400014. 78. Wong MYL, Munday PL, Jones GP. Habitat patch size, facultative monogamy and sex change in a coral-dwelling fish, Caracanthus unipinna. Environmental Biology of Fishes. 2005; 74(2):141 ±50. doi: 10.1007/s10641-005-6715-2. WOS:000233240400003.

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 21 / 22

Repeated cyclone events reveal potential causes of sociality in coral-dwelling Gobiodon fishes

79. Ang TZ, Manica A. Effect of the Presence of Subordinates on Dominant Female Behaviour and Fitness in Hierarchies of the Dwarf Angelfish Centropyge bicolor. Ethology. 2011; 117(12):1111 ±9. doi: 10. 1111/j.1439-0310.2011.01964.x. WOS:000297151600006. 80. Munday PL, Jones GP, Caley MJ. Interspecific competition and coexistence ina guild of coral-dwelling fishes. Ecology. 2001; 82(8):2177 ±89. doi: 10.1890/0012- 9658(2001)082[2177:icacia]2.0.co;2. WOS:000170452600007. 81. Lucia KE, Keane B, Hayes LD, Lin YK, Schaefer RL, Solomon NG. Philopatry in prairie voles: an evaluation of the habitat saturation hypothesis. Behavioral Ecology. 2008; 19(4):774 ±83. doi: 10.1093/ beheco/arn028. WOS:000257786700011. 82. Knutson TR, McBride JL, Chan J, Emanuel K, Holland G, Landsea C, et al. Tropical cyclones and climate change. Nat Geosci. 2010; 3(3):157 ±63. doi: 10.1038/ngeo779. WOS:000274974700014. 83. Cheal AJ, Coleman G, Delean S, Miller I, Osborne K, Sweatman H. Responses of coral and fish assemblages to a severe but short-lived tropical cyclone on the Great Barrier Reef, Australia. Coral Reefs. 2002; 21(2):131 ±42.

PLOS ONE | https://doi.org/10.1371/journal.pone.0202407 September 5, 2018 22 / 22

Appendix 2: Additional publications during PhD candidature

• Scheel, D., Chancellor, S., Hing, M., Lawrence, M., Linquist, S., & Godfrey-Smith, P. (2017). A second site occupied by Octopus tetricus at high densities, with notes on their ecology and behavior. Marine and Freshwater Behaviour and Physiology, 50(4), 285-291. doi: 10.1080/10236244.2017.1369851

• Scheel, D., Godfrey-Smith, P., Linquist, S., Chancellor, S., Hing, M., & Lawrence, M. (2018). Octopus engineering, intentional and inadvertent. Communicative & Integrative Biology, 11(1), e1395994. doi: 10.1080/19420889.2017.1395994

• Hing, M., & Godfrey-Smith, P. (2017). Did they mean to do that? Accident and intent in an octopuses’ garden. The Conversation.

170

Supplementary Materials

Supplementary Tables Supplementary Table 2.1 All searches were made using the advanced search feature on the SCOPUS database. Total figures used the Base search parameters. These searches were then refined for each category by adding the following search parameters to the base search: 5-year AND ( LIMIT-TO ( PUBYEAR , 2017 ) OR LIMIT- TO ( PUBYEAR , 2016 ) OR LIMIT-TO ( PUBYEAR , 2015 ) OR LIMIT-TO ( PUBYEAR , 2014 ) OR LIMIT-TO ( PUBYEAR , 2013 ) OR LIMIT- TO ( PUBYEAR , 2012 ) ); Kinship and Monogamy (KS/Mon) - AND TITLE-ABS-KEY (kin* OR monogamy); Ecological Constraints (EC) - AND TITLE-ABS-KEY ( ecolog* OR ( ecological AND constraint* ) ); Benefits of Philopatry (BoP) - AND TITLE-ABS-KEY ( ( benefit* AND philopatry ) OR ( benefit* AND "delayed dispersal" ) ); Life-history (LH) - AND TITLE-ABS-KEY ( life-history OR "life history" ). The five year search included publications for 2012 as the manuscript was under revision in early 2017. Line sums may not add up to the total figures as the search terms added to the base search parameters are not mutually exclusive. i.e. a single publication could be counted in more than one of the additional search parameters. Additionally the base search parameters may return some publications that the additional search parameters do not. We have minimised these inconsistencies where possible. However, these searches are not exhaustive and are intended only to give an approximate indication of publication numbers.

Group Total 5-year KS/Mon EC BoP LH Base search parameters

Bird 757 228 162 215 49 90 ( TITLE-ABS-KEY ( "cooperative breeding" OR "evolution of sociality" OR "group living" ) AND TITLE-ABS-KEY ( bird OR aves OR avian ) AND NOT TITLE-ABS- KEY ( mammal OR mammalia OR mammalian OR reptile OR reptilia OR reptilian O R (social AND lizard*) OR invertebrate OR insect OR insecta OR arthropod OR arthropoda OR marine AND fish OR osteichthyes OR chondrichthyes ) )

171

Mammal* 389 155 78 112 8 43 ( TITLE-ABS-KEY ( "cooperative breeding" OR "evolution of sociality" OR "group living" ) AND TITLE-ABS-KEY ( mammal OR mammalia OR mammalian ) AND NOT TITLE-ABS- KEY ( bird OR aves OR avian OR reptile OR reptilia OR reptilian OR (social AND lizard*) OR invertebrate OR insect OR insecta OR arthropod OR arthropoda OR marine AND

fish OR osteichthyes OR chondrichthyes ) )

Reptile† 23 8 10 7 1 3 ( TITLE-ABS-KEY ( "cooperative breeding" OR "evolution of sociality" OR "group

living" ) AND TITLE-ABS- KEY ( reptile OR reptilia OR reptilian OR ( social AND lizard* ) ) AND NOT TITLE- ABS- KEY ( bird OR aves OR avian OR mammal OR mammalia OR mammalian OR invert ebrate OR insect OR insecta OR arthropod OR arthropoda OR marine AND fish OR osteichthyes OR chondrichthyes ) )

Invertebrate 348 134 63 111 4 44 ( TITLE-ABS-KEY ( "cooperative breeding" OR "evolution of sociality" OR "group living" ) AND TITLE-ABS- KEY (invertebrate OR insect OR insecta OR arthropod OR arthropoda ) AND NOT TITLE-ABS- KEY ( bird OR aves OR avian OR mammal OR mammalia OR mammalian OR reptil e OR reptilia OR reptilian OR ( social AND lizard* ) OR marine AND fish OR osteic hthyes OR chondrichthyes ) )

172

Marine*† 137 57 9 31 1 4 ( TITLE-ABS-KEY ( "cooperative breeding" OR "evolution of sociality" OR "group living" ) AND TITLE-ABS- KEY ( marine OR fish* OR osteichthyes OR chondrichthyes OR shrimp OR sirenia O R cetacea OR whale OR dolphin OR paragobiodon ) AND NOT TITLE-ABS- KEY ( bird OR aves OR avian OR mammal OR mammalia OR mammalian OR reptil e OR reptilia OR reptilian OR (social AND lizard*) OR invertebrate OR insect OR insecta OR arthropod OR arthropoda OR freshwater OR "fr esh water" OR cichlid OR fisheries) )

FW Fish 107 40 20 28 1 9 ( TITLE-ABS-KEY ( "cooperative breeding" OR "evolution of sociality" OR "group living" ) AND TITLE-ABS-KEY ( (freshwater AND fish*) OR ("fresh water" AND fish*) OR cichlid ) AND NOT TITLE-ABS-KEY ( bird OR aves OR avian OR mammal OR mammalia OR mammalian OR reptile OR reptilia OR reptilian OR (social AND lizard*) OR invertebrate OR insect OR insecta OR arthropod OR arthropoda OR marine OR chondrichthyes OR shrimp OR sirenia OR cetacea OR whale OR dolphin OR fisheries ) )

M Fish 117 47 8 29 1 3 ( TITLE-ABS-KEY ( "cooperative breeding" OR "evolution of sociality" OR "group living" ) AND TITLE-ABS- KEY ( fish* OR ( marine AND fish* ) OR paragobiodon OR amphiprion OR dascyllus OR chondrichthyes ) AND NOT TITLE-ABS- KEY ( bird OR aves OR avian OR mammal OR mammalia OR mammalian OR reptil e OR reptilia OR reptilian OR (social AND lizard*) OR invertebrate OR insect OR insecta OR arthropod OR arthropoda OR shrimp OR sirenia OR cetacea OR whale OR dolphin OR freshwater OR "fresh water" OR cichlid OR fisheries) )

173

Comparative 70 28 10 28 2 17 ( TITLE-ABS-KEY ( "cooperative breeding" OR "evolution of sociality" OR "group living" ) AND TITLE-ABS-KEY ( "comparative analysis" OR "comparative approach" OR "comparative method" ) )

Observational 406 132 73 86 12 19 ( TITLE-ABS-KEY ( "cooperative breeding" OR "evolution of sociality" OR "group living" ) AND TITLE-ABS-KEY ( observational OR "observational approach" OR "observational method" OR "observational methodology" OR "observational study" OR observation ) )

Experimental 751 246 110 154 12 38 ( TITLE-ABS-KEY ( "cooperative breeding" OR "evolution of sociality" OR "group living" ) AND TITLE-ABS-KEY ( experiment OR experimental OR "manipulative experiment" OR "experimentally manipulated" ) AND NOT TITLE-ABS- KEY ( "observational experiment" ) )

* Marine mammals (infraorder Cetacea and clade Pinnipedia) were not included in the ‘Mammals’ category as we wished to draw a distinction between terrestrial and marine mammals and to minimize overlap between categories.

† Marine reptiles (subfamily Hydrophiinae and superfamily Chelonioidea) were not included in the ‘reptiles’ category as we wished to draw a distinction between terrestrial and marine mammals and to minimize overlap between categories.

174

Supplementary Table 3.1: Full model and analysis of deviance for each species of Gobiodon.

Model Analysis of Deviance Likelihood Species Response Predictors AIC Coefficient Estimate SE z P ratio χ2 df P G. acicularis Group size Coral size 41.86 Intercept -2.982 3.267 -0.913 0.361 Standard length of Alpha CS 0.064 0.550 1.162 0.245 0.255 1 0.614 SLα 1.876 1.357 1.382 0.167 0.171 1 0.680 CS:SLα -0.031 0.023 -1.307 0.191 2.000 1 0.193 G. brochus Group size Coral size 88.48 Intercept -2.148 4.319 -0.497 0.619 Standard length of Alpha CS 0.198 0.213 0.929 0.353 0.590 1 0.442 SLα 0.942 1.657 0.569 0.570 0.808 1 0.369 CS:SLα -0.066 0.080 -0.830 0.407 0.706 1 0.401 G. ceramensis Group size Coral size 50.99 Intercept 5.206 11.569 0.450 0.653 Standard length of Alpha CS -0.196 0.432 -0.455 0.649 0.072 1 0.789 SLα -1.414 3.790 -0.373 0.709 0.455 1 0.500 CS:SLα 0.060 0.140 0.428 0.668 0.188 1 0.664 G. erythrospilus Group size Coral size 71.47 Intercept -0.268 2.570 -0.104 0.917 Standard length of Alpha CS 0.016 0.096 0.163 0.871 2.201 1 0.138 SLα 0.108 0.791 0.136 0.892 0.306 1 0.580 CS:SLα 0.003 0.028 0.094 0.925 0.009 1 0.925 G. fuscoruber Group size Coral size 113.81 Intercept -0.596 2.368 -0.252 0.801 Standard length of Alpha CS 0.077 0.073 1.067 0.286 20.976 1 <0.001 SLα -0.297 0.784 -0.379 0.705 1.260 1 0.262 CS:SLα 0.001 0.022 0.033 0.974 0.001 1 0.974

175

G. histrio Group size Coral size 68.71 Intercept -2.950 5.351 -0.551 0.581 Standard length of Alpha CS 0.157 0.236 0.664 0.506 0.382 1 0.536 SLα 0.949 0.167 0.568 0.570 0.001 1 0.974 CS:SLα -0.041 0.072 -0.573 0.567 0.341 1 0.559 G. oculolineatus Group size Coral size 68.69 Intercept 4.484 5.863 0.765 0.444 Standard length of Alpha CS -0.156 0.225 -0.692 0.489 8.130 1 0.004 SLα -1.770 2.274 -0.778 0.436 0.056 1 0.813 CS:SLα 0.072 0.086 0.832 0.405 0.700 1 0.403 G. okinawae Group size Coral size 26.63 Intercept -1.857 3.816 -0.487 0.627 Standard length of Alpha CS 0.035 0.095 0.372 0.710 0.409 1 0.522 SLα 0.967 2.071 0.467 0.640 0.738 1 0.390 CS:SLα -0.014 0.053 -0.268 0.789 0.070 1 0.791 G. quinquestrigatus Group size Coral size 110.10 Intercept -2.387 4.733 -0.504 0.614 Standard length of Alpha CS 0.147 0.225 0.655 0.513 0.006 1 0.938 SLα 1.176 1.834 0.641 0.521 0.001 1 0.980 CS:SLα -0.055 0.085 -0.651 0.515 0.434 1 0.510 G. rivulatus Group size Coral size 104.94 Intercept -3.411 2.321 -1.470 0.142 Standard length of Alpha CS 0.195 0.093 2.099 0.036 19.274 1 <0.001 SLα 1.305 1.122 1.163 0.245 0.043 1 0.514 CS:SLα -0.061 0.045 -1.358 0.175 1.836 1 0.175

176

Supplementary Table 3.2 Generalized linear model results and analysis of deviance of the effect of coral size on group size Model Analysis of Deviance

Likelihood Species Response Predictors AIC Coefficient Estimate SE z P ratio χ2 df P G. acicularis Group size Coral size 39.73 Intercept 1.350 0.639 2.111 0.035 CS -0.006 0.012 -0.505 0.614 0.254 1 0.614 G. brochus Group size Coral size 86.00 Intercept 0.551 0.544 1.013 0.311 CS 0.010 0.026 0.407 0.684 0.164 1 0.685 G. ceramensis Group size Coral size 47.63 Intercept 0.762 1.330 0.573 0.567 CS -0.008 0.047 -0.173 0.863 0.030 1 0.863 G. erythrospilus Group size Coral size 67.790 Intercept -0.037 0.472 -0.079 0.937 CS 0.029 0.014 1.993 0.046 3.999 1 0.046 G. fuscoruber Group size Coral size 111.07 Intercept -1.036 0.429 -2.410 0.016 CS 0.066 0.012 5.256 <0.001 25.734 1 <0.001 G. histrio Group size Coral size 65.05 Intercept 0.077 0.803 0.095 0.924 CS 0.023 0.033 0.704 0.482 0.488 1 0.485 G. oculolineatus Group size Coral size 65.45 Intercept -0.130 0.339 -0.383 0.702 CS 0.032 0.010 3.365 0.001 8.766 1 0.003 G. okinawae Group size Coral size 23.44 Intercept 0.063 0.635 0.098 0.922 CS 0.009 0.014 0.633 0.527 0.371 1 0.542 G. quinquestrigatus Group size Coral size 106.54 Intercept 0.629 0.649 0.969 0.332 CS 0.003 0.027 0.100 0.920 0.010 1 0.920 G. rivulatus Group size Coral size 103.20 Intercept -0.735 0.435 -1.689 0.091 CS 0.070 0.016 4.324 <0.001 18.877 1 <0.001

177

178

Supplementary Table 3.3: Generalized linear model results and analysis of deviance of the effect of standard length of alpha on group size Model Analysis of Deviance

Likelihood Species Response Predictors AIC Coefficient Estimate SE z P ratio χ2 df P G. acicularis Group size Standard length of Alpha 39.81 Intercept 0.716 0.806 0.889 0.374 SLα 0.139 0.339 0.411 0.681 0.169 1 0.681 G. brochus Group size Standard length of Alpha 85.78 Intercept 1.374 0.988 1.391 0.164 SLα -0.231 0.373 -0.619 0.536 0.382 1 0.537 G. ceramensis Group size Standard length of Alpha 47.25 Intercept -0.035 0.940 -0.037 0.970 SLα 0.198 0.317 0.625 0.532 0.413 1 0.521 G. erythrospilus Group size Standard length of Alpha 69.68 Intercept -0.484 0.948 -0.510 0.610 SLα 0.392 0.277 1.414 0.157 2.104 1 0.147 G. fuscoruber Group size Standard length of Alpha 130.79 Intercept -0.325 0.547 -0.595 0.552 SLα 0.444 0.177 2.509 0.012 6.017 1 0.014 G. histrio Group size Standard length of Alpha 65.43 Intercept 0.358 0.841 0.426 0.670 SLα 0.085 0.262 0.325 0.745 0.107 1 0.744 G. oculolineatus Group size Standard length of Alpha 73.52 Intercept 0.014 0.951 0.015 0.988 SLα 0.324 0.381 0.850 0.395 0.692 1 0.405 G. okinawae Group size Standard length of Alpha 23.11 Intercept -0.484 1.136 -0.426 0.670 SLα 0.413 0.494 0.836 0.403 0.100 1 0.403 G. quinquestrigatus Group size Standard length of Alpha 106.54 Intercept 0.633 0.894 0.708 0.479 SLα 0.022 0.323 0.068 0.946 0.005 1 0.946 G. rivulatus Group size Standard length of Alpha 122.05 Intercept 1.066 0.533 2.001 0.045 SLα -0.044 0.261 -0.170 0.865 0.029 1 0.864

179

Supplementary Table 3.4: Linear model results and analysis of deviance of the effect of coral size on standard length of alpha

Species Response Predictors Coefficient Estimate SE t P G. acicularis Standard length of Alpha Coral size Intercept 2.301 0.649 3.543 0.006 CS 0.000 0.012 -0.035 0.973 G. brochus Standard length of Alpha Coral size Intercept 2.018 0.259 7.806 <0.001 CS 0.031 0.012 2.529 0.018 G. ceramensis Standard length of Alpha Coral size Intercept 2.207 1.168 1.889 0.078 CS 0.023 0.043 0.546 0.593 G. erythrospilus Standard length of Alpha Coral size Intercept 2.456 0.324 7.577 <0.001 CS 0.029 0.011 2.659 0.015 G. fuscoruber Standard length of Alpha Coral size Intercept 1.605 0.342 4.698 <0.001 CS 0.044 0.012 3.822 0.001 G. histrio Standard length of Alpha Coral size Intercept 1.818 0.619 2.938 0.008 CS 0.056 0.026 2.151 0.043 G. oculolineatus Standard length of Alpha Coral size Intercept 2.222 0.232 9.586 <0.001 CS 0.007 0.008 0.910 0.374 G. okinawae Standard length of Alpha Coral size Intercept 2.050 0.535 3.832 0.009 CS 0.001 0.013 0.072 0.945 G. quinquestrigatus Standard length of Alpha Coral size Intercept 1.832 0.311 5.897 <0.001 CS 0.039 0.013 2.987 0.005 G. rivulatus Standard length of Alpha Coral size Intercept 1.853 0.278 6.672 <0.001 CS 0.007 0.012 0.582 0.565

180

Supplementary Table 4.1

Primer sequences with primer specific annealing temperatures (Ta) used in this study.

Locus (Reference) Primer name Primer sequence Ta COI FishF2 (CO1) 5’ TCGACTAATCATAAAGATATCGGCAC 3’ 64.8 (Ward et al., 2005) FishR2 (CO1) 5’ ACTTCAGGGTGACCGAAGAATCAGAA 3’ 70.5 Goby specific COI Goby CO1 F 5’ ATATCGGCACTAGATGTTGG 3’ 59.1 (This study) Goby CO1 R 5’ CCTCTACTTAGCTTTTGGTGCC 3’ 62.9 RAG1 (external) RAG1F1 (2533F) 5’ CTGAGCTGCAGTCAGTACCATAAGATGT 3’ 68.2 (Holcroft, 2004) RAG1R1 (4090R) 5’ CTGAGTCCTTGTGAGCTTCCATRAAYTT3’ 67.8 RAG1 (internal) Goby RAG1 F2 5’ GGGACAGGYTAYGAYGARAAGATGGT 3’ 67.5 (This study) Goby RAD1 R1 5’ ATYTCATCYTGRAAGATTTTGTARAACTC 3’ 57.7 zic1 zic1_F9 5’ GGACGCAGGACCGCARTAYC 3’ 68.5 (Li et al., 2007) zic1_R967 5’ CTGTGTGTGTCCTTTTGTGRATYTT 3’ 60.9

Supplementary Table 4.2 GenBank Accession numbers for Gobiodon species examined in this study.

Goby spp COI RAG1 ZIC1 12s 16s cytb S7I1 G. acicularis MK496336 - MK496387 - MK496431 - EF540565, EF463071, KC894468 KC894494 MK496338 MK496389 MK49433 EF540566 EF463072 G. axillaris MK496339 - MK496390 - MK496434 - EF540567 EF463073, KC894469 KC894495 MK496341 MK496392 MK49436 EF463074 G. aoyagii † MK496372 - MK496421 - MK496467 - EF540560 KC894479 KC894508

181 MK496374 MK49423 MK49469 G. brochus MK496342 - MK496393 - MK496437 - EF540568, EF463075, KC894470 KC894496 MK496344 MK496395 MK49439 EF540569 EF463076 G. ceramensis MK496345 - MK496396 - MK496440 - EF540570, EF527238, KC894471 KC894497 MK496350 MK496400 MK49445 EF540571 EF527239 G. citrinus MK496351 - MK496401 - MK496446 - EF540572, EF527240, KC894472 KC894499 MK496353 MK49403 MK49448 EF540573, EF527241, FJ617027 - FJ617067 - FJ617030 FJ617070 G. erythrospilus MK496354 - MK496404 - MK496449 - EF540574, EF527242, KC894473 KC894500 MK496356 MK49406 MK49451 EF540575 EF527243 G. fuscoruber†† MK496377 - MK496427 - MK496472 - EF540584 EF527253, KC894484 KC894514 MK496379 MK49429 MK49474 EF527254 G. histrio MK496357 - MK496407 - MK496452 - EF540576, FJ617071 - KC894474 KC894502 MK496359 MK49409 MK49454 EF540577, FJ617073 FJ617031 - FJ617033 G. oculolineatus MK496360 - MK496410 - MK496455 - KC894488 KC894491 KC894475 KC894503 MK496362 MK49412 MK49457 G. okinawae MK496363 - MK496413, MK496458 - EF540578, EF527246, KC894476 KC894504 MK496365 MK49414 MK49460 EF540579 EF527247 G. quinquestrigatus MK496366 - MK496415 - MK496461 - EF540580 EF527248, KC894477 KC894505 MK496368 MK49417 MK49463 EF527249

182 G. rivulatus MK496369 - MK496418 - MK496464 - EF540581 - EF527250 - KC894478 KC894507 MK496371 MK49420 MK49466 EF540583, EF527252, FJ617037 - FJ617077 - FJ617040 FJ617080 G. species D MK496375, MK496424 - MK496470, EF540564 EF463070 KC894482 KC894511 MK496376 MK49426 MK49471 P. xanthosoma MK496380 MK496430 MK496475 EF540558 EF443263 KC894487 KC894517 G. spilophthalmus c.f. MK496381 ------(G. acicularis) ‡ MK496383 G. spilophthalmus c.f. MK496384 ------(G. ceramensis) ‡ MK496386 † G. aoyagii was formally described by Shibukawa et al. (2013). This species was known as G. sp A in previous studies (Duchene et al., 2013; Harold et al., 2008; Munday et al., 1999) †† G. unicolor (sensu Munday et al., 1999) was reassigned as G. fuscoruber by Herler et al. (2013). ‡ These samples were collected from individuals matching the description of G. spilophthalmus but phylogenetic analyses revealed they were likely juveniles of G. acicularis and G. ceramensis.

183

Supplementary Table 5.1 Summary of statistical models

Fixed Model AIC Performance Response Distribution Parameter Estimate SE Effects Coefficient Estimate SE df Group size 7867.8 0.843 Group Size Negative Dispersion 403.430 0.272 Survey Intercept 0.664 0.063 2574 (interaction) (RMSE) (count) binomial (Feb-14) Aug-14 -0.041 0.058 2574

Jan-15 -0.067 0.060 2574

Jan-16 -0.073 0.058 2574

Sociality Group 0.290 0.075 2574

Interact Aug-14:Group -0.202 0.092 2574

Jan-15:Group 0.027 0.093 2574

Jan-16:Group -0.084 0.093 2574

Group size 6307.2 1.160 Group Size Zero- Dispersion 8.049 1.599 Survey Intercept 0.251 0.127 2574 (interaction) (RMSE) (count) truncated (Feb-14) negative Aug-14 -0.090 0.089 2574 binomial Jan-15 -0.136 0.094 2574

Jan-16 -0.160 0.092 2574

184

Fixed Model AIC Performance Response Distribution Parameter Estimate SE Effects Coefficient Estimate SE df Sociality Group 0.476 0.151 2574

Interact Aug-14:Group -0.367 0.135 2574

Jan-15:Group -0.025 0.138 2574

Jan-16:Group -0.162 0.137 2574

Coral Size 23321 7.387 Mean coral Gamma Shape 7.654 0.179 Sociality Intercept 2.927 0.169 3537

(interaction) (RMSE) diameter (Vacant)

(continuous) Pair 0.385 0.153 3537

Group 0.594 0.156 3537

Survey Aug-14 -0.158 0.087 3537

Jan-15 -0.356 0.087 3537

Jan-16 -0.227 0.088 3537

Interact Pair:Aug-14 0.061 0.093 3537

Group:Aug-14 0.087 0.098 3537

Pair:Jan-15 0.178 0.093 3537

Group:Jan-15 0.218 0.098 3537

185

Fixed Model AIC Performance Response Distribution Parameter Estimate SE Effects Coefficient Estimate SE df Pair:Jan-16 0.000 0.093 3537

Group:Jan-16 -0.028 0.099 3537

Coral Size 23343 7.423 Mean coral Gamma Shape 7.585 0.178 Sociality Intercept 2.850 0.150 3543

(main effects) (RMSE) diameter (Vacant)

(continuous) Pair 0.463 0.128 3543

Group 0.683 0.132 3543

Survey Aug-14 -0.091 0.025 3543

Jan-15 -0.206 0.026 3543

Jan-16 -0.213 0.025 3543

Transects 1513.1 1.440 vacant corals Zero-inflated Zero-inflation 0.2261 0.027 Survey Intercept 0.588 0.333 366 with/without (RMSE) (count) Poisson (Feb-14) groups Aug-14 0.288 0.343 366 (interaction) Jan-15 0.617 0.342 366

Jan-16 0.146 0.347 366

w/w.out w/groups 0.105 0.459 366 groups

186

Fixed Model AIC Performance Response Distribution Parameter Estimate SE Effects Coefficient Estimate SE df Interact Aug-14: -0.239 0.492 366 w/groups

Jan-15: -0.395 0.482 366 w/groups

Jan-16: 0.267 0.495 366 w/groups Transects 1422 1.187 vacant corals Zero-inflated Zero- 1.061E-06 0.000 Survey Intercept 0.830 0.405 365 with/without (RMSE) (count) negative inflation (Feb-14) groups binomial Aug-14 -0.244 0.416 365 (interaction) Dispersion 2.429 0.216 Jan-15 0.151 0.418 365

Jan-16 -0.319 0.420 365

w/w.out w/groups 0.083 0.561 365 groups Interact Aug-14: -0.127 0.605 365 w/groups Jan-15: -0.342 0.594 365 w/groups Jan-16: -0.100 0.612 365 w/groups

187

Fixed Model AIC Performance Response Distribution Parameter Estimate SE Effects Coefficient Estimate SE df Probability of 6277.7 0.492 Coral Multinomial NONE NA NA Survey Pair (Intercept) -0.107 0.278 NA inhabitance (misclass- occupant Pair(Aug-14) -1.318 0.256 NA (main effects) ification) Pair(Jan-15) -1.531 0.256 NA

Pair(Jan-16) -1.315 0.256 NA

mean Pair 0.130 0.007 NA coral (Avg.Diam) diam Survey Group -2.409 0.307 NA (Intercept) Group (Aug- -1.469 0.276 NA 14) Group (Jan- -1.464 0.277 NA 15) Group (Jan- -1.134 0.276 NA 16) mean Group 0.190 0.008 NA coral (Avg.Diam) diam Results from statistical models. Abbreviations are: Akaike Information Criterion (AIC); standard error (SE); degrees of freedom (df); standard deviation (SD); root mean squared error (RMSE).

188 5.2. Pairwise comparisons for the fixed effects terms of each of the group size, coral size, empty corals and predicted probabilities of inhabitance. Pairwise comparisons were conducted in R using the emmeans package (Lenth, 2018). For a given contrast A/B, ratios greater than 1.00 indicate that A is greater than B and ratios less than 1.00 indicate that B is greater than A. Supplementary Table 5.2.1. Pairwise comparisons of interacting effects of sociality and survey time on group size.

Contrast Ratio Lower CI Upper CI Feb-14,AS / Aug-14,AS 1.094 0.835 1.434 Feb-14,AS / Jan-15,AS 1.146 0.861 1.526 Feb-14,AS / Jan-16,AS 1.174 0.887 1.553 Feb-14,AS / Feb-14,S 0.622 0.394 0.981 Feb-14,AS / Aug-14,S 0.982 0.521 1.850 Feb-14,AS / Jan-15,S 0.730 0.388 1.375 Feb-14,AS / Jan-16,S 0.858 0.445 1.654 Aug-14,AS / Jan-15,AS 1.047 0.715 1.535 Aug-14,AS / Jan-16,AS 1.072 0.728 1.580 Aug-14,AS / Feb-14,S 0.568 0.329 0.981 Aug-14,AS / Aug-14,S 0.897 0.485 1.659 Aug-14,AS / Jan-15,S 0.667 0.334 1.333 Aug-14,AS / Jan-16,S 0.784 0.382 1.610 Jan-15,AS / Jan-16,AS 1.024 0.687 1.525 Jan-15,AS / Feb-14,S 0.542 0.313 0.940 Jan-15,AS / Aug-14,S 0.856 0.428 1.714 Jan-15,AS / Jan-15,S 0.637 0.340 1.193 Jan-15,AS / Jan-16,S 0.748 0.367 1.528 Jan-16,AS / Feb-14,S 0.530 0.303 0.925 Jan-16,AS / Aug-14,S 0.836 0.412 1.699 Jan-16,AS / Jan-15,S 0.622 0.308 1.257 Jan-16,AS / Jan-16,S 0.731 0.384 1.393 Feb-14,S / Aug-14,S 1.579 0.999 2.496 Feb-14,S / Jan-15,S 1.175 0.755 1.829 Feb-14,S / Jan-16,S 1.380 0.869 2.193 Aug-14,S / Jan-15,S 0.744 0.403 1.373

189 Aug-14,S / Jan-16,S 0.874 0.456 1.676 Jan-15,S / Jan-16,S 1.175 0.632 2.182 Pairwise comparisons conducted in R using the emmeans package. Tests were conducted on the log scale. Confidence intervals were back-transformed from the log scale. Supplementary Table 5.2.2. Pairwise comparisons of main effects of sociality and survey time on coral size.

Contrast Ratio Lower CI Upper CI Feb-14 / Aug-14 1.096 1.028 1.168 Feb-14 / Jan-15 1.228 1.150 1.312 Feb-14 / Jan-16 1.237 1.160 1.319 Aug-14 / Jan-15 1.121 1.026 1.225 Aug-14 / Jan-16 1.129 1.032 1.235 Jan-15 / Jan-16 1.007 0.920 1.102 Empty / Pair 0.629 0.467 0.848 Empty / Group 0.505 0.371 0.689 Pair / Group 0.803 0.607 1.063 Tests were conducted on the log scale. Confidence intervals were back-transformed from the log scale. Supplementary Table 5.2.3: Pairwise comparisons of interacting effects of survey time and transects with (Y) and without (N) groups on the mean number of empty corals per transect. Contrast Ratio Lower CI Upper CI Feb-14,N / Aug-14,N 1.277 0.362 4.502 Feb-14,N / Jan-15,N 0.859 0.242 3.049 Feb-14,N / Jan-16,N 1.376 0.385 4.910 Feb-14,N / Feb-14,Y 0.920 0.168 5.040 Feb-14,N / Aug-14,Y 1.335 0.074 24.028 Feb-14,N / Jan-15,Y 1.114 0.072 17.314 Feb-14,N / Jan-16,Y 1.400 0.086 22.713 Aug-14,N / Jan-15,N 0.673 0.118 3.854 Aug-14,N / Jan-16,N 1.077 0.161 7.207 Aug-14,N / Feb-14,Y 0.721 0.092 5.654 Aug-14,N / Aug-14,Y 1.045 0.084 12.984 Aug-14,N / Jan-15,Y 0.872 0.045 16.946

190 Aug-14,N / Jan-16,Y 1.096 0.051 23.396 Jan-15,N / Jan-16,N 1.601 0.289 8.862 Jan-15,N / Feb-14,Y 1.071 0.121 9.454 Jan-15,N / Aug-14,Y 1.553 0.064 37.922 Jan-15,N / Jan-15,Y 1.296 0.110 15.203 Jan-15,N / Jan-16,Y 1.628 0.076 34.731 Jan-16,N / Feb-14,Y 0.669 0.073 6.109 Jan-16,N / Aug-14,Y 0.970 0.037 25.452 Jan-16,N / Jan-15,Y 0.810 0.038 17.077 Jan-16,N / Jan-16,Y 1.017 0.084 12.295 Feb-14,Y / Aug-14,Y 1.450 0.150 13.986 Feb-14,Y / Jan-15,Y 1.210 0.131 11.201 Feb-14,Y / Jan-16,Y 1.521 0.149 15.476 Aug-14,Y / Jan-15,Y 0.835 0.035 19.711 Aug-14,Y / Jan-16,Y 1.049 0.035 31.171 Jan-15,Y / Jan-16,Y 1.257 0.057 27.817 Tests were conducted on the log scale. Confidence intervals were back-transformed from the log scale.

Supplementary Table 5.2.4. Predicted probabilities of inhabitance

Mean Coral Predicted Dataset Diameter (cm) Inhabitance Probability Feb-14 5 Empty 0.339 Aug-14 5 Empty 0.661 Jan-15 5 Empty 0.702 Jan-16 5 Empty 0.651 Feb-14 10 Empty 0.205 Aug-14 10 Empty 0.496 Jan-15 10 Empty 0.541 Jan-16 10 Empty 0.482 Feb-14 15 Empty 0.113 Aug-14 15 Empty 0.329 Jan-15 15 Empty 0.368 Jan-16 15 Empty 0.314

191 Feb-14 20 Empty 0.059 Aug-14 20 Empty 0.195 Jan-15 20 Empty 0.221 Jan-16 20 Empty 0.181 Feb-14 25 Empty 0.029 Aug-14 25 Empty 0.105 Jan-15 25 Empty 0.119 Jan-16 25 Empty 0.095 Feb-14 30 Empty 0.014 Aug-14 30 Empty 0.053 Jan-15 30 Empty 0.060 Jan-16 30 Empty 0.047 Feb-14 35 Empty 0.006 Aug-14 35 Empty 0.025 Jan-15 35 Empty 0.028 Jan-16 35 Empty 0.022 Feb-14 40 Empty 0.003 Aug-14 40 Empty 0.012 Jan-15 40 Empty 0.013 Jan-16 40 Empty 0.010 Feb-14 45 Empty 0.001 Aug-14 45 Empty 0.005 Jan-15 45 Empty 0.006 Jan-16 45 Empty 0.004 Feb-14 50 Empty 0.001 Aug-14 50 Empty 0.002 Jan-15 50 Empty 0.002 Jan-16 50 Empty 0.002 Feb-14 55 Empty 0.000 Aug-14 55 Empty 0.001 Jan-15 55 Empty 0.001 Jan-16 55 Empty 0.001 Feb-14 60 Empty 0.000 Aug-14 60 Empty 0.000

192 Jan-15 60 Empty 0.000 Jan-16 60 Empty 0.000 Feb-14 5 Pair 0.582 Aug-14 5 Pair 0.304 Jan-15 5 Pair 0.261 Jan-16 5 Pair 0.300 Feb-14 10 Pair 0.672 Aug-14 10 Pair 0.436 Jan-15 10 Pair 0.384 Jan-16 10 Pair 0.425 Feb-14 15 Pair 0.711 Aug-14 15 Pair 0.553 Jan-15 15 Pair 0.500 Jan-16 15 Pair 0.529 Feb-14 20 Pair 0.705 Aug-14 20 Pair 0.625 Jan-15 20 Pair 0.574 Jan-16 20 Pair 0.584 Feb-14 25 Pair 0.668 Aug-14 25 Pair 0.644 Jan-15 25 Pair 0.593 Jan-16 25 Pair 0.586 Feb-14 30 Pair 0.611 Aug-14 30 Pair 0.620 Jan-15 30 Pair 0.568 Jan-16 30 Pair 0.549 Feb-14 35 Pair 0.543 Aug-14 35 Pair 0.569 Jan-15 35 Pair 0.515 Jan-16 35 Pair 0.490 Feb-14 40 Pair 0.470 Aug-14 40 Pair 0.503 Jan-15 40 Pair 0.448 Jan-16 40 Pair 0.422

193 Feb-14 45 Pair 0.396 Aug-14 45 Pair 0.431 Jan-15 45 Pair 0.379 Jan-16 45 Pair 0.353 Feb-14 50 Pair 0.327 Aug-14 50 Pair 0.360 Jan-15 50 Pair 0.312 Jan-16 50 Pair 0.288 Feb-14 55 Pair 0.264 Aug-14 55 Pair 0.294 Jan-15 55 Pair 0.251 Jan-16 55 Pair 0.231 Feb-14 60 Pair 0.210 Aug-14 60 Pair 0.236 Jan-15 60 Pair 0.199 Jan-16 60 Pair 0.181 Feb-14 5 Group 0.079 Aug-14 5 Group 0.035 Jan-15 5 Group 0.038 Jan-16 5 Group 0.049 Feb-14 10 Group 0.123 Aug-14 10 Group 0.069 Jan-15 10 Group 0.075 Jan-16 10 Group 0.093 Feb-14 15 Group 0.176 Aug-14 15 Group 0.118 Jan-15 15 Group 0.132 Jan-16 15 Group 0.157 Feb-14 20 Group 0.236 Aug-14 20 Group 0.180 Jan-15 20 Group 0.206 Jan-16 20 Group 0.235 Feb-14 25 Group 0.303 Aug-14 25 Group 0.251

194 Jan-15 25 Group 0.288 Jan-16 25 Group 0.319 Feb-14 30 Group 0.375 Aug-14 30 Group 0.327 Jan-15 30 Group 0.373 Jan-16 30 Group 0.404 Feb-14 35 Group 0.451 Aug-14 35 Group 0.406 Jan-15 35 Group 0.457 Jan-16 35 Group 0.488 Feb-14 40 Group 0.527 Aug-14 40 Group 0.486 Jan-15 40 Group 0.539 Jan-16 40 Group 0.568 Feb-14 45 Group 0.602 Aug-14 45 Group 0.564 Jan-15 45 Group 0.616 Jan-16 45 Group 0.643 Feb-14 50 Group 0.672 Aug-14 50 Group 0.637 Jan-15 50 Group 0.686 Jan-16 50 Group 0.710 Feb-14 55 Group 0.735 Aug-14 55 Group 0.705 Jan-15 55 Group 0.748 Jan-16 55 Group 0.769 Feb-14 60 Group 0.790 Aug-14 60 Group 0.764 Jan-15 60 Group 0.801 Jan-16 60 Group 0.818 Probability that corals of varying mean diameter would remain empty or be inhabited by either pair- or group-forming species of Gobiodon. Probabilities were predicted from a multinomial model performed in R using the nnet package (Venables and Ripley, 2002).

195

Supplementary Table 5.3: Model coefficients for the multinomial probability of occupancy.

Intercept Aug-14 Jan-15 Jan-16 Odds Lower CI Upper CI Odds Lower CI Upper CI Odds Lower CI Upper CI Odds Lower CI Upper CI Pair 1.680 0.000 1.038 0.163 0.000 -3.624 0.084 0.000 -4.960 0.158 0.000 -3.694 Group 0.099 0.000 -4.625 0.221 0.000 -3.018 0.135 0.000 -3.999 0.483 0.000 -1.454 Avg.Diam Aug-14:Avg.Diam Jan-15:Avg.Diam Jan-16:Avg.Diam Odds Lower CI Upper CI Odds Lower CI Upper CI Odds Lower CI Upper CI Odds Lower CI Upper CI Pair 1.103 0.000 0.197 1.023 0.000 0.046 1.056 0.000 0.110 1.023 0.000 0.045 Group 1.196 0.000 0.357 1.006 0.000 0.013 1.041 0.000 0.079 0.983 0.000 -0.035 Odds and associated confidence interval (CI) for each model coefficient. Vacant corals were the reference group. Odds = 1 indicate an equal chance that the coral would remain vacant or be inhabited by either a pair- or group-forming species. Odds > 1 indicate a greater chance of the coral being inhabited by either pair- or group-forming species rather than remaining vacant. Odds < 1 indicates a greater chance of the coral remaining vacant.

196

Supplementary Figures

Supplementary Fig 5.1: Sociality index for each species of Gobiodon observed at Lizard Island.

Sociality indices (red dot) calculated for each species. Jittered point clouds indicate the relative number of colonies that were available to calculate the index from. There is a natural split in the species’ indices around 0.5.

197

Supplementary Fig 5.2: Gobiodon juvenile abundance at Lizard Island

Predicted mean juvenile abundance and 95% CI for pair- and group-forming species (pink and blue respectively) across each survey time. Raw data is shown as jittered point clouds. We recorded juvenile number when they were present in coral colonies. However they were excluded from the group size analyses because identification of many species’ juveniles is not possible from morphological features and we observed several moving between multiple corals. This meant that we could not definitively assign them to any particular group. We assessed whether juvenile abundance changed over successive survey times for pair- and group-forming species (identification assumed qualitatively from the colony they appeared to spend the most time with) with a generalized linear mixed model. The model contained juvenile abundance as the response variable, survey time and social category as predictors and site, goby species and coral species as random effects. We used a zero inflated negative binomial model as the data set was heavily zero-inflated (S4 Data) and the negative binomial model produced the best fitting model when compared with a zero-inflated Poisson model (negative binomial AIC = 2163.74, Poisson AIC =

198

2197.58). The model fit was assessed using root mean square error (RMSE) which is a measure of the overall error between the model predictions and the raw data in the units of the response variable. The model fit was reasonable given the true range of the samples but produced very large confidence intervals for group-forming species in the last two survey times (RMSE = 1.06; Fig 1). Nevertheless, we are confident that the abundance of juveniles for both pair- and group-forming species was similar at all survey times and that juvenile recruitment played a very minor role in the group size patterns we reported.

199

Supplementary phylogenetic trees (Newick format) 4.1 BEAST analysis ((((((acic_Con:0.023324816986979306,cera_Con:0.023324816986979306):0.0234286186402995,oki_Co n:0.0467534356272788):0.02603466729770166,cit_Con:0.07278810292498046):0.06122521953645239 4,(oculo_Con:0.09901811018773046,((quin_Con:0.021152038768774938,sp_D_Con:0.02115203876877 4938):0.03650546735076257,riv_Con:0.0576575061195375):0.04136060406819296):0.0349952122737 0239):0.0038410074645782166,(((axi_Con:0.03962434999337051,uni_Con:0.03962434999337051):0.0 4739860989085303,(eryth_Con:0.05702461843625441,hist_Con:0.05702461843625441):0.0299983414 47969132):0.030754655761881952,(broch_Con:0.09683155439671387,sp_A_Con:0.0968315543967138 7):0.02094606124939162):0.02007671427990558):0.1831152925858579,xantho:0.320969622511869); 4.2 RaxML Analysis ((((uni_Con:0.0456679101268182,axi_Con:0.026785648192133305):0.06291568947603998,(hist_Con:0 .16570055142474793,eryth_Con:0.038476933651589496):0.020944859104064406):0.016818017857766 127,((broch_Con:0.12429919244195053,sp_A_Con:0.07085930723616501):0.031816111262365804,((ci t_Con:0.10068837897112687,((cera_Con:0.01805105801677709,acic_Con:0.027190620060057347):0.0 3172947994719877,oki_Con:0.0318263092115495):0.01604450171535038):0.06289302994485257,(ocu lo_Con:0.09711232750448012,(riv_Con:0.049548668673115026,(sp_D_Con:0.02026557826374209,qui n_Con:0.01661539547531843):0.055096097848647996):0.06197239304881952):0.04073519365827460 4):0.020882652594190393):0.018558272938096032):0.11144632486440244,xantho:0.11144632486440 244); 4.3 BEAST analysis with sociality cut off value set at 0.4 ((((((acic_Con:0.023486252875619992,cera_Con:0.023486252875619992):0.02349861197897739,oki_C on:0.04698486485459738):0.02595275290552261,cit_Con:0.07293761776011999):0.060705681781088 3,(oculo_Con:0.0989464091728752,((quin_Con:0.0212258633841253,sp_D_Con:0.0212258633841253) :0.036478771572962976,riv_Con:0.05770463495708827):0.04124177421578693):0.0346968903683330 94):0.003968379451382009,(((axi_Con:0.039421229520330045,uni_Con:0.039421229520330045):0.04 743865180468321,(eryth_Con:0.057062565697819326,hist_Con:0.057062565697819326):0.029797315 627193927):0.03087764886650729,(broch_Con:0.0966579136139621,sp_A_Con:0.0966579136139621) :0.02107961657755844):0.01987414880106976):0.18476712126306036,xantho:0.3223788002556507); 4.4 BEAST analysis with sociality cut off value set at 0.5 ((((((acic_Con:0.023400017245821178,cera_Con:0.023400017245821178):0.023449439942577022,oki_ Con:0.0468494571883982):0.02600960539308511,cit_Con:0.07285906258148331):0.061494591226391 476,(oculo_Con:0.09918069473678942,((quin_Con:0.021058357159250758,sp_D_Con:0.021058357159

200

250758):0.03665430022739202,riv_Con:0.05771265738664278):0.04146803735014664):0.0351729590 7108536):0.004029903095619514,(((axi_Con:0.03971941004295191,uni_Con:0.03971941004295191):0 .047564851097281334,(eryth_Con:0.05717545415848719,hist_Con:0.05717545415848719):0.03010880 6981746054):0.03131919855434312,(broch_Con:0.09762666458967961,sp_A_Con:0.097626664589679 61):0.02097679510489675):0.019780097208917935):0.1850590981709113,xantho:0.323442655074405 6); 4.5 Gobiodon spilophthalmus BEAST analysis (((acic_E_B26:0.0021014799626346272,(((acic_E_B73:0.0010126801908364861,spil_E_B27:0.001012 680190836486):3.303196688794177E- 4,(acic_E_F18:0.0010187425057125168,spil_E_B83:0.0010187425057125166):3.2425735400338726E- 4):5.094125015283517E-5,spil_E_B75:0.001393941109868739):7.07538852765888E- 4):0.02557834339669087,((cera_h_A11:0.0031025745270748836,((cera_h_C42:7.942857151927565E- 4,cera_p_D80:7.942857151927566E-4):6.998192736548497E- 4,cera_p_E90:0.001494104988847606):0.0016084695382272774):8.847417770739227E- 4,(((cera_h_D46:8.60432983616549E-4,spil_h_C40:8.604329836165486E-4):2.6905634205791383E- 4,(cera_p_H20:8.590753013406036E-4,spil_h_D73:8.590753013406039E-4):2.704140243338589E- 4):4.309373341452021E- 5,spil_h_C45:0.0011725830590889829):0.002814733245059824):0.023692507055176695):0.265719923 5940887,oki_cons:0.2933997469534142);

201

202