Expression and Function of Corticotropin-Releasing Hormone in Anthropoid Primate Placenta

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Expression and function of corticotropin-releasing hormone in anthropoid primate placenta A dissertation submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate Program of Molecular and Developmental Biology of the College of Medicine by Caitlin E. Dunn-Fletcher B.S. Indiana University, Bloomington, Indiana, 2011 Committee Chair: Louis Muglia, M.D., Ph.D. Helen Jones, Ph.D. Raphael Kopan, Ph.D. Rolf Stottmann, Ph.D. Sing Sing Way, M.D., Ph.D. Matthew Weirauch, Ph.D. Abstract Pregnancy and parturition are intricately regulated to ensure successful reproductive outcomes. However, the factors that control gestational length in humans and other anthropoid primates remain poorly defined. Variations in maternal plasma corticotropin-releasing hormone (CRH) concentrations, arising from placental synthesis, have been associated with pathological alterations of gestation length in humans. Although hypothalamic CRH expression is conserved in all vertebrates, placental CRH expression is specific to anthropoid primates. Using comparative genomic analysis, we discovered a correlation between genomic integration of retroviral long terminal repeat transposon-like human element 1B (THE1B) and placental expression of CRH. Here, we show the endogenous retroviral element THE1B selectively controls placental expression of CRH that, in turn, influences gestational length and birth timing. Placental expression of CRH and subsequently prolonged gestational length were found in two independent strains of transgenic mice carrying a 180-kb human bacterial artificial chromosome (BAC) DNA that contained the full length of CRH and extended flanking regions, including THE1B. Restricted deletion of THE1B silenced placental CRH expression and normalized birth timing in these transgenic lines. Furthermore, we revealed an interaction at the 5′ insertion site of THE1B with distal-less homeobox 3 (DLX3), a transcription factor required for placental development. Together, these findings suggest that retroviral insertion of THE1B into the anthropoid primate genome may have initiated expression of CRH in placental syncytiotrophoblasts via DLX3 and that this placental CRH is sufficient to alter the timing of birth. ii iii Acknowledgements The work presented here has been strengthened and refined by the guidance of my thesis committee. I would like to thank the members of my committee for their time and expertise, and for the many lively discussions that helped shape this work. Special thanks to my mentor, Louis Muglia, for providing the right balance of leadership and freedom for me to explore my own ideas and develop as a scientist. I especially appreciated the opportunities he provided to share our work with others and truly partake in collaborative team science. I would also like to thank the members of the Muglia Lab and our collaborators and core facilities at Cincinnati Children’s Hospital Medical Center for stepping in with technical knowledge, advice, and instructions that helped me overcome many roadblocks throughout this project. I have greatly appreciated the privilege of training at an institution that actively encourages the sharing of skills and knowledge. Much of the work presented here would not have been possible without the willingness of others to demonstrate techniques, share protocols, provide resources, and generously give of their own time. I would especially like to recognize the undergraduate students who went above and beyond what was expected of them and were instrumental to the success of this work. Thank you to Katri, Lauren, Libbey, Sammy, and Shivani for sticking with me while I developed as a mentor. Special thanks to Katie Bezold Lamm, Kayleigh Swaggart, and the other past members of the Bae for all the little things (and some big things) that made this work possible and enjoyable. Thanks for all the feedback and the Starbucks runs. We did it! Finally, I would like to thank my family for their help and support. To my parents and siblings, thank you for encouraging me to pursue my interests and providing a sense of normalcy when iv the process seemed unpredictable. To Jon, my teammate, thank you for all of your scientific and non-scientific contributions. The best collaboration is ours (including Harper, Dora, and Abe). v Table of Contents Abstract ii Acknowledgements iv List of Figures and Tables xiii List of Abbreviations xv Chapter I: Introduction 1 The onset of normal parturition 2 Structure and function of the uterus 2 Structure and function of the placenta 5 Hormonal transition to parturition: role of progesterone 6 Hormonal transition to parturition: role of prostaglandins 8 Hormonal transition to parturition: role of oxytocin 10 Corticotropin-releasing hormone (CRH) in human pregnancy 11 Identification of CRH in placenta of anthropoid primates 11 Clinical utility of CRH as a biomarker of birth timing 12 Interplay of CRH with other pathways in parturition 14 A forward-thinking approach to the study of CRH in parturition 15 Figures 16 Figure 1-1. Progression from Phase 0 through Phase I of labor………………………….16 References 18 Chapter II: Anthropoid primate-specific retroviral element THE1B controls expression of CRH in placenta and alters gestation length 28 vi Introduction 29 Results 30 CRH expression and retroviral element THE1B presence are concordant in anthropoid primate placenta 30 THE1B LTRs may form a coordinated regulatory network in anthropoid primate placenta 31 THE1B-CRH transgenic mice express human CRH in placenta 32 Placental expression of human CRH delays parturition in transgenic mice 33 Deletion of THE1B by CRISPR/Cas9 eliminates placental CRH expression 34 Deletion of THE1B by CRISPR/Cas9 restores wild-type gestation length 35 Transcription factor DLX3 interacts with THE1B 5’ insertion site 35 DLX3 binding to THE1B may drive CRH expression in syncytiotrophoblasts 36 Discussion 36 Materials and Methods 39 Human and rhesus tissue collection, RNA-seq, and transcriptome analysis 39 PCR screening for THE1B-CRH fusion transcript in human and rhesus 40 Relative co-expression analysis of THE1B-associated genes 40 THE1B capture array and analysis 40 Annotation of human placenta-enriched genes 41 Association analysis between human placenta-enriched genes and THE1B subfamily 41 ChIP-seq for histone modifications in human term placenta 42 Ethics statement 42 Establishment of transgenic mouse lines 42 Mouse tissue collection and RNA isolation 43 qPCR for human CRH expression in transgenic mice 44 Localization of human CRH by immunohistochemistry/immunofluorescence 44 Quantification of gestation length in transgenic mice 45 vii Mouse uterus and placenta RNA-seq and analysis 45 Measurement of serum progesterone 45 Measurement of uterine prostaglandin F2α 46 Measurement of serum corticosterone 46 Binding site prediction of placental TFs 46 Electrophoretic mobility shift assay for binding at THE1B 46 ChIP and qPCR 47 Statistical analysis 48 Figures 49 Figure 2-1. THE1B is a candidate enhancer for placenta-specific regulation of CRH and other genes……………………………………………………………………………………...49 Figure 2-2. BAC transgenic mice exhibit placental CRH expression and delayed parturition, which are eliminated by THE1B deletion……………………………………….51 Figure 2-3. THE1B 5’ insertion site creates novel binding site for transcription factor DLX3……………………………………………………………………………………………..53 Supporting Information 56 Figure 2-S1. THE1B near CRH is not associated with classical enhancer chromatin marks…………………………………………………………………………………………….56 Figure 2-S2. Post-term birth phenotype is independent of progesterone and contractile- associated protein changes but may involve prostaglandin F2α………………………….58 Figure 2-S3. Hypothalamic-pituitary-adrenal axis function in transgenic mice is comparable to control………………………………………………………………………….60 Figure 2-S4. TRIM55 expression is altered by deletion of THE1B from the human BAC………………………………………..…………………………………………………….61 Figure 2-S5. Gestation length of litters hemizygous for Tg(CR2) is not significantly different from wild-type control………………………………………………………………..62 Table 2-S1. THE1B-CRH novel splice site is conserved in anthropoid primate species.63 References 64 viii Chapter III: Human CRH induces expression changes in mouse uterus in late gestation 70 Introduction 71 Results 72 Transgenic mice expressing placental CRH demonstrate altered gene expression in uterus 72 Glucocorticoid pathway signaling in uterus is altered by CRH expression 72 CRH production in placenta alters uterine prostaglandin balance 73 CRH-dependent changes to Rho pathway may affect myometrial contractility 73 Genes associated with vesicle-mediated transport are differentially expressed in Tg(BAC1) uterus 74 Selenoproteins are downregulated in Tg(BAC1) uterus 75 Discussion 75 Materials and Methods 77 Mouse uterus tissue collection and RNA isolation 77 Uterus RNA-seq and analysis 77 Hierarchical clustering of uterine samples 78 Measurement of serum corticosterone 78 Measurement of uterine prostaglandin F2α 78 Determination of significantly differentially expressed genes 78 Identification of overrepresented pathways with PANTHER database 79 Figures and Tables 80 Figure 3-1. Tg(BAC1) uterine expression clusters separately from nontransgenic and Tg(CR1)………………………………………………………………………………………….80 Figure 3-2. Tg(BAC1) glucocorticoid receptor and cochaperone expression is elevated in uterus with no changes to serum corticosterone……………………………………………81 ix Figure 3-3. Decreased
Recommended publications
  • Dominantly Acting Variants in ARF3 Have Disruptive Consequences on Golgi Integrity and Cause Microcephaly Recapitulated in Zebra�Sh

    Dominantly Acting Variants in ARF3 Have Disruptive Consequences on Golgi Integrity and Cause Microcephaly Recapitulated in ZebraSh

    Dominantly acting variants in ARF3 have disruptive consequences on Golgi integrity and cause microcephaly recapitulated in zebrash Giulia Fasano Ospedale Pediatrico Bambino Gesù Valentina Muto Ospedale Pediatrico Bambino Gesù Francesca Clementina Radio Genetic and Rare Disease Research Division, Bambino Gesù Children's Hospital IRCCS, Rome, Italy https://orcid.org/0000-0003-1993-8018 Martina Venditti Ospedale Pediatrico Bambino Gesù Alban Ziegler Département de Génétique, CHU d’Angers Giovanni Chillemi Tuscia University https://orcid.org/0000-0003-3901-6926 Annalisa Vetro Pediatric Neurology, Neurogenetics and Neurobiology Unit and Laboratories, Meyer Children’s Hospital, University of Florence Francesca Pantaleoni https://orcid.org/0000-0003-0765-9281 Simone Pizzi Bambino Gesù Children's Hospital Libenzio Conti Ospedale Pediatrico Bambino Gesù, IRCCS, 00146 Rome https://orcid.org/0000-0001-9466-5473 Stefania Petrini Bambino Gesù Children's Hospital Simona Coppola Istituto Superiore di Sanità Alessandro Bruselles Istituto Superiore di Sanità https://orcid.org/0000-0002-1556-4998 Ingrid Guarnetti Prandi University of Pisa, 56124 Pisa, Italy Balasubramanian Chandramouli Super Computing Applications and Innovation, CINECA Magalie Barth Céline Bris Département de Génétique, CHU d’Angers Donatella Milani Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico Angelo Selicorni ASST Lariana Marina Macchiaiolo Ospedale Pediatrico Bambino Gesù, IRCCS Michaela Gonantini Ospedale Pediatrico Bambino Gesù, IRCCS Andrea Bartuli Bambino Gesù Children's
  • TEAD3 (NM 003214) Human Tagged ORF Clone Product Data

    TEAD3 (NM 003214) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC210621 TEAD3 (NM_003214) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TEAD3 (NM_003214) Human Tagged ORF Clone Tag: Myc-DDK Symbol: TEAD3 Synonyms: DTEF-1; ETFR-1; TEAD-3; TEAD5; TEF-5; TEF5 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC210621 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATAGCGTCCAACAGCTGGAACGCCAGCAGCAGCCCCGGGGAGGCCCGGGAGGATGGGCCCGAGGGCCTGG ACAAGGGGCTGGACAACGATGCGGAGGGCGTGTGGAGCCCGGACATCGAGCAGAGCTTCCAGGAGGCCCT GGCCATCTACCCGCCCTGCGGCCGGCGGAAGATCATCCTGTCAGACGAGGGCAAGATGTACGGCCGAAAT GAGTTGATTGCACGCTATATTAAACTGAGGACGGGGAAGACTCGGACGAGAAAACAGGTGTCCAGCCACA TACAGGTTCTAGCTCGGAAGAAGGTGCGGGAGTACCAGGTTGGCATCAAGGCCATGAACCTGGACCAGGT CTCCAAGGACAAAGCCCTTCAGAGCATGGCGTCCATGTCCTCTGCCCAGATCGTCTCTGCCAGTGTCCTG CAGAACAAGTTCAGCCCACCTTCCCCTCTGCCCCAGGCCGTCTTCTCCACTTCCTCGCGGTTCTGGAGCA GCCCCCCTCTCCTGGGACAGCAGCCTGGACCCTCTCAGGACATCAAGCCCTTTGCACAGCCAGCCTACCC CATCCAGCCGCCCCTGCCGCCGACGCTCAGCAGTTATGAGCCCCTGGCCCCGCTCCCCTCAGCTGCTGCC TCTGTGCCTGTGTGGCAGGACCGTACCATTGCCTCCTCCCGGCTGCGGCTCCTGGAGTATTCAGCCTTCA TGGAGGTGCAGCGAGACCCTGACACGTACAGCAAACACCTGTTTGTGCACATCGGCCAGACGAACCCCGC CTTCTCAGACCCACCCCTGGAGGCAGTAGATGTGCGCCAGATCTATGACAAATTCCCCGAGAAAAAGGGA GGATTGAAGGAGCTCTATGAGAAGGGGCCCCCTAATGCCTTCTTCCTTGTCAAGTTCTGGGCCGACCTCA
  • Anthropoid Primate–Specific Retroviral Element THE1B Controls Expression of CRH in Placenta and Alters Gestation Length

    Anthropoid Primate–Specific Retroviral Element THE1B Controls Expression of CRH in Placenta and Alters Gestation Length

    SHORT REPORTS Anthropoid primate±specific retroviral element THE1B controls expression of CRH in placenta and alters gestation length 1 1 1 2 Caitlin E. Dunn-FletcherID *, Lisa M. Muglia , Mihaela Pavlicev , Gernot Wolf , Ming- An Sun2, Yueh-Chiang Hu3, Elizabeth Huffman1, Shivani Tumukuntala1, Katri Thiele1, Amrita Mukherjee1, Sandra Zoubovsky1, Xuzhe Zhang1, Kayleigh A. Swaggart1, Katherine Y. Bezold Lamm1, Helen Jones4, Todd S. Macfarlan2, Louis J. Muglia1* a1111111111 1 Division of Human Genetics, Center for Prevention of Preterm Birth, Perinatal Institute, Cincinnati a1111111111 Children's Hospital Medical Center, Department of Pediatrics, University of Cincinnati College of Medicine, a1111111111 Cincinnati, Ohio, United States of America, 2 The Eunice Kennedy Shriver National Institute of Child Health a1111111111 and Human Development, The National Institutes of Health, Bethesda, Maryland, United States of America, 3 Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, Department of a1111111111 Pediatrics, University of Cincinnati College of Medicine, Cincinnati, Ohio, United States of America, 4 Division of Pediatric Surgery, Cincinnati Children's Hospital Medical Center, Department of Surgery, University of Cincinnati College of Medicine, Cincinnati, Ohio, United States of America * [email protected] (CED); [email protected] (LJM) OPEN ACCESS Citation: Dunn-Fletcher CE, Muglia LM, Pavlicev M, Wolf G, Sun M-A, Hu Y-C, et al. (2018) Anthropoid Abstract primate±specific retroviral element THE1B controls expression of CRH in placenta and alters gestation Pregnancy and parturition are intricately regulated to ensure successful reproductive out- length. PLoS Biol 16(9): e2006337. https://doi.org/ comes. However, the factors that control gestational length in humans and other anthropoid 10.1371/journal.pbio.2006337 primates remain poorly defined.
  • Analysis of Gene Expression Data for Gene Ontology

    Analysis of Gene Expression Data for Gene Ontology

    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
  • Table 2. Significant

    Table 2. Significant

    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
  • Datasheet: VMA00439 Product Details

    Datasheet: VMA00439 Product Details

    Datasheet: VMA00439 Description: MOUSE ANTI ACBD3 Specificity: ACBD3 Format: Purified Product Type: PrecisionAb™ Monoclonal Clone: 5F9 Isotype: IgG1 Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Rat Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation Mouse monoclonal antibody purified by affinity chromatography from ascites Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers 1% Bovine Serum Albumin 50% Glycerol Immunogen Full length recombinant human ACBD3 (NP_073572) produced in HEK293T cells External Database Links UniProt: Q9H3P7 Related reagents Entrez Gene: 64746 ACBD3 Related reagents Page 1 of 2 Synonyms GCP60, GOCAP1, GOLPH1 Specificity Mouse anti Human ACBD3 antibody recognizes ACBD3, also known as PBR- and PKA-associated protein 7, PKA (RIalpha)-associated protein, acyl-Coenzyme A binding domain containing 3, golgi complex associated protein 1 60kDa, golgi phosphoprotein 1 and peripheral benzodiazepine receptor-associated protein PAP7.
  • The Expression of Human Endogenous Retroviruses Is Modulated by the Tat Protein of HIV‐1

    The Expression of Human Endogenous Retroviruses Is Modulated by the Tat Protein of HIV‐1

    The Expression of Human Endogenous Retroviruses is modulated by the Tat protein of HIV‐1 by Marta Jeannette Gonzalez‐Hernandez A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Immunology) in The University of Michigan 2012 Doctoral Committee Professor David M. Markovitz, Chair Professor Gary Huffnagle Professor Michael J. Imperiale Associate Professor David J. Miller Assistant Professor Akira Ono Assistant Professor Christiane E. Wobus © Marta Jeannette Gonzalez‐Hernandez 2012 For my family and friends, the most fantastic teachers I have ever had. ii Acknowledgements First, and foremost, I would like to thank David Markovitz for his patience and his scientific and mentoring endeavor. My time in the laboratory has been an honor and a pleasure. Special thanks are also due to all the members of the Markovitz laboratory, past and present. It has been a privilege, and a lot of fun, to work near such excellent scientists and friends. You all have a special place in my heart. I would like to thank all the members of my thesis committee for all the valuable advice, help and jokes whenever needed. Our collaborators from the Bioinformatics Core, particularly James Cavalcoli, Fan Meng, Manhong Dai, Maureen Sartor and Gil Omenn gave generous support, technical expertise and scientific insight to a very important part of this project. Thank you. Thanks also go to Mariana Kaplan’s and Akira Ono’s laboratory for help with experimental designs and for being especially generous with time and reagents. iii Table of Contents Dedication ............................................................................................................................ ii Acknowledgements ............................................................................................................. iii List of Figures ...................................................................................................................
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Knock-Out of ACBD3 Leads to Dispersed Golgi Structure, but Unaffected Mitochondrial Functions in HEK293 and Hela Cells

    Knock-Out of ACBD3 Leads to Dispersed Golgi Structure, but Unaffected Mitochondrial Functions in HEK293 and Hela Cells

    International Journal of Molecular Sciences Article Knock-Out of ACBD3 Leads to Dispersed Golgi Structure, but Unaffected Mitochondrial Functions in HEK293 and HeLa Cells Tereza Da ˇnhelovská 1 , Lucie Zdražilová 1 , Hana Štufková 1, Marie Vanišová 1, Nikol Volfová 1, Jana Kˇrížová 1 , OndˇrejKuda 2 , Jana Sládková 1 and Markéta Tesaˇrová 1,* 1 Department of Paediatrics and Inherited Metabolic Disorders, Charles University, First Faculty of Medicine and General University Hospital in Prague, 128 01 Prague, Czech Republic; [email protected] (T.D.); [email protected] (L.Z.); [email protected] (H.Š.); [email protected] (M.V.); [email protected] (N.V.); [email protected] (J.K.); [email protected] (J.S.) 2 Institute of Physiology, Academy of Sciences of the Czech Republic, 142 00 Prague, Czech Republic; [email protected] * Correspondence: [email protected] Abstract: The Acyl-CoA-binding domain-containing protein (ACBD3) plays multiple roles across the cell. Although generally associated with the Golgi apparatus, it operates also in mitochondria. In steroidogenic cells, ACBD3 is an important part of a multiprotein complex transporting cholesterol into mitochondria. Balance in mitochondrial cholesterol is essential for proper mitochondrial protein biosynthesis, among others. We generated ACBD3 knock-out (ACBD3-KO) HEK293 and HeLa cells and characterized the impact of protein absence on mitochondria, Golgi, and lipid profile. In ACBD3- Citation: Daˇnhelovská,T.; KO cells, cholesterol level and mitochondrial structure and functions are not altered, demonstrating Zdražilová, L.; Štufková, H.; that an alternative pathway of cholesterol transport into mitochondria exists. However, ACBD3- Vanišová, M.; Volfová, N.; Kˇrížová,J.; Kuda, O.; Sládková, J.; Tesaˇrová,M.
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle

    Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle

    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.