DOCSLIB.ORG

King's Research Portal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
King's Research Portal View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by King's Research Portal King’s Research Portal DOI: 10.3233/JAD-181085 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Patel, H., Dobson, R. J. B., & Newhouse, S. J. (2019). A Meta-Analysis of Alzheimer’s Disease Brain Transcriptomic Data. Journal of Alzheimer's Disease, 68(4), 1635-1656. https://doi.org/10.3233/JAD-181085 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 09. May. 2019 Journal of Alzheimer’s Disease 68 (2019) 1635–1656 1635 DOI 10.3233/JAD-181085 IOS Press A Meta-Analysis of Alzheimer’s Disease Brain Transcriptomic Data Hamel Patela,b,1,∗, Richard J.B. Dobsona,b,c,d,e,1 and Stephen J. Newhousea,b,c,d,e,1 aDepartment of Biostatistics and Health Informatics, Institute of Psychiatry, Psychology and Neuroscience, King’s College London, London, UK bNIHR BioResource Centre Maudsley, NIHR Maudsley Biomedical Research Centre (BRC) at South London and Maudsley NHS Foundation Trust (SLaM) and Institute of Psychiatry, Psychology and Neuroscience (IoPPN), King’s College London, London, UK cHealth Data Research UK London, University College London, London, UK dInstitute of Health Informatics, University College London, London, UK eThe National Institute for Health Research University College London Hospitals Biomedical Research Centre, University College London, London, UK Accepted 11 February 2019 Abstract. Background: Microarray technologies have identified imbalances in the expression of specific genes and biological pathways in Alzheimer’s disease (AD) brains. However, there is a lack of reproducibility across individual AD studies, and many related neurodegenerative and mental health disorders exhibit similar perturbations. Objective: Meta-analyze publicly available transcriptomic data from multiple brain-related disorders to identify robust transcriptomic changes specific to AD brains. Methods: Twenty-two AD, eight schizophrenia, five bipolar disorder, four Huntington’s disease, two major depressive disorder, and one Parkinson’s disease dataset totaling 2,667 samples and mapping to four different brain regions (temporal lobe, frontal lobe, parietal lobe, and cerebellum) were analyzed. Differential expression analysis was performed independently in each dataset, followed by meta-analysis using a combining p-value method known as Adaptively Weighted with One-sided Correction. Results: Meta-analysis identified 323, 435, 1,023, and 828 differentially expressed genes specific to the AD temporal lobe, frontal lobe, parietal lobe, and cerebellum brain regions, respectively. Seven of these genes were consistently perturbed across all AD brain regions with SPCS1 gene expression pattern replicating in RNA-Seq data. A further nineteen genes were perturbed specifically in AD brain regions affected by both plaques and tangles, suggesting possible involvement in AD neuropathology. In addition, biological pathways involved in the “metabolism of proteins” and viral components were significantly enriched across AD brains. Conclusion: This study identified transcriptomic changes specific to AD brains, which could make a significant contribution toward the understanding of AD disease mechanisms and may also provide new therapeutic targets. Keywords: Alzheimer’s disease, gene expression, human, mental disorders, meta-analysis, microarray analysis, neurodegen- erative disorders, neuropathology INTRODUCTION 1These authors are joint last authors. ∗ Correspondence to: Hamel Patel, Department of Biostatistics Alzheimer’s disease (AD) is the most common & Health Informatics, SGDP Centre, IoPPN, De Crespigny Park, Denmark Hill London, SE5 8AF, UK. Tel.: +44 207 848 0969; form of dementia affecting over 44 million individu- E-mail: [email protected]. als worldwide, and numbers are expected to triple by ISSN 1387-2877/19/$35.00 © 2019 – IOS Press and the authors. All rights reserved This article is published online with Open Access and distributed under the terms of the Creative Commons Attribution Non-Commercial License (CC BY-NC 4.0). 1636 H. Patel et al. / Meta-Analysis of AD Brain Transcriptomic Data 2050 [1]. The hallmark of the disease is characterized for multiple testing, no gene was replicated between by the abnormal brain accumulation of amyloid-␤ the two studies. The Miller study consisted of 7 (A␤) protein and hyperphosphorylated tau filaments, AD and 10 control subjects expression profiled on which forms structures known as plaques and tan- the Affymetrix platform while the Hakoma study gles, respectively. The accumulation of these proteins consisted of 31 AD and 32 control subjects expres- contributes to the loss of connections between neuron sion profiled on the Illumina platform. Replication synapses, leading to the loss of brain tissue and the between the Illumina and Affymetrix platform has disruption of normal cognitive functions. been shown to be generally very high [9]; therefore, As AD progresses, the spread of plaques and tan- the lack of replication between the two studies is gles in the brain usually occurs in a predictable pattern probably down to a range of other factors includ- and can begin up to 18 years prior to the onset of clini- ing low statistical power, sampling bias, and disease cal symptoms [2]. In the earliest stages of the disease, heterogeneity. plaques and tangles form in areas of the brain primar- Unlike DEGs, replication of the molecular changes ily involved in learning and memory, specifically the at a pathway level are more consistent and have hippocampus and entorhinal cortex, both situated in provided insights into the biological processes dis- the temporal lobe (TL) region [3]. Next, the frontal turbed in AD. Numerous studies have consistently lobe (FL), a region involved in voluntary movement, highlighted disruptions in immune response [10–13], is affected, followed by the parietal lobe (PL), a region protein transcription/translation [10, 11, 14–17], cal- involved in processing reading and writing. In the cium signaling [10, 18, 19], MAPK signaling [7, 16], later stage of the disease, the occipital lobe, a region various metabolism pathways such as carbohydrates involved in processing information from the eyes, can [16], lipids [16, 20], glucose [17, 21, 22], iron [11, become affected, followed by the cerebellum (CB), 23], chemical synapse [7, 18, 19], and neurotransmit- a region which receives information from the sen- ter [11, 18, 19]. However, many of these pathways sory systems and the spinal cord to regulates motor have also been suggested to be disrupted in other movement. Nerve cell death, tissue loss, and atrophy brain-related disorders. For example, disruptions in occur throughout the brain as AD progresses, leading calcium signaling, MAPK, chemical synapse, and to the manifestation of clinical symptoms associated various neurotransmitter pathways have also been with loss of normal brain function. However, not all implicated in Parkinson’s disease (PD) [24, 25]. In brain regions are neuropathologically affected in the addition, glucose metabolism, protein translation, same manner. The CB, which only accounts for 10% and various neurotransmission pathways have also of the brain but contains over 50% of the brain’s total been suggested to be disrupted in bipolar disorder neurons, is often neglected in AD research because (BD) [26–29]. Although the biological disruptions it is generally considered to be partially spared from involved in AD are steadily being identified, many the disease as plaques are only occasionally seen but other neurodegenerative and mental disorders are tangles are generally not reported [4, 5]. showing similar perturbations. We are yet to identify The histopathological spread of the disease is well robust transcriptomic changes specific to AD brains. documented, and with the advent of high throughput In this study, we combined publicly available genomics approaches, we are now able to study the microarray gene expression data generated from AD transcriptomic and biological pathways disrupted in human brain tissue and matched cognitively healthy AD brains. Microarrays can simultaneously exam- controls to
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Mitoxplorer, a Visual Data Mining Platform To
    mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, Cecilia Garcia-Perez, José Villaveces, Salma Gamal, Giovanni Cardone, Fabiana Perocchi, et al. To cite this version: Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, et al.. mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dy- namics and mutations. Nucleic Acids Research, Oxford University Press, 2020, 10.1093/nar/gkz1128. hal-02394433 HAL Id: hal-02394433 https://hal-amu.archives-ouvertes.fr/hal-02394433 Submitted on 4 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Nucleic Acids Research, 2019 1 doi: 10.1093/nar/gkz1128 Downloaded from https://academic.oup.com/nar/advance-article-abstract/doi/10.1093/nar/gkz1128/5651332 by Bibliothèque de l'université la Méditerranée user on 04 December 2019 mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim1,†, Prasanna Koti1,†, Adrien Bonnard2, Fabio Marchiano3, Milena Durrbaum¨ 1, Cecilia Garcia-Perez4, Jose Villaveces1, Salma Gamal1, Giovanni Cardone1, Fabiana Perocchi4, Zuzana Storchova1,5 and Bianca H.
    [Show full text]
  • GATA2 Regulates Mast Cell Identity and Responsiveness to Antigenic Stimulation by Promoting Chromatin Remodeling at Super- Enhancers
    ARTICLE https://doi.org/10.1038/s41467-020-20766-0 OPEN GATA2 regulates mast cell identity and responsiveness to antigenic stimulation by promoting chromatin remodeling at super- enhancers Yapeng Li1, Junfeng Gao 1, Mohammad Kamran1, Laura Harmacek2, Thomas Danhorn 2, Sonia M. Leach1,2, ✉ Brian P. O’Connor2, James R. Hagman 1,3 & Hua Huang 1,3 1234567890():,; Mast cells are critical effectors of allergic inflammation and protection against parasitic infections. We previously demonstrated that transcription factors GATA2 and MITF are the mast cell lineage-determining factors. However, it is unclear whether these lineage- determining factors regulate chromatin accessibility at mast cell enhancer regions. In this study, we demonstrate that GATA2 promotes chromatin accessibility at the super-enhancers of mast cell identity genes and primes both typical and super-enhancers at genes that respond to antigenic stimulation. We find that the number and densities of GATA2- but not MITF-bound sites at the super-enhancers are several folds higher than that at the typical enhancers. Our studies reveal that GATA2 promotes robust gene transcription to maintain mast cell identity and respond to antigenic stimulation by binding to super-enhancer regions with dense GATA2 binding sites available at key mast cell genes. 1 Department of Immunology and Genomic Medicine, National Jewish Health, Denver, CO 80206, USA. 2 Center for Genes, Environment and Health, National Jewish Health, Denver, CO 80206, USA. 3 Department of Immunology and Microbiology, University of Colorado Anschutz Medical Campus, Aurora, ✉ CO 80045, USA. email: [email protected] NATURE COMMUNICATIONS | (2021) 12:494 | https://doi.org/10.1038/s41467-020-20766-0 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-20766-0 ast cells (MCs) are critical effectors in immunity that at key MC genes.
    [Show full text]
  • CLDND1 (NM 001040183) Human Tagged ORF Clone – RC211544
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC211544 CLDND1 (NM_001040183) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CLDND1 (NM_001040183) Human Tagged ORF Clone Tag: Myc-DDK Symbol: CLDND1 Synonyms: C3orf4; GENX-3745; Z38 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC211544 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATAACCGTTTTGCTACAGCATTTGTAATTGCTTGTGTGCTGAGCCTCATTTCCACCATCTACATGG CAGCCTCCATTGGCACAGACTTCTGGTATGAATATCGAAGTCCAGTTCAAGAAAATTCCAGTGATTTGAA TAAAAGCATCTGGGATGAATTCATTAGTGATGAGGCAGATGAAAAGACTTATAATGATGCACTTTTTCGA TACAATGGCACAGTGGGATTGTGGAGACGGTGTATCACCATACCCAAAAACATGCATTGGTATAGCCCAC CAGAAAGGACAGAGTCATTTGATGTGGTCACAAAATGTGTGAGTTTCACACTAACTGAGCAGTTCATGGA GAAATTTGTTGATCCCGGAAACCACAATAGCGGGATTGATCTCCTTAGGACCTATCTTTGGCGTTGCCAG TTCCTTTTACCTTTTGTGAGTTTAGGTTTGATGTGCTTTGGGGCTTTGATCGGACTTTGTGCTTGCATTT GCCGAAGCTTATATCCCACCATTGCCACGGGCATTCTCCATCTCCTTGCAGGTCTGTGTACACTGGGCTC AGTAAGTTGTTATGTTGCTGGAATTGAACTACTCCACCAGAAACTAGAGCTCCCTGACAATGTATCCGGT GAATTTGGATGGTCCTTCTGCCTGGCTTGTGTCTCTGCTCCCTTACAGTTCATGGCTTCTGCTCTCTTCA TCTGGGCTGCTCACACCAACCGGAAAGAGTACACCTTAATGAAGGCATATCGTGTGGCA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
    [Show full text]
  • Expression Profiling of Substantia Nigra in Parkinson Disease, Progressive Supranuclear Palsy, and Frontotemporal Dementia with Parkinsonism
    ORIGINAL CONTRIBUTION Expression Profiling of Substantia Nigra in Parkinson Disease, Progressive Supranuclear Palsy, and Frontotemporal Dementia With Parkinsonism Michael A. Hauser, PhD; Yi-Ju Li, PhD; Hong Xu, MA; Maher A. Noureddine, PhD; Yujun S. Shao, PhD; Steven R. Gullans, PhD; Clemens R. Scherzer, MD; Roderick V. Jensen, PhD; Adam C. McLaurin, BA; Jason R. Gibson, BA; Burton L. Scott, MD; Rita M. Jewett, RN; Judith E. Stenger, PhD; Donald E. Schmechel, MD; Christine M. Hulette, MD, PhD; Jeffery M. Vance, MD, PhD Background: Parkinson disease (PD) is characterized Results: There were 142 genes that were significantly by loss of dopaminergic neurons in the substantia nigra. differentially expressed between PD cases and controls Genes contributing to rare mendelian forms of PD have and 96 genes that were significantly differentially ex- been identified, but the genes involved in the more com- pressed between the combined progressive supra- mon idiopathic PD are not well understood. nuclear palsy and frontotemporal dementia with parkin- sonism cases and controls. The 12 genes common to all Objectives: To identify genes important to PD patho- 3 disorders may be related to secondary effects. Hierar- genesis using microarrays and to investigate their poten- chical cluster analysis after exclusion of these 12 genes tial to aid in diagnosing parkinsonism. differentiated 4 of the 6 PD cases from progressive su- pranuclear palsy and frontotemporal dementia with par- Design: Microarray expression analysis of postmortem kinsonism. substantia nigra tissue. Conclusions: Four main molecular pathways are al- Patients: Substantia nigra samples from 14 unrelated tered in PD substantia nigra: chaperones, ubiquitina- individuals were analyzed, including 6 with PD, 2 with tion, vesicle trafficking, and nuclear-encoded mitochon- progressive supranuclear palsy, 1 with frontotemporal de- drial genes.
    [Show full text]
  • Transcriptional Regulation of Cancer Genes in the Xiphophorus
    Transcriptional regulation of cancer genes in the Xiphophorus melanoma system Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg vorgelegt von Janine Regneri aus Herdecke Würzburg 2013 Eingereicht am: ....................................................................................................................... Mitglieder der Promotionskommission: Vorsitzender: .......................................................................................................................... Gutachter : .............................................................................................................................. Gutachter: ............................................................................................................................... Tag des Promotionskolloquiums: ............................................................................................. Doktorurkunde ausgehändigt am: ............................................................................................ Eidesstattliche Erklärung Gemäß §4, Abs. 3, Ziff. 3, 5 und 8 der Promotionsordnung der Fakultät für Biologie der Bayerischen Julius-Maximilians-Universität Würzburg Hiermit erkläre ich ehrenwörtlich, dass ich die vorliegende Dissertation selbständig angefertigt und keine anderen als die angegebenen Quellen und Hilfsmittel verwendet habe. Ich erkläre weiterhin, dass die vorliegende Dissertation weder in gleicher, noch in ähnlicher Form bereits in einem anderen Prüfungsverfahren
    [Show full text]
  • Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets
    www.nature.com/scientificreports OPEN Assessment of a complete and classifed platelet proteome from genome‑wide transcripts of human platelets and megakaryocytes covering platelet functions Jingnan Huang1,2*, Frauke Swieringa1,2,9, Fiorella A. Solari2,9, Isabella Provenzale1, Luigi Grassi3, Ilaria De Simone1, Constance C. F. M. J. Baaten1,4, Rachel Cavill5, Albert Sickmann2,6,7,9, Mattia Frontini3,8,9 & Johan W. M. Heemskerk1,9* Novel platelet and megakaryocyte transcriptome analysis allows prediction of the full or theoretical proteome of a representative human platelet. Here, we integrated the established platelet proteomes from six cohorts of healthy subjects, encompassing 5.2 k proteins, with two novel genome‑wide transcriptomes (57.8 k mRNAs). For 14.8 k protein‑coding transcripts, we assigned the proteins to 21 UniProt‑based classes, based on their preferential intracellular localization and presumed function. This classifed transcriptome‑proteome profle of platelets revealed: (i) Absence of 37.2 k genome‑ wide transcripts. (ii) High quantitative similarity of platelet and megakaryocyte transcriptomes (R = 0.75) for 14.8 k protein‑coding genes, but not for 3.8 k RNA genes or 1.9 k pseudogenes (R = 0.43–0.54), suggesting redistribution of mRNAs upon platelet shedding from megakaryocytes. (iii) Copy numbers of 3.5 k proteins that were restricted in size by the corresponding transcript levels (iv) Near complete coverage of identifed proteins in the relevant transcriptome (log2fpkm > 0.20) except for plasma‑derived secretory proteins, pointing to adhesion and uptake of such proteins. (v) Underrepresentation in the identifed proteome of nuclear‑related, membrane and signaling proteins, as well proteins with low‑level transcripts.
    [Show full text]
  • Bayesian Hidden Markov Tree Models for Clustering Genes with Shared Evolutionary History
    Submitted to the Annals of Applied Statistics arXiv: arXiv:0000.0000 BAYESIAN HIDDEN MARKOV TREE MODELS FOR CLUSTERING GENES WITH SHARED EVOLUTIONARY HISTORY By Yang Liy,{,∗, Shaoyang Ningy,∗, Sarah E. Calvoz,x,{, Vamsi K. Moothak,z,x,{ and Jun S. Liuy Harvard Universityy, Broad Institutez, Harvard Medical Schoolx, Massachusetts General Hospital{, and Howard Hughes Medical Institutek Determination of functions for poorly characterized genes is cru- cial for understanding biological processes and studying human dis- eases. Functionally associated genes are often gained and lost together through evolution. Therefore identifying co-evolution of genes can predict functional gene-gene associations. We describe here the full statistical model and computational strategies underlying the orig- inal algorithm CLustering by Inferred Models of Evolution (CLIME 1.0) recently reported by us [Li et al., 2014]. CLIME 1.0 employs a mixture of tree-structured hidden Markov models for gene evolution process, and a Bayesian model-based clustering algorithm to detect gene modules with shared evolutionary histories (termed evolutionary conserved modules, or ECMs). A Dirichlet process prior was adopted for estimating the number of gene clusters and a Gibbs sampler was developed for posterior sampling. We further developed an extended version, CLIME 1.1, to incorporate the uncertainty on the evolution- ary tree structure. By simulation studies and benchmarks on real data sets, we show that CLIME 1.0 and CLIME 1.1 outperform traditional methods that use simple metrics (e.g., the Hamming distance or Pear- son correlation) to measure co-evolution between pairs of genes. 1. Introduction. The human genome encodes more than 20,000 protein- coding genes, of which a large fraction do not have annotated function to date [Galperin and Koonin, 2010].
    [Show full text]
  • The Evolutionary Origin and Domestication History of Goldfish (Carassius Auratus)
    The evolutionary origin and domestication history of goldfish (Carassius auratus) Duo Chena,b,1, Qing Zhangc,1, Weiqi Tangd,1, Zhen Huanga,b,1,2, Gang Wangc,1, Yongjun Wangc, Jiaxian Shia,c, Huimin Xuc, Lianyu Linc, Zhen Lic, Wenchao Chid, Likun Huange, Jing Xiae, Xingtan Zhangc, Lin Guoc, Yuanyuan Wangc, Panpan Mac, Juan Tangf, Gang Zhouf, Min Liuf, Fuyan Liuf, Xiuting Huac, Baiyu Wangc, Qiaochu Shenc, Qing Jiangc, Jingxian Linc, Xuequn Chenc, Hongbo Wangc, Meijie Douc, Lei Liuc, Haoran Panc, Yiying Qic, Bin Wug, Jingping Fanga, Yitao Zhoua,b, Wan Cena, Wenjin Hea,h, Qiujin Zhanga, Ting Xuea,h,i, Gang Lina,i, Wenchun Zhangj, Zhongjian Liuk, Liming Qul, Aiming Wangm, Qichang Yej, Jianming Chend, Yanding Zhangb, Ray Mingn, Marc Van Montaguo,p,2, Haibao Tangc,2, Yves Van de Peero,p,q,r,2, Youqiang Chena,i,2, and Jisen Zhangc,2 aPublic Service Platform for Industrialization Development Technology of Marine Biological Medicine and Product of State Oceanic Administration, College of Life Sciences, Fujian Normal University, 350117 Fuzhou, China; bFujian Key Laboratory of Developmental and Neural Biology, College of Life Sciences, Fujian Normal University, 350117 Fuzhou, China; cCenter for Genomics and Biotechnology, Haixia Institute of Science and Technology, Fujian Provincial Laboratory of Haixia Applied Plant Systems Biology, College of Life Sciences, Fujian Agriculture and Forestry University, 350002 Fuzhou, China; dInstitute of Oceanography, Marine Biotechnology Center, Minjiang University, 350108 Fuzhou, China; eFujian Key Laboratory of
    [Show full text]
  • Gene Expression in Blood Reflects Smoking Exposure Among Cancer
    www.nature.com/scientificreports OPEN Gene expression in blood refects smoking exposure among cancer‑free women in the Norwegian Women and Cancer (NOWAC) postgenome cohort Nikita Baiju1*, Torkjel M. Sandanger1, Pål Sætrom2,3,4,5 & Therese H. Nøst1,5 Active smoking has been linked to modulated gene expression in blood. However, there is a need for a more thorough understanding of how quantitative measures of smoking exposure relate to diferentially expressed genes (DEGs) in whole‑blood among ever smokers. This study analysed microarray‑based gene expression profles from whole‑blood samples according to smoking status and quantitative measures of smoking exposure among cancer‑free women (n = 1708) in the Norwegian Women and Cancer postgenome cohort. When compared with never smokers and former smokers, current smokers had 911 and 1082 DEGs, respectively and their biological functions could indicate systemic impacts of smoking. LRRN3 was associated with smoking status with the lowest FDR‑adjusted p‑value. When never smokers and all former smokers were compared, no DEGs were observed, but LRRN3 was diferentially expressed when never smokers were compared with former smokers who quit smoking ≤ 10 years ago. Further, LRRN3 was positively associated with smoking intensity, pack‑years, and comprehensive smoking index score among current smokers; and negatively associated with time since cessation among former smokers. Consequently, LRRN3 expression in whole‑blood is a molecular signal of smoking exposure that could supplant self‑reported smoking data in further research targeting blood‑based markers related to the health efects of smoking. Tobacco smoking is one of the major threats to public health, and it is currently responsible for more than 8 million deaths worldwide each year 1.
    [Show full text]
  • Cldnd1 (NM 171826) Mouse Tagged ORF Clone – MR203231 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR203231 Cldnd1 (NM_171826) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Cldnd1 (NM_171826) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Cldnd1 Synonyms: 1110019C08Rik; AA407103; AI849195; AW489850; Cldn25 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR203231 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATAACCGTTTTGCTACTGCGTTTGTGATTGCTTGTGTGCTTAGTCTGATTTCCACCATCTACATGG CGGCCTCCATAGGCACGGACTTCTGGTATGAGTATCGAAGTCCCATTCAAGAGAATTCAAGTGACTCGAA TAAAATCGCCTGGGAAGATTTCCTCGGTGACGAGGCGGATGAGAAGACTTACAACGATGTTCTGTTCCGA TACAACGGCAGCTTGGGGCTGTGGAGACGGTGCATCACCATACCCAAAAACACTCACTGGTATGCGCCAC CGGAAAGGACAGAGTCATTTGATGTGGTTACCAAATGCATGAGTTTCACACTAAACGAGCAGTTCATGGA GAAGTATGTGGACCCCGGCAACCACAATAGCGGCATCGACCTGCTTCGCACCTACCTGTGGCGCTGCCAG TTCCTTTTACCCTTCGTCAGCTTGGGCTTGATGTGCTTTGGGGCGTTGATTGGCCTCTGTGCCTGTATCT GCCGCAGCCTGTATCCCACCCTCGCCACTGGCATTCTCCATCTCCTTGCAGGTCTGTGCACACTGGGCTC CGTGAGTTGCTATGTTGCCGGCATTGAACTCTTACATCAGAAAGTAGAGCTGCCCAAGGATGTATCTGGA GAATTTGGATGGTCCTTCTGCCTGGCCTGCGTCTCGGCTCCCTTACAGTTCATGGCGGCCGCTCTCTTCA TCTGGGCTGCCCACACCAACCGGAAAGAGTACACCTTAATGAAGGCTTATCGTGTGGCA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
    [Show full text]